A pullulanase mutant with improved glycogen debranching activity, its preparation method and application

An improved pullulanase mutant was prepared by site-directed mutagenesis of amino acid 81 of type I pullulanase, which solved the problem of insufficient glycogen hydrolysis ability of type I pullulanase, achieved effective debranching of glycogen, and expanded its application range.

CN122303200APending Publication Date: 2026-06-30JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
JIANGNAN UNIV
Filing Date
2026-05-08
Publication Date
2026-06-30

AI Technical Summary

Technical Problem

Existing type I pullulanases have limited hydrolytic ability on highly branched substrates such as glycogen, making it difficult to effectively recognize and bind to α-1,6 glycosidic bonds, thus limiting their application in the field of glycogen debranching.

Method used

By site-directed mutagenesis of amino acid 81 in type I pullulanase, replacing tryptophan with alanine or tyrosine, a pullulanase mutant with improved glycogen debranching activity was prepared.

Benefits of technology

The mutant significantly enhanced the hydrolytic ability of glycogen while maintaining the hydrolytic activity of pullulan, thus expanding the application potential of type I pullulanase in the field of glycogen debranching.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN122303200A_ABST
    Figure CN122303200A_ABST
Patent Text Reader

Abstract

This invention relates to a pullulanase mutant with improved glycogen debranching activity, its preparation method, and its applications, belonging to the fields of enzyme engineering and biotechnology. The mutant is obtained by mutating tryptophan at position 81 of the type I pullulanase shown in SEQ ID NO.1 to alanine or tyrosine, with amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO.3, respectively. Enzymatic performance tests show that this mutant significantly enhances the hydrolytic ability of glycogen while maintaining its original catalytic activity, providing a tool for the controlled synthesis and modification of glycogen. This invention also provides the gene encoding the mutant, a recombinant vector containing the gene, an engineered bacterium, and the application of the mutant in glycogen debranching. The pullulanase mutant provided by this invention can be effectively used for glycogen debranching treatment, expanding the application scope of type I pullulanase in glycogen-related fields.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of enzyme engineering and biotechnology, specifically relating to a pullulanase mutant with improved glycogen debranching activity, its preparation method and application, and particularly to obtaining a pullulanase mutant with enhanced glycogen hydrolysis activity by site-directed mutation of the 81st amino acid of type I pullulanase. Background Technology

[0002] Glycogen, a highly branched α-glucan, plays a vital role in energy storage within organisms. Its molecular structure primarily consists of linear chains linked by α-1,4 glycosidic bonds and branching points formed by α-1,6 glycosidic bonds. Due to its high branch density and relatively short branched chains, this complex spatial configuration presents challenges for structural analysis and functional studies. In glycogen-related research and biotransformation processes, debranching enzymes capable of specifically hydrolyzing α-1,6 glycosidic bonds are often used to debranch glycogen molecules for subsequent analysis or applications.

[0003] Pullulans are a class of debranching enzymes capable of hydrolyzing α-1,6 glycosidic bonds, and are generally classified into type I and type II based on their substrate specificity. Type I pullulans primarily act on pullulan polysaccharides, exhibiting high hydrolytic activity against the regularly arranged α-1,6 glycosidic bonds in their molecules, thus finding widespread application in industries such as starch processing. However, in current research and practical applications, the hydrolytic ability of type I pullulans on highly branched substrates such as glycogen is quite limited. Due to the dense distribution of branch points within the glycogen molecule, the short branched chains, and significant steric hindrance, type I pullulans struggle to effectively recognize and bind to these α-1,6 glycosidic bonds. Under conventional enzymatic detection conditions, type I pullulans often exhibit extremely low activity in the hydrolysis of glycogen, significantly limiting their application in glycogen debranching-related fields.

[0004] To address the need for glycogen debranching, current research primarily focuses on type II pullulanases and other debranching enzymes. Type II pullulanases possess both α-1,6 and α-1,4 glycosidic bond hydrolytic activities, exhibiting high catalytic efficiency in substrate degradation. However, their catalytic characteristics are complex, often making specific debranching difficult in applications requiring selective cleavage of α-1,6 glycosidic bonds. On the other hand, while some α-1,6-specific debranching enzymes (such as isoamylases) can hydrolyze α-1,6 glycosidic bonds, they are more suitable for substrates like amylopectin, showing lower debranching efficiency for substrates like glycogen with high branch density and short branches, thus failing to meet relevant application requirements. Furthermore, some related enzymes still have limitations in terms of heterologous expression efficiency, enzymatic stability, and engineering modification potential, making it difficult to fully meet practical application needs. In contrast, type I pullulanases are widely available, have relatively stable protein structures, and have well-established heterologous expression systems and rational modification strategies, giving them a certain advantage in industrial enzyme development. However, existing type I pullulanases still have limited debranching efficiency for highly branched substrates such as glycogen. Therefore, improving the debranching ability of type I pullulanases for complex branched substrates such as glycogen while maintaining their α-1,6 bond specificity hydrolysis characteristics remains a pressing technical problem to be solved.

[0005] Therefore, improving the hydrolytic ability of type I pullulanase to α-1,6 glycosidic bonds in glycogen through enzyme molecule modification, and obtaining detectable debranching activity of glycogen while maintaining its original performance advantages, is of great significance for expanding the application range of type I pullulanase and enriching the types of glycogen debranching enzyme tools. Summary of the Invention

[0006] Technical problem solved: To address the issues of low activity of existing type I pullulanases in glycogen debranching and difficulty in effectively hydrolyzing α-1,6 glycosidic bonds in glycogen, this invention provides a pullulanase mutant with improved glycogen debranching activity, its preparation method, and its application. Obtained by site-directed mutagenesis of tryptophan at position 81 of wild-type pullulanase, it significantly enhances the hydrolytic ability of glycogen, thereby expanding the application of type I pullulanase in the field of glycogen debranching.

[0007] Technical solution: A pullulanase mutant, wherein the pullulanase with the amino acid sequence shown in SEQ ID NO. 1 is mutated to have the amino acid sequence shown in SEQ ID NO. 2 or SEQ ID NO. 3.

[0008] A gene encoding the pullulanase mutant described above.

[0009] The nucleotide sequences of the above genes are shown in SEQ ID NO.5 or SEQ ID NO.6.

[0010] Recombinant vectors containing the above-mentioned genes.

[0011] A recombinant microbial cell expressing the pullulanase mutant described above, wherein the recombinant microbial cell carries the gene described above or contains the recombinant vector described above.

[0012] The recombinant microbial cells mentioned above are preferably Escherichia coli, Bacillus subtilis, or yeast.

[0013] A method for constructing the pullulanase mutant, using pullulanase with the amino acid sequence shown in SEQ ID NO.1 as the parent, and replacing tryptophan at position 81 with alanine or tyrosine.

[0014] Site-directed mutagenesis was introduced using whole plasmid PCR to mutate the codon encoding tryptophan at position 81 in the nucleotide sequence shown in SEQ ID NO.4 to a codon encoding alanine or tyrosine.

[0015] The application of pullulanase mutants, genes, recombinant vectors, or recombinant microbial cells in glycogen debranching.

[0016] Beneficial Effects: This invention, through site-directed mutagenesis of tryptophan at position 81 of pullulanase type I derived from Klebsiella pneumoniae, found that replacing tryptophan with alanine or tyrosine resulted in mutants exhibiting debranching activity against glycogen, with stable detectable hydrolytic activity against glycogen under conventional enzymatic assay conditions. Given that the mutant W81F, which also replaces tryptophan at position 81 with phenylalanine, exhibits catalytic efficiency against pullulan substrates no lower than the wild type, but still shows no detectable debranching activity against glycogen, this indicates that the introduction of alanine and tyrosine brings unique substrate recognition characteristics at the molecular level, enabling the mutants to overcome the spatial barriers caused by the highly branched structure of glycogen and effectively bind to and hydrolyze its α-1,6 glycosidic bonds. Meanwhile, the hydrolytic activity of pullulan by W81A and W81Y remained at a high level, comparable to or slightly improved by the wild type. They did not sacrifice their original catalytic performance by gaining the ability to debranch glycogen. This synergistic effect of adding activity to complex substrates while maintaining the original substrate catalytic advantages significantly expands the application potential of type I pullulanases and provides new and effective tools for glycogen structure analysis, glycogen-related disease research, and biotransformation of sugar-containing raw materials. Attached Figure Description

[0017] Figure 1 The optimal reaction temperatures are WT, W81A, W81Y, and W81F.

[0018] Figure 2 The optimal reaction pH is for WT, W81A, W81Y, and W81F. Detailed Implementation

[0019] The present invention will be further illustrated below with reference to the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. After reading this invention, any modifications of the invention in various equivalent forms by those skilled in the art will fall within the scope defined by the appended claims.

[0020] The carrier involved in the embodiments is pETM-11.

[0021] The culture media involved in the examples are as follows: (1) LB liquid culture medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L.

[0022] (2) LB solid medium: yeast powder 5 g / L, peptone 10 g / L, NaCl 10 g / L, agar powder 15 g / L.

[0023] The detection methods involved in the embodiments are as follows: Pullulanase hydrolysis activity was determined using the DNS method. Each tube contained 1350 μL of substrate (prepared with buffer solution at optimal pH) and was incubated at the optimal temperature for 10 min. After incubation, 150 μL of pullulanase was added to the experimental group to initiate the reaction. At time points of 0.5, 1, 2, 3, 5, 7, and 10 min, 150 μL of the reaction solution was transferred to 150 μL of pre-allotted DNS reagent. After sampling at all time points, the solution was boiled for 5 min for color development, and the OD was measured. 540 The enzyme solution was replaced with Tris-HCl buffer (20 mM, pH 7.5, containing 250 mM NaCl) to determine the blank control group. A reducing sugar content-time curve was fitted with reaction time (min) on the x-axis and the reducing sugar content (mg / mL) generated in the enzymatic hydrolysis system on the y-axis. The initial hydrolysis rate was determined from the slope, and the enzyme activity was then calculated.

[0024] One unit of enzyme activity (U) is defined as the amount of enzyme required to release 1 μmol of reducing sugar (calculated as glucose) per minute at a given pH and temperature.

[0025] Enzyme activity: defined as the enzyme activity per unit protein, U / mg.

[0026] Example 1: Construction of a recombinant plasmid containing the pullulanase mutant gene (1) Construction of recombinant plasmids containing wild-type pullulanase gene Chemical synthesis originates from Klebsiella pneumoniaeThe wild-type pullulanase gene of NCTC243 was identified and named KpPul. The natural amino acid sequence of this enzyme can be found in the NCBI GenBank database, with accession number STR29919.1. Based on this natural sequence, the nucleotide sequence encoding the N-terminal signal peptide was removed, and the gene was designed and chemically synthesized. Its nucleotide sequence is shown in SEQ ID NO.4. The gene was then ligated to the expression vector pETM-11 after digestion with restriction endonucleases XbaI and EcoRI, respectively, to construct the recombinant expression vector pETM-11-KpPul.

[0027] (2) Obtaining recombinant plasmids containing mutant genes Using whole plasmid PCR amplification, site-directed mutagenesis was performed using the recombinant vector pETM-11-KpPul prepared in step (1) as a template to obtain recombinant plasmids pETM-11-W81A, pETM-11-W81Y, and pETM-11-W81F containing mutant genes.

[0028] The designed primer sequences are as follows: W81A-F: TGCGACGAAAAACCTCTATTTAGCGAACAACGAAACCTGTGAC; W81A-R: GTCACAGGTTTCGTTGTTCGCTAAATAGAGGTTTTTCGTCGCA; W81Y-F: CGACTATGCGACGAAAAACCTCTATTTATATAACAACGAAACCTGTGA; W81Y-R: TCACAGGTTTCGTTGTTATAAATAGAGGTTTTTCGTCGCATAGTCG; W81F-F: GACTATGCGACGAAAAACCTCTATTTATTCAACAACGAAACCTGTG; W81F-R: CACAGGTTTCGTTGTTGAATAAATAGAGGTTTTTCGTCGCATAGTC; The PCR amplification program was set as follows: 98℃ pre-denaturation for 5 min, PCR cycle 30 times (98℃ denaturation for 10 s, 62℃ annealing for 20 s, 68℃ extension for 9 min), 72℃ extension for 10 min, and 4℃ incubation.

[0029] The amplified PCR products were digested using Dpn I enzyme at 37°C for 30 min to eliminate the original template. DNA amplification was then checked by agarose gel electrophoresis. Subsequently, the correctly digested products were heat-shocked into E. coli DH5α- at 42°C. The transformation buffer was then plated onto LB solid medium containing 50 μg / mL kanamycin sulfate, and plasmids were extracted and sequenced. Sequencing was performed by Genewiz, Suzhou. The correctly validated plasmids were named pETM-11-W81A, pETM-11-W81Y, and pETM-11-W81F, respectively.

[0030] Example 2: Construction of recombinant Escherichia coli producing pullulanase mutant The recombinant plasmids pETM-11-KpPul, pETM-11-W81A, pETM-11-W81Y, and pETM-11-W81F obtained in Example 1 were further heat-shocked into E. coli BL21 (DE3) to prepare the following genetically engineered bacteria: E. coli BL21 / pETM-11-KpPul, E. coli BL21 / pETM-11-W81A, E. coli BL21 / pETM-11-W81Y, and E. coli BL21 / pETM-11-W81F.

[0031] Example 3: Expression, isolation, purification, and determination of purity and concentration of pullulanase mutants (1) Enzyme expression Seed culture: The genetically engineered bacteria constructed in Example 2 were inoculated into 50 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate and cultured at 37℃ and 200 rpm for 8-10 h to obtain seed culture.

[0032] Cell expansion culture: The prepared seed culture was transferred to 400 mL of LB liquid medium containing 50 μg / mL kanamycin sulfate at an inoculation rate of 5% (v / v), and cultured at 37°C and 200 rpm until OD500. 600 It ranges from 0.4 to 0.6.

[0033] Enzyme induction expression: IPTG at a final concentration of 0.4 mM was added to the expanded bacterial culture, and protein expression was induced at 16℃ and 160 rpm for 16-24 h.

[0034] (2) Isolation and purification of enzymes The fermentation broth was centrifuged at 4℃ and 8000×g for 15 min to collect the bacterial cells. The cells were then washed twice with Tris-HCl buffer (20 mM, pH 7.5, containing 250 mM NaCl) under the same centrifugation parameters. The cells were then collected and weighed.

[0035] Collection of crude enzyme solution: Add 10 mL of Tris-HCl buffer (20 mM, pH 7.5, containing 250 mM NaCl) to 1 g of bacterial sludge, and repeatedly pipette to evenly disperse the cells. Then, treat the resuspended cells with an ultrasonic homogenizer under ice bath conditions for 20 min, centrifuge for 40 min (8000×g, 4℃), and the resulting supernatant is the crude enzyme solution. Subsequently, further filter the crude enzyme using a 0.22 μm filter to remove bacteria.

[0036] Enzyme purification: Nickel affinity chromatography was used. The steps included: packing the chromatography column with nickel-containing packing material, washing and equilibrating sequentially with deionized water and 20 mM Tris-HCl buffer (pH 7.5) containing 250 mM NaCl; loading the crude enzyme solution and cycling the sample once to ensure sufficient binding of the target protein; washing with the above buffer to remove unbound contaminants; gradient elution with buffers containing 20, 50, 100, 300, and 500 mM imidazole, and collecting the target protein in the elution fraction; after purification, cleaning and storing the chromatography column sequentially with buffer, deionized water, and 20% ethanol.

[0037] (1) Determination of enzyme purity and concentration Enzyme purity identification: The purified enzyme solutions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). The electrophoresis results showed that when the imidazole concentration was 50 mM, all four proteins reached electrophoretic purity (clear single bands could be observed), and the bands were all near the theoretical molecular weight of 119 kDa, proving that wild-type pullulanase and the three mutants were expressed.

[0038] (2) Enzyme concentration determination: The absorbance of the electrophoretically pure enzyme protein elution buffer at 280 nm was measured using a Nanodrop spectrophotometer. The instrument initially provided a concentration estimate using the default conversion factor (1 Abs = 1 mg / mL). To obtain an accurate concentration, the theoretical mass extinction coefficient A1 mg / mL 280 nm (280 nm, 1 mg / mL, 1 cm) was calculated based on the amino acid sequence of the target enzyme using the NovoPro online tool, as shown in Table 1. The initial estimate was corrected based on this coefficient to obtain the final protein concentration (mg / mL).

[0039] Table 1 Extinction coefficients of different pullulanase theoretical mass

[0040] Example 4: Determination of the enzymatic properties of pullulanase mutants (1) Optimal temperature A 1% (w / v) solution of pullulan was prepared using 20 mM (pH 6.0) phosphate buffer (w / v is weight-volume concentration; 1% (w / v) means 1 g of solute per 100 mL of solution). Enzyme activity was measured at 40, 45, 50, 55, 60, 65, and 70 °C. The highest activity was defined as 100%. Results are as follows: Figure 1 As shown, the optimal temperature for W81Y and W81F is the same as that for the wild type, which is 60℃. The optimal temperature for W81A is lower than that for the wild type, which is 55℃.

[0041] (2) Optimal pH 1% (w / v) pullulan was prepared using 20 mM buffers at different pH values, specifically: acetate-sodium acetate buffer (pH 4.5–5.5), sodium dihydrogen phosphate-disodium hydrogen phosphate buffer (pH 6.0–8.0), and glycine-sodium hydroxide buffer (pH 8.5–10.5). Enzyme activity was measured at different pH conditions under their respective optimal temperatures. The highest activity was defined as 100%. Results are as follows: Figure 2 As shown, the optimal pH of W81A, W81Y and W81F all shifted slightly compared to the wild type, increasing from 6.0 in the wild type to 6.5.

[0042] (3) Hydrolysis activity and kinetic parameters Hydrolytic activity: A 1% (w / v) pullulan polysaccharide was prepared, and the enzyme activity of any pullulanase was determined under its optimal reaction conditions. The results are shown in Table 2.

[0043] Kinetic parameters: Pullulanose solutions of 0.1, 0.2, 0.5, 1, 3, 5, 7, and 10 mg / mL were prepared. For any pullulanase, the initial hydrolysis rate under different substrate concentrations was measured under its optimal reaction conditions. The substrate affinity constant was obtained by nonlinear fitting of substrate concentration and initial hydrolysis rate. K m Maximum reaction rate V max Catalytic constant k cat and catalytic efficiency k cat / K m .

[0044] The results of hydrolysis activity and kinetic parameters are shown in Table 2. Compared with the wild type, the hydrolysis activity and kinetic parameters of the W81A, W81Y, and W81F mutants were significantly different. k cat The levels are at a high level, but... K m and k cat / K m They exhibit different characteristics in terms of kinetic parameters. Among them, W81A and W81F... k cat / K m Similar to or slightly improved from the wild type, while W81Y's K m and k cat / K m It differs from the wild type, exhibiting different dynamic behaviors.

[0045] Table 2 Hydrolytic activity and kinetic parameters of different pullulanases

[0046] (4) Enzyme activity against glycogen The effect of pullulanase mutants on glycogen hydrolysis activity was investigated using 0.3% (w / v) glycogen as a substrate. The results are shown in Table 3. Compared with the wild type, the glycogen hydrolysis activity of mutants W81A and W81Y increased from undetectable to detectable.

[0047] Table 3 Hydrolytic activity of different pullulanases on glycogen.

[0048] The above examples are merely illustrative of the technical concept and features of this invention, intended to enable those skilled in the art to understand the content of this invention and implement it accordingly, and should not be construed as limiting the scope of protection of this invention. All equivalent transformations or modifications made in accordance with the spirit and essence of this invention should be included within the scope of protection of this invention.

Claims

1. A pullulanase mutant, characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO.2 or SEQ ID NO.

3.

2. The gene encoding the pullulanase mutant of claim 1.

3. A recombinant vector carrying the gene of claim 2.

4. A recombinant microbial cell containing the gene of claim 2, or containing the recombinant vector of claim 3.

5. The recombinant microbial cell according to claim 4, characterized in that, The recombinant microbial cells use Escherichia coli, Bacillus subtilis, and yeast as hosts.

6. A method for constructing the pullulanase mutant of claim 1, characterized in that, Using pullulanase with the amino acid sequence shown in SEQ ID NO.1 as the parent, tryptophan at position 81 was replaced with alanine or tyrosine.

7. The method according to claim 6, characterized in that, Site-directed mutagenesis was introduced using whole-plasmid PCR to mutate the codon encoding tryptophan at position 81 in the nucleotide sequence shown in SEQ ID NO.4 to a codon encoding alanine or tyrosine.

8. The use of the pullulanase mutant of claim 1, or the gene of claim 2, or the recombinant vector of claim 3, or the recombinant microbial cell of claim 4 or 5 in glycogen debranching.