Construction method and application of human acute liver injury and chemotaxis model based on normal liver organoids

Abstract

The present application relates to a method for constructing a human acute liver injury and chemotaxis model based on a normal liver organoid and application thereof. Specifically, the present application provides a method for constructing a human liver organoid; further, contacting the liver organoid with a hepatotoxic drug can construct a human acute liver injury model; co-culturing the organoid or the injury model with immune cells can construct an in vitro immune cell chemotaxis model. The present application also provides reversible immunoaffinity magnetic beads for isolating VSIG4-positive macrophages and a method for isolating the same. The human liver organoid, acute liver injury model and chemotaxis model of the present application can be used for screening drugs for treating acute liver injury, evaluating the hepatotoxicity of compounds, researching the pathogenesis of acute liver injury and evaluating the effect of immunomodulatory drugs.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to a method for constructing a human acute liver injury and chemotaxis model based on normal liver organoids and its application. Background Technology

[0002] Currently, the mainstream technical approach for constructing normal liver organoids typically involves completely digesting liver tissue into a single-cell suspension or inducing complex differentiation from pluripotent stem cells, followed by co-culturing with other cells. These methods essentially "reset" the liver's native microenvironment, disrupting the natural spatial structure and physical connections between hepatocytes, bile duct cells, endothelial cells, and stellate cells. During the three-dimensional culture stage, these techniques heavily rely on bioscaffolds such as Matrix to provide support and differentiation signals for the cells. This results in organoids with a single cell composition (often dominated by hepatocytes), lacking a functional vascular network and crucial immune cell components; they resemble "hepatocyte spheres" rather than a miniature "micro-liver" with a complete physiological structure.

[0003] In clinical practice, patients with acute liver injury often have severe conditions, making it impossible to obtain liver tissue. Therefore, research often uses laboratory animals (mice) to construct acute liver injury models. However, the actual microenvironment differs from that of humans. Consequently, acute liver injury disease models based on these organoids and laboratory animals have fundamental limitations in simulating the systemic pathological processes involved in acute liver injury. These organoids cannot realistically reproduce core aspects that depend on an intact vascular and immune microenvironment, such as inflammatory cell recruitment, sinusoidal endothelial damage, and microcirculatory disturbances. Furthermore, animal models cannot accurately reflect the actual situation in humans. These factors result in insufficient effectiveness of models in predicting real-world human responses.

[0004] Therefore, there is an urgent need in this field to find an organoid construction method that can preserve and reproduce the original complex structure and microenvironment of the human liver to the greatest extent, and to establish a more physiologically and pathologically relevant human acute liver injury model based on this. Summary of the Invention

[0005] The purpose of this invention is to provide an organoid construction method that can preserve and reproduce the original complex structure and microenvironment of the human liver to the greatest extent, and based on this, to establish a human acute liver injury model that is more physiologically and pathologically relevant.

[0006] In a first aspect of the present invention, a method for constructing a human liver organoid is provided, the method comprising the following steps:

[0007] (a) Obtain normal human liver tissue and cut it into tissue blocks with a volume of 1-2 mm³;

[0008] (b) The tissue blocks were directly inoculated into a culture vessel, and liver organoid culture medium was added for static culture; and

[0009] (c) Cultured until cells migrate from the edge of the tissue block and form organoid structures;

[0010] The method does not use exogenous matrix gel and does not digest liver tissue into a single-cell suspension, thereby preserving the integrity of the liver's native microenvironment and intercellular connections.

[0011] In a preferred embodiment, the tissue block fully preserves the natural spatial arrangement, physical connections, and extracellular matrix network among hepatocytes, bile duct cells, endothelial cells, stellate cells, and resident immune cells in the liver lobules.

[0012] In a preferred embodiment, the natural spatial arrangement includes: hepatocyte plate structure, hepatic sinusoidal structure, and bile duct structure.

[0013] In a preferred embodiment, the culture medium is a chemically defined culture medium without the addition of exogenous matrix gel.

[0014] In a preferred embodiment, the tissue block in step (a) is not subjected to any enzymatic digestion.

[0015] In a preferred embodiment, the method enables the spontaneous formation of a CD31-positive functional vascular network without the addition of exogenous vascular endothelial growth factor.

[0016] In a preferred embodiment, the liver organoid culture medium is selected from the liver organoid culture medium with catalog number LSNO00400402 from Shanghai Lisheng Biotechnology Co., Ltd.

[0017] In a preferred embodiment, the human normal liver tissue is derived from surgically removed liver tissue that has been pathologically confirmed to be normal, preferably normal liver tissue adjacent to hepatic hemangioma or hepatocellular carcinoma.

[0018] In a preferred embodiment, in step (b), the static culture conditions are 37°C, 5% CO2, and the culture medium is replaced by half every 3-5 days.

[0019] In a preferred embodiment, the constructed human liver organoid comprises the following cell types: hepatocytes, vascular endothelial cells, hepatic stellate cells, and hepatic macrophages (Kupffer cells).

[0020] In a preferred embodiment, the constructed human liver organoid has a functional vascular network and a microenvironment inhabited by immune cells.

[0021] In a preferred embodiment, the functional vascular network is identified as an endothelial cell network with luminal structures by CD31 immunofluorescence staining, and the colonizing immune cell microenvironment is identified as having Kupffer cells by CD68 immunofluorescence staining.

[0022] In a second aspect of the invention, a human liver organoid is provided, which is constructed by the method described in the first aspect of the invention.

[0023] In a third aspect of the present invention, a method for constructing a human acute liver injury (ALI) model is provided, the method comprising: contacting the human liver organoid described in the second aspect of the present invention with a hepatotoxic drug to induce liver injury, thereby obtaining a human acute liver injury (ALI) model.

[0024] In a preferred embodiment, the hepatotoxic drug is acetaminophen (APAP).

[0025] In a preferred embodiment, the treatment concentration of the hepatotoxic drug is 2-20 mM, and the treatment time is 2-12 hours.

[0026] In a preferred embodiment, the model is capable of reproducing one or more pathological features of acute liver injury selected from the group consisting of: hepatocyte vacuolar degeneration, ballooning degeneration, punctate necrosis, apoptosis, vascular leakage, activation of endogenous immune cells, release of inflammatory factors, and microcirculatory disturbances.

[0027] In a third aspect of the invention, a human acute liver injury (ALI) model is provided, which is constructed by the method described in the third aspect of the invention.

[0028] In a fifth aspect of the present invention, a method for constructing an in vitro immune cell chemotaxis model is provided, the method comprising: culturing human liver organoids as described in the second aspect of the present invention or acute liver injury models as described in the fourth aspect of the present invention with immune cells in a co-culture system, thereby causing the immune cells to migrate to the organoids.

[0029] In a preferred embodiment, the co-culture system is a Transwell co-culture system, wherein organoids are placed in the lower chamber and immune cells are placed in the upper chamber.

[0030] In a preferred embodiment, the pore size of the Transwell is 8.0 μm.

[0031] In a preferred embodiment, the immune cells are selected from the group consisting of peripheral blood mononuclear cells, mononuclear cell lines, macrophages, or combinations thereof.

[0032] In a preferred embodiment, the mononuclear cell line comprises THP-1 cells.

[0033] In a preferred embodiment, the macrophages include VSIG4-positive macrophages.

[0034] In a preferred embodiment, the method is used to assess the chemotactic capacity, differentiation state, polarization direction, or function of immune cells, or to assess the ability of organoids to secrete chemokines; the chemokine is preferably CCL2.

[0035] In a preferred embodiment, the assessment of the chemotactic capacity of immune cells is achieved by detecting CCR2 and CD68 markers.

[0036] In a sixth aspect of the present invention, an in vitro immune cell chemotaxis model is provided, which is constructed by the method described in the fifth aspect of the present invention.

[0037] In a seventh aspect of the invention, a reversible immunoaffinity magnetic bead is provided, the magnetic bead comprising:

[0038] (1) Magnetic core;

[0039] (2) An oligonucleotide linker connected to the surface of a magnetic nucleus via an amide bond, the oligonucleotide linker comprising at least one deoxyinosine (dI) base; and

[0040] (3) Targeting molecules (such as antibodies) are covalently linked to the other end of the oligonucleotide linker;

[0041] The oligonucleotide linker contains the sequence shown in SEQ ID NO:1.

[0042] In a preferred embodiment, the targeting molecule is an anti-VSIG4 antibody.

[0043] In a preferred embodiment, the oligonucleotide linker comprises four deoxyinosine bases, and the deoxyinosine bases are spaced apart in the linker sequence.

[0044] In a preferred embodiment, after the magnetic beads dissociate from the target cells, the survival rate of the target cells is ≥90%, and the magnetic bead residue rate is ≤1%.

[0045] In an eighth aspect of the invention, a method for separating target cells from a cell mixture is provided, comprising:

[0046] (a) Incubating the reversible immunoaffinity magnetic beads described in the seventh aspect of the present invention with a mixture of cells to allow the magnetic beads to bind to antigens on the surface of target cells;

[0047] (b) Applying a magnetic field to separate target cells bound with magnetic beads; and

[0048] (c) The deoxyinosine site in the oligonucleotide linker is cut with a nuclease to dissociate the magnetic beads from the target cells and obtain purified target cells.

[0049] In a preferred embodiment, the target cells are VSIG4-positive macrophages.

[0050] In a preferred embodiment, the endonuclease is Endo V nuclease.

[0051] In a preferred embodiment, in step (c), the cleavage reaction conditions are: treatment at 37°C for 30 minutes in a buffer solution containing 10 mM HEPES, 120 mM NaCl, 5 mM KCl, 5 mM glucose, 5 mM MgCl2, and 0.5 mM reduced glutathione.

[0052] In a ninth aspect of the present invention, the application of the human liver organoid described in the second aspect of the present invention, the acute liver injury model described in the fourth aspect of the present invention, or the immune cell chemotaxis model described in the sixth aspect of the present invention in at least one of the following aspects is provided:

[0053] (a) Screening for drugs to treat acute liver injury;

[0054] (b) Assess the hepatotoxicity of the candidate compounds;

[0055] (c) To study the pathogenesis of acute liver injury;

[0056] (d) To investigate the recruitment, differentiation, and function of immune cells in liver injury; and

[0057] (e) Evaluate the effects of anti-inflammatory or immunomodulatory drugs.

[0058] In a tenth aspect of the invention, a kit for constructing human liver organoids is provided, the kit comprising:

[0059] (1) Liver organoid culture medium; and

[0060] (2) Instruction manual, which describes the method described in the first aspect of the present invention.

[0061] In a preferred embodiment, the kit further comprises the reversible immunoaffinity magnetic beads described in the seventh aspect of the present invention, and / or a buffer solution for isolating VSIG4-positive macrophages.

[0062] In a preferred embodiment, the buffer solution is a buffer solution containing 10 mM HEPES, 120 mM NaCl, 5 mM KCl, 5 mM glucose, 5 mM MgCl2, and 0.5 mM reduced glutathione.

[0063] In an eleventh aspect of the present invention, a method for screening candidate drugs for treating acute liver injury is provided, comprising the following steps:

[0064] (a) Providing the human liver organoids described in the second aspect of the present invention and the acute liver injury model described in the fourth aspect of the present invention;

[0065] (b) Contact the candidate drug with the organoid or model described in step (a); and

[0066] (c) Detect one or more indicators selected from the following groups: hepatocellular injury markers, inflammatory factor levels, apoptosis rate, vascular leakage, and number of recruited immune cells, and compare them with a control group that has not been exposed to the candidate drug;

[0067] If a candidate drug can reduce hepatocyte injury markers, decrease the release of inflammatory factors, reduce the apoptosis rate, alleviate vascular leakage, or reduce the recruitment of abnormal immune cells, then the candidate drug is considered a potential treatment for acute liver injury.

[0068] In a preferred embodiment, the hepatocyte injury marker is selected from lactate dehydrogenase (LDH), alanine aminotransferase (ALT), aspartate aminotransferase (AST), or a combination thereof.

[0069] In a preferred embodiment, the inflammatory factors are selected from: TNFα, IL-1β, IL-6, IL-10, TGF-β, or combinations thereof.

[0070] In a twelfth aspect of the present invention, a method for screening compounds having hepatotoxic or hepatoprotective effects is provided, comprising the following steps:

[0071] (a) Providing the human liver organoid as described in the second aspect of the present invention;

[0072] (b) Contacting the test compound with the liver organoid; and

[0073] (c) Detect the levels of hepatocellular injury markers or cell activity and compare them with a negative control group;

[0074] Specifically, if the test compound causes a significant increase in hepatocyte damage markers or a significant decrease in cell activity, it indicates that the compound is hepatotoxic; if the test compound can reduce hepatocyte damage markers or increase cell activity in the presence of hepatotoxic substances, it indicates that the compound has a hepatoprotective effect.

[0075] In a thirteenth aspect of the present invention, a method for screening candidate drugs that regulate immune cell chemotaxis is provided, comprising the following steps:

[0076] (a) Provides the in vitro immune cell chemotaxis model as described in the sixth aspect of the present invention, the model comprising the human acute liver injury model and immune cells as described in the fourth aspect of the present invention;

[0077] (b) Adding the candidate drug to the co-culture system; and

[0078] (c) Detect the number of immune cells migrating to organoids and compare it with the control group that did not include the candidate drug;

[0079] If a candidate drug can inhibit immune cell migration, it is indicated that the candidate drug is an immunosuppressive or anti-inflammatory candidate drug; if a candidate drug can promote immune cell migration, it is indicated that the candidate drug is an immune-activating or tissue-repairing candidate drug.

[0080] In a preferred embodiment, the immune cells are VSIG4-positive macrophages or THP-1 cells.

[0081] In a preferred embodiment, the number of migrating immune cells is quantified by detecting CCR2 or CD68 markers.

[0082] It should be understood that, within the scope of this invention, the above-described technical features of this invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be described in detail here.

[0083] Compared with the prior art, the present invention has the following technical effects:

[0084] (1) The method provided by this invention greatly improves the human-derived realism, physiological complexity, and application reliability of the constructed model. The human liver organoid produced by this invention contains multiple cell types, intercellular connections, initial blood vessels, and settled immune cells, which can be directly used to construct a comprehensive disease model that can simulate the complex pathological chain of inflammation initiation, immune cell recruitment, and microcirculatory disturbances in acute injury. This is a key expansion of the functional dimensions of existing technology models.

[0085] (2) The method provided by this invention can preserve the original structure and functional units to the greatest extent: by using 1-2mm 3Direct culture of tissue blocks preserves the natural spatial arrangement, physical connections, and extracellular matrix (ECM) network among hepatocytes, bile duct cells, endothelial cells, stellate cells, and resident immune cells (such as Kupffer cell precursors) within the liver lobules. Its cellular diversity, polar structure, and intercellular communication more closely resemble those of a real liver. This method, which eliminates the need for matrix gel and single-cell initiation cultures of normal liver organoids, preserves the basic functional unit structure of the liver lobules, laying the foundation for the subsequent spontaneous formation of physiologically conformable organoids during culture, and providing a vascularized and immune microenvironment.

[0086] (3) The method provided by this invention avoids interference from exogenous materials and obtains a purer and more stable culture system: it explicitly does not use matrix gel, thus completely avoiding the potential impact of such animal-derived, complex, and batch-varying materials on experimental results. This not only reduces technical uncertainty and cost, but also ensures that the cultured tissue is entirely a product of human cells and their own ECM, providing a purer background for subsequent molecular mechanism research and drug response evaluation.

[0087] (4) The method provided by this invention has high potential for simplification and standardization: Compared with traditional methods that require complex digestion, cell sorting, and multi-factor sequential induction, the process of this scheme (material collection-cutting-culture) is significantly simplified, reducing the dependence on the technical skills of experimental personnel. Combined with the use of commercial culture media, it is more conducive to the standardization of methods and the reproducibility of results in different laboratories.

[0088] (5) This invention constructs an acute liver injury model with an immune-vascular microenvironment: Since the initial organoids naturally contain vascular endothelial cells and immune cells, when stimuli such as APAP are applied, the model can simulate early events of real in vivo injury, such as vascular leakage, release of inflammatory factors, and activation of endogenous immune cells. This surpasses the limitations of traditional models that can only observe hepatotoxicity and animal-derived models.

[0089] (6) This invention successfully established a dynamic immune cell recruitment model: by co-culturing damaged organoids with peripheral blood mononuclear cells in Transwell, this invention for the first time completely reproduced the core pathophysiological chain of "liver injury → release of chemokines → recruitment of circulating immune cells to the injury site" in vitro. This model provides a dynamic research window for studying the origin, differentiation, polarization and function of immune cells in acute liver injury.

[0090] (7) The human acute liver injury model constructed in this invention provides a more reliable and clinically relevant standardized research tool for disease mechanism research, precise assessment of drug hepatotoxicity, and efficient screening of novel treatment options. Attached Figure Description

[0091] Figure 1 The diagram shown illustrates the construction and identification of liver organoids, ALI models, and co-culture chemotaxis models in embodiments of the present invention.

[0092] Figure 2 The diagram shown is a schematic representation of liver organoid culture in an embodiment of the present invention. P1 and P2 are abbreviations for Patent 1 and 2, respectively, referring to organoids cultured from normal liver tissue from two patients.

[0093] Figure 3 The diagram shown is a schematic representation of the vascularization of a liver organoid in an embodiment of the present invention. Under a microscope, red vascular tissue can be seen inside the liver organoid.

[0094] Figure 4 The image shown is a morphological diagram of liver organoid tissue in an embodiment of the present invention. HE staining shows that the liver organoid tissue has a good morphology, with obvious sinusoidal structures and vascular regions. The right image is a magnified image of the left image by 20 times.

[0095] Figure 5 The image shown is a diagram illustrating the identification results of various cell groups in liver organoids in an embodiment of the present invention. Immunofluorescence staining revealed that, in addition to hepatic parenchymal cells, the liver organoids also include hepatic stellate cells, Kupffer cells, vascular endothelial cells, etc. The liver organoids exhibit a rich variety of cell groups and possess vascularization and an immune microenvironment.

[0096] Figure 6 The image shown is a single-cell sequencing result of liver tissue in an embodiment of the present invention.

[0097] Figure 7 The image shown is a graph of LDH detection results in the liver organoid ALI model in this embodiment of the invention. Compared with the DMSO control group, the ALI model (APAP administration group) showed increased hepatocyte damage and increased LDH release.

[0098] Figure 8 The figure shown is a graph of ALT / AST activity detection results of the APAP concentration gradient-induced organoid ALI model in an embodiment of the present invention.

[0099] Figure 9 The image shown is a comparison of the H&E staining and TUNEL detection results of the organoid ALI model in this embodiment of the invention with the control.

[0100] Figure 10 The image shown is a graph illustrating the LDH detection results of a liver organoid co-culture chemotaxis model in an embodiment of the present invention.

[0101] Figure 11The image shown is a graph of the detection results of inflammatory factors and chemokines in the co-culture chemotactic model of liver organoids in this embodiment of the invention. After the ALI model was co-cultured with VSIG4 positive mononuclear macrophages and chemotactic, the release of pro-inflammatory factors increased and the chemokine CCL2 increased in a short period of time. In a long period of time, the increase of anti-inflammatory factors and the decrease of CCL2 were observed.

[0102] Figure 12 The image shown is a graph of LDH detection results during NAC drug testing in a liver organoid co-culture chemotactic model according to an embodiment of the present invention.

[0103] Figure 13 The image shown is a graph illustrating the detection results of inflammatory factors during the NAC drug test in a liver organoid co-culture chemotactic model, as described in this embodiment of the invention. Detailed Implementation

[0104] To make the objectives, technical solutions, beneficial effects, and significant advancements of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, all the described embodiments are only some embodiments of the present invention, and not all embodiments; based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0105] the term

[0106] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

[0107] As used herein, “including” or “containing” includes “comprising,” “mainly composed of,” “substantially composed of,” and “composed of”; “mainly composed of,” “substantially composed of,” and “composed of” are subordinate concepts of “containing,” “having,” or “including.”

[0108] As used herein, the 'functional vascular network' refers to the microvascular system within organoids that is spontaneously formed by host-derived endothelial cells, has an open lumen structure, and can maintain barrier function; the 'resident immune cell microenvironment' refers to the presence of tissue-resident macrophages (Kupffer cells) in organoids that can respond to inflammatory stimuli and secrete cytokines.

[0109] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Percentages and parts are by weight unless otherwise stated. Unless otherwise specified, all experimental materials and reagents involved in this invention are commercially available.

[0110] Experimental methods:

[0111] 1. Preparation of MNP@Oligo-VSIG4 reversible immunoaffinity magnetic beads:

[0112] Through extensive screening, an oligonucleotide containing four deoxyinosine (dI) bases (OligoDNA, 5'COOH-ATGCGATCTIGACTGAITCGAATICGGTACICATGTA-Aminolinker-3', SEQ ID NO: 1) was finally designed as a linker, where I represents the deoxyinosine (dI) base. A control linker without dI (sequence ATGCGATCTAGACTGAATCGAATACGGTACACATGTA, SEQ ID NO: 2) was used to determine the enzyme digestion effect. Carboxylated magnetic beads were directionally coupled to a specific VSIG4 antibody. Specifically, the connection method was: the amino-modified end of Oligo (3'... Aminolinker C7 modification refers to the chemical modification of an oligonucleotide (such as a primer or probe) by connecting an amino group (-NH2) to the 3' end through a methylene chain containing 7 carbon atoms (C7 intercostal arm). The Oligo carboxyl modification end (COOH) is connected to the carboxyl group on the surface of the magnetic bead via an amide bond. The carboxyl modification end (COOH) is activated by EDC / NHS and covalently binds to the amino group of the antibody.

[0113] The experimental procedure is as follows:

[0114] Step 1: Activation of carboxylated magnetic beads

[0115] 1) Take carboxylated magnetic beads: Take 0.2 mL of carboxylated magnetic bead suspension (about 2 mg of magnetic beads), collect the magnetic beads with a magnetic rack, and discard the supernatant.

[0116] 2) Washing: Wash three times with 2 mL of 0.1 M MES buffer, and discard the supernatant after each wash using magnetic separation.

[0117] 3) Activate carboxyl groups: Resuspend the magnetic beads in 0.2 mL of 0.1 M M EES buffer. Add EDC to a final concentration of 10 mM and NHS to a final concentration of 5 mM. Shake at room temperature (300 rpm) for 15 minutes to activate the carboxyl groups on the magnetic beads.

[0118] Step 2: Coupling Oligo DNA with Magnetic Beads

[0119] 1) Prepare aminoated Oligo DNA: Take 20 μL of 100 μM aminoated Oligo DNA solution (dissolved in 0.1 M MES buffer).

[0120] 2) Coupling reaction: Mix the activated magnetic beads with Oligo DNA solution and shake at room temperature (200 rpm) for 2 hours.

[0121] 3) Termination of reaction: Add hydroxylamine hydrochloride to a final concentration of 50 mM (e.g., add 10 μL of 1 M hydroxylamine hydrochloride), and shake at room temperature for 15 minutes to terminate the reaction.

[0122] Step 3: Block unreacted reactive groups

[0123] 1) Washing: Wash the magnetic beads three times with 2 mL PBS, and discard the supernatant after magnetic separation.

[0124] 2) Blocking: Resuspend the magnetic beads in 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour.

[0125] 3) Final washing: Wash 3 times with PBS, magnetically separate, and store in 0.2 mL PBS (4°C for later use).

[0126] Step 4: Conjugation of carboxylated Oligo DNA to antibodies

[0127] 1) Activate the carboxyl terminus: Take the above-conjugated magnetic beads and wash them three times with 2 mL of 0.1 M MES buffer. Resuspend them in 0.2 mL of MES buffer, add 10 mM EDC and 5 mM NHS to a final concentration, and shake at room temperature for 15 minutes.

[0128] 2) Prepare antibody solution: Dissolve 0.1 mg VSIG4 antibody in 100 μL PBS (final concentration 1 mg / mL).

[0129] 3) Antibody conjugation: Mix the VSIG4 antibody solution with the activated magnetic beads and shake at room temperature (200 rpm) for 2 hours.

[0130] 4) Termination of reaction: Add hydroxylamine hydrochloride to a final concentration of 50 mM and shake at room temperature for 15 minutes.

[0131] Step 5: Blocking and Purification

[0132] 1) Blocking: Add 0.2 mL of 1 mg / mL BSA solution and shake at room temperature for 1 hour.

[0133] 2) Washing: Wash 3 times with 2 mL PBS, then magnetically separate and discard the supernatant.

[0134] 3) Storage: Resuspend in 0.2 mL PBS (containing 0.05% NaN3) to obtain MNP@Oligo-VSIG4 reversible immunoaffinity magnetic beads, and store at 4°C protected from light.

[0135] After cell immunoaffinity separation, the dI site in Oligo is cleaved by Endo V nuclease (the processing buffer consists of 10 mM HEPES, pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione, which is a buffer that facilitates enzymatic cleavage and cell preservation; the optimal temperature is 37℃ and the processing time is 30 min), thus achieving gentle dissociation of the magnetic beads from the cells and ensuring cell viability.

[0136] Verification showed that after dissociation using Endo V nuclease, the survival rate of the target cells (VSIG4-positive macrophages) obtained was higher than 90%, and the magnetic bead residue rate was less than 1%, indicating that the reversible magnetic beads have good cell-mild dissociation characteristics.

[0137] This invention solves the problem of cell damage caused by the irreversible binding of traditional immunomagnetic beads, and is suitable for cell sorting followed by culture and cell therapy. The method is simple to operate, highly specific, and reproducible, and the dissociation efficiency can be controlled by adjusting the Oligo length and dI number.

[0138] 2. Isolation of VSIG4-positive macrophages from bone marrow

[0139] (1) Acquisition and induction of differentiation of bone marrow mononuclear cells:

[0140] Under aseptic conditions, mouse femurs and tibias were harvested, and bone marrow cells were flushed out with PBS containing 2% FBS. After erythrocyte lysis, the cells were resuspended in complete medium (RPMI-1640, 10% FBS) containing 20 ng / mL M-CSF and seeded at an appropriate density in culture dishes. The cells were cultured at 37°C in a 5% CO2 incubator for 5-7 days, with half the medium replaced every 2-3 days, to induce differentiation into bone marrow-derived macrophages.

[0141] (2) Positive sorting of MNP@Oligo-VSIG4 reversible immunoaffinity magnetic beads:

[0142] Collect induced cells, resuspend them in pre-chilled cell sorting buffer (10 mM HEPES, pH 7.4 + 120 mM NaCl + 5 mM KCl + 5 mM glucose + 5 mM MgCl2 + 0.5 mM reduced glutathione) and count them. Divide the cells into groups of 10-1.7 Each cell was incubated with 10 μL of MNP@Oligo-VSIG4 for 15 minutes at room temperature. The cells were washed twice with buffer and placed on a magnetic rack to remove unbound cells. The sorted VSIG4-positive macrophages were used for subsequent experiments.

[0143] Example 1:

[0144] This embodiment constructs liver organoids, an ALI model, and a co-culture chemotaxis model, as follows: Figure 1 As shown, the specific process is as follows:

[0145] 1. Construction of human liver organoids

[0146] 1) Obtaining and preprocessing human normal liver tissue

[0147] Tissue source: Surgically removed, pathologically confirmed normal human liver tissue (such as hepatic hemangioma, normal liver tissue adjacent to hepatocellular carcinoma). After removal from the body, the tissue was immediately placed in a pre-cooled, sterile 50mL empty centrifuge tube and transported on ice (the centrifuge tube did not directly contact the ice and was wrapped in gauze to prevent frostbite). Subsequent processing was completed within 4 hours.

[0148] Tissue processing: In a sterile biosafety cabinet, rinse the tissue repeatedly 3-5 times with liver organoid washing solution (Shanghai Lisheng Biotechnology Co., Ltd., catalog number: LSNO00400201) until the washing solution is clear.

[0149] Tissue block preparation: Place the processed liver tissue in a sterile culture dish and cut it into small, roughly uniform pieces using a sharp blade or tissue scissors, with a target size of approximately 1-2 mm³.

[0150] 2) Initial culture and expansion of liver organoids

[0151] Inoculation and culture: Carefully transfer the cut liver tissue blocks into a normal 6-well culture plate or culture dish using a wide-mouth pipette tip. Inoculate 8-15 tissue blocks into each well and add 2-3 mL (for a single well in a 6-well plate) of liver organoid culture medium preheated to 37°C (Shanghai Lisheng Biotechnology Co., Ltd., catalog number: LSNO00400402).

[0152] Culture conditions: Place the culture plate in a constant temperature and humidity incubator at 37°C and 5% CO2 for static culture. Replace half of the culture medium with fresh medium every 3-5 days. After 5-7 days of culture, cells can be observed migrating from the edges of the tissue blocks and forming translucent, dense organoid-like structures. At this point, subsequent identification and modeling can be performed.

[0153] The results of the culture on day 1 and day 10 are as follows: Figure 2As shown, new cells have grown from the edge of the organoid after 10 days of culture, indicating that the organoid construction is complete and the growth is good. These cells will be used for subsequent experiments.

[0154] 3) Phenotypic identification of liver organoids

[0155] Morphological identification: The growth dynamics and overall structure of the organoids were observed regularly using an inverted phase-contrast microscope or a live-cell imaging system. Under the microscope, red vascular tissue was visible inside the liver organoids. Figure 3 (As indicated by the arrow); HE staining shows that the liver organoid tissue has a good morphology, with obvious hepatic sinusoidal structures and vascular regions visible. Figure 4 ).

[0156] Multiple cell type identification: The identification criteria for functional vascular networks are: endothelial cell networks with typical tubular structures can be seen inside organoids by CD31 immunofluorescence staining; the identification criteria for the colonized immune cell microenvironment are: scattered or aggregated positive cells can be detected by CD68 immunofluorescence staining, and single-cell sequencing data show the expression of Kupffer cell characteristic genes (such as CLE4F, VSIG4).

[0157] The positive expression of hepatocyte nuclear factor 4α (HNF4A), vascular endothelial cell marker CD31, hepatic stellate cell marker α-SMA, and hepatic macrophage marker CD68 was detected by immunofluorescence staining or immunohistochemistry. Figure 5 The results were largely consistent with those of single-cell sequencing of liver tissue. Figure 6 ).

[0158] 2. Construction of acute liver injury (ALI) model and myeloid mononuclear macrophage chemotaxis model

[0159] 1) Construct an ALI model based on the organoids described above.

[0160] Organoid selection: Human liver organoids that have been cultured for about 7 days and have passed identification were selected for modeling.

[0161] Acetaminophen (APAP) induced ALI model: treat organoids with organoid culture medium containing 2-20 mM APAP for 2-12 hours.

[0162] ALI model validation: Supernatant was collected, and the release of lactate dehydrogenase (LDH) was detected. The results showed that the release of LDH in the 2 mM APAP group was significantly increased compared with the DMSO group. Figure 7Furthermore, the accumulation of N-acetyl-p-benzoquinone imine (NAPQI), a toxic intermediate from APAP metabolism, in the same system affects the enzyme activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST). NAPQI binds to enzymes with thiol-based catalytic centers, influencing their activity. Since aminotransferases have thiol groups at their active sites, their catalytic activity depends on these groups. Therefore, the detected release levels of ALT and AST show a significant decrease. Figure 8 This also reflects the accumulation of NAPQI in the ALI model and its increased hepatotoxic damage.

[0163] Among them, the ALT / AST reduction was significant in the 2 mM APAP treatment group, while the reduction in ALT / AST caused by higher concentrations of APAP was not significantly different from that in the 2 mM APAP treatment group. Figure 8 This indicates that 2 mM APAP is sufficient to cause severe hepatocyte damage, so 2 mM APAP was used as the concentration for model induction in all subsequent ALI groups.

[0164] Organoids were prepared into paraffin sections and stained with H&E to observe acute injury pathological features such as hepatocyte vacuolar degeneration, ballooning degeneration, and punctate necrosis. Through H&E staining, the typical pathological features of the acute liver injury model also included discontinuity of hepatic sinusoidal endothelial cells, disordered hepatic plate structure, and neutrophil infiltration in punctate necrotic foci.

[0165] Cell apoptosis was assessed using TUNEL staining. Compared to the control group (normal cultured organoids), the 2 mM APAP group (APAP-treated organoid-induced ALI model group) showed a significant increase in apoptotic cells. Figure 9 ).

[0166] 2) Construction of a myeloid mononuclear macrophage chemotaxis model

[0167] Preparation of monocytes: Culture the monocyte cell line THP-1 for later use.

[0168] Establishment of co-culture system: Transwell co-culture system (12-well or 24-well plate Transwell chambers with 8.0 μm pore size) was used.

[0169] Lower chamber: Undamaged liver organoids or those treated with acute injury as described in the above examples (5-10 organoids per lower chamber) are placed in liver organoid culture medium.

[0170] Upper chamber: Prepare 1×10 5 One THP-1 cell was suspended in 200 μL of 1640 complete culture medium and added to the upper chamber.

[0171] Chemotactic Culture and Evaluation: The co-culture system was incubated in an incubator for 12-24 hours. After incubation, the upper chamber was carefully removed, and the culture medium and cells / organoids in the upper and lower chambers were collected separately. The number of monocytes / macrophages migrating from the upper and lower chambers to the lower chamber was observed and counted using CCR2 and CD68 antibody labeling. Simultaneously, changes in the expression and secretion levels of inflammatory chemokines (MCP-1 / CCL2), inflammatory factors (IL1β / IL6 / TNFα, etc.), and anti-inflammatory factors (IL-10 / CD206 / TGF-β, etc.) were detected by qPCR or ELISA to validate the chemotactic effect of the model at the molecular level.

[0172] 3) Validation of ALI and myeloid mononuclear macrophage chemotaxis models based on organoids

[0173] Based on the APAP-induced ALI model and myeloid monocyte / macrophage chemotaxis model constructed above, VSIG4-positive macrophages (VSIG4) with anti-inflammatory effects were prepared using the above experimental methods. + Model validation was performed using Mφ. The groups are as follows:

[0174] (1) Normal co-culture group: 5-10 normally cultured organoids + 1×10 6 VSIG4-positive macrophages + 10 μL DMSO (Control + VSIG4) + Mφ);

[0175] (2) ALI model group (APAP);

[0176] (3) ALI model short-term co-culture group (APAP+VSIG4) + Mφ(2h)): 5-10 normally cultured organoids + 1×10 6 VSIG4-positive macrophages were co-cultured with 10 μL APAP (final concentration 2 mM) for 2 h to allow the macrophages to adapt to the culture environment without causing excessive chemotactic migration.

[0177] (4) Long-term chemokine group of ALI model (APAP+VSIG4) + Mφ(12h)): 5-10 normally cultured organoids + 1×10 6 VSIG4-positive macrophages were co-cultured with 10 μL APAP (final concentration 2 mM) for 12 h, which enabled most macrophages to migrate into the lower chamber in response to chemokine stimulation and thus alleviate liver damage.

[0178] Co-culturing of each group was carried out using Transwell chambers with an 8 μm pore size. The upper chamber contained 500 μL of culture medium, and the lower chamber contained 1 mL of culture medium.

[0179] LDH detection was performed using a lactate dehydrogenase release assay kit (WST-8 method) (Beyotime, catalog number C0019S). The procedure was as follows: Prepare the LDH detection working solution, set up the LDH standard curve wells, and add 100 μl of sample to the sample wells of a 96-well plate. Add 100 μl of LDH detection working solution to each of the standard and sample wells, mix well, and incubate at 37°C in the dark for 30 minutes. Add 20 μl of Stop Solution to each well, mix well, and then measure the absorbance at 450 nm. Establish the LDH standard curve and calculate the lactate dehydrogenase activity released in the sample.

[0180] The results showed that, compared with the normal co-culture group, the ALI model group (APAP) had increased hepatocyte damage and increased LDH release; compared with the ALI model group, with the reduction of VSIG4... + The prolongation of Mφ chemotaxis time reduced liver injury in the ALI model. Figure 10 ).

[0181] Compared with the normal co-culture group, the ALI model (APAP) and VSIG4 + Following co-culture with macrophages and subsequent chemotaxis, a short-term (e.g., 2 hours, reflecting increased inflammation in the early stages of injury) release of pro-inflammatory factors (such as TNFα, IL1β, and IL6) and increased inflammation were observed, along with an increase in the chemokine CCL2, which was used to attract more monocytes and macrophages to participate in the initial inflammatory response of ALI. A longer-term (e.g., 12 hours, reflecting inflammation suppression and tissue repair in the later stages of injury) release of anti-inflammatory factors (such as IL-10, CD206, and TGF-β) was observed, with increased release of VSIG4 in the later stages of ALI. + Increased Mφ chemotaxis suppresses the inflammatory response, initiating a repair phase. Simultaneously, the chemokine CCL2 and its receptor CCR2 decrease. These results indicate a significant increase in VSIG4. + Mφ is chemotactically attracted into the damaged tissue to perform its function. Figure 11 ).

[0182] Example 2: Drug testing based on APAP-induced organoid ALI model

[0183] Based on the APAP-induced ALI model and myeloid monocyte / macrophage chemotaxis model constructed above, the reliability of the models was tested using the known hepatoprotective drug N-acetylcysteine ​​(NAC). The groups are as follows:

[0184] (1) Control group: 5-10 normally cultured organoids + 1×10 6 THP-1+10μL DMSO (Control+Mφ);

[0185] (2) APAP group, i.e. ALI model group: 5-10 normally cultured organoids + 1×10 6 One THP-1 + 10 μL AAPAP (final concentration 2mM) were co-cultured for 12h (APAP + Mφ (12h));

[0186] (3) APAP+NAC treatment group: 5-10 normally cultured organoids + 1×10 6 THP-1 + 10 μL APAP (final concentration 2 mM) + 33 μL NAC (final concentration 20 mM), co-cultured for 12 h (APAP + VSIG4) + Mφ(12h)).

[0187] Co-culturing of each group was conducted using Transwell chambers with an 8 μm pore size. The upper chamber contained 500 μL of culture medium, and the lower chamber contained 1 mL of culture medium. APAP was prepared using DMSO stock solution at a concentration of 200 mM; NAC was prepared using culture medium stock solution at a concentration of 600 mM.

[0188] LDH detection was performed using a lactate dehydrogenase release assay kit (WST-8 method) (Beyotime, catalog number C0019S). The procedure was as follows: Prepare the LDH detection working solution, set up the LDH standard curve wells, and add 100 μl of sample to the sample wells of a 96-well plate. Add 100 μl of LDH detection working solution to each of the standard and sample wells, mix well, and incubate at 37°C in the dark for 30 minutes. Add 20 μl of Stop Solution to each well, mix well, and then measure the absorbance at 450 nm. Establish the LDH standard curve and calculate the lactate dehydrogenase activity released in the sample.

[0189] The results showed that, compared with the normal co-culture group, the ALI model group (APAP) had increased hepatocyte damage and increased LDH release; compared with the ALI model group, the NAC treatment group had decreased LDH release and reduced liver damage. Figure 12 ).

[0190] Compared with the normal co-culture group, the ALI model group showed increased release of pro-inflammatory factors (such as TNFα, IL1β, and IL6), increased inflammation, and aggravated inflammatory damage to liver tissue; the NAC treatment group showed reduced release of pro-inflammatory factors, suppressed the inflammatory response, and NAC had a certain protective effect against hepatocellular damage. Figure 13 This liver organoid ALI and chemotaxis model can be applied to drug testing for liver-related diseases.

[0191] The preferred embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and the devices and structures not described in detail should be understood as being implemented in a conventional manner in the art. Any person skilled in the art can make many possible variations and modifications to the technical solutions of the present invention using the methods and techniques disclosed above, or modify them into equivalent embodiments with equivalent changes, without departing from the scope of the present invention. This does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the present invention's technical solutions still fall within the protection scope of the present invention.

Claims

1. A method for constructing human liver organoids, characterized in that, The method includes the following steps: (a) Obtain normal human liver tissue and cut it into tissue blocks with a volume of 1-2 mm³; (b) The tissue blocks were directly inoculated into a culture vessel, and liver organoid culture medium was added for static culture; and (c) Cultured until cells migrate from the edge of the tissue block and form organoid structures; The method does not use exogenous matrix gel and does not digest liver tissue into a single-cell suspension, thereby preserving the integrity of the liver's native microenvironment and intercellular connections.

2. A human liver organoid, characterized in that, It is constructed by the method described in claim 1.

3. A method for constructing a human acute liver injury (ALI) model, characterized in that, The method includes: contacting the human liver organoid of claim 2 with a hepatotoxic drug to induce liver injury, thereby obtaining a human acute liver injury (ALI) model; The hepatotoxic drug mentioned is acetaminophen (APAP).

4. A human acute liver injury (ALI) model, characterized in that, It is obtained by the method described in claim 3.

5. A method for constructing an in vitro immune cell chemotaxis model, characterized in that, The method includes: culturing the human liver organoid of claim 2 or the acute liver injury model of claim 4 with immune cells in a co-culture system, so that the immune cells migrate to the organoid.

6. An in vitro immune cell chemotaxis model, characterized in that, It is obtained by the method described in claim 5.

7. A reversible immunoaffinity magnetic bead, characterized in that, The magnetic bead comprises: (1) Magnetic core; (2) An oligonucleotide linker connected to the surface of a magnetic nucleus via an amide bond, the oligonucleotide linker comprising at least one deoxyinosine (dI) base; and (3) The target molecule is covalently linked to the other end of the oligonucleotide linker; The oligonucleotide linker sequence includes the sequence shown in SEQ ID NO:1; the targeting molecule is an anti-VSIG4 antibody.

8. A method for isolating target cells from a mixture of cells, characterized in that, include: (a) Incubating the reversible immunoaffinity magnetic beads of claim 7 with a mixture of cells to allow the magnetic beads to bind to antigens on the surface of target cells; (b) Apply a magnetic field to separate target cells bound with magnetic beads; and (c) The deoxyinosine site in the oligonucleotide linker is cut with a nuclease to dissociate the magnetic beads from the target cells and obtain purified target cells; the target cells are VSIG4 positive macrophages.

9. The application of the human liver organoid of claim 2, the acute liver injury model of claim 4, or the immune cell chemotaxis model of claim 6 in at least one of the following aspects: (a) Screening for drugs to treat acute liver injury; (b) Assess the hepatotoxicity of the candidate compounds; (c) To study the pathogenesis of acute liver injury; (d) To investigate the recruitment, differentiation, and function of immune cells in liver injury; and (e) Evaluate the effects of anti-inflammatory or immunomodulatory drugs.

10. A kit for constructing human liver organoids, characterized in that, The kit contains: (1) Liver organoid culture medium; (2) The reversible immunoaffinity magnetic beads of claim 7, and / or the buffer solution for separating VSIG4-positive macrophages; (3) A user manual, which describes the method of claim 1; The buffer solution contains 10 mM HEPES, 120 mM NaCl, 5 mM KCl, 5 mM glucose, 5 mM MgCl2, and 0.5 mM reduced glutathione.

Images