SSR primer sets of Mahonia and their application

Abstract

The present application relates to a kind of SSR molecular marker primer set of Mahonia, and its application, the forward primer sequence of the SSR molecular marker primer set includes the sequence as shown in any one of SEQ ID NO:1-7 or as shown in any one of SEQ ID NO:1-7;The reverse primer sequence of the SSR molecular marker primer set includes the sequence as shown in any one of SEQ ID NO:8-14 or as shown in any one of SEQ ID NO:8-14, the SSR molecular marker primer set of the present application is accurately identified long column Mahonia, and it guarantees the authenticity of base original variety for its relevant quality standard research.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to SSR molecular marker primer sets of the genus Mahonia and their applications. Background Technology

[0002] The Ten Great Merits of Long Pillar ( Mahonia duclouxiana *Gagne przewalskii* (Gagne przewalskii) is a plant belonging to the genus *Mahonia* in the family Berberidaceae. Its main chemical components are berberine hydrochloride, berberine hydrochloride, and palmatine hydrochloride. Its stems and leaves are one of the raw materials for extracting berberine. It has the effects of clearing heat and drying dampness, purging fire and detoxifying, and is commonly used in folk medicine for colds, dysentery, burns, and scalds. It is found in Yunnan, Sichuan, and Guangxi Zhuang Autonomous Region. It grows in forests, thickets, roadsides, riverbanks, or hillsides at altitudes of 1800-2700 meters. Plants in the genus *Mahonia* of the family Berberidaceae are widely distributed and have many species. It is a common medicinal and ornamental plant, with 31 species distributed in my country, of which 22 are medicinal. The 2025 edition of the Chinese Pharmacopoeia lists Mahonia as a medicinal material derived from the dried stems of Mahonia latifolia and Mahonia stenoptera. These stems are the main raw materials in traditional Chinese medicine preparations such as "Mahonia Detoxifying Tablets" and "Berberine Hydrochloride Tablets." Currently, only the dried stems of Mahonia latifolia or Mahonia stenoptera are used in pharmaceutical preparations. Furthermore, the medicinal material source for Mahonia leaf-based granules in the Guizhou Province Traditional Chinese Medicine Formula Granules Quality Standard (Batch 23), Sichuan Province Traditional Chinese Medicine Formula Granules Trial Standard (Batch 2), and Anhui Province Traditional Chinese Medicine Formula Granules Standard (Trial (Batch 16)) is... The medicinal material source for Mahonia macrocarpa granules is Mahonia macrocarpa, as specified in the Hunan Provincial Standard for Traditional Chinese Medicine Granules (Seventh Batch) and the Hubei Provincial Standard for Traditional Chinese Medicine Granules (Third Batch). In the Guizhou Provincial Standard for Traditional Chinese Medicine and Ethnic Medicine (2003 Edition), the medicinal material source for Mahonia macrocarpa is the dried stems of Mahonia longifolia, Mahonia smallifolia, Mahonia anpingensis, and Mahonia broadleaf. The medicinal material source for Mahonia macrocarpa leaves is the dried leaves of Mahonia longifolia, Mahonia smallifolia, Mahonia slenderis, Mahonia broadleaf, and Mahonia macrocarpa. Because the wild resources of these two species are extremely scarce and there is very little large-scale artificial cultivation, in order to clarify the phylogenetic relationship between different species of Mahonia and to find alternative sources of medicinal materials to replace Mahonia broadleaf and Mahonia narrowleaf, Nong Zhihuan et al. and Luo Xiaozhen et al. conducted RAPD analysis on plants of the Mahonia genus. The results showed that Mahonia longissimum and Mahonia broadleaf are closely related, and Mahonia longissimum may be used as an alternative medicinal material. At present, there are already standardized cultivation bases for Mahonia longissimum, which can meet the demand for medicinal materials.

[0003] However, in recent years, research on plants of the genus *Mahonia* has mainly focused on chemical composition, quality evaluation, and pharmacological effects, with relatively little research on molecular identification. Furthermore, the morphological similarity among *Mahonia* plants has led to serious misuse of *Mahonia wood* and *Mahonia leaves* in the market, posing a safety hazard to clinical use. With the continuous changes in their growing environment, under conditions of no flowering or fruiting, traditional morphological identification methods are insufficient for accurate species identification, hindering research on this variety. With the development of traditional Chinese medicine (TCM) identification technology, molecular identification technology has become increasingly mature and widely used in the identification of the origins of TCM raw materials, TCM decoctions, and TCM formula granules. Among them, simple sequence repeats (SSR) and single nucleotide polymorphisms (SNP) are currently the most widely used and most effective types of molecular markers. Compared with SNP and other molecular marker technologies, SSR markers have the advantages of being fast, accurate, having high information content, co-dominant inheritance, high stability and reproducibility of results, and low requirements for DNA quality. They are widely used in the variety identification of agricultural, forestry, and TCM crops such as wheat, passion fruit, potato, artemisia, and wrinkled papaya, and have been widely applied in research such as genetic diversity analysis, fingerprinting, early hybrid identification, and gene mapping. Summary of the Invention

[0004] In view of the problems existing in the prior art, the present invention provides an SSR molecular marker primer set of the genus Mahonia and its application.

[0005] Specifically, in order to solve the above-mentioned technical problems, the present invention provides the following technical solution.

[0006] The present invention provides an SSR molecular marker primer set for the genus Mahonia, wherein the forward primer sequence of the SSR molecular marker primer set comprises a sequence as shown in any one of SEQ ID NO:1-7 or a sequence as shown in any one of SEQ ID NO:1-7; The reverse primer sequence of the SSR molecular marker primer set includes a sequence as shown in any one of SEQ ID NO:8-14 or a sequence as shown in any one of SEQ ID NO:8-14.

[0007] Optionally, for the SSR molecular marker primer set described above, the SSR molecular marker primer set is selected from any of the following: the forward primer sequence includes the sequence shown in SEQ ID NO:1 or the sequence shown in SEQ ID NO:1 and the reverse primer sequence includes the sequence shown in SEQ ID NO:8 or the sequence shown in SEQ ID NO:8. The forward primer sequence comprises the sequence shown in SEQ ID NO:2 or the sequence shown in SEQ ID NO:2, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:9 or the sequence shown in SEQ ID NO:9. The forward primer sequence comprises the sequence shown in SEQ ID NO:3 or the sequence shown in SEQ ID NO:3, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:10 or the sequence shown in SEQ ID NO:10. The forward primer sequence comprises the sequence shown in SEQ ID NO:4 or the sequence shown in SEQ ID NO:4, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:11 or the sequence shown in SEQ ID NO:11. The forward primer sequence comprises the sequence shown in SEQ ID NO:5 or the sequence shown in SEQ ID NO:5, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:12 or the sequence shown in SEQ ID NO:12. The forward primer sequence comprises the sequence shown in SEQ ID NO:6 or the sequence shown in SEQ ID NO:6, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:13 or the sequence shown in SEQ ID NO:13; and The forward primer sequence comprises the sequence shown in SEQ ID NO:7 or the sequence shown in SEQ ID NO:7, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:14 or the sequence shown in SEQ ID NO:14.

[0008] Optionally, for the SSR molecular marker primer set described above, the SSR molecular marker primer set is selected from any one of the following: the forward primer sequence as shown in SEQ ID NO:1 and the reverse primer sequence as shown in SEQ ID NO:8; The forward primer sequence is as shown in SEQ ID NO:2 and the reverse primer sequence is as shown in SEQ ID NO:9; The forward primer sequence is as shown in SEQ ID NO:3 and the reverse primer sequence is as shown in SEQ ID NO:10; The forward primer sequence is as shown in SEQ ID NO:4 and the reverse primer sequence is as shown in SEQ ID NO:11; The forward primer sequence is as shown in SEQ ID NO:5 and the reverse primer sequence is as shown in SEQ ID NO:12; The forward primer sequence comprises the sequence shown in SEQ ID NO:6 or the sequence shown in SEQ ID NO:6, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:13 or the sequence shown in SEQ ID NO:13; and The forward primer sequence is as shown in SEQ ID NO:7 and the reverse primer sequence is as shown in SEQ ID NO:14.

[0009] Optionally, the forward primer sequence as shown in SEQ ID NO:1 and the reverse primer sequence as shown in SEQ ID NO:8 are used to identify Mahonia spp. The forward primer sequence shown in SEQ ID NO:2 and the reverse primer sequence shown in SEQ ID NO:9, the forward primer sequence shown in SEQ ID NO:4 and the reverse primer sequence shown in SEQ ID NO:11, the forward primer sequence shown in SEQ ID NO:5 and the reverse primer sequence shown in SEQ ID NO:12, or the forward primer sequence shown in SEQ ID NO:7 and the reverse primer sequence shown in SEQ ID NO:14 are used to identify long-column Mahonia. Forward primer sequences as shown in SEQ ID NO:3 and reverse primer sequences as shown in SEQ ID NO:10 or forward primer sequences as shown in SEQ ID NO:6 and reverse primer sequences as shown in SEQ ID NO:13 are used to identify small-fruited Mahonia.

[0010] The present invention provides a kit comprising the SSR molecular marker primer set described in any of the above claims.

[0011] This application provides a DNA molecular identity card, which includes the SSR molecular marker primer set described in any of the above claims.

[0012] This application provides a method for screening SSR molecular marker primer sets as described in any one of the above claims, comprising: DNA was extracted from the Mahonia genus. Using chloroplast genome data from the genus Mahonia, SSR loci were obtained, including chloroplast genome sequence number PX869754. SSR primers were designed based on SSR sites, synthesized, and then the obtained DNA was used to perform PCR amplification of the SSR primers followed by electrophoresis to screen and obtain the SSR molecular marker primer set.

[0013] This application provides a method for identifying varieties of the genus Mahonia, the method comprising: using the DNA of the Mahonia variety to be tested as a template, performing PCR amplification using the SSR molecular marker primer set described above, detecting the PCR amplification product by electrophoresis, obtaining the pattern of the Mahonia variety to be tested, and identifying the variety.

[0014] Optionally, for the method described above, the PCR amplification program is as follows: denaturation at 93-96°C for 20-35 seconds, annealing at 52-61°C for 25-40 seconds, extension at 72°C for 25-40 seconds, PCR cycles of 28-34, and the Taq enzyme is 2×M5 Taq PCR Mix, 2×FidCycle Evo high-fidelity PCR Master Mix, 2×SanTaq Fast PCR Mix, 2×TransFast Taq PCR, or 2×Taq PCR Master Mix; Preferably, the PCT amplification program is 95°C denaturation for 30s, 55°C annealing for 25s, 72°C extension for 30s, for 34 cycles, and the Taq enzyme is 2×FidCycle Evo high-fidelity PCR Master Mix.

[0015] Optionally, for any of the methods described above, the electrophoretic detection is agarose gel electrophoresis, polyacrylamide gel electrophoresis, or / and capillary electrophoresis.

[0016] Optionally, in any of the methods described above, the forward primer sequence as shown in SEQ ID NO:1 and the reverse primer sequence as shown in SEQ ID NO:8 are used to identify Mahonia spp. The forward primer sequence shown in SEQ ID NO:2 and the reverse primer sequence shown in SEQ ID NO:9, the forward primer sequence shown in SEQ ID NO:4 and the reverse primer sequence shown in SEQ ID NO:11, the forward primer sequence shown in SEQ ID NO:5 and the reverse primer sequence shown in SEQ ID NO:12, or the forward primer sequence shown in SEQ ID NO:7 and the reverse primer sequence shown in SEQ ID NO:14 are used to identify long-column Mahonia. Forward primer sequences as shown in SEQ ID NO:3 and reverse primer sequences as shown in SEQ ID NO:10 or forward primer sequences as shown in SEQ ID NO:6 and reverse primer sequences as shown in SEQ ID NO:13 are used to identify small-fruited Mahonia.

[0017] This invention provides any of the following applications of the SSR molecular marker primer set described above, the kit described above, or the DNA molecular identity card described above: A1) Application in the genetic diversity analysis of the ten Mahonia genera; A2) Application in the resource diversity analysis of the ten major varieties of Mahonia; A3) Application of the analysis of kinship among the ten great merits; A4) Application in the identification of ten varieties of the *Mahonia* genus; and A5) Application in constructing genetic maps or DNA fingerprint maps of the Mahonia genus.

[0018] The SSR molecular marker primer set described in this invention can accurately identify the genus Mahonia, ensuring the authenticity of the original varieties in related quality standard research. It can be used in related fields such as variety identification and genetic resource analysis, realizing the traceability of variety uniqueness, and providing reliable technical support for the identification of genuine and counterfeit medicinal materials, the traceability of authentic medicinal materials, and the identification of germplasm purity.

[0019] This invention utilizes SSR molecular marker technology to study Mahonia, establishing molecular identification codes for Mahonia broadleaf, Mahonia long-column, and Mahonia small-fruited varieties. The results are characterized by strong site specificity, high specificity, and good reproducibility, laying the foundation for genetic map construction and markers of superior traits. This is of great significance for promoting the improvement of Mahonia varieties and the breeding of superior new varieties.

[0020] The method for identifying Mahonia species established in this invention has good repeatability, clear bands, stable amplification, high standardization, and wide applicability. It can be used to identify Mahonia samples from different origins, growth years, and processing methods. It can accurately and quickly distinguish closely related varieties and easily confused germplasms, and is suitable for large-scale testing and quality control applications. Attached Figure Description

[0021] Figure 1 This is an acrylamide gel electrophoresis image of the PCR products, where M is the Ladder H1 (100~1000bp) DNA Marker, 1-2 are long-column Mahonia, 3-4 are small-fruited Mahonia, 5-6 are narrow-leaved Mahonia, 7-8 are broad-leaved Mahonia, 9-10 are broad-bracted Mahonia, and N is the blank control.

[0022] Figure 2This is an agarose gel electrophoresis image of PCR products. A is SSR078, B is SSR264, M is Ladder H1 (100~1000bp) DNA Marker, 1-2 are long-column Mahonia, 3-4 are small-fruited Mahonia, 5 is narrow-leaved Mahonia, 6-7 are broad-leaved Mahonia, 8 is broad-bracted Mahonia, and N is the blank control.

[0023] Figure 3 These are agarose gel electrophoresis images of PCR products after different denaturation temperatures. M is the Ladder H1 (100~1000bp) DNA Marker; 1 is the long-column Mahonia; 2 is the small-fruited Mahonia; 3 is the narrow-leaved Mahonia; 4 is the broad-leaved Mahonia; 5 is the broad-bracted Mahonia; N is the blank control; A1 is SSR040; A2 is SSR074; A3 is SSR085); B1 is SSR053; B2 is SSR075; B3 is SSR078.

[0024] Figure 4 These are agarose gel electrophoresis images of PCR products after different denaturation times. M is the Ladder H1 (100~1000bp) DNA Marker; 1 is the long-column Mahonia; 2 is the small-fruited Mahonia; 3 is the narrow-leaved Mahonia; 4 is the broad-leaved Mahonia; 5 is the broad-bracted Mahonia; N is the blank control; A1 is SSR040; A2 is SSR074; A3 is SSR085); B1 is SSR053; B2 is SSR075; B3 is SSR078.

[0025] Figure 5 These are agarose gel electrophoresis images of PCR products after different annealing temperatures. M represents the Ladder H1 (100~1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; 5 represents the broad-bracted Mahonia; N represents the blank control; A1 represents SSR040; A2 represents SSR074; A3 represents SSR085); B1 represents SSR053; B2 represents SSR075; B3 represents SSR078.

[0026] Figure 6 These are agarose gel electrophoresis images of PCR products after different annealing times. M is the Ladder H1 (100~1000bp) DNA Marker; 1 is the long-column Mahonia; 2 is the small-fruited Mahonia; 3 is the narrow-leaved Mahonia; 4 is the broad-leaved Mahonia; 5 is the broad-bracted Mahonia; N is the blank control; A1 is SSR040; A2 is SSR074; A3 is SSR085; B1 is SSR053; B2 is SSR075; B3 is SSR078.

[0027] Figure 7These are agarose gel electrophoresis images of PCR products at different extension times. M is the Ladder H1 (100~1000bp) DNA Marker; 1 is the long column Mahonia; 2 is the small fruit Mahonia; 3 is the narrow leaf Mahonia; 4 is the broad leaf Mahonia; 5 is the broad bract Mahonia; N is the blank control; A1 is SSR040; A2 is SSR074; A3 is SSR085; B1 is SSR053; B2 is SSR075; B3 is SSR078.

[0028] Figure 8 These are agarose gel electrophoresis images of PCR products after different cycle numbers. M is the Ladder H1 (100~1000bp) DNA Marker; 1 is the long column Mahonia; 2 is the small-fruited Mahonia; 3 is the narrow-leaved Mahonia; 4 is the broad-leaved Mahonia; 5 is the broad-bracted Mahonia; N is the blank control; A1 is SSR040; A2 is SSR074; A3 is SSR085); B1 is SSR053; B2 is SSR075; B3 is SSR078.

[0029] Figure 9 These are agarose gel electrophoresis images of PCR products from different Taq enzyme species. M is the Ladder H1 (100~1000bp) DNA Marker; 1 is the long-column Mahonia; 2 is the small-fruited Mahonia; 3 is the narrow-leaved Mahonia; 4 is the broad-leaved Mahonia; 5 is the broad-bracted Mahonia; N is the blank control; A1 is SSR040; A2 is SSR074; A3 is SSR085; B1 is SSR053; B2 is SSR075; B3 is SSR078.

[0030] Figure 10 This study investigated the specificity of primers used for identifying Mahonia longifolia and its closely related species. A was SSR078, M was the Ladder H1 (100-1000bp) DNA Marker, 1-15 were Mahonia longifolia (Z1-15), G1-3 were Mahonia microcarpa, X1-2 were Mahonia slender-leaved, B1-2 were Mahonia broad-bracted, K1-3 were Mahonia thunbergii, and N was the blank control. B was SSR264, M was the Ladder H1 (100-1000bp) DNA Marker, 1-15 were Mahonia longifolia (Z1-15), G1-3 were Mahonia microcarpa, X1-2 were Mahonia slender-leaved, B1-2 were Mahonia broad-bracted, K1-3 were Mahonia thunbergii, and N was the blank control.

[0031] Figure 11Specificity of primers for identifying Mahonia simonii and its closely related species was investigated. A was SSR074; B was SSR26085; M was Ladder H1 (100~1000bp) DNA Marker; 1-15 were Mahonia simonii (G1~15); 16-18 were Mahonia longifolia; 19-21 were Mahonia simonii; 22-23 were Mahonia slender-leaved; 24-26 were Mahonia broad-bracted; 27-29 were Mahonia broad-leaved; N was the blank control.

[0032] Figure 12 This study investigated the applicability of specific primers for identifying Mahonia longifolia and its closely related species. A was SSR078, B was SSR264, M was the Ladder H1 (100-1000bp) DNA Marker, 1-67 were Mahonia longifolia (Z1-67), G1-3 were Mahonia microcarpa, X1-2 were Mahonia slender-leaved, B1-3 were Mahonia broad-bracted, K1-3 were Mahonia thunbergii, and N was the blank control.

[0033] Figure 13 This study investigated the applicability of specific primers for identifying Mahonia simonii and its closely related species. A was SSR074; B was SSR26085; M was the Ladder H1 (100-1000bp) DNA Marker; 1-3 were Mahonia simonii long-column (Z1, Z6, Z10); 4-22 were 19 batches of Mahonia simonii adulterants (W1-19); 23-25 ​​were Mahonia simonii small-fruited (G1, G5, G9); 26-27 were Mahonia simonii narrow-leaved (X1-2); 28-30 were Mahonia simonii broad-leaved (K1-3); 31-33 were Mahonia simonii broad-bracted (B1-3); N was the blank control. Detailed Implementation

[0034] The specific embodiments of the present invention will be further described below with reference to the accompanying drawings. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of protection of the present invention.

[0035] The present invention provides an SSR molecular marker primer set for the genus Mahonia, wherein the forward primer sequence of the SSR molecular marker primer set comprises a sequence as shown in any one of SEQ ID NO:1-7 or a sequence as shown in any one of SEQ ID NO:1-7; The reverse primer sequence of the SSR molecular marker primer set includes a sequence as shown in any one of SEQ ID NO:8-14 or a sequence as shown in any one of SEQ ID NO:8-14.

[0036] For example, the sequence of SEQ ID NO:1 is as follows: CAAATGCCGGTCCTCTGATAGA The sequence of SEQ ID NO:2 is as follows: TGCTTCCGTGCTTTGGTTATTT The sequence of SEQ ID NO:3 is as follows: GCAGAGTACCGTCGCCTATTT The sequence of SEQ ID NO:4 is as follows: GCTACTCTGCGGTGGATTAA The sequence of SEQ ID NO:5 is as follows: ACTCCTAAACCGCCGACTATAA The sequence of SEQ ID NO:6 is as follows: CTTCCTGTTTAGTCCCGAAAGT The sequence of SEQ ID NO:7 is as follows: ACTCCTAAACCGCCGACTATAA The sequence of SEQ ID NO:8 is as follows: AGTCCGTAGCGTCTACCAATTT The sequence of SEQ ID NO:9 is as follows: GGGGAGCTGGCTTAGACAAAAT The sequence of SEQ ID NO:10 is as follows: CTTCCTGTTTAGTCCCGAAAGT The sequence of SEQ ID NO:11 is as follows: TCTTTGTAGGAGAGGGGATAAA The sequence of SEQ ID NO:12 is as follows: TGAGACTCATGACGTGCTTTGT The sequence of SEQ ID NO:13 is as follows: GCAGAGTACCGTCGCCTATTT The sequence of SEQ ID NO:14 is as follows: GAGACTCATGACGTGCTTTGTA In some embodiments, the SSR molecular marker primer set is selected from any of the following: the forward primer sequence comprises the sequence shown in SEQ ID NO:1 or the sequence shown in SEQ ID NO:1 and the reverse primer sequence comprises the sequence shown in SEQ ID NO:8 or the sequence shown in SEQ ID NO:8; The forward primer sequence contains the sequence shown in SEQ ID NO:2 or the sequence shown in SEQ ID NO:2, and the reverse primer sequence contains the sequence shown in SEQ ID NO:9 or the sequence shown in SEQ ID NO:9; The forward primer sequence includes the sequence shown in SEQ ID NO:3 or the sequence shown in SEQ ID NO:3, and the reverse primer sequence includes the sequence shown in SEQ ID NO:10 or the sequence shown in SEQ ID NO:10. The forward primer sequence includes the sequence shown in SEQ ID NO:4 or the sequence shown in SEQ ID NO:4, and the reverse primer sequence includes the sequence shown in SEQ ID NO:11 or the sequence shown in SEQ ID NO:11. The forward primer sequence comprises the sequence shown in SEQ ID NO:5 or the sequence shown in SEQ ID NO:5, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:12 or the sequence shown in SEQ ID NO:12. The forward primer sequence comprises the sequence shown in SEQ ID NO:6 or the sequence shown in SEQ ID NO:6, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:13 or the sequence shown in SEQ ID NO:13; and The forward primer sequence includes the sequence shown in SEQ ID NO:7 or the sequence shown in SEQ ID NO:7, and the reverse primer sequence includes the sequence shown in SEQ ID NO:14 or the sequence shown in SEQ ID NO:14.

[0037] In some specific embodiments, the SSR molecular marker primer set is selected from any one of the following: the forward primer sequence as shown in SEQ ID NO:1 and the reverse primer sequence as shown in SEQ ID NO:8, and the primer set number is SSR040; The forward primer sequence is shown in SEQ ID NO:2 and the reverse primer sequence is shown in SEQ ID NO:9. The primer set number is SSR053. The forward primer sequence is shown in SEQ ID NO:3 and the reverse primer sequence is shown in SEQ ID NO:10. The primer set number is SSR074. The forward primer sequence is shown in SEQ ID NO:4 and the reverse primer sequence is shown in SEQ ID NO:11. The primer set number is SSR075. The forward primer sequence is shown in SEQ ID NO:5 and the reverse primer sequence is shown in SEQ ID NO:12. The primer set number is SSR078. The forward primer sequence is shown in SEQ ID NO:6, and the reverse primer sequence is shown in SEQ ID NO:13; the primer set number is SSR085; and The forward primer sequence is shown in SEQ ID NO:7 and the reverse primer sequence is shown in SEQ ID NO:14. The primer set number is SSR264.

[0038] This invention provides a kit comprising the SSR molecular marker primer set described above. This invention also provides a DNA molecular identity card comprising the SSR molecular marker primer set described above.

[0039] This application provides a method for screening the SSR molecular marker primer set described above, comprising: DNA was extracted from the Mahonia genus. Using chloroplast genome data from the genus Mahonia, SSR loci were obtained, including chloroplast genome sequence number PX869754. SSR primers were designed based on SSR sites, synthesized, and then the obtained DNA was used to perform PCR amplification of the SSR primers followed by electrophoresis to screen and obtain the SSR molecular marker primer set.

[0040] The present invention uses the method described above to obtain an SSR molecular marker primer set.

[0041] This invention provides a method for identifying varieties of the genus Mahonia, the method comprising: using the DNA of the Mahonia variety to be tested as a template, performing PCR amplification using the SSR molecular marker primer set described above, detecting the PCR amplification products by electrophoresis, obtaining the pattern of the Mahonia variety to be tested, and identifying the variety.

[0042] In some implementations, SSR40 can be used to identify broadleaf Mahonia; SSR53, SSR75, SSR78 and SSR264 can be used to identify long-columnar Mahonia; SSR74 and SSR85 can be used to identify small-fruited Mahonia.

[0043] In some embodiments, the PCR amplification program is as follows: denaturation at 93-96°C for 20-35 seconds, annealing at 52-61°C for 25-40 seconds, extension at 72°C for 25-40 seconds, PCR cycles of 28-34, and the Taq enzyme is 2×M5 Taq PCR Mix, 2×FidCycle Evo High-Fidelity PCR Master Mix, 2×SanTaq Fast PCR Mix, 2×TransFast Taq PCR, or 2×Taq PCR Master Mix; Preferably, the PCT amplification program is 95°C denaturation for 30s, 55°C annealing for 25s, 72°C extension for 30s, for 34 cycles, and the Taq enzyme is 2×FidCycle Evo high-fidelity PCR Master Mix.

[0044] For example, denaturation at 93°C, 94°C, 95°C, 96°C for 20s, 21s, 22s, 23s, 24s, 25s, 26s, 27s, 28s, 29s, 30s, 31s, 32s, 33s, 34s, 35s, etc., and annealing at 52°C, 53°C, 54°C, 55°C, 56°C, 57°C, 58°C, 59°C, 60°C, 61°C for 25s, 26s, 27s, 2... 8s, 29s, 30s, 31s, 32s, 33s, 34s, 35s, 36s, 37s, 38s, 39s, 40s, etc., extended at 72°C for 25s, 26s, 27s, 28s, 29s, 30s, 31s, 32s, 33s, 34s, 35s, 36s, 37s, 38s, 39s, 40s, etc., and PCR cycles were performed 28, 29, 30, 31, 32, 33, 34, etc.

[0045] In some embodiments, the electrophoretic detection is agarose gel electrophoresis, polyacrylamide gel electrophoresis, or / and capillary electrophoresis.

[0046] This application provides for any of the following applications of the SSR molecular marker primer set, the kit described above, or the DNA molecular identity card described above: A1) Application in the genetic diversity analysis of the ten Mahonia genera; A2) Application in the resource diversity analysis of the ten major varieties of Mahonia; A3) Application of the analysis of kinship among the ten great merits; A4) Application in the identification of ten varieties of the *Mahonia* genus; and A5) Application in constructing genetic maps or DNA fingerprint maps of the Mahonia genus.

[0047] In this application, the above-described applications are all operated using methods conventional in the art.

[0048] The present invention will be further illustrated below with a representative embodiment. Example

[0049] 1. Experimental Objective The genus *Mahonia* is widely distributed and contains many species, making identification challenging. With constantly changing growing environments, traditional morphological identification methods alone are insufficient to accurately identify species under conditions of no flowering or fruiting, hindering research on traditional Chinese medicine (TCM) granules. To ensure the accuracy of the source of medicinal materials for TCM granules, DNA molecular identification studies were conducted on five species of the genus *Mahonia* with identified sources: *Mahonia duclouxiana* Gagnep., *Mahonia bodinieri* Gagnep., *Mahonia eurybracteata* Fedde, *Mahonia fortunei* (Lindl.) Fedde, and *Mahonia bealei* (Fort.) Carr.

[0050] 2. Experimental materials and equipment 2.1 The experimental materials and reagents are shown in Table 1 and Table 2.

[0051]

[0052]

[0053]

[0054]

[0055] 3. Methods Simple sequence repeats (SSRs) are widely recognized as powerful and informative molecular markers in crop variety and species identification research. This study developed universal SSR primers for the *Mahonia* genus using chloroplast genome sequencing data from *Mahonia longifolia*. The developed SSR primers were screened using extracted total DNA to create universal SSR marker primers for identifying *Mahonia longifolia* species.

[0056] 3.1 Template DNA Extraction Wipe the surface of *Mahonia longicornis* leaves and closely related species with 75% ethanol, allow to air dry, and place approximately 90 mg of fresh or 30 mg of dried sample in a mortar. Add appropriate amounts of silica and polyvinylpyrrolidone, and liquid nitrogen. Grind thoroughly into powder and place in a 2.0 ml centrifuge tube. Following the instructions of the DNAsercure Novel Plant Genomic DNA Extraction Kit, extract total DNA from the sample: add 400 μL and 6 μL of... RNase A (10 mg / ml), vortex for 1 minute, incubate at room temperature for 10 minutes; add 130 μL of buffer LP2, mix thoroughly, vortex for 1 minute, centrifuge at 12,000 rpm for 5 minutes, transfer the supernatant to a new centrifuge tube; add 1.5 times the volume of buffer LP3, immediately vortex thoroughly for 15 seconds, add all the above solutions to an adsorption column CB3 (place the adsorption column in a collection tube), centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid; place the adsorption column CB3 in a collection tube, and add the adsorption column CB3... Add 600 μL of wash buffer PW, centrifuge at 12,000 rpm for 30 seconds, and discard the waste liquid; place the adsorption column CB3 into the collection tube, centrifuge at 12,000 rpm for 2 minutes, discard the waste liquid, transfer the adsorption column CB3 into a clean centrifuge tube, and let it stand at room temperature for several minutes to completely dry any residual wash buffer in the adsorption material; add 50-200 μL of elution buffer TE dropwise to the middle of the adsorption membrane, let it stand at room temperature for 2-5 minutes, centrifuge at 12,000 rpm for 2 minutes, and collect the solution into a centrifuge tube to obtain the template DNA solution.

[0057] 3.2 Primer Design and Screening Using the chloroplast genome data of *Mahonia longifolia* (sequence number: PX869754), SSR loci were obtained. Using Primer 5.0 software, SSR primers for *Mahonia longifolia* were designed, resulting in 289 pairs of SSR primers. 291 primer pairs were synthesized, including the 289 SSR primer pairs and 2 universal primer pairs (ITS2, psbA-trnH). PCR amplification was performed on the 289 synthesized primer pairs, and primers specific to *Mahonia longifolia* were selected by 1.0% agarose gel electrophoresis or polyacrylamide gel electrophoresis. The primers were synthesized by Wuhan Jinkairui Biotechnology Co., Ltd.

[0058] 3.3 PCR Amplification The PCR amplification system and amplification procedure are shown in Table 3:

[0059] 3.3 Electrophoresis detection 3.3.1 Agarose gel electrophoresis The gel concentration was 1.0%. Weigh 1.0 g of agarose and add it to 100 mL of 1×TAE electrophoresis buffer. Heat the buffer in a microwave oven until completely melted. Add 4S Geen Plus non-toxic nucleic acid dye to the gel. Pour the gel into a casting tank, insert the sample comb, and wait for it to cool and solidify. Gently pull out the sample comb vertically upwards to load the samples. The loading volume for PCR amplification products is 8 μl, and the loading volume for the DNA molecular weight standard LadderH1 (100~1000 bp) is 8 μl. After electrophoresis, examine the gel slide on a gel imaging system.

[0060] 3.3.2 Polyacrylamide gel electrophoresis 3.3.2.1 Glue preparation and sample loading Prepare 8% gel in advance for later use. The amount of gel needed for one gel is 30mL + 300μL AWS + 30μL TEMED.

[0061] Place the cleaned glass panel and ear plate face up on the balance plate. Add a small amount of anhydrous ethanol. Wipe the panel and ear plate with clean, crease-free filter paper. Place the cleaned and dried seal strips on both sides of the panel. Invert the ear plate and place it on top of the panel. Clip the glass plate to both sides. Pour in the pre-prepared 8.0% PAGE gel solution (30ml / plate; in summer, generally add 200μl of 10% APS and 20μl of TEMED; in winter, generally add 300μl of 10% APS and TEMED). 30 μL of gel was added, and the glass plate was filled with gel solution. The Great Wall toothed comb was inserted into the groove of the glass plate and allowed to solidify. After solidification, the clamp was removed, and the surface of the gel plate was cleaned. The gel plate was then fixed to the electrophoresis tank with clamps. 0.5×TBE electrophoresis buffer was poured in until it covered the sample wells, and the sample comb was gently removed. The working environment was set to 380V, 100mA, and 30W per plate. After setup, samples were loaded: 0.5 μL of PCR product and 1.5 μL of DNA molecular weight standard Ladder H1 (100~1000bp). After loading, the electrophoresis parameters were set to 110V, 110mA, 300W, and 4h. (Note: The voltage for each gel during electrophoresis should be 50-60V; the voltage should be calculated based on the number of gels used.) 3.3.2.2 Silver staining After electrophoresis, remove the film and perform the following silver staining procedure: Fixative: 400 mL purified water + 40 mL ethanol + 2 mL acetic acid, shake for 10 mins, wash once with purified water; Silver staining solution: 400mL purified water + 4mL 20% silver nitrate, shake for 10mins, wash once with purified water; Decolorizing solution: 400mL purified water + 80μL 10% sodium thiosulfate, shake for 30 seconds, wash once with purified water; Developer: 400mL purified water + 40mL 15% sodium hydroxide + 2mL formaldehyde, develop for 8-12 minutes.

[0062] After silver staining, discard the developing solution, gently rinse twice with purified water, place the film in purified water, remove it and place it on a film observation lamp to observe the results, and take photos with a mobile phone to record them.

[0063] 3.4 Determination of PCR Identification Conditions After selecting the primers, approximately 90 mg of fresh samples of *Mahonia longifolia* (C1), *Mahonia smallifolia* (G1), *Mahonia stenoptera* (X1), *Mahonia broadleaf* (K1), and *Mahonia scabra* (B1) were weighed. The weighed fresh samples were placed in a mortar, quick-frozen with liquid nitrogen, and then silica was added. The samples were manually ground into a fine powder. The ground samples were placed in centrifuge tubes on crushed ice. Following the instructions of the DNAsercure novel plant genomic DNA extraction kit, total DNA was extracted from the samples. The nucleic acid concentration of the obtained total DNA solution was measured using a micro-spectrophotometer, and the solution was stored at -20°C for later use.

[0064] The following parameters were used to investigate the optimal amplification conditions for PCR identification using DNA samples of *Mahonia fortunei* and closely related species extracted from long-column samples: ① Denaturation temperature: 93, 94, 95, 96℃; ② Denaturation time: 20, 25, 30, 35s; ③ Annealing temperature: 52, 55, 58, 61℃; ④ Annealing time: 25, 30, 35, 40s; ⑤ Extension time: 25, 30, 35, 40s; ⑥ PCR cycle number: 28, 30, 32, 34 times; ⑦ Taq enzyme type: 2×Tap RCR Mix DNA polymerase, 2×SanTaq Fast PCRMix DNA polymerase, 2×M5Taq PCR Mix DNA polymerase, 2×TransFast Taq PCR Mix DNA polymerase, 2×FidCycle Evo high-fidelity PCR Master Mix DNA polymerase. Detection was performed using 1.0% agarose gel electrophoresis, selecting parameters that resulted in successful amplification, bright and clear bands, and good amplification effect.

[0065] 3.5 Specificity Examination Using conventional methods in the field, under defined PCR identification conditions, more than 10 batches of long-column Mahonia and closely related species were amplified with the selected specific identification primers to determine their intraspecific variation range and verify the specificity of the method. The PCR products were detected by 1.0% agarose gel electrophoresis.

[0066] 3.6 Applicability Assessment Using conventional methods in the field, under defined PCR identification conditions, more than 20 batches of long-column Mahonia and closely related species were amplified with the selected specific identification primers to ensure the applicability of PCR identification. The PCR products were detected by 1.0% agarose gel electrophoresis.

[0067] 4 Results 4.1 SSR Primer Screening Through screening, seven SSR primer pairs with significant differences were selected from 289 primer pairs: SSR040, SSR053, SSR074, SSR075, SSR078, SSR085, and SSR264. Electrophoresis results show that SSR40 can be used to identify *Mahonia spp.* (broadleaf variety); while SSR53, SSR75, SSR78, and SSR264 can be used to identify *Mahonia spp.* (long-columnar variety); and SSR74 and SSR85 can be used to identify *Mahonia spp.* (small-fruited variety). See [link to relevant documentation] for details. Figure 1 and Figure 2 Among them Figure 1 In the middle, M: Ladder H1 (100~1000bp) DNA Marker; 1-2: Long-column Mahonia; 3-4: Small-fruited Mahonia; 5-6: Narrow-leaved Mahonia; 7-8: Broad-leaved Mahonia; 9-10: Broad-bracted Mahonia; N: Blank control; Figure 2 In the table below, A: SSR078; B: SSR264; M: Ladder H1 (100~1000bp) DNA Marker; 1-2: Long-column Mahonia; 3-4: Small-fruited Mahonia; 5: Narrow-leaved Mahonia; 6-7: Broad-leaved Mahonia; 8: Broad-bracted Mahonia; N: Blank control. Primer sequence information is shown in Table 4. Six primer pairs, namely SSR040, SSR053, SSR074, SSR075, SSR078, and SSR085, were selected for PCR identification condition investigation.

[0068]

[0069] 4.2 Determination of PCR identification conditions and robustness study 4.2.1 Investigation at different denaturation temperatures The designed denaturation temperature was 93–96 °C. PCR amplification results showed that at 96 °C, all six primer pairs amplified successfully with bright bands. However, at 93 °C, primers SSR053(B1) and SSR075(B2) showed no target bands. At 94 °C and 96 °C, the band of SSR075(B2) was relatively faint. See details. Figure 3 Among them Figure 3In the diagram, M represents the Ladder H1 (100-1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; and 5 represents the broad-bracted Mahonia. N represents the blank control; A (A1: SSR040; A2: SSR074; A3: SSR085); and B (B1: SSR053; B2: SSR075; B3: SSR078). Therefore, 95℃ was selected as the optimal denaturation temperature for PCR amplification of Mahonia leaves.

[0070] 4.2.2 Investigation of different denaturation times The denaturation times were designed to be 20s, 25s, 30s, and 35s. PCR amplification results showed that all six primer pairs successfully amplified the target bands at denaturation times of 25s-35s. However, at 20s denaturation, the target bands of primer pairs SSR053(B1) and SSR078(B3) were diffuse, while the target band of SSR075(B2) was faint. At 35s, the corresponding DNA bands of primer pairs SSR074(A2), SSR085(A3), and SSR075(B2) were faint. Compared to 25s, the target bands of each primer were relatively bright and clear at 30s. See details. Figure 4 Among them Figure 4 In the diagram, M represents the Ladder H1 (100-1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; and 5 represents the broad-bracted Mahonia. N represents the blank control; A (A1: SSR040; A2: SSR074; A3: SSR085); and B (B1: SSR053; B2: SSR075; B3: SSR078). Therefore, 30 seconds was selected as the optimal denaturation time for PCR amplification of Mahonia leaves.

[0071] 4.2.3 Investigation of different annealing temperatures The designed annealing temperatures were 52℃, 55℃, 58℃, and 61℃. PCR amplification results showed that the target bands were visible at all four annealing temperatures. However, at 52℃, the target bands for primers SSR074 (A2) and SSR085 (A3) were fainter; at 61℃, the target band for primer SSR075 (B2) was also fainter. Compared to 52℃, at 55℃ and 58℃, all six primer pairs showed clear and bright target bands, and there was no significant difference in the bands between the two annealing temperatures. See details. Figure 5 Among them Figure 5In the diagram, M represents the Ladder H1 (100-1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; 5 represents the broad-bracted Mahonia; N represents the blank control; A (A1: SSR040; A2: SSR074; A3: SSR085); B (B1: SSR053; B2: SSR075; B3: SSR078). Considering energy consumption, time cost, and instrument heating time, 55℃ was selected as the optimal annealing temperature for PCR amplification of Mahonia leaves.

[0072] 4.2.4 Investigation of different annealing times The designed annealing times were 25s, 30s, 35s, and 40s. PCR amplification results showed that the target band was visible at all four annealing times. At 25s, 30s, and 35s, there was no significant difference between the primer bands, but the target band for SSR075(B2) at 40s was fainter than at the other three times. At 35s, the band was clearer, as observed in printed results. See details. Figure 6 Among them Figure 6 In the diagram, M represents the Ladder H1 (100-1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; and 5 represents the broad-bracted Mahonia. N represents the blank control; A (A1: SSR040; A2: SSR074; A3: SSR085); and B (B1: SSR053; B2: SSR075; B3: SSR078). Considering energy consumption, time cost, and instrument heating time, 25 seconds was selected as the optimal annealing time for the Mahonia leaf PCR identification method. After further screening of the optimal amplification parameters, a comparative experiment was conducted between the two annealing times to verify and select the optimal annealing time.

[0073] 4.2.5 Examination of different extension times The designed extension times were 25s, 30s, 35s, and 40s. PCR amplification results showed that at a 25s extension time, no target band was observed with any of the five primer pairs, and the target band of SSR053(B1) was faint and difficult to see. At 30s and 35s, clear target bands were visible with all primer pairs, but at a 30s extension time, the target bands of all six primer pairs were clearer and brighter. At a 40s extension time, the target band of SSR075(B2) was fainter compared to the other primer pairs. See details. Figure 7 Among them Figure 7In the diagram, M represents the LadderH1 (100-1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; 5 represents the broad-bracted Mahonia; N represents the blank control; A represents (A1: SSR040; A2: SSR074; A3: SSR085); and B represents (B1: SSR053; B2: SSR075; B3: SSR078). Therefore, 30 seconds was chosen as the optimal extension time for the PCR identification method of Mahonia leaves.

[0074] 4.2.6 Examination of different number of iterations The design cycle numbers were 28, 30, 32, and 34. PCR amplification results showed that the target bands were visible at all four cycle numbers. At cycle number 28, the bands of primer pairs SSR074 (A2) and SSR085 (A3) were faint. At cycles 30 and 32, the target bands of the six primer pairs showed no significant difference, but at cycle number 30, the target band of SSR078 (B3) was brighter. Compared to the other three cycle number conditions, the target bands of all six primer pairs were generally clearer and brighter at cycle number 34. See details. Figure 8 Among them Figure 8 In the diagram, M represents the Ladder H1 (100-1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; and 5 represents the broad-bracted Mahonia. N represents the blank control; A (A1: SSR040; A2: SSR074; A3: SSR085); and B (B1: SSR053; B2: SSR075; B3: SSR078). A cycle count of 34 was selected as the optimal number of PCR amplification cycles for the Mahonia leaf PCR identification method.

[0075] 4.2.7 Investigation of different types of Taq enzymes Five DNA polymerases were selected for evaluation: 2×M5 Taq PCR Mix, 2×FidCycleEvo High-Fidelity PCR Master Mix, 2×San TaqFast PCR Mix, 2×TransFastTaq PCR, and 2×Taq PCR Master Mix. The band brightness of the products amplified by the PCR reaction of different Taq enzymes showed certain differences.

[0076] Under the action of 2×San Taq Fast PCR Mix enzyme, the target bands of primers SSR074 (A2), SSR085 (A3), and SSR075 (B2) were relatively faint. Under the action of 2×TransFast Taq PCR enzyme, except for the target bands of primers SSR040 (A1) and SSR078 (B3) which were relatively bright, the target bands of the other four primer pairs were relatively faint, showing the worst amplification effect compared with the other four DNA polymerases. Under the action of 2×Taq PCR enzyme, the band of SSR075 (B2) was faint, and the band of the long column of SSR078 (B3) was also faint. However, under the action of 2×M5 Taq PCR... Under the action of the Mix enzyme, double bands appeared in SSR075 (B2) for *Mahonia simonii* (2), *Mahonia simonii* (3), *Mahonia simonii* (4), and *Mahonia simonii* (5), which may be due to mixed bands. However, under the action of the 2×FidCycleEvo high-fidelity PCR Master Mix enzyme, the target bands of all six primer pairs were clearly visible and bright. Compared with the 2×M5 Taq PCR Mix enzyme, the target band of SSR078 (B3) was brighter, indicating better overall amplification. See detailed results figures below. Figure 9 Among them Figure 9 In the diagram, M represents the Ladder H1 (100-1000bp) DNA Marker; 1 represents the long-column Mahonia; 2 represents the small-fruited Mahonia; 3 represents the narrow-leaved Mahonia; 4 represents the broad-leaved Mahonia; and 5 represents the broad-bracted Mahonia. N represents the blank control; A (A1: SSR040; A2: SSR074; A3: SSR085); and B (B1: SSR053; B2: SSR075; B3: SSR078). The 2×FidCycleEvo high-fidelity PCR Master Mix enzyme was selected as the optimal DNA polymerase for PCR amplification of Mahonia leaf molecular identification.

[0077] 4.2.8 Determination of PCR identification conditions Based on the results of the denaturation temperature and time, annealing temperature and time, extension time, number of cycles, and Taq enzyme type, considering factors such as energy consumption, time cost, and instrument heating time, the PCR identification conditions for long-column Mahonia were determined. The reaction system consisted of 10 μL of 2×FidCycle Evo high-fidelity PCR Master Mix, 0.6 μL of identification primers, 1.0 μL of DNA template, and 9.0 μL of sterile double-distilled water. The PCR reaction program included: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 25 s, 72℃ extension for 30 s (34 cycles); and 72℃ extension for 7 min.

[0078] 4.3 Specificity Examination 4.3.1 Examination of the Exclusivity of the Ten Merits of the Long Column Specificity studies were conducted on 15 batches of *Mahonia longicornis*, 3 batches of *Mahonia microcarpa*, 2 batches of *Mahonia stenoptera*, 2 batches of *Mahonia stenoptera*, and 3 batches of *Mahonia stenoptera*. Amplification was performed using two pairs of SSR-specific primers, SSR078 and SSR264. Target bands were amplified at 200–300 bp, and a second band was observed at approximately 100–200 bp. Closely related species did not show corresponding bands at these two positions. (See...) Figure 10 Among them Figure 10 In the study, A: SSR078; B: SSR264; M: Ladder H1 (100~1000bp) DNA Marker; 1-15: Long-column Mahonia (Z1~15); G1~3: Small-fruited Mahonia; X1~2: Narrow-leaved Mahonia; B1~2: Broad-bracted Mahonia; K1~3: Broad-leaved Mahonia; N: Blank control.

[0079] 4.3.2 Examination of the Exclusivity of the Ten Merits of the Small Fruit Specificity studies were conducted on 15 batches of *Mahonia simonii* (small-fruited variety), 3 batches of *Mahonia simonii* (long-columned variety), 2 batches of *Mahonia simonii* (narrow-leaved variety), 3 batches of *Mahonia simonii* (broad-bracted variety), and 3 batches of *Mahonia simonii* (broad-leaved variety). Amplification was performed using two pairs of SSR-specific primers, SSR074 and SSR085. Target bands were amplified at positions 100–200 bp, while closely related species did not show corresponding bands at these positions. (See...) Figure 11 Among them Figure 11 In the table, A: SSR074; B: SSR26085; M: Ladder H1 (100~1000bp) DNA Marker; 1-15: Small-fruited Mahonia (G1~15); 16~18: Long-columned Mahonia; 19~21: Small-fruited Mahonia; 22~23: Narrow-leaved Mahonia; 24~26: Broad-bracted Mahonia; 27~29: Broad-leaved Mahonia; N: Blank control.

[0080] 4.4 Applicability Assessment 4.4.1 Applicability Assessment of the Ten Merits of Long Column The applicability of this method was verified by PCR amplification and electrophoresis detection using primers SSR078 and SSR264 on 67 batches of *Mahonia longifolia*, 3 batches of *Mahonia microcarpa*, 2 batches of *Mahonia stenoptera*, 3 batches of *Mahonia scabra*, and 3 batches of *Mahonia scabra*. The results showed that using the *Mahonia longifolia*-specific primers to amplify all samples yielded a specific identification band of approximately 250–300 bp for *Mahonia longifolia*, but closely related species did not show consistent bands at the corresponding positions, and the blank control showed no band. In conclusion, the two pairs of specific primers SSR078 and SSR264 can accurately identify *Mahonia longifolia* and its closely related species. (See...) Figure 12Among them Figure 12 In the table, A: SSR078; B: SSR078; M: Ladder H1 (100~1000bp) DNA Marker; 1-67: Long-column Mahonia (Z1~67); G1~3: Small-fruited Mahonia; X1~2: Narrow-leaved Mahonia; B1~3: Broad-bracted Mahonia; K1~3: Broad-leaved Mahonia; N: Blank control.

[0081] 4.4.1 Applicability Assessment of the Ten Merits of Small Fruit Nineteen batches of adulterants of *Mahonia fortunei*, three batches of *Mahonia simonii*, three batches of *Mahonia longicornis*, two batches of *Mahonia slender-leaved*, three batches of *Mahonia broadbreade*, and three batches of *Mahonia thunbergii* were amplified by PCR using primers SSR074 and SSR085, followed by electrophoretic detection to verify the applicability of this method. The results showed that using the *Mahonia simonii*-specific primers to amplify all samples yielded specific identification bands of approximately 100–200 bp for *Mahonia simonii*. Among the adulterants, three batches of *Mahonia simonii* showed specific identification bands at the same positions, but closely related species did not show consistent bands at the corresponding positions. The blank control showed no band. In conclusion, the two pairs of specific primers SSR074 and SSR085 can accurately identify *Mahonia simonii* and its closely related species. See [link to relevant documentation]. Figure 13 Among them Figure 13 In the study, A: SSR074; B: SSR26085; M: Ladder H1 (100~1000bp) DNA Marker; 1-3: Long-column Mahonia (Z1, Z6, Z10); 4-22: 19 batches of Mahonia adulterants (W1~19); 23-25: Small-fruited Mahonia (G1, G5, G9); 26-27: Narrow-leaved Mahonia (X1~2); 28-30: Broad-leaved Mahonia (K1~3); 31-33: Broad-bracted Mahonia (B1~3); N: Blank control.

[0082] The above embodiments are only intended to explain the present invention in more detail and to make it easier for those skilled in the art to understand the present invention, and are not intended to limit the present invention. It is understood that various improvements and changes can be made to the present invention without departing from the spirit and principles of the present invention, and such improvements and changes are all within the protection scope of the present invention.

Claims

1. A set of SSR molecular marker primers for the genus Mahonia, wherein the forward primer sequence of the set of SSR molecular marker primers comprises a sequence as shown in any one of SEQ ID NO:1-7 or a sequence as shown in any one of SEQ ID NO:1-7; The reverse primer sequence of the SSR molecular marker primer set includes a sequence as shown in any one of SEQ ID NO:8-14 or a sequence as shown in any one of SEQ ID NO:8-14.

2. The SSR molecular marker primer set according to claim 1, wherein the SSR molecular marker primer set is selected from any one of the following: the forward primer sequence comprises the sequence shown in SEQ ID NO:1 or the sequence shown in SEQ ID NO:1 and the reverse primer sequence comprises the sequence shown in SEQ ID NO:8 or the sequence shown in SEQ ID NO:8; The forward primer sequence comprises the sequence shown in SEQ ID NO:2 or the sequence shown in SEQ ID NO:2, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:9 or the sequence shown in SEQ ID NO:

9. The forward primer sequence comprises the sequence shown in SEQ ID NO:3 or the sequence shown in SEQ ID NO:3, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:10 or the sequence shown in SEQ ID NO:

10. The forward primer sequence comprises the sequence shown in SEQ ID NO:4 or the sequence shown in SEQ ID NO:4, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:11 or the sequence shown in SEQ ID NO:

11. The forward primer sequence comprises the sequence shown in SEQ ID NO:5 or the sequence shown in SEQ ID NO:5, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:12 or the sequence shown in SEQ ID NO:

12. The forward primer sequence comprises the sequence shown in SEQ ID NO:6 or the sequence shown in SEQ ID NO:6, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:13 or the sequence shown in SEQ ID NO:13; and The forward primer sequence comprises the sequence shown in SEQ ID NO:7 or the sequence shown in SEQ ID NO:7, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:14 or the sequence shown in SEQ ID NO:

14.

3. The SSR molecular marker primer set according to claim 2, wherein the SSR molecular marker primer set is selected from any one of the following: the forward primer sequence as shown in SEQ ID NO:1 and the reverse primer sequence as shown in SEQ ID NO:8; The forward primer sequence is as shown in SEQ ID NO:2 and the reverse primer sequence is as shown in SEQ ID NO:9; The forward primer sequence is as shown in SEQ ID NO:3 and the reverse primer sequence is as shown in SEQ ID NO:10; The forward primer sequence is as shown in SEQ ID NO:4 and the reverse primer sequence is as shown in SEQ ID NO:11; The forward primer sequence is as shown in SEQ ID NO:5 and the reverse primer sequence is as shown in SEQ ID NO:12; The forward primer sequence comprises the sequence shown in SEQ ID NO:6 or the sequence shown in SEQ ID NO:6, and the reverse primer sequence comprises the sequence shown in SEQ ID NO:13 or the sequence shown in SEQ ID NO:13; and The forward primer sequence is as shown in SEQ ID NO:7 and the reverse primer sequence is as shown in SEQ ID NO:

14.

4. The SSR molecular marker primer set according to claim 3, wherein the forward primer sequence as shown in SEQ ID NO:1 and the reverse primer sequence as shown in SEQ ID NO:8 are used to identify Mahonia sieboldii; The forward primer sequence as shown in SEQ ID NO:2 and the reverse primer sequence as shown in SEQ ID NO:9, the forward primer sequence as shown in SEQ ID NO:4 and the reverse primer sequence as shown in SEQ ID NO:11, the forward primer sequence as shown in SEQ ID NO:5 and the reverse primer sequence as shown in SEQ ID NO:12, or the forward primer sequence as shown in SEQ ID NO:7 and the reverse primer sequence as shown in SEQ ID NO:14 are used to identify long-column Mahonia. Forward primer sequences as shown in SEQ ID NO:3 and reverse primer sequences as shown in SEQ ID NO:10 or forward primer sequences as shown in SEQ ID NO:6 and reverse primer sequences as shown in SEQ ID NO:13 are used to identify small-fruited Mahonia.

5. A kit comprising the SSR molecular marker primer set according to any one of claims 1-4.

6. A DNA molecular identity card for the ten great fruits, among which, It contains the SSR molecular marker primer set as described in any one of claims 1-4.

7. A method for screening SSR molecular marker primer sets according to any one of claims 1-4, comprising: DNA was extracted from the Mahonia genus. Using chloroplast genome data from the genus Mahonia, SSR loci were obtained, including chloroplast genome sequence number PX869754. SSR primers were designed based on SSR sites, synthesized, and then the obtained DNA was used to perform PCR amplification of the SSR primers followed by electrophoresis. The SSR molecular marker primer set was then screened to obtain the set.

8. A method for identifying species of the genus Mahonia, the method comprising: Using the DNA of the ten Mahonia varieties to be tested as templates, PCR amplification was performed using the SSR molecular marker primer set as described in any one of claims 1-4. The PCR amplification products were detected by electrophoresis to obtain the patterns of the ten Mahonia varieties to be tested, and the varieties were identified.

9. The method according to claim 7 or 8, wherein, The PCR amplification program is as follows: denaturation at 93-96°C for 20-35 seconds, annealing at 52-61°C for 25-40 seconds, extension at 72°C for 25-40 seconds, PCR cycles of 28-34, and Taq enzyme is 2×M5 Taq PCR Mix, 2×FidCycle Evo High-Fidelity PCR Master Mix, 2×San Taq Fast PCR Mix, 2×TransFast Taq PCR, or 2×Taq PCR Master Mix; Preferably, the PCT amplification program is 95°C denaturation for 30s, 55°C annealing for 25s, 72°C extension for 30s, 34 cycles, and the Taq enzyme is 2×FidCycle Evo high-fidelity PCR Master Mix.

10. The method according to claim 7 or 8, wherein, The electrophoretic detection is agarose gel electrophoresis, polyacrylamide gel electrophoresis, or / and capillary electrophoresis.

11. The method according to any one of claims 8-10, wherein the forward primer sequence as shown in SEQ ID NO:1 and the reverse primer sequence as shown in SEQ ID NO:8 are used to identify Mahonia sibirica; The forward primer sequence as shown in SEQ ID NO:2 and the reverse primer sequence as shown in SEQ ID NO:9, the forward primer sequence as shown in SEQ ID NO:4 and the reverse primer sequence as shown in SEQ ID NO:11, the forward primer sequence as shown in SEQ ID NO:5 and the reverse primer sequence as shown in SEQ ID NO:12, or the forward primer sequence as shown in SEQ ID NO:7 and the reverse primer sequence as shown in SEQ ID NO:14 are used to identify long-column Mahonia. Forward primer sequences as shown in SEQ ID NO:3 and reverse primer sequences as shown in SEQ ID NO:10 or forward primer sequences as shown in SEQ ID NO:6 and reverse primer sequences as shown in SEQ ID NO:13 are used to identify small-fruited Mahonia.

12. Any of the following applications of the SSR molecular marker primer set according to any one of claims 1-4, the kit according to claim 5, or the DNA molecular ID card according to claim 6: A1) Application in the genetic diversity analysis of the ten Mahonia genera; A2) Application in the resource diversity analysis of the ten major varieties of Mahonia; A3) Application of the analysis of kinship among the ten great merits; A4) Application in the identification of ten varieties of the *Mahonia* genus; and A5) Application in constructing genetic maps or DNA fingerprint maps of the Mahonia genus.

Images