6,6-core silacycle based inhibitors of dna-dependent protein kinase and compositions and application in gene editing

EP4766716A1Pending Publication Date: 2026-07-01JUNO THERAPEUTICS INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
EP · EP
Patent Type
Applications
Current Assignee / Owner
JUNO THERAPEUTICS INC
Filing Date
2024-08-22
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Current genome editing technologies, particularly CRISPR/Cas systems, face challenges in achieving high efficiency due to the predominant use of the error-prone non-homologous end joining (NHEJ) pathway for DNA repair, which hinders precise insertion or deletion at target sites.

Method used

The development of DNA-dependent protein kinase (DNA-PK) inhibitors, specifically compounds of Formula (I), which transiently block the NHEJ pathway, thereby promoting DNA repair via the more precise homology-directed repair (HDR) pathway, enhancing the efficiency of CRISPR/Cas-mediated genome editing.

Benefits of technology

By inhibiting DNA-PK, these compounds significantly increase the efficiency of HDR-mediated genome editing, leading to improved precision and reduced errors in genome modifications, particularly in CRISPR-engineered CAR-T cells.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2024043441_06032025_PF_FP_ABST
    Figure US2024043441_06032025_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure is directed to DNA-PK inhibitors having the Formula (I), or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, methods of preparing the forgoing, and compositions thereof, as well as methods of use for the compounds of Formula (I), in combination with a DNA cutting agent.
Need to check novelty before this filing date? Find Prior Art

Description

6,6-CORE SILA CYCLE BASED INHIBITORS OF DNA-DEPENDENT PROTEINKINASE AND COMPOSITIONS AND APPLICATION IN GENE EDITINGCROSS-REFERENCE

[0001] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 578,848 filed on August 25, 2023, the entire contents of which are hereby incorporated by reference herein.FIELD

[0002] The present disclosure relates generally to compounds, compositions, methods, and kits for increasing genome editing efficiency by administering an inhibitor of DNA protein-kinase (DNA-PK) of general formula (I) and a genome editing system to a eukaryotic cell(s). The present disclosure further relates to compositions including the DNA-PK inhibitors of general formula (I), methods of inserting a polynucleotide of interest into the genome of a eukaryotic cell, and kits for inserting a gene of interest into the genome of a eukaryotic cell. The methods and kits can improve the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells, in particular in CRISPR-engineered CAR-T cells.INCORPORATION BY REFERENCE OF SEQUENCE LISTING

[0003] This application contains a Sequence Listing which has been submitted in .XML format via EFS-WEB and is hereby incorporated by reference in its entirety. Said .XML copy, created on August 24, 2023 is named 055920-610P01US_SeqList_ST26.xml and is 75 KB in size.BACKGROUND

[0004] The development of cost-efficient and reliable methods for precise targeted alterations to the genome of living cells has been a long-standing goal. Genome editing has the potential to eliminate genes responsible for a particular disorder (i.e., a gene “knock-out”), or alternatively, provide a means for gene manipulation or insertion to correct a genetic deficiency or enhance a biological process via a gene “knock-in.” Genome editing can be applied for treatment of a multitude of disorders, including treatment of inherited disorders, hematological disorders and cancer, and in methods of immunotherapy. Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated (Cas) systems are prokaryotic immune systems(Ishino et al., Journal of Bacteriology 169:5429-5433 (1987)), which provide immunity against viruses and plasmids by targeting the nucleic acids of the viruses and plasmids in a sequence- specific manner (Soret et al., Nature Reviews Microbiology 6:181-186 (2008)). Since its original discovery, multiple groups have performed extensive research around potential applications of the CRISPR system in genetic engineering, including gene editing (Jinek et al., Science 337(6096):816-821 (2012); Cong et al, Science 339(6121):819-823 (2013); and Mali et al., Science 339(6121):823-826 (2013)). The CRISPR-Cas9 gene editing system has been used successfully in a wide range of organisms and cell lines.

[0005] The Cas9 endonuclease generates a double-stranded DNA break at the target sequence, upstream of a protospacer adjacent motif (PAM). The target sequence can then be removed, or a sequence of interest can be inserted into the target sequence using an endogenous repair pathway of the cell. Endogenous DNA repair pathways include the Nonhomology Mediated End-Joining (NHEJ) pathway, Microhomology Mediated End-Joining (MMEJ) pathway, and the Homology Directed Repair (HDR) pathway.

[0006] NHEJ, MMEJ, and HDR pathways repair double-stranded DNA breaks, but repair of such double-stranded DNA breaks may result in insertions or deletions at the double stranded break site. In NHEJ, a homologous template is not required for repairing breaks in the DNA. NHEJ repair can be error-prone, although errors are decreased when the DNA break includes compatible overhangs. NHEJ and MMEJ are mechanistically distinct DNA repair pathways with different subsets of DNA repair enzymes involved in each of them. Unlike NHEJ, which can be precise in some cases, or error-prone in some cases, MMEJ is always error-prone and results in both deletion and insertions at the site under repair. MMEJ-associated deletions are due to the micro-homologies (2-10 base pairs) at both sides of a double-strand break. In contrast, HDR requires a homologous template to direct repair, but HDR repairs are typically high-fidelity and less error prone. HDR-driven repair of double-stranded DNA breaks is therefore preferable to NHEJ- or MMEJ-mediated repair; however, in many cell types HDR is limited by the activity of NHEJ at all cell cycle stages, and HDR is primarily utilized in the S / G2 phase of cell growth (Mao et al., Cell Cycle, 7:2902-2906 (2008)).

[0007] The ability to modify the genome of any cell at a precise location has improved with the recent discovery and implementation of CRISPR / Cas9 editing technology. However, the capacity to introduce specific directed changes at given loci is hindered by the fact that themajor cellular repair pathway that occurs following Cas9-mediated DNA cleavage is the erroneous non-homologous end joining (NHEJ) pathway. Homology-directed recombination (HDR) is less efficient than NHEJ, reducing editing efficiencies in eukaryotic cells. While the achievement of insertion or deletions (indels) from NHEJ is up to 70% effective in some reports, the efficiency of HDR remains challenging, with rates at less than 1%. Accordingly, there is a need for increasing genome editing efficiency, in particular, HDR efficiency.

[0008] Studies have shown that reduced NHEJ activity in vivo results in increases in HDR activity, and this phenomenon can be exploited to increase the efficiency of HDR-mediated CRISPR / Cas9 precision genome engineering Pierce et al. Genes Dev., 15, 3237-3242 (2001), Ma et al. RNA Biol., 13, 605-612 (2016), Maruyama, et al. Nat. Biotechnol., 33, 538-542 (2015), Robert et al. Genome Med., 7, 93 (2015).

[0009] DNA-dependent protein kinase (DNA-PK) is a nuclear serine / threonine kinase that has been shown to be essential in DNA double stranded break repair machinery. In mammals, the predominant pathway for repair of double stranded DNA breaks is the non-homologous end joining (NHEJ) pathway which is functional regardless of the phase of the cell cycle and acts by removing non-ligatable ends and ligating ends of double strand breaks. There is a need for potent and selective DNA-PK inhibitors (DNA-PKi) that transiently block the NHEJ pathway to promote DNA repair via the desirable HDR pathway, therefore, improving the efficiency of CRISPR / Cas-mediated polynucleotide insertion in cells, such as CRISPR CAR-T cells. SUMMARY

[0010] A first aspect of the present disclosure relates to compounds of Formula (I):and pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, and tautomers thereof, wherein:A is a 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5; R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one or more R6; R2is H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, -CN, OH, CH2OH, NH2, or CH2NH2; R3and R4are each independently selected from the group consisting of -OH, C1-C4alkyl, C1-C4alkoxy, C1-C4 haloalkyl, C1-C4 alkylaryl, and aryl; each R5is independently selected from the group consisting of H, halogen, oxo, thioxo, C1-C4 alkyl, C1-C4alkoxy, C1-C6haloalkyl, CD3, CD2CD3, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R6; or two geminal R5together with the intervening geminal carbon atom, form a C3-C6 cycloalkyl; each R6is independently selected from the group consisting of H, halogen, NH2, OH, -CN, C(O)NHR7, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R7; each R7is independently selected from the group consisting of H, Halogen, OH, NH2, CHO, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, or C1-C6 haloalkyl; and n is an integer from 1 to 3.

[0011] Another aspect of the present disclosure relates to compounds of Formula I:and pharmaceutically acceptable salts, stereoisomers, solvatess, prodrug, andtautomers thereof, wherein:A is a 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one to three R5; R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one to five R6; R2is H, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, -CN, OH, CH2OH, NH2, or CH2NH2; R3and R4are each independently selected from the group consisting of -OH, C1-C4alkyl, C1-C4alkoxy, C1-C4 haloalkyl, C1-C4 alkylaryl, and aryl; each R5is independently selected from the group consisting of H, halogen, oxo, thioxo, C1-C4 alkyl, C1-C4alkoxy, C1-C6haloalkyl, CD3, CD2CD3, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one to three R6; two geminal R5together with the intervening geminal carbon atom, form a C3-C6 cycloalkyl; each R6is independently selected from the group consisting of H, halogen, NH2, OH, -CN, C(O)NHR7, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one to three R7; each R7is independently selected from the group consisting of H, Halogen, OH, NH2, CHO, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, or C1-C6 haloalkyl; and n is an integer from 1 to 3.

[0012] Another aspect of the present disclosure is directed to pharmaceutical compositions comprising a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof and a pharmaceutically acceptable carrier. The pharmaceutical acceptable carrier may further include an excipient, diluent, or surfactant.

[0013] Another aspect of the present disclosure is directed to a composition comprising (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cutting agent, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0014] Another aspect of the present disclosure is directed to a method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, whereinthe DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0015] Another aspect of the present disclosure is directed to a method for repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0016] Another aspect of the present disclosure is directed to a method for inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA- PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0017] Another aspect of the present disclosure is directed to a method for targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0018] Another aspect of the present disclosure relates to compounds of Formula (I), and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof, for use in the manufacture of a medicament for cell therapy.

[0019] Another aspect of the present disclosure relates to the use of a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition thereof, in the treatment of a cell.

[0020] In some aspects, the present disclosure provides a method of preparing a compound of the present disclosure.

[0021] In some aspects, the present disclosure provides a method of preparing a compound, comprising one or more steps described herein.

[0022] Other features and advantages of the disclosure will be apparent from the following detailed description and claims.BRIEF DESCRIPTION OF DRAWINGS

[0023] FIG. 1 shows the effect of DNA-PK inhibitor Compound 1 on cell viability 5 days after electroporation. Live cells are shown as a percentage of total cells.

[0024] FIG. 2 shows the effect of DNA-PK inhibitor Compound 1 on T cell proliferation 5 days after electroporation. Total live cell counts (x10e6) are shown.

[0025] FIG. 3 shows the effect of DNA-PK inhibitor Compound 1 on CAR insertion into the TRAC locus 5 days after electroporation. Frequency of CAR+ T cells is shown as a percentage of total live cells.

[0026] FIG. 4 shows the effect of DNA-PK inhibitor Compound 1 on CAR insertion into the TRAC locus 5 days after electroporation. KI efficiency is shown as percentage change over the untreated control condition (calculated by dividing the % CAR+ of DNA-PKi treated by untreated, subtracting 1, and multiplying by 100).

[0027] FIG. 5 shows the effect of DNA-PK inhibitor Compound 1 on total CAR+ cell yields 5 days after electroporation. Relative CAR+ yield is shown as percentage change over the untreated control condition (calculated by dividing the number of CAR+ cells in DNA-PKi treated condition by untreated, subtracting 1, and multiplying by 100). DETAILED DESCRIPTION Definitions

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In the specification, the singular forms also include the plural unless the context clearly dictates otherwise. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated by reference. The references cited herein are not admitted to be prior art to the claimed present disclosure. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods and examples are illustrative only and are not intended to be limiting. In the case of conflictbetween the chemical structures and names of the compounds disclosed herein, the chemical structures will control.

[0029] The articles "a" and "an" are used in this disclosure to refer to one or more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0030] The term "and / or" is used in this disclosure to mean either "and" or "or" unless indicated otherwise.

[0031] The term “optionally substituted” is understood to mean that a given chemical moiety (e.g., an alkyl group) can (but is not required to) be bonded other substituents (e.g., heteroatoms). For instance, an alkyl group that is optionally substituted can be a fully saturated alkyl chain (i.e., a pure hydrocarbon). Alternatively, the same optionally substituted alkyl group can have substituents different from hydrogen. For instance, it can, at any point along the chain be bounded to a halogen atom, a hydroxyl group, or any other substituent described herein. Thus, the term “optionally substituted” means that a given chemical moiety has the potential to contain other functional groups but does not necessarily have any further functional groups. Suitable substituents used in the optional substitution of the described groups include, without limitation, halogen, oxo, -OH, -CN, -COOH, -CH2CN, -O-(C1-C6) alkyl, (C1-C6) alkyl, (Ci- C6) alkoxy, (C1-C6) haloalkyl, (C1-C6) haloalkoxy, -O-(C2-C6) alkenyl, -O-(C2-C6) alkynyl, (C2-C6) alkenyl, (C2-C6) alkynyl, -OH, -OP(O)(OH)2, -OC(O)(C1-C6) alkyl, -C(O)(C1-C6) alkyl, -OC(O)O(C1-C6) alkyl, -NH2, -NH((C1-C6) alkyl), -N((C1-C6) alkyl)2, -NHC(O)(C1-C6) alkyl, -C(O)NH(C1-C6) alkyl, -S(O)2(C1-C6) alkyl, -S(O)NH(C1-C6) alkyl, and S(O)N((C1-C6) alkyl)2. The substituents can themselves be optionally substituted. “Optionally substituted” as used herein also refers to substituted or unsubstituted whose meaning is described below.

[0032] As used herein, the term “substituted,” means that any one or more hydrogen atoms on the designated atom is replaced with a selection from the indicated groups, provided that the designated atom’s normal valency is not exceeded, and that the substitution results in a stable compound. When a substituent is oxo or keto (i.e., =O), then 2 hydrogen atoms on the atom are replaced. Keto substituents are not present on aromatic moieties. Ring double bonds, as used herein, are double bonds that are formed between two adjacent ring atoms (e.g., C=C, C=N or N=N). “Stable compound” and “stable structure” are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a RM, andformulation into an efficacious therapeutic agent. For example, an aryl substituted with a cycloalkyl may indicate that the cycloalkyl connects to one atom of the aryl with a bond or by fusing with the aryl and sharing two or more common atoms.

[0033] As used herein, the term “unsubstituted” means that the specified group bears no substituents.

[0034] As used herein, “Alkyl” refers to optionally substituted, straight and branched chain aliphatic groups having from 1 to 30 carbon atoms. “Cl, C2, C3, C4, C5 or C6 alkyl” or “Cl- C6 alkyl” is intended to include Cl, C2, C3, C4, C5 or C6 straight chain (linear) saturated aliphatic hydrocarbon groups and C3, C4, C5 or C6 branched saturated aliphatic hydrocarbon groups. For example, C1-C6 alkyl is intends to include Cl, C2, C3, C4, C5 and C6 alkyl groups. Examples of alkyl include, moieties having from one to six carbon atoms, such as, but not limited to, methyl, ethyl, n-propyl, i-propyl, n-butyl, s-butyl, t-butyl, n-pentyl, i-pentyl, or n-hexyl. In some embodiments, a straight chain or branched alkyl has six or fewer carbon atoms (e.g., C1-C6 for straight chain, C3-C6 for branched chain), and in another embodiment, a straight chain or branched alkyl has four or fewer carbon atoms. The term “heteroalkyl” as used herein contemplates an alkyl with one or more heteroatoms. As used herein, the term “optionally substituted alkyl” refers to unsubstituted alkyl or alkyl having designated substituents replacing one or more hydrogen atoms on one or more carbons of the hydrocarbon backbone. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0035] “Alkoxy” refers to a straight or branched chain saturated hydrocarbon containing 1-12 carbon atoms containing a terminal “O” in the chain, i.e., -O(alkyl). Examples of alkoxy groups include without limitation, methoxy, ethoxy, propoxy, butoxy, t-butoxy, or pentoxy groups.

[0036] As used herein, the term “alkenyl” includes unsaturated or partially unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double bond. For example, the term “alkenyl” includes straight chain alkenyl groups (e.g., ethenyl, propenyl, butenyl, pentenyl, hexenyl, heptenyl, octenyl, nonenyl, decenyl), and branched alkenyl groups. In certain embodiments, a straight chain or branched alkenyl group has six or fewer carbon atoms in its backbone (e.g., C2-6for straight chain, C3-6 for branched chain). The term “C2-6” includes alkenyl groups containing two to six carbon atoms. The term “C3-6” includes alkenyl groups containing three to six carbon atoms.

[0037] As used herein, the term “optionally substituted alkenyl” refers to unsubstituted alkenyl or alkenyl having designated substituents replacing one or more hydrogen atoms on one or more hydrocarbon backbone carbon atoms. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, aryl carbonyl ami no, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkyl sulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0038] As used herein, the term “alkynyl” includes unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but which contain at least one triple bond. For example, “alkynyl” includes straight chain alkynyl groups (e.g., ethynyl, propynyl, butynyl, pentynyl, hexynyl, heptynyl, octynyl, nonynyl, decynyl), and branched alkynyl groups. In certain embodiments, a straight chain or branched alkynyl group has six or fewer carbon atoms in its backbone (e.g., C2-6for straight chain, C3-6for branched chain). The term “C2-6” includes alkynyl groups containing two to six carbon atoms. The term “C3-6” includes alkynyl groups containing three to six carbon atoms.

[0039] As used herein, the term “optionally substituted alkynyl” refers to unsubstituted alkynyl or alkynyl having designated substituents replacing one or more hydrogen atoms on one or more hydrocarbon backbone carbon atoms. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy,aryl oxycarbonyl oxy, carboxylate, alkyl carbonyl, arylcarbonyl, alkoxy carbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0040] Other optionally substituted moieties (such as optionally substituted cycloalkyl, heterocycloalkyl, aryl, or heteroaryl) include both the unsubstituted moieties and the moieties having one or more of the designated substituents. For example, substituted heterocycloalkyl includes those substituted with one or more alkyl groups, such as 2,2,6,6-tetramethyl- piperidinyl and 2,2,6,6-tetramethyl-l,2,3,6-tetrahydropyridinyl.

[0041] As used herein, the term “cycloalkyl” refers to a saturated or partially unsaturated hydrocarbon monocyclic or polycyclic (e.g., fused, bridged, or spiro) system having 3 to 30 carbon atoms (e.g., C3-12, C3-10, C3-8, or C3-6). Examples of cycloalkyl include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, 1,2,3,4-tetrahydronaphthalenyl, and adamantyl. In the case of polycyclic cycloalkyl, only one of the rings in the cycloalkyl needs to be nonaromatic.

[0042] As used herein, the term “heterocycloalkyl” refers to a saturated or partially unsaturated 3- 8 membered monocyclic or bicyclic, 7-12 membered bicyclic (fused, bridged, or spiro rings), or 11-14 membered tricyclic ring system (fused, bridged, or spiro rings) having one or more heteroatoms (such as O, N, S, P, or Se), e.g., 1 or 1-2 or 1-3 or 1-4 or 1-5 or 1-6 heteroatoms, or e.g., 1, 2, 3, 4, 5, or 6 heteroatoms, independently selected from the group consisting of nitrogen, oxygen and sulfur, unless specified otherwise. Examples of heterocycloalkyl groups include, but are not limited to, piperidinyl, piperazinyl, pyrrolidinyl, dioxanyl, tetrahydrofuranyl, isoindolinyl, indolinyl, imidazolidinyl, pyrazolidinyl, oxazolidinyl, isoxazolidinyl, triazolidinyl, oxiranyl, azetidinyl, oxetanyl, thietanyl, 1, 2,3,6- tetrahydropyridinyl, tetrahydropyranyl, dihydropyranyl, pyranyl, morpholinyl, tetrahydrothiopyranyl, 1,4-diazepanyl, 1,4-oxazepanyl, 2-oxa-5-azabicyclo[2.2.1]heptanyl, 2,5-diazabicyclo[2.2.1]heptanyl, 2-oxa-6-azaspiro[3.3]heptanyl, 2,6-diazaspiro[3.3]heptanyl,l,4-dioxa-8-azaspiro[4.5]decanyl, l,4-dioxaspiro[4.5]decanyl, l-oxaspiro[4.5]decanyl, 1 - azaspiro[4.5]dccanyl, 3'H-spiro[cyclohexane-l,l'-isobenzofurran]-yl, 7'H-spiro[cyclohexane- l,5'-furo[3,4-b]pyridin]-yl, 3'H-spiro[cyclohexane-l,l'-furo[3,4-c]pyridin]-yl, 3- azabicyclo[3.1.0]hexanyl, 3-azabicyclo[3.1.0]hexan-3-yl, l,4,5,6-tetrahydropyrrolo[3,4- c]pyrazolyl, 3,4,5,6,7,8-hexahydropyrido[4,3-d]pyrimidinyl, 4,5,6,7-tetrahydro-lH- pyrazolo[3,4-c]pyridinyl, 5,6,7,8-tetrahydropyrido[4,3-d]pyrimidinyl, 2- azaspiro[3.3]heptanyl, 2-methyl-2-azaspiro[3.3]heptanyl, 2-azaspiro[3.5]nonanyl, 2-methyl-2-azaspiro[3.5]nonanyl, 2-azaspiro[4.5]decanyl, 2-methyl-2-azaspiro[4.5]decanyl, 2-oxa- azaspiro[3 ,4]octanyl, 2-oxa-azaspiro[3 ,4]octan-6-yl, 5,6-dihydro-4H- cyclopenta[b]thiophenyl, and the like. In the case of multicyclic heterocycloalkyl, only one of the rings in the heterocycloalkyl needs to be non-aromatic (e.g., l,3-dihydrobenzo[c]isoxazol-3-yl).

[0043] As used herein, the term “optionally substituted heterocycloalkyl” refers to unsubstituted heterocycloalkyl having designated substituents replacing one or more hydrogen atoms on one or more carbon or heteroatom. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkyl aryl ami no), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkyl sulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0044] Unless otherwise specifically defined, the term “aryl” refers to cyclic, aromatic hydrocarbon groups that have 1 to 3 aromatic rings, including monocyclic or bicyclic groups such as phenyl, biphenyl, or naphthyl. Where containing two aromatic rings (bicyclic, etc.), the aromatic rings of the aryl group may be joined at a single point (e.g., biphenyl), or fused (e.g., naphthyl). The aryl group may be optionally substituted by one or more substituents, e.g., 1 to 5 substituents, at any point of attachment. Exemplary substituents include, but are not limited to, — H, -halogen. — O — (Ci-e) alkyl, (Ci-e) alkyl, — O — (C2-6) alkenyl, — O — (C2- 6) alkynyl, (C2-6) alkenyl, (C2-6) alkynyl, —OH, — OP(O)(OH)2, — OC(O)(Ci-6) alkyl, —C(O)(C1.6) alkyl, — OC(O)O(Ci-6) alkyl, — NH2, NH((CI-6) alkyl), N((CI-6) alkyl)2, — S(O)2— (Ci-e) alkyl, — S(O)NH(Ci-e) alkyl, and — S(O)N((Ci-e) alkyl)2. The substituents can themselves be optionally substituted. Furthermore, when containing two or more fused rings, the aryl groups herein defined may have a saturated or partially unsaturated ring fused with a fully unsaturated aromatic ring Exemplary ring systems of these aryl groups include, but are not limited to, phenyl, biphenyl, naphthyl, anthracenyl, phenalenyl, phenanthrenyl, indanyl, indenyl, tetrahydronaphthal enyl, tetrahydrobenzoannul enyl, 10,11 -dihy dro-5H- dibenzo[a,d][7]annulenyl, and the like. Furthermore, when containing two or more fused rings, the aryl groups herein defined may have a saturated or partially unsaturated heterocyclic ring fused with a fully unsaturated aromatic ring. Exemplary ring systems of these aryl groups include, but are not limited to, benzo[d][l,3]dioxol-5-yl, 2,3-dihydrobenzo[b][l,4]dioxin-6-yl, benzo[d]isoxazol-3(2H)-on-6-yl, benzo[d]oxazol-2(3H)-on-6-yl, and benzo[d]oxazol-2(3H)- on-5-yl.

[0045] Unless otherwise specifically defined, “heteroaryl” means a monovalent monocyclic or polycyclic aromatic radical of 5 to 24 ring atoms, containing one or more ring heteroatoms selected from N, O, S, P, Se, or B, the remaining ring atoms being C. Heteroaryl as herein defined also means a bicyclic heteroaromatic group wherein the heteroatom is selected from N, O, S, P, Se, or B. Heteroaryl as herein defined also means a tricyclic heteroaromatic group containing one or more ring heteroatoms selected from N, O, S, P, Se, or B. The aromatic radical is optionally substituted independently with one or more substituents described herein. Examples include, but are not limited to, furyl, thienyl, pyrrolyl, pyridyl, pyrazolyl, pyrimidinyl, imidazolyl, isoxazolyl, oxazolyl, oxadiazolyl, pyrazinyl, indolyl, thiophen-2-yl, quinolinyl, benzopyranyl, isothiazolyl, thiazolyl, thiadiazole, indazole, benzimidazolyl, thieno[3,2-b]thiophene, triazolyl, triazinyl, imidazo[l,2-b]pyrazolyl, furo[2,3-c]pyridinyl, imidazof 1 ,2-a]pyridinyl, indazolyl, pyrrolo[2,3-c]pyridinyl, pyrrolo[3,2-c]pyridinyl, pyrazolo[3,4-c]pyridinyl, thieno[3,2-c]pyridinyl, thieno[2,3-c]pyridinyl, thieno[2,3- b]pyridinyl, benzothiazolyl, indolyl, indolinyl, indolinony 1 , dihy drob enzothi opheny 1 , dihydrobenzofuranyl, benzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, quinolinyl, isoquinolinyl, 1,6-naphthyridinyl, benzo[de]isoquinolinyl, pyrido[4,3-b][l,6]naphthyridinyl, thieno[2,3-b]pyrazinyl, quinazolinyl, tetrazolo[l,5- a]pyridinyl, [l,2,4]triazolo[4,3-a]pyridinyl, isoindolyl, pyrrolo[2,3-b]pyridinyl, pyrrolo[3,4-b]pyridinyl, pyrrolo[3,2-b]pyridinyl, imidazo[5,4-b]pyridinyl, pyrrolo[1,2-a]pyrimidinyl, tetrahydro pyrrolo[1,2-a]pyrimidinyl, 3,4-dihydro-2H-0^1-pyrrolo[2,1-b]pyrimidine, dibenzo[b,d] thiophene, pyridin-2-one, furo[3,2-c]pyridinyl, furo[2,3-c]pyridinyl, 1H- pyrido[3,4-b][1,4] thiazinyl, benzoxazolyl, benzisoxazolyl, furo[2,3-b]pyridinyl, benzothiophenyl, 1,5-naphthyridinyl, furo[3,2-b]pyridine, [1,2,4]triazolo[1,5-a]pyridinyl, benzo [1,2,3]triazolyl, imidazo[1,2-a]pyrimidinyl, [1,2,4]triazolo[4,3-b]pyridazinyl, benzo[c][1,2,5]thiadiazolyl, benzo[c][1,2,5]oxadiazole, 1,3-dihydro-2H-benzo[d]imidazol-2- one, 3,4-dihydro-2H-pyrazolo [1,5-b][1,2]oxazinyl, 4,5,6,7-tetrahydropyrazolo[1,5- a]pyridinyl, thiazolo[5,4-d]thiazolyl, imidazo[2,1-b][1,3,4]thiadiazolyl, thieno[2,3-b]pyrrolyl, 3H-indolyl, and derivatives thereof. Furthermore, when containing two or more fused rings, the heteroaryl groups defined herein may have one or more saturated or partially unsaturated ring fused with a fully unsaturated aromatic ring, e.g., a 5-membered heteroaromatic ring containing 1 to 3 heteroatoms selected from N, O, S, P, Se, or B, or a 6-membered heteroaromatic ring containing 1 to 3 nitrogens, wherein the saturated or partially unsaturated ring includes 0 to 4 heteroatoms selected from N, O, S, P, Se, or B, and is optionally substituted with one or more oxo. In heteroaryl ring systems containing more than two fused rings, a saturated or partially unsaturated ring may further be fused with a saturated or partially unsaturated ring described herein. Exemplary ring systems of these heteroaryl groups include, for example, indolinyl, indolinonyl, dihydrobenzothiophenyl, dihydrobenzofuran, chromanyl, thiochromanyl, tetrahydroquinolinyl, dihydrobenzothiazine, 3,4-dihydro-11H-isoquinolinyl, 2,3-dihydrobenzofuranyl, benzofuranonyl, indolinyl, oxindolyl, indolyl, 1,6-dihydro-7H- pyrazolo[3,4-c]pyridin-7-onyl, 7,8-dihydro-6H-pyrido[3,2-b]pyrrolizinyl, 8H-pyrido[3,2- b]pyrrolizinyl, 1,5,6,7-tetrahydrocyclopenta[b]pyrazolo[4,3-e]pyridinyl, 7,8-dihydro-6H- pyrido[3,2-b]pyrrolizine, pyrazolo[1,5-a]pyrimidin-7(4H)-only, 3,4-dihydropyrazino[1,2- a]indol-1(2H)-onyl, or benzo[c][1,2]oxaborol-1(3H)-olyl.

[0046] The cycloalkyl, heterocycloalkyl, aryl, or heteroaryl ring can be substituted at one or more ring positions (e.g., the ring-forming carbon or heteroatom such as N) with such substituents as described above, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkoxy, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, alkylaminocarbonyl, aralkylaminocarbonyl, alkenylaminocarbonyl, alkylcarbonyl, arylcarbonyl, aralkylcarbonyl, alkenylcarbonyl, alkoxycarbonyl,aminocarbonyl, alkylthiocarbonyl, phosphate, phosphonato, phosphinato, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety. Aryl and heteroaryl groups can also be fused or bridged with alicyclic or heterocyclic rings, which are not aromatic so as to form a multicyclic system (e.g., tetralin, methylenedioxyphenyl such as benzo[d][l,3]dioxole-5-yl).

[0047] When a bond to a substituent is shown to cross a bond connecting two atoms in a ring, then such substituent may be bonded to any atom in the ring. For example, in the structure an R6substituent may replace any hydrogen attached to an atom in the ring,including hydrogens attached to atoms of the ring indicated by B. When a substituent is listed without indicating the atom via which such substituent is bonded to the rest of the compound of a given formula, then such substituent may be bonded via any atom in such formula. For example, the structureencompassesCombinations of substituents and / or variables are permissible, but only if such combinations result in stable compounds.

[0048] When any variable (e.g., R) occurs more than one time in any constituent or formula for a compound, its definition at each occurrence is independent of its definition at every other occurrence. Thus, for example, if a group is shown to be substituted with 0-2 R moieties, then the group may optionally be substituted with up to two R moieties and R at each occurrence is selected independently from the definition of R. Also, combinations of substituents and / or variables are permissible, but only if such combinations result in stable compounds.

[0049] As used herein, the term “hydroxy” or “hydroxyl” includes groups with an — OH or —O— .

[0050] As used herein, the term “halo” or “halogen” refers to fluoro, chloro, bromo and iodo.

[0051] The term “haloalkyl” or “haloalkoxyl” refers to an alkyl or alkoxyl substituted with one or more halogen atoms. Examples of haloalkyl groups include, but are not limited to, trifluoromethyl, difluoromethyl, pentafluoroethyl, trichloromethyl, etc. Examples of haloalkoxy groups include, but are not limited to, trifluoromethoxy, difluoromethoxy, pentafluoroethoxy, trichloromethoxy, etc.

[0052] As used herein, the term “cyano” refers to a nitrile radical (e.g., — CN).

[0053] As used herein, the term “optionally substituted haloalkyl” refers to unsubstituted haloalkyl having designated substituents replacing one or more hydrogen atoms on one or more hydrocarbon backbone carbon atoms. Such substituents can include, for example, alkyl, alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino and alkylarylamino), acylamino (including alkylcarbonylamino, arylcarbonylamino, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamide, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moiety.

[0054] As used herein, the term “alkoxy” or “alkoxyl” includes substituted and unsubstituted alkyl, alkenyl and alkynyl groups covalently linked to an oxygen atom. Examples of alkoxy groups or alkoxyl radicals include, but are not limited to, methoxy, ethoxy, isopropyloxy, propoxy, butoxy and pentoxy groups. Examples of substituted alkoxy groups include halogenated alkoxy groups. The alkoxy groups can be substituted with groups such as alkenyl, alkynyl, halogen, hydroxyl, alkylcarbonyloxy, arylcarbonyloxy, alkoxycarbonyloxy, aryloxycarbonyloxy, carboxylate, alkylcarbonyl, arylcarbonyl, alkoxycarbonyl, aminocarbonyl, alkylaminocarbonyl, dialkylaminocarbonyl, alkylthiocarbonyl, alkoxyl, phosphate, phosphonato, phosphinate, amino (including alkylamino, dialkylamino, arylamino, diarylamino, and alkylarylamino), acylamino (including alkylcarbonylamino, aryl carbonyl ami no, carbamoyl and ureido), amidino, imino, sulfhydryl, alkylthio, arylthio, thiocarboxylate, sulfates, alkylsulfinyl, sulfonato, sulfamoyl, sulfonamido, nitro, trifluoromethyl, cyano, azido, heterocyclyl, alkylaryl, or an aromatic or heteroaromatic moieties. Examples of halogen substituted alkoxy groups include, but are not limited to,fluoromethoxy, difluoromethoxy, trifluoromethoxy, chloromethoxy, di chloromethoxy and trichloromethoxy.

[0055] As used herein, the term “solvate” means solvent addition forms that contain either stoichiometric or non-stoichiometric amounts of solvent. Some compounds have a tendency to trap a fixed molar ratio of solvent molecules in the crystalline solid state, thus forming a solvate. If the solvent is water the solvate formed is a hydrate, and if the solvent is alcohol, the solvate formed is an alcoholate. Hydrates are formed by the combination of one or more molecules of water with one molecule of the substance in which the water retains its molecular state as H2O.

[0056] As used herein, the term “isomerism” means compounds that have identical molecular formulae but differ in the sequence of bonding of their atoms or in the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are termed “stereoisomers.” Stereoisomers that are not mirror images of one another are termed “diastereoisomers,” and stereoisomers that are non-superimposable mirror images of each other are termed “enantiomers” or sometimes optical isomers. A mixture containing equal amounts of individual enantiomeric forms of opposite chirality is temied a “racemic mixture.” The compounds of Formula (I) may have one or more asymmetric carbon atom and may occur as racemates, racemic mixtures and as individual enantiomers or diastereomers.

[0057] As used herein, the term “tautomer” is one of two or more structural isomers that exist in equilibrium and is readily converted from one isomeric form to another. This conversion results in the formal migration of a hydrogen atom accompanied by a switch of adjacent conjugated double bonds. Tautomers exist as a mixture of a tautomeric set in solution. In solutions where tautomerization is possible, a chemical equilibrium of the tautomers will be reached. The exact ratio of the tautomers depends on several factors, including temperature, solvent and pH. The concept of tautomers that are interconvertible by tautomerizations is called tautomerism. In keto-enol tautomerism a simultaneous shift of electrons and a hydrogen atom occurs.

[0058] It is to be understood that the compounds of the present disclosure may be depicted as different tautomers. It should also be understood that when compounds have tautomeric forms, all tautomeric forms are intended to be included in the scope of the present disclosure, and thenaming of the compounds does not exclude any tautomer form. It will be understood that certain tautomers may have a higher level of activity than others.

[0059] The present disclosure also contemplates isotopically-labelled compounds of Formula I (e.g., those labeled with2H and14C). Substitution with heavier isotopes such as deuterium may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements). Isotopically labelled compounds of Formula I can generally be prepared by following procedures analogous to those disclosed in the Schemes and / or in the Examples herein below, by substituting an appropriate isotopically labelled reagent for a non-isotopically labelled reagent.

[0060] The disclosure also includes pharmaceutical compositions comprising an effective amount of a disclosed compound and a pharmaceutically acceptable carrier.

[0061] As used herein, the term “pharmaceutically acceptable salts” refer to derivatives of the compounds of the present disclosure wherein the parent compound is modified by making acid or base salts thereof. Examples of pharmaceutically acceptable salts include, but are not limited to, mineral or organic acid salts of basic residues such as amines, alkali or organic salts of acidic residues such as carboxylic acids, and the like. The pharmaceutically acceptable salts include the conventional non-toxic salts or the quaternary ammonium salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. For example, such conventional non-toxic salts include, but are not limited to, those derived from inorganic and organic acids selected from 2-acetoxybenzoic, 2-hydroxyethane sulfonic, acetic, ascorbic, benzene sulfonic, benzoic, bicarbonic, carbonic, citric, edetic, ethane disulfonic, 1,2-ethane sulfonic, fumaric, glucoheptonic, gluconic, glutamic, glycolic, glycollyarsanilic, hexylresorcinic, hydrabamic, hydrobromic, hydrochloric, hydroiodic, hydroxymaleic, hydroxynaphthoic, isethionic, lactic, lactobionic, lauryl sulfonic, maleic, malic, mandelic, methane sulfonic, napsylic, nitric, oxalic, pamoic, pantothenic, phenylacetic, phosphoric, polygalacturonic, propionic, salicylic, stearic, subacetic, succinic, sulfamic, sulfanilic, sulfuric, tannic, tartaric, toluene sulfonic, and the commonly occurring amine acids, e.g., glycine, alanine, phenylalanine, arginine, etc.

[0062] In some embodiments, the pharmaceutically acceptable salt is a sodium salt, a potassium salt, a calcium salt, a magnesium salt, a diethylamine salt, a choline salt, a meglumine salt, a benzathine salt, a tromethamine salt, an ammonia salt, an arginine salt, or a lysine salt.

[0063] Other examples of pharmaceutically acceptable salts include hexanoic acid, cyclopentane propionic acid, pyruvic acid, malonic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo-[2.2.2]-oct-2-ene-l-carboxylic acid, 3- phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, muconic acid, and the like. The present disclosure also encompasses salts formed when an acidic proton presents in the parent compound either is replaced by a metal ion, e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion, or coordinates with an organic base such as ethanolamine, diethanolamine, triethanolamine, tromethamine, N-methylglucamine, and the like. In the salt form, it is understood that the ratio of the compound to the cation or anion of the salt can be 1 : 1, or any ratio other than 1 : 1, e g., 3: 1, 2: 1, 1 :2, or 1 :3.

[0064] It is to be understood that all references to pharmaceutically acceptable salts include solvent addition forms (solvates) or crystal forms (polymorphs) as defined herein, of the same salt.

[0065] A "patient" or “subject” is a mammal, e.g., a human, mouse, rat, guinea pig, dog, cat, horse, cow, pig, or non-human primate, such as a monkey, chimpanzee, baboon or rhesus.

[0066] An "effective amount" when used in connection with a compound is an amount effective for use in a cell therapy.

[0067] The term "carrier" as used in this disclosure, encompasses carriers, excipients, and diluents and means a material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting a pharmaceutical agent from one organ, or portion of the body, to another organ, or portion of the body of a subject.

[0068] The term "disorder" is used in this disclosure to mean, and is used interchangeably with, the terms disease, condition, or illness, unless otherwise indicated.

[0069] The term "administer", "administering", or "administration" as used in this disclosure refers to either directly administering a disclosed compound or pharmaceutically acceptable salt of the disclosed compound or a composition to a subject, or administering a prodrug derivative or analog of the compound or pharmaceutically acceptable salt of the compound or composition to the subject, which can form an equivalent amount of active compound within the subject's body.

[0070] The term "prodrug" as used in this disclosure, means a compound which is convertible in vivo by metabolic means (e.g., by hydrolysis) to a disclosed compound.

[0071] The present disclosure relates to compounds and compositions that are capable of inhibiting DNA-dependent protein kinase (DNA-PK) in a subject or in a biological sample.

[0072] In a first aspect of the present disclosure, the compounds of Formula (I) are described:and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, and tautomers thereof, wherein A, R1, R2, R3, R4, and n are described herein.

[0073] The details of the present disclosure are set forth in the accompanying description below. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, illustrative methods and materials are now described. Other features, objects, and advantages of the present disclosure will be apparent from the description and from the claims. In the specification and the appended claims, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this present disclosure belongs. All patents and publications cited in this specification are incorporated herein by reference in their entireties.

[0074] In some embodiments, R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one or more R6, wherein each R6is independently selected from the group consisting of halogen, NH2, OH, -CN, C(O)NHR7, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl of R6is optionally substituted with one or more R7. In some embodiments, R1is a 6- to 10- membered aryl or 5- to 12-membered heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S wherein the aryl or heteroaryl is optionally substituted with one or more R6. In some embodiments, R1is a 6- to 10-membered aryl or 5- to 12- membered heteroaryl containing one to four heteroatoms selected from the group consisting ofN, O, and S, wherein the aryl or heteroaryl is optionally substituted with one or more R6. In some embodiments, R1is a 6- to 10-membered aryl or 5- to 12-membered heteroaryl containing one to four heteroatoms selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one to five R6. In some embodiments, R1is a 6- to 10- membered aryl or 5- to 12-membered heteroaryl containing one to three heteroatoms selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one to five R6. In some embodiments, R1is a 6- to 10-membered aryl or 6- to 12-membered heteroaryl containing one to three heteroatoms selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one to five R6.

[0075] In some embodiments, each R6is independently selected from the group consisting of halogen, NH2, OH, -CN, C(O)NHR7, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R7. In some embodiments, each R6is independently selected from the group consisting of halogen, OH, -CN, C(O)NHR7, C1-C4 alkyl, C1-C6 alkoxy, C2-C4alkenyl, C2-C4alkynyl, CD3, CD2CD3, C1-C6haloalkyl, and heteroaryl, wherein the alkyl, alkoxy, haloalkyl, and heteroaryl is optionally substituted with one or more R7. In some embodiments, each R6is independently selected from the group consisting of halogen, C(O)NHR7, C1-C4 alkyl, C1-C6 alkoxy, and C1-C6 haloalkyl, wherein the alkyl, alkoxy, and haloalkyl, is optionally substituted with one or more R7. In some embodiments, each R6is independently selected from the group consisting of halogen, OH, -CN, C(O)NHR7, C1-C4 alkyl, trifluoromethyl, CD3, CD2, CD3, and C1-C6 alkoxy, wherein the alkyl, and alkoxy is optionally substituted with one or more R7. In some embodiments, each R6is independently selected from the group consisting of halogen, C(O)NH2, methyl, and methoxy.

[0076] In some embodiments, each R6is independently selected from the group consisting of halogen, NH2, OH, -CN, C(O)NHR7, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, CD3, CD2CD3, C1-C6alkoxy, C1-C6haloalkyl, C3-C6cycloalkyl, 4- to 6-membered heterocycloalkyl, 5- to 6- membered heteroaryl, and phenyl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R7, and wherein each heterocycloalkyl or heteroaryl contains at least one heteroatom selected from N, O, andS. In some embodiments, each R6is independently selected from the group consisting of halogen, C(O)NHR7, C1-C4 alkyl, C1-C6 alkoxy, C1-C6 haloalkyl, and 5- to 6-membered heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the alkyl, alkoxy, haloalkyl, and heteroaryl is optionally substituted with one or more R7. In some embodiments, each R6is independently selected from the group consisting of halogen, OH, -CN, C(O)NHR7, trifluoromethyl, CD3, C1-C4 alkyl, C1-C6 alkoxy, and C1- C6haloalkyl, wherein the alkyl, alkoxy, and haloalkyl, is optionally substituted with one or more R7. In some embodiments, each R6is independently selected from the group consisting of halogen, C(O)NHR7, C1-C4 alkyl, and C1-C6 alkoxy, wherein the alkyl, and alkoxy is optionally substituted with one or more R7. In some embodiments, each R6is independently selected from the group consisting of halogen, C(O)NH2, CD3, methyl, and methoxy.

[0077] In some embodiments, each R7is independently selected from the group consisting of H, halogen, OH, NH2, CHO, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy and C1-C6 haloalkyl. In some embodiments, each R7is independently selected from the group consisting of halogen, OH, NH2, CHO, oxo, thioxo, C1-C3 alkyl, C1-C3 alkoxy and C1-C3 haloalkyl. In some embodiments, each R7is independently selected from the group consisting of fluoro, methyl, and methoxy. In some embodiments, each R7is independently selected from the group consisting of fluoro, oxo, methyl, and methoxy.

[0078] In some embodiments, R1is:wherein Z is N or C; B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5. In some embodiments, Z is N or C; B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5. In some embodiments, Z is N or C; B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5. In some embodiments, Z is N or C; B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl orheteroaryl contains at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3. In some embodiments, Z is N or C; B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3. In some embodiments, Z is N or C; B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3. In some embodiments, at least one R6is CD3 or methyl.

[0079] In some embodiments, R1is:wherein B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5. In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5. In some embodiments, B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5. In some embodiments, B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3. In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3. In some embodiments, B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3.

[0080] In some embodiments, R1is selected from the group consisting of:wherein X1, X2, X3, X4and X5are each independently N, CH, or C(R6); and m is an integer from 1 to 3.

[0081] In some embodiments, R1is:wherein X1is N, and each of X2, X3, and X4is CH or C(R6). In some embodiments, two of X1, X2, X3, and X4are N, and the remaining X1, X2, X3, and X4are CH or C(R6) . In some embodiments, X1is N, and one of X2, X3, and X4is N. In some embodiments, X1and X2are N, and X3and X4are CH or C(R6). In some embodiments, X1and X3are N, and X2and X4are CH or C(R6). In some embodiments, X1and X4are N, and X2and X3are CH or C(R6). In some embodiments, X2and X4are N, and X1and X3are CH or C(R6). In some embodiments, X3and X4are N, and X1and X2are CH or C(R6). In some embodiments, each C(R6) is C(C1-C6 alkoxy). In some embodiments, each C(R6) is C(methoxy). In some embodiments, R1is selected from the group consisting of:

[0082] In some embodiments, R1is selected from the group consisting of:wherein X1, X2, X3, X4and X5are each independently N, CH, or C(R6).

[0083] In some embodiments, R1is:wherein X1is N, and each of X2, X3, and X4is C(R6). In some embodiments, two of X1, X2, X3, and X4are N, and the remaining X1, X2, X3, and X4are C(R6). In some embodiments, X1is N, and one of X2, X3, and X4is N. In some embodiments, X1and X2are N, and X3and X4are C(R6). In some embodiments, X1and X3are N, and X2and X4are C(R6). In some embodiments, X1and X4are N, and X2and X3are C(R6). In some embodiments, X2and X4are N, and X1and X3are C(R6). In some embodiments, X3and X4are N, and X1and X2are C(R6). In some embodiments, each C(R6) is selected from the group consisting of C(H) and C(C1-C6alkoxy). In some embodiments, each C(R6) is selected from the group consisting of C(H) and C(methoxy). In some embodiments,each C(R6) is C(H). In some embodiments, R1is selected from the group consisting of, , ,

[0084] In some embodiments R1is selected from the group consisting of,

[0085] In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing one or two heteroatoms selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing one or two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing two heteroatoms selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5. In some embodiments, A is a 6-membered heteroaryl or heterocycloalkyl group containing one heteroatom selected from the group consisting of N and O, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5.

[0086] In some embodiments, each R5is independently selected from the group consisting of halogen, oxo, thioxo, C1-C4alkyl, C1-C4alkoxy, C1-C6haloalkyl, CD3, CD2CD3, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl of R5is optionally substituted with one or more R6; or two geminal R5, together with the intervening geminal carbon atom, form a C3-C6 cycloalkyl. In some embodiments, each R5is independently selected from the group consisting of halogen, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, C1-C6 haloalkyl, CD3, CD2CD3, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl of R5is optionally substituted with one or more R6; or two geminal R5, together with the intervening geminal carbon atom, form a cyclopropyl. In some embodiments, each R5is oxo, thioxo, or methyl, or two geminal R5, together with the intervening geminal carbon atom, form a cyclopropyl. In some embodiments, each R5is oxo, thioxo, or methyl, or two geminal R5, together with the intervening geminal carbon atom, form a cyclopropyl. In some embodiments, two geminal R5, together with the intervening geminal carbon atom, form a cyclopropyl.

[0087] In some embodiments, each R5is independently selected from the group consisting of halogen, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, C1-C6 haloalkyl, CD3, CD2CD3, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl of R5is optionally substituted with one or more R6. In some embodiments, each R5is independently selected from the group consisting of halogen, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, and C1-C6 haloalkyl, wherein the alkyl, alkoxy, or haloalkyl of R5is optionally substituted with one or more R6. In some embodiments, each R5is independently selected from the group consisting of oxo, thioxo, C1-C4alkyl, C1- C4 alkoxy, and C1-C4 haloalkyl, wherein the alkyl, alkoxy, haloalkyl, or cycloalkyl of R5is optionally substituted with one or more R6. In some embodiments, each R5is oxo, thioxo, CD3, or methyl. In some embodiments, each R5is oxo, thioxo, CD3, or methyl.

[0088] In some embodiments, R2is H, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, CN, OH, CH2OH, NH2, or CH2NH2. In some embodiments, R2is H or CN. In some embodiments, R2is H.

[0089] In some embodiments, R3and R4are each independently selected from the group consisting of -OH, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 haloalkyl, C1-C4 alkylaryl, and aryl. In some embodiments, R3and R4are each independently selected from the group consisting of -OH, C1-C4alkyl, C1-C4alkoxy, and C1-C4haloalkyl. In some embodiments, R3and R4are eachindependently selected from the group consisting of -OH and methyl. In some embodiments, R3and R4are each methyl. In some embodiments, R3is methyl and R4is -OH.

[0090] In some embodiments, n is an integer from 1 to 3. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In some embodiments, n is 2.

[0091] In some embodiments, n is 1, and R3and R4are each independently selected from the group consisting of -OH and methyl. In some embodiments, n is 2, and R3and R4are each independently selected from the group consisting of -OH and methyl. In some embodiments, n is 1, and R3and R4are each methyl. In some embodiments, n is 2, and R3and R4are each methyl. In some embodiments, n is 1, R3is methyl and R4is -OH. In some embodiments, n is 2, R3is methyl and R4is -OH.

[0092] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-1):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0093] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-2):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0094] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ia-3):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0095] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-1):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3.

[0096] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-2):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3.

[0097] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-3):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3.

[0098] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-4):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3.

[0099] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-5):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3, and X1, X2, X3, and X4are each independently N or C(R7).

[0100] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-6):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein X5is N, CH, or C(R6); and m is an integer from 1 to 3.

[0101] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-7):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein X5is N, CH, or C(R6); and m is an integer from 1 to 3.

[0102] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-8):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein X5is N, CH, or C(R6); m is an integer from 1 to 3.

[0103] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-9):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 5. In some embodiments, B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integerfrom 1 to 5. In some embodiments, B is a 5- or 6-membered aryl, heterocyclyl, or heteroaryl, wherein the heterocyclyl or heteroaryl contains at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3.In some embodiments, B is a 5- or 6- membered aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3. In some embodiments, B is a 5- or 6- membered heterocyclyl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, S, and Se; and m is an integer from 1 to 3.

[0104] In some embodiments, the compounds of Formula (I) have the structure of Formula (Ib-6):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3.

[0105] In some embodiments, the compound of Formula I is selected from the compounds provided in Table 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0106] In some embodiments, the compound of Formula I is selected from the compounds provided in Table 2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0107] In some embodiments, the compound of Formula I is selected from the group consisting of:, , or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

[0108] In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts, stereoisomers, solvates, prodrugs, or tautomers thereof. In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts, stereoisomers, or tautomers thereof. In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts or stereoisomers thereof. In some embodiments of the foregoing, the compounds of Formula I are compounds or pharmaceutically acceptable salts thereof. In some embodiments, the compounds of Formula I is a compound of Table 1 or Table 2.

[0109] Table 1. Exemplary DNA-PKi Compounds

[0110] Table 2. Selected Exemplary DNA-PKi Compounds

[0111] It should be understood that all isomeric forms are included within the present disclosure, including mixtures thereof. If the compound contains a double bond, the substituent may be in the E or Z configuration. If the compound contains a disubstituted cycloalkyl, the cycloalkyl substituent may have a cis- or trans configuration. All tautomeric forms are also intended to be included.

[0112] Compounds of the present disclosure, and pharmaceutically acceptable salts, hydrates, solvates, stereoisomers and prodrugs thereof may exist in their tautomeric form (for example, as an amide or imino ether). All such tautomeric forms are contemplated herein as part of the present disclosure.

[0113] The compounds of the present disclosure may contain asymmetric or chiral centers, and, therefore, exist in different stereoisomeric forms. It is intended that all stereoisomeric forms of the compounds of the present disclosure as well as mixtures thereof, including racemic mixtures, form part of the present disclosure. In addition, the present disclosure embraces all geometric and positional isomers. For example, if a compound of the present disclosure incorporates a double bond or a fused ring, both the cis- and trans-forms, as well as mixtures, are embraced within the scope of the present disclosure. Each compound herein disclosed includes all the enantiomers that conform to the general structure of the compound. The compounds may be in a racemic or enantiomerically pure form, or any other form in terms ofstereochemistry. The assay results may reflect the data collected for the racemic form, the enantiomerically pure form, or any other form in terms of stereochemistry.

[0114] Diastereomeric mixtures can be separated into their individual diastereomers on the basis of their physical chemical differences by methods well known to those skilled in the art, such as, for example, by chromatography and / or fractional crystallization. Enantiomers can be separated by converting the enantiomeric mixture into a diastereomeric mixture by reaction with an appropriate optically active compound (e.g., chiral auxiliary such as a chiral alcohol or Mosher's acid chloride), separating the diastereomers and converting (e.g., hydrolyzing) the individual diastereomers to the corresponding pure enantiomers. Also, some of the compounds of the present disclosure may be atropisomers (e.g., substituted biaryls) and are considered as part of this present disclosure. Enantiomers can also be separated by use of a chiral HPLC column.

[0115] It is also possible that the compounds of the present disclosure may exist in different tautomeric forms, and all such forms are embraced within the scope of the present disclosure. Also, for example, all keto-enol and imine-enamine forms of the compounds are included in the present disclosure.

[0116] All stereoisomers (for example, geometric isomers, optical isomers and the like) of the present compounds (including those of the salts, solvates, esters and prodrugs of the compounds as well as the salts, solvates and esters of the prodrugs), such as those which may exist due to asymmetric carbons on various substituents, including enantiomeric forms (which may exist even in the absence of asymmetric carbons), rotameric forms, atropisomers, and diastereomeric forms, are contemplated within the scope of this present disclosure, as are positional isomers (such as, for example, 4-pyridyl and 3-pyridyl). (For example, if a compound of Formula (I) incorporates a double bond or a fused ring, both the cis- and trans- forms, as well as mixtures, are embraced within the scope of the present disclosure. Also, for example, all keto-enol and imine-enamine forms of the compounds are included in the present disclosure). Individual stereoisomers of the compounds of the present disclosure may, for example, be substantially free of other stereoisomers, or may be admixed, for example, as racemates or with all other, or other selected, stereoisomers. The chiral centers of the present disclosure can have the S or R configuration as defined by the IUPAC 1974 Recommendations.

[0117] The use of the terms “salt”, “solvate”, “ester,” “prodrug” and the like, is intended to equally apply to the salt, solvate, ester and prodrug of enantiomers, stereoisomers, rotamers, tautomers, positional isomers, racemates or prodrugs of the inventive compounds.

[0118] The compounds of Formula I may form salts which are also within the scope of this present disclosure. Reference to a compound of the Formula herein is understood to include reference to salts thereof, unless otherwise indicated.

[0119] The present disclosure is directed to compounds as described herein and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers thereof, and pharmaceutical compositions comprising one or more compounds as described herein, or pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, or tautomers thereof.Method of Synthesizing the Compounds

[0120] The compounds of the present disclosure can be prepared in a number of ways well known to those skilled in the art of organic synthesis. By way of example, compounds of the present disclosure can be synthesized using the methods described below, together with synthetic methods known in the art of synthetic organic chemistry, or variations thereon as appreciated by those skilled in the art. Standard synthetic methods and procedures for the preparation of organic molecules and functional group transformations and manipulations can be obtained from the relevant scientific literature or from standard textbooks in the field. Although not limited to any one or several sources, classic texts such as Smith, M. B., March, J., March’s Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 5th edition, John Wiley & Sons: New York, 2001; Greene, T. W., Wuts, P. G. M., Protective Groups in Organic Synthesis, 3rd edition, John Wiley & Sons: New York, 1999; R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); L. Fieser and M. Fieser, Fieser and Fieser’s Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed, Encyclopedia of Reagents for Organic Synthesis, John Wiley and Sons (1995), incorporated by reference herein, are useful and recognised reference textbooks of organic synthesis known to those in the art.

[0121] During the reaction sequences and synthetic schemes described herein, the order of certain steps may be changed, such as the introduction and removal of protecting groups. One of ordinary skill in the art will recognize that certain groups may require protection from thereaction conditions via the use of protecting groups. Protecting groups may also be used to differentiate similar functional groups in molecules. A list of protecting groups and how to introduce and remove these groups can be found in Greene, T. W., Wuts, P. G. M., Protective Groups in Organic Synthesis, 3rd edition. John Wiley & Sons. New York, 1999.

[0122] It is to be understood that the synthetic processes of the disclosure can tolerate a wide variety of functional groups, therefore various substituted starting materials can be used. The processes generally provide the desired final compound at or near the end of the overall process, although it may be desirable in certain instances to further convert the compound to a pharmaceutically acceptable salt thereof.

[0123] In the synthetic schemes described herein, compounds may be drawn with one particular configuration for simplicity. Such particular configurations are not to be construed as limiting the disclosure to one or another isomer, tautomer, regioisomer or stereoisomer, nor does it exclude mixtures of isomers, tautomers, regioisomers or stereoisomers, however, it will be understood that a given isomer, tautomer, regioisomer or stereoisomer may have a higher level of activity than another isomer, tautomer, regioisomer or stereoisomer.

[0124] Methods include, but are not limited to, those methods described below. Compounds of the present disclosure can be synthesized by following the steps outlined in General Scheme 1, which comprises different sequences of assembling intermediates or compounds. Starting materials are either commercially available or made by known procedures in the reported literature or as illustrated below. General Scheme 1.

[0125] A suitable general route for the preparation of a compound of the application can be described in General Scheme 1 herein. Reductive amination of the silacycle G1 containing a ketone function group with ethyl glycinate mediated by NaBH(OAc)3can form the amine G2, which can then be added to 2,4-dichloro-5-nitropyrimidine in the presence a base such as Et3N or K2CO3via nucleophilic substitution to provide Compound G3. Alternatively, Compound G3 can be formed by displacement reactions either from amine G8 with ethyl 2-haloacetate then 2,4-dichloro-5-nitropyrimidine or from amine G8 with 2,4-dichloro-5-nitropyrimidine then ethyl 2-haloacetate. The bicyclic core G4 can be formed by reduction of the nitro group to amine using Fe or Zn in the presence of HOAc followed by in situ lactam formation underelevated temperature (such as 40-100 C). The alkyated G5 can be formed from G4 with a halide in the presence of a base such as NaOH, NaH, K2CO3, etc. Installation of the aniline groups NH2Ar or NH2-HetAr can be performed with a Buchwald-Hartwig coupling using catalyst system such as Brett Phos G3 on the chloropyrimidine core G5 to synthesize the final product G6.Compositions Comprising Compounds of the Disclosure

[0126] Another aspect of the present disclosure relates to compositions comprising a (a) a DNA protein kinase inhibitor (DNA-PKI) and (b) a DNA cutting agent, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the composition further comprises a cell. In some embodiments, the composition further comprises a donor DNA. In some embodiments, the composition further comprises a cell and a donor DNA.

[0127] In some embodiments, the cell is a eukaryotic cell. In some embodiments, the cell is useful in adoptive cell therapy (ACT). In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a leukocyte, or a lymphocyte (e.g., a T cell, a B cell, or an NK cell). In some embodiments, the immune cell is a lymphocyte. In some embodiments, the lymphocyte is a T cell. In some embodments, the lymphocyte is a primary T cell. In some embodiments, the lymphocyte is a regulatory T cell. In some embodiments, the lymphocyte is an activated T cell. In some embodiments, the lymphocyte is a non-activated T cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is not a cancer cell.

[0128] In some embodiments, the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA.

[0129] In some embodiments, the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof.

[0130] In some embodiments, the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a double strand DNA break or single strand DNA break. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a single strand DNA break.

[0131] In some embodiments, the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. In some embodiments, the Cas nuclease is a Class 2, Type II Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 nuclease (e.g., a S. pyogenes Cas9 nuclease). In some embodiments, the Cas nuclease is a Class 2, Type V Cas nuclease. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., a Acidaminococcus sp. Cas12a nuclease).

[0132] In some embodiments, the composition comprises a modified RNA.

[0133] In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is or encodes a dual-guide RNA (dgRNA). In some embodiments, the dual -guide RNA is composed of a crRNA and tracrRNA. In some embodiments, the guide RNA nucleic acid is or encodes a single-guide (sgRNA). In some embodiments, the gRNA is a modified gRNA.

[0134] In some embodiments, the DNA cutting agent is Cas9 or an mRNA encoding Cas9, and a modified gRNA comprising a modification at one or more of the first five nucleotides at the 5’ end. In some embodiments, the cutting agent is Cas12a or an mRNA encoding Cas12a, and a modified gRNA comprising a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA comprises a modification at one or more of the last five nucleotides at the 3 ’ end.

[0135] In some embodiments, the DNA cutting agent is a Class 2, or Type II or Class 2, Type V Cas nuclease and a guide RNA nucleic acid; and the molar ratio of the guide RNA to Cas nuclease is from about 4: 1 to 1 :4.

[0136] In some embodiments, the composition further comprises a vector. In some embodiments, the vector encodes the donor DNA. In some embodiments, the vector is a viral vector (e.g., an AAV). In some embodiments, the vector is a non-viral vector. In some embodiments, the vector is a non-viral vector comprising donor DNA having a linear, close end, circular, single strand, double strand format.

[0137] In some embodiments, the composition further comprises an inhibitor of the microhomology mediated end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is a DNA polymerase theta (Pol0 or POLQ). In some embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from the group consisting of a PolQ inhibitor selected from the compounds described in J. Med. Chem 2023, 66, 6498 by Pismataro, M. C., et al. and references therein, for example, inhibitor of PolQ is ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiocin (Dana-Farber Cancer Institute, Inc.) Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof.

[0138] In some embodiments, the concentration of the DNA-PKI in the composition is about 10 μM or less. In some embodiments, the concentration of the DNA-PKI in the composition isfrom about 0.1 μM to about 10 μM. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.25 μM to about 5 μM. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.25 μM to about 10 μM. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.1 μM to about 5 μM. In some embodiments, the concentration of the DNA-PKI in the composition is from about 0.1 μM to about 0.25 μM.

[0139] Methods of Using the Disclosed Compounds

[0140] Another aspect of the present disclosure is directed to a method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0141] Another aspect of the present disclosure is directed to a method for repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the double stranded DNA break is a blunt end break. In some embodiments, the double stranded DNA break comprises paired single strand breaks (e.g., made by a combination of nickase nucleases).

[0142] Another aspect of the present disclosure is directed to a method for inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA- PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof. In some embodiments, the method further comprises contacting the cell with an inhibitor of the microhomology mediated end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is a DNA polymerase theta (Pol0 or POLQ) inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from the group consisting of a PolQ inhibitor selected from the compounds described in J. Med. Chem 2023, 66, 6498 by Pismataro, M. C., et al. and references therein, for example, inhibitor of PolQ is ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited),novobiocin (Dana-Farber Cancer Institute, Inc.) Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof.

[0143] Another aspect of the present disclosure is directed to a method for targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, or tautomer thereof.

[0144] In some embodiments of the methods disclosed herein, the method comprises growing the cell in a cell medium free of the DNA-PKI, and adding the DNA-PKI to the cell medium.

[0145] In some embodiments of the methods disclosed herein, the method comprises contacting the cell with the DNA cutting agent before contacting the cell with the DNA-PKI. In some embodiments, the method comprises contacting the cell with the DNA-PKI within about six hours of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI within about three hours of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI within about two hours of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI between about 15 minutes and about 45 minutes of contacting the cell with the DNA cutting agent. In some embodiments, the methods comprise contacting the cell with the DNA-PKI about 30 minutes of contacting the cell with the DNA cutting agent.

[0146] In some embodiments, the methods comprise contacting the cell with the DNA cutting agent simultaneously with the DNA-PKI.

[0147] In some embodiments of the methods disclosed herein, the method comprises growing the cell in a cell medium comprising the DNA-PKI.

[0148] In some embodiments, the methods comprise contacting the cell with the DNA cutting agent after contacting the cell with the DNA-PKI. In some embodiments, the methods comprise contacting the cell with the DNA cutting agent within about three hours of contacting the cell with the DNA-PKI.

[0149] In some embodiments, contacting the cell with the DNA cutting agent comprises electroporating the cell to allow the DNA cutting agent to enter the cell. In some embodiments, contacting the cell with the DNA cutting agent comprises delivering the DNA cutting agent to the cell using other methods, e.g., microinjection or via a lipid nanoparticle, liposome,exosome, or gold nanoparticle. In some embodiments, the methods comprise contacting the cell with the DNA cutting agent and the donor DNA simultaneously.

[0150] In some embodiments of the methods disclosed herein, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for at least about one day. In some embodiments, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for about one day. In some embodiments, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for between about one day and about two weeks. In some embodiments, the method comprises contacting the cell with the DNA cutting agent and the DNA-PKI for about two weeks.

[0151] In some embodiments of the methods disclosed herein, the method comprises contacting the cell with the DNA-PKI in a cell medium, wherein the concentration of the DNA-PKI in the cell medium is about 10 μM or less. In some embodiments, the method comprises contacting the cell with the DNA-PKI in a cell medium, wherein the concentration of the DNA- PKI in the cell medium is between about 0.1 μM and about 10 μM. In some embodiments, the method comprises contacting the cell with the DNA-PKI in a cell medium, wherein the concentration of the DNA-PKI in the cell medium is between about 0.25 μM and about 5 μM.

[0152] In some embodiments of the methods disclosed herein, the cell is a eukaryotic cell. In some embodiments, the cell is for use in adoptive cell therapy (ACT). In some embodiments, the cell is for use in autologous cell therapy. In some embodiments, the cell is for use in allogenic cell therapy. In some embodiments, the cell is a stem cell. In some embodiments, the cell is a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). In some embodiments, the cell is an immune cell. In some embodiments, the immune cell is a leukocyte, or a lymphocyte (e.g., a T cell, a B cell, or an NK cell). In some embodiments, the immune cell is a lymphocyte. In some embodiments, the lymphocyte is a T cell. In some embedments, the lymphocyte is a primary T cell. In some embodiments, the lymphocyte is a regulatory T cell. In some embodiments, the lymphocyte is an activated T cell. In some embodiments, the lymphocyte is a non-activated T cell. In some embodiments, the cell is a human cell. In some embodiments, the cell is not a cancer cell.

[0153] In some embodiments of the methods disclosed herein, the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof.

[0154] In some embodiments of the methods disclosed herein, the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a double strand DNA break or single strand DNA break. In some embodiments, the CRISPR / Cas nuclease component comprises or encodes a CRISPR / Cas nuclease that generates a single strand DNA break.

[0155] In some embodiments of the methods disclosed herein, the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. In some embodiments, the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. In some embodiments, the Cas nuclease is a Class 2, Type II Cas nuclease. In some embodiments, the Cas nuclease is a Cas9 nuclease (e g., a S. pyogenes Cas9 nuclease). In some embodiments, the Cas nuclease is a Class 2, Type V Cas nuclease. In some embodiments, the Cas nuclease is a Cas12a nuclease (e.g., a Acidaminococcus sp. Cas12a nuclease).

[0156] In some embodiments of the methods disclosed herein, the methods further comprise contacting the cell with a modified RNA.

[0157] In some embodiments of the methods disclosed herein, the methods further comprise contacting the cell with a guide RNA component. In some embodiments, the guide RNA component is a guide RNA nucleic acid. In some embodiments, the guide RNA component is a guide RNA (gRNA). In some embodiments, the guide RNA nucleic acid is or encodes a dualguide RNA (dgRNA). In some embodiments, the guide RNA nucleic acid is or encodes a single-guide (sgRNA). In some embodiments, the gRNA is a modified gRNA.

[0158] In some embodiments of the methods disclosed herein, the DNA cutting agent is Cas9 or an mRNA encoding Cas9, and a modified gRNA comprising a modification at one or more of the first five nucleotides at the 5’ end. In some embodiments, the cutting agent is Cas 12a or an mRNA encoding Cas12a, and a modified gRNA comprising a DNA / RNA hybrid molecule. In some embodiments, the modified gRNA comprises a modification at one or more of the last five nucleotides at the 3’ end.

[0159] In some embodiments of the methods disclosed herein, the DNA cutting agent is a Class 2, Type II or Class 2, Type V Cas nuclease and a guide RNA nucleic acid; and the molar ratio of the guide RNA to Cas nuclease is from about 4: 1 to 1 :4.

[0160] In some embodiments of the methods disclosed herein, the DNA cutting agent interacts with a target sequence within the TRAC gene of a T cell.

[0161] In some embodiments of the methods disclosed herein, the methods comprise contacting the cell with at least two different DNA cutting agents targeting different loci.

[0162] In some embodiments, the methods comprise contacting the cell with a vector encoding the DNA cutting agent. In some embodiments, the vector encodes the DNA cutting agent and the donor DNA. In some embodiments, the methods comprise contacting the cell with a vector encoding the DNA cutting agent, and a second vector encoding the donor DNA.

[0163] In some embodiments, the vector is a viral vector (e.g., an AAV). In some embodiments, the vector is a non-viral vector. In some embodiments, the vector is a non-viral vector comprising donor DNA having a linear, close end, circular, single strand, double strand format.

[0164] In some embodiments of the methods disclosed herein, the DNA cutting agent interacts with a target sequence within the genome of the cell, resulting in a double stranded DNA break (DSB).

[0165] In some embodiments of the methods disclosed herein, the methods further comprise contacting the cell with a donor DNA. In some embodiments, the methods comprise contacting the cell with a vector comprising the donor DNA. In some embodiments, the vector encodes the donor DNA. In some embodiments, the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA. In some embodiments, the donor DNA comprises a template comprising an exogenous nucleic acid encoding a protein. In some embodiments, the protein is selected from a cytokine, an immunosuppressor, an antibody, a receptor, and an enzyme. In some embodiments, the protein is a receptor. In some embodiments, the receptor is selected from an immunological receptor, a T-cell receptor (TCR), and a chimeric antigen receptor. In some embodiments, the exogenous nucleic acid encodes a TCR chain of a TCR, e.g. a TCR alpha, beta, delta, or gamma chain, or any combination thereof. In some embodiments, the exogenous nucleic acid encodes a TCR alpha and / or TCR beta chain. In some embodiments, the template comprises a first homology arm and a second homology arm that are complementary to sequences located upstream and downstream of the cleavage site, respectively.

[0166] In some embodiments of the methods disclosed herein, the method results in a gene knockout. In some embodiments of the methods disclosed herein, the method results in a genecorrection. In some embodiments of the methods disclosed herein, the method results in a gene insertion.

[0167] In some embodiments, the methods further comprise contacting the cell with an inhibitor of the microhomology mediated end joining (MMEJ) pathway. In some embodiments, the inhibitor of the MMEJ pathway is a DNA polymerase theta (Polu or POLQ). In some embodiments, the inhibitor of the MMEJ pathway is a FEN1 inhibitor. In some embodiments, the inhibitor of the MMEJ pathway is selected from the group consisting of a PolQ inhibitor selected from the compounds described in J. Med. Chem 2023, 66, 6498 by Pismataro, M. C., et al. and references therein, for example, inhibitor of PolQ is ART558 (Artios Pharma Limited), ART812 (Artios Pharma Limited), novobiocin (Dana-Farber Cancer Institute, Inc.) Compound 23 (Ideaya Biosciences, Inc.), and RP-6685 (Repare Therapeutics), or combinations thereof.

[0168] Another aspect of the present disclosure relates to compounds of Formula (I), and pharmaceutically acceptable salts, hydrates, solvates, prodrugs, stereoisomers, tautomers, or pharmaceutical compositions thereof, for use in the manufacture of a medicament for cell therapy.

[0169] Another aspect of the present disclosure relates to the use of a compound of Formula (I), or a pharmaceutically acceptable salt, hydrate, solvate, prodrug, stereoisomer, tautomer, or pharmaceutical composition thereof, in the treatment of a cell.

[0170] In one embodiment, the subject is a mammal.

[0171] In one embodiment, the mammal is a human.

[0172] Administration of the disclosed compounds may also be accomplished via any mode of administration for therapeutic agents. These modes include systemic or local administration such as oral, nasal, parenteral, transdermal, subcutaneous, vaginal, buccal, rectal or topical administration modes.

[0173] Depending on the intended mode of administration, the disclosed compositions can be in solid, semi-solid or liquid dosage form, such as, for example, injectables, tablets, suppositories, pills, time-release capsules, elixirs, tinctures, emulsions, syrups, powders, liquids, suspensions, or the like, sometimes in unit dosages and consistent with conventional pharmaceutical practices. Likewise, they can also be administered in intravenous (both bolus and infusion),intraperitoneal, subcutaneous or intramuscular form, and all using forms well known to those skilled in the pharmaceutical arts.

[0174] Illustrative pharmaceutical compositions are tablets and gelatin capsules comprising a compound of the present disclosure and a pharmaceutically acceptable carrier, such as a) a diluent, e.g., purified water, triglyceride oils, such as hydrogenated or partially hydrogenated vegetable oil, or mixtures thereof, corn oil, olive oil, sunflower oil, safflower oil, fish oils, such as EPA or DHA, or their esters or triglycerides or mixtures thereof, omega-3 fatty acids or derivatives thereof, lactose, dextrose, sucrose, mannitol, sorbitol, cellulose, sodium, saccharin, glucose and / or glycine; b) a lubricant, e.g., silica, talcum, stearic acid, its magnesium or calcium salt, sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and / or polyethylene glycol; for tablets also; c) a binder, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, magnesium carbonate, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium alginate, waxes and / or polyvinylpyrrolidone, if desired; d) a disintegrant, e.g., starches, agar, methyl cellulose, bentonite, xanthan gum, algic acid or its sodium salt, or effervescent mixtures; e) absorbent, colorant, flavorant and sweetener; f) an emulsifier or dispersing agent, such as Tween 80, Labrasol, HPMC, DOSS, caproyl 909, labrafac, labrafil, peceol, transcutol, capmul MCM, capmul PG-12, captex 355, gelucire, vitamin E TGPS or other acceptable emulsifier; and / or g) an agent that enhances absorption of the compound such as cyclodextrin, hydroxypropyl-cyclodextrin, PEG400, PEG200.

[0175] Liquid, particularly injectable, compositions can, for example, be prepared by dissolution, dispersion, etc. For example, the disclosed compound is dissolved in or mixed with a pharmaceutically acceptable solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form an injectable isotonic solution or suspension. Proteins such as albumin, chylomicron particles, or serum proteins can be used to solubilize the disclosed compounds.

[0176] The disclosed compounds may be also formulated as a suppository that can be prepared from fatty emulsions or suspensions; using polyalkylene glycols such as propylene glycol, as the carrier.

[0177] The disclosed compounds may also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines. In some embodiments, a film of lipid components is hydrated with an aqueous solution of drug to a form lipid layer encapsulating the drug, as described in U.S. Pat. No.5,262,564 which is hereby incorporated by reference in its entirety.

[0178] Disclosed compounds may also be delivered by the use of monoclonal antibodies as individual carriers to which the disclosed compounds are coupled. The disclosed compounds can also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropylmethacrylamide-phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysine substituted with palmitoyl residues. Furthermore, the Disclosed compounds can be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross-linked or amphipathic block copolymers of hydrogels. In one embodiment, disclosed compounds are not covalently bound to a polymer, e.g., a polycarboxylic acid polymer, or a polyacrylate.

[0179] Parenteral injectable administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions or solid forms suitable for dissolving in liquid prior to injection.

[0180] Another aspect of the present disclosure is directed to pharmaceutical compositions comprising a compound of Formula (I) and a pharmaceutically acceptable carrier. The pharmaceutical acceptable carrier may further include an excipient, diluent, or surfactant. In some embodiments, the pharmaceutical composition can further comprise an additional pharmaceutically active agent.

[0181] In one embodiment, the pharmaceutical acceptable carrier further comprises an excipient, diluent, surfactant, or any combination thereof.

[0182] In one embodiment, the pharmaceutical composition further comprises at least one additional therapeutic agent.

[0183] Another aspect of the present disclosure is directed to pharmaceutical compositions for use in cell therapy comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

[0184] Compositions can be prepared according to conventional mixing, granulating or coating methods, respectively, and the present pharmaceutical compositions can contain from about 0.1% to about 99%, from about 5% to about 90%, or from about 1% to about 20% of the disclosed compound by weight or volume.

[0185] In one embodiment, the composition comprises about 1 mg to about 2000 mg of the compound.

[0186] In one embodiment, the composition is administered to the subject twice daily, once daily, once every other day, or once weekly. EXAMPLES

[0187] The disclosure is further illustrated by the following examples and synthesis schemes, which are not to be construed as limiting this disclosure in scope or spirit to the specific procedures herein described. It is to be understood that the examples are provided to illustrate certain embodiments and that no limitation to the scope of the disclosure is intended thereby. It is to be further understood that resort may be had to various other embodiments, modifications, and equivalents thereof which may suggest themselves to those skilled in the art without departing from the spirit of the present disclosure and / or scope of the appended claims.

[0188] The compounds of the present disclosure may be prepared by use of known chemical reactions and procedures. Nevertheless, the following general preparative methods are presented to aid the reader in synthesizing the compounds with specific details provided below in the experimental section to illustrate working examples.

[0189] All variable groups of these methods are as described in the generic description if they are not specifically defined below.

[0190] It is recognized that compounds of the disclosure with each claimed optional functional group may not be prepared by each of the below-listed methods. Within the scope of each method, optional substituents may appear on reagents or intermediates which may act as protecting or otherwise non-participating groups. Utilizing methods well known to thoseskilled in the art, these groups are introduced and / or removed during the course of the synthetic schemes which provide the compounds of the present disclosure.

[0191] Abbreviations used in the following examples and elsewhere herein are:Analytical ProceduresNMR

[0192] The following conditions were used for obtaining proton nuclear magnetic resonance (NMR) spectra: NMR spectra were taken in either 400 MHz or 500 MHz. Bruker instrument using either DMSO-de or CDCI3 as solvent and internal standard. The crude NMR data was analyzed by using either ACD Spectrus version 2015-01 by ADC Labs or MestReNova software.

[0193] Chemical shifts are reported in parts per million (ppm) downfield from internal tetramethylsilane (TMS) or from the position of TMS inferred by the deuterated NMR solvent. Apparent multiplicities are reported as: singlet-s, doublet-d, triplet-t, quartet-q, or multiplet- m. Peaks that exhibit broadening are further denoted as br. Integrations are approximate. It should be noted that integration intensities, peak shapes, chemical shifts and coupling constants can be dependent on solvent, concentration, temperature, pH, and other factors. Further, peaks that overlap with or exchange with water or solvent peaks in the NMR spectrum may not provide reliable integration intensities. In some cases, NMR spectra may be obtained using water peak suppression, which may result in overlapping peaks not being visible or having altered shape and / or integration.Liquid Chromatography

[0194] The following preparative and / or analytical (LC / MS) liquid chromatography methods were used.

[0195] Method A: Column: XBridge Cl 8, 2.1 mm x 50 mm, 1 .7 μm particles; Mobile Phase A: ACN / H2O (5:95) with 10 mM AA; Mobile Phase B: ACN / H2O (95:5) with 10 mM AA; Temperature: 50 °C; Gradient: 0-100 %B (0.0-3.0 min), 100 %B (3.0-3.5 min); Flow: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI +).

[0196] Method B: Column: XBridge C18, 2.1 mm x 50 mm, 1.7 μm particles; Mobile Phase A: ACN / H2O (5:95) with 0.05 % TFA; Mobile Phase B: ACN / H2O (95:5) with 0.05 % TFA;Temperature: 50 °C; Gradient: 0-100 %B (0.0-3.0 min), 100 %B (3.0-3.5 min); Flow: 1.0 mL / min; Detection: UV (220 nm) and MS (ESI +).

[0197] UHPLC Method D: Column: Waters Acquity BEH Cl 8 2.1 x 50 mm 1.7 pm particles; Mobile Phase A: 95:5 acetonitrile: water with 0.05% TFA; Mobile Phase B: 95:5 acetonitrile: water with 0.05% TFA; Temperature: 50 °C; Gradient: 0 %B to 100 %B over 3.00 min, then a 0.50 min hold at 100 %B; Flow: 1.0 mL / min; Detection: MS and UV (254 nm).

[0198] UHPLC Method E: Column: Waters Acquity BEH C18 2.1 x 50 mm 1.7 pm particles; Mobile Phase A: 95:5 acetonitrile: water with 0.05% TFA; Mobile Phase B: 95:5 acetonitrile: water with 0.05% TFA; Temperature: 50 °C; Gradient: 0 %B to 100 %B over 1.5 min, then a 0.50 min hold at 100 %B; Flow: 1.0 mL / min; Detection: MS and UV (254 nm).

[0199] UHPLC Method F: Column: Waters Acquity BEH C18 3.0 x 50 mm 1.7 pm particles; Mobile Phase A: 0. 1% TFA in water; Mobile Phase B: 0. 1% TFA in ACN; Temperature: 50 °C; Gradient: 20%B to 98 %B over 1.5 min, then a 0.50 min hold at 98 %B; Flow: 0.7 mL / min; Detection: MS and UV (254 nm).

[0200] UHPLC Method G: Column: Waters Acquity BEH C18 3.0 x 50 mm 1.7 pm particles; Mobile Phase A: 5mm Ammonium formate pH 3.3 ACN (98:02); Mobile Phase B: ACN: Buffer (98:02); Temperature: 50 °C; Gradient: 20%B to 98 %B over 1.5 min, then a 0.50 min hold at 98 %B; Flow: 0.7 mL / min; Detection: MS and UV (254 nm).

[0201] UHPLC Method H: Column: Kinetex XB - C18 (75 x 3 mm), 2.6 pm particles; Mobile Phase A: 5mm Ammonium formate pH 3.3 ACN (98:02); Mobile Phase B: ACN: Buffer (98:02); Temperature: 50 °C; Gradient: 80%B to 100 %B over 4.0 min, then a 0.50 min hold at 100 %B; Flow: 1.0 mL / min; Detection: MS and UV (254 nm).

[0202] LCMS method I: Column: Kinetex XB- C18 (75x3mm) 2.6 pm; Mobile phase: A :0.1% TFA in H2O; Mobile phase: B: 0.1% TFA in ACN; Flow Rate: 1.0 mL / min. Time / Gradient: 5% B to 95 %B in 2.5 min, then hold at 95 %B for 2 min hold at 95 %B.

[0203] Analytical HPLC A: Column: Kinetex Biphenyl (100X4.6) mm, 2.6pm, Mobile phase: A: 0.05% TFA in WATER: ACN; Mobile phase: B: 0.05% TFA IN ACNWATER; Flow: 1.0 mL / min; Time / Gradient (%B): 0 / 10, 9 / 60, 11 / 100, 11.1 / 100 (1.5 mL / min), 12.5 / 100 (1.5 mL / min). 13 / 10, 15 / 10.

[0204] Analytical HPLC B: Column: X-select CSH C18 (150X4.6) mm, 3.5pm, Mobile phase: A: 10mM Ammonium acetate in water. Mobile phase: B: CAN, Flow: 1 .0 mL / min, Time (min) / Grad (%B): 0 / 30, 9 / 70, 11 / 100, 11.1 / 100 (1.5 ml / min), 12.5 / 100 (1.5 ml / min), 13 / 30, 15 / 30.Example 1. 8‐(1,1‐Dimethylsilinan‐4‐yl)‐5‐methyl‐2‐({7‐methyl‐[1,2,4]triazolo[1,5‐a]pyridin‐6‐ yl}amino)‐5,6,7,8‐tetrahydropteridin‐6‐one (Compound 1)Step 1. Synthesis of 1,1-Dimethylsilinan-4-one.

[0205] Dry n-hexane (300 mL) was added into a 1-l round-bottomed flask. Argon was purged for 5 min at chilled condition. Dimethyldivinylsilane (13.68 mL, 89 mmol) and 9- borabicyclo[3.3.1]nonane dimer (21.74 g, 89 mmol) were added and the reaction mixture was heated to reflux for 2 h at 72 °C. It was cooled to RT. Borane dimethyl sulfide complex (8.46 mL, 89 mmol) was added and again heated to reflux for 2 h. It was cooled to RT. Methanol (32 mL) was added slowly and stirred at RT for 16 h. The solvents were removed under vacuum at 43 °C. To that crude was added tetrahydrofuran (720 mL) and chilled to 0 °C. Dichloro(methoxy)methane (8.53 mL, 89 mmol) was added followed by lithium tert-butoxide solution in THF (223 mL, 445 mmol). The temperature was slowly raised to RT and stirred at RT for 1 h. Ethanol (120 mL) was added followed by NaOH (10.69 g, 267 mmol) in water (35 mL), followed by slow addition of hydrogen peroxide (16 mL, 157 mmol) [High exotherm observed]. After addition, the mixture was heated to reflux for 3 h. Initially very thick mass was formed after 30 min at reflux condition the reaction mass become slurry. After 3 h, the reaction was cooled to RT and water (300 mL) was added. The organic layer was separated, and the aqueous layer was again extracted with ethyl acetate. All organic layers were combined and dried in sodium sulphate. The crude was concentrated and purified by silica gel column (120 g column) eluting with 10% Ethyl acetate in PE to give the desired 1,1-dimethylsilinan-4-one (8.5 g, 44.8 mmol, 50.3 % yield).1H NMR (400 MHz, CDCl3) h 2.52 (dd, J = 7.8, 5.8 Hz, 4H), 0.97-0.90 (m, 4H), 0.18 (s, 6H).13C NMR (101 MHz, CDCl3) h 215.10, 37.78, 10.65, -3.10 ppm. GC-MS m / z 142.0 [M]+, RT= 14.55 min, 90.1% pure (Column: HP-5MS 30 m x 0.25 mm x 0.25 um) carrier gas: helium. Flow rate 1 mL / min. Oven program Rate [°C / min] 0, target value [°C] 35, hold time [min] 4; Oven program Rate [°C / min] 10, target value [°C] 180, hold time [min] 4; Oven program Rate [°C / min] 10, target value [°C] 240, hold time [min] 4. Step 2. Synthesis of 1,1-Dimethylsilinan-4-amine, HCl

[0206] 1,1-Dimethylsilinan-4-one (6.5 g, 45.7 mmol) and ethanol (450 mL) were added into a 100-ml round-bottomed flask. Water (45 ml) was added followed by hydroxylamine hydrochloride (9.52 g, 137 mmol) and sodium acetate (14.99 g, 183 mmol). The reaction mixture was heated to 80 °C and maintained at 80 °C for 2 h. After cooling to RT, the solvents were removed under vacuum. DCM was added and washed with water. The organic layer was dried in sodium sulphate, concentrated and the crude was taken for next step without purification. The above oxime intermediate was dissolved in anhydrous THF (450 mL) and cooled to 0 °C in an ice water bath.

[0207] Lithium aluminum hydride (12.14 g, 320 mmol) powder was added portion-wise to the stirring mixture. The solution was warmed up to ambient temperature then heated to reflux for 4 h.

[0208] The reaction mass was cooled to room temperature, then cooled to 0 °C in ice water bath and quenched with sequential addition of water (12 mL) / 15% NaOH (12 mL) solution and water (36 mL). The resulting slurry was warmed up to ambient temperature and filtered, and the solvents were removed under pressure.4M HCl in dioxane (30 mL) was added to the oily residue and solvent was removed pressure to give a white solid. MTBE (50 mL) was added to the white solid. After continued stirring for 30 min, the white solid was filtered and dried to give 1,1-dimethylsilinan-4-amine, HCl (3.2 g, 39% yield).1H NMR (400 MHz, CDCl3) h 8.29 (br. s, 2H), 3.04 (br. s, 1H), 2.56-2.54 (m, 2H), 1.82-1.76 (m, 2H), 0.86-0.82 (m, 2H), 0.59- 0.51 (m, 2H), 0.04 (s, 3H), -0.02 (s, 3H).13C NMR (101 MHz, CDCl3) h 53.48, 29.12, 11.03, -2.64 , -4.24 ppm. GC-MS m / z 143.0 [M+H]+, RT= 13.90 min, 96.3% pure. (Column: HP- 5MS 30 m x 0.25 mm x 0.25 um) carrier gas: helium. Flow rate 1 mL / min. Oven program Rate[°C / min] 0, target value [°C] 80, hold time [min] 0.75; Oven program Rate [°C / min] 30, target value [°C] 260, hold time [min] 4; Step 3. Synthesis of Ethyl (1,1-dimethylsilinan-4-yl)glycinate.

[0209] To a stirred solution of 1,1-dimethylsilinan-4-amine, HCl (500 mg, 2.78 mmol) in Acetonitrile (10 mL) were added DIPEA (1.214 mL, 6.95 mmol) and Ethyl bromoacetate (557 mg, 3.34 mmol) at ambient temperature. Then, it was stirred at 25 °C for 16 h. The reaction was monitored by TLC and LCMS. The reaction mixture was diluted with water (50 mL). The crude product was extracted with ethyl acetate (2 x 70 mL). The combined organic layer was washed with brine, dried with anhydrous sodium sulfate, and concentrated under reduced pressure to give ethyl (1,1-dimethylsilinan-4-yl)glycinate (550 mg, 1.582 mmol, 56.9 % yield). LCMS m / z [M+H]+;230.2 RT = 1.90 min. Column :Kinetex XB - ?07 (64 q 2 / )ff+ 1-5^f Mobile Phase :A :5mm Ammonium formate pH 3.3 :ACN (98:02)Mobile Phase :A :5mm Ammonium formate pH 3.3 :ACN (98:02) Flow Rate :1.0 ml / min. 0.00 min 20% B to 4.00 min 100% B. Step 4. Synthesis of Ethyl N-(2-chloro-5-nitropyrimidin-4-yl)-N-(1,1-dimethylsilinan-4- yl)glycinate.

[0210] To a stirred solution of ethyl (1,1-dimethylsilinan-4-yl)glycinate (550 mg, 2.40 mmol) in acetonitrile (15 mL) were added DIPEA (0.84 mL, 4.80 mmol) and 2,4-dichloro-5- nitropyrimidine (465 mg, 2.40 mmol) at 0-25 °C. Then, it was stirred at 25 °C for 1 h. The reaction was monitored by TLC and LCMS. The reaction mixture was diluted with water (70 mL). The crude product was extracted with ethyl acetate (2 x 80 mL), The combined organic layer was washed with brine, dried with anhydrous sodium sulphate, and concentrated under reduced pressure. The crude product was purified by RP-column purification in (0.1%ammonium acetate: ACN) to obtain ethyl N-(2-chloro-5-nitropyrimidin-4-yl)-N-(l ,l - dimethylsilinan-4-yl)glycinate (700 mg, 65.6 % yield) as a pale-yellow solid. LCMS ESI m / z [M+H]+; 387.0; RT = 0.87 min. LCMS Conditions: Column :Kinetex XB - C18 (75 x 30)mm, 2.6pm Mobile Phase :A :5mm Ammonium formate pH 3.3 ACN (98:02)Mobile Phase :A :5mm Ammonium formate pH 3.3 ACN (98:02)Flow Rate :1.0 ml / min. Time: 0.00 min 80%B, 4.0 min, 100% B.Step 5. Synthesis of 2-Chloro-8-(l,l-dimethylsilinan-4-yl)-7,8-dihydropteridin-6(5H)-one.

[0211] To a stirred solution of ethyl N-(2-chloro-5-nitropyrimidin-4-yl)-N-(l,l-dimethylsilinan- 4-yl)glycinate (700 mg, 1.809 mmol) in acetic acid (10 mL) was added iron (303 mg, 5.43 mmol) at 25 ° C. Then, it was stirred at 80 °C for 5 hr. The reaction was monitored by TLC and LCMS. The reaction mixture was diluted with water (80 mL). The crude product was extracted with ethyl acetate (2 x 100 mL). The combined organic layers were washed with brine, dried with anhydrous sodium sulphate, and concentrated under reduced pressure to give 2-chloro-8-(l,l-dimethylsilinan-4-yl)-7,8-dihydropteridin-6(5H)-one (400 mg, 1.184 mmol, 65.4 % yield) as a pale-yellow solid. LCMS ESI m / z 311.0 [M+H]+, RT = 2.95 min. Column :Kinetex XB - C18 (75 x 30) mm, 2.6pm Mobile Phase :A :5mm Ammonium formate pH 3.3 :ACN (98 :02)Mobile Phase :A :5mm Ammonium formate pH 3.3 :ACN (98:02)FlowRate : 1.0 ml / min. 0.00 min 20% B to 4.00 min 100% B.Step 6. Synthesis of 8-(l,l-Dimethylsilinan-4-yl)-5-methyl-2-((7-methyl-[l,2,4]triazolo[l,5- a]pyridin-6-yl)amino)-7,8-dihydropteridin-6(5H)-one.

[0212] 2-Chloro-9-(l,l-dimethylsilinan-4-yl)-7-methyl-7,9-dihydro-8H-purin-8-one (0.0182 g, 0.059 mmol) and 7-methyl-[l,2,4]triazolo[l,5-a]pyridin-6-amine (0.019 g, 0.129 mmol) weredissolved in 1,4-dioxane (0.5 mL). N2was bubbled into the solution for a couple of minutes. BRETTPHOS PD G3 (10.61 mg, 0.012 mmol) was added followed by cesium carbonate (0.038 g, 0.117 mmol). The reaction was bubbled N2 for an additional 1 min. It was capped and heated at 100 °C for 2 h. then 95 °C for 16 h. After cooling the reaction was filtered and concentrated, it wasdissolved in MeOH, filtered, and submitted to purification to give the titled compound (4.8 mg 12% yield).1H NMR (500 MHz, DMSO-d6) ^ 9.21 (s, 1H), 8.39 (br d, J=2.0 Hz, 1H), 8.35 (s, 1H), 7.73 (s, 1H), 7.70 (s, 1H), 4.29 - 4.20 (m, 1H), 4.08 (s, 2H), 3.44 - 3.37 (m, 2H), 2.42 (s, 3H), 1.82 - 1.72 (m, 4H), 0.76 (br d, J=14.2 Hz, 2H), 0.58 - 0.49 (m, 2H), 0.06 (s, 3H), 0.03 - -0.03 (m, 3H), missing 1 proton, Analytical LCMS ESI m / z 437.3 [M+H]+; RT = 1.83 min, 99% (Method A); 437.2 [M+H]+, RT = 1.44 min, 99% (Method B).

[0213] The following Compounds of Table 3 were prepared in a methodology analogous to that of Example 1, using suitable reagents, precursors, and starting materials.

[0214] Table 3. Compounds Prepared According to Example 1Biological Examples

[0215] DNA-PK Biochemical Assay using Reaction Biology’s HotSpot Kinase Assay Protocol:

[0216] Reagent: Base Reaction buffer; 20 mM Hepes (pH 7.5), 10 mM MgCl2, 1 mM EGTA, 0.01% Brij35, 0.02 mg / ml BSA, 0.1 mM Na3VO4, 2 mM DTT, 1% DMSO Required cofactors were added individually to each kinase reaction.

[0217] Reaction Procedure: 1. Prepared substrate in freshly prepared Reaction Buffer; 2. Delivered any required cofactors to the substrate solution above; 3. Delivered kinase into the substrate solution and gently mixed; 4. Delivered compounds in 100% DMSO into the kinase reaction mixture by Acoustic technology (Echo550; nanoliter range), incubated for 20 min at room temperature; 5. Delivered 33P-ATP into the reaction mixture to initiate the reaction; 6. Incubated for 2 hours at room temperature; 7. Detected kinase activity by P81 filter-binding method. Activity Table

[0218] Various compounds were evaluated in the DNA-PK biochemical assay.

[0219] Table 4. DNA-PK Biochemical AssayT Cell Cytotoxicity Assay- CD3 Glo Proliferation Assay:

[0220] Frozen vials of CD3 T cells were thawed in assay media (RPMI 1640, 5% HI FBS, 1x L / G, 1X NEAA, 1X Sodium Pyruvate, 1X P / S (Gibco, Waltham MA), and viable cells counted using the Moxi V cell counter (Orflo, Ketchum ID). Thawed T cells were collected bycentrifugation at 1600 rpm for 10 mins at room temperature. T cell pellets were resuspended in 10 ml of assay media in 50 ml conical tube and allowed to rest in 37 °C incubator for 1 hour. T cell suspension was removed from 37 °C incubator and diluted to 5e5 cells per ml. T cells were then stimulated using an anti-CD3 / anti-CD28 stimulatory reagent prepared using an oligomeric streptavidin mutein reagent produced as described in WO 2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)) at 4 ug per 1 million T cells for 24 hours at 37 °C. The next day, compound plates were prepared by ten, 3-fold serial dilutions in 100% DMSO with top concentration at 3 mM. All compound dilutions were done on Echo-qualified 384w plates (Beckman, Indianapolis IN) before 200 nanoliters were acoustically transferred to Corning 384w tissue culture treated plates (Catalog #353988, Corning, Tewksbury MA) using an ECHO 650 acoustical liquid handler (Beckman, Indianapolis IN). To neutralize anti- CD3 / anti-CD28 stimulatory reagent -mediated T cell activation, 50 mM D-Biotin was added to anti-CD3 / anti-CD28 stimulatory reagent-activated T cell cultures at 1:50 dilution and incubated for 10 minutes at 37 °C. Forty microliters of neutralized T cell culture or assay media control was dispensed per well on corning assay plates pre-printed with 200 nanoliters of compound in DMSO using a multidrop liquid handler (ThermoFisher, Waltham MA). Plates were incubated for 3 days at which point 10 ul per well of Celltiter Glo reagent (Promega, Madison WI) was added, incubated at room temperature for 10 minutes then read on an Envision plate reader (Perkin-Elmer, Waltham MA). The concentration where 50% reduction in Celltiter Glo signal from well containing only DMSO (CC50) was calculated using a four- parameter logistic equation. T cell media and thaw

[0221] CD4+ and CD8+ T cells were isolated from healthy donor T cells and combined at a 1:1 ratio of CD4 to CD8 T cells in a serum free T cell media (TCM) containing recombinant cytokines as follows: 100 IU / mL IL-2, 1500 IU / mL IL-7, 19 IU / mL IL-15. T cell activation

[0222] For T cell stimulation, an anti-CD3 / anti-CD28 stimulatory reagent was prepared using an oligomeric streptavidin mutein reagent produced as described in WO 2018 / 197949 (see also Poltorak et al., Scientific Reports (2020)). The oligomeric streptavidin mutein reagent had an average hydrodynamic radius of 90-120 nm and contained an average of 2000-2800 tetramers of a streptavidin mutein (Strep-Tactin® m2, SEQ ID NO: 6). The oligomeric streptavidinmutein reagent was mixed at room temperature with (i) an anti-CD3 Fab fragment individually fused at the carboxy-terminus of its heavy chain to a streptavidin-binding peptide sequence (Twin-Strep-tag®, SEQ ID NO: 16) and (ii) an anti-CD28 Fab fragment also individually fused at the carboxy-terminus of its heavy chain to a streptavidin-binding peptide sequence (Twin- Strep-tag®, SEQ ID NO: 16). The peptide-tagged Fab fragments were recombinantly produced (see International Patent App. Pub. Nos. WO 2013 / 011011 and WO 2013 / 124474). The anti- CD3 Fab fragment was derived from the CD3 binding monoclonal antibody produced by the hybridoma cell line OKT3 (ATCC® CRL-8001y; see also U.S. Patent No. 4,361,549) and contained the heavy chain variable domain (SEQ ID NO: 31) and light chain variable domain (SEQ ID NO: 32) of the anti-CD3 antibody OKT3 described in Arakawa et al., J. Biochem. 120, 657-662 (1996). The anti-CD28 Fab fragment was derived from antibody CD28.3 (deposited as a synthetic single chain Fv construct under GenBank Accession No. AF451974.1; see also Vanhove et al., BLOOD, 15 July 2003, Vol.102, No.2, pages 564-570) and contained the heavy chain variable domain (SEQ ID NO: 33) and the light chain variable domain (SEQ ID NO: 34) of the anti-CD28 antibody CD28.3. To prepare the anti-CD3 / anti- CD28 stimulatory reagent, 0.3 mg of oligomeric streptavidin mutein reagent, 0.5 µg of peptide- tagged anti-CD3 Fab fragments, and 0.5 µg of peptide-tagged anti-CD28 Fab fragment was used.

[0223] Isolated T cells described above were suspended at a density of about 3x106cells / mL and the anti-CD3 / anti-CD28 stimulatory reagent was added to the cells in a media supplemented with 100 IU / mL IL-2, 1500 IU / mL IL-7, 19 IU / mL IL-15. Cells were cultured in 6 well plates (Corning 351146) and incubated at 37°C for 48 hours. T cell engineering

[0224] 48 hours post-activation, T cells were counted and resuspended in buffer at a density of 5x107cells / mL. Bhk bgmkh]n\bg` Z `^g^mb\ ]blknimbhg Zm ma^ ^g]h`^ghnl P?N^ \hglmZgm k^`bhg (TRAC) locus by CRISPR / Cas9-mediated gene editing, ribonucleoprotein (RNP) composed of Cas9 protein (Aldevron) and TRAC-targeted single guide RNA (sgRNA) with targeting domain sequence GAGAAUCAAAAUCGGUGAAU (SEQ ID NO:28; targeting within exon 1 of the endogenous TRAC gene) was added to the resuspended T cells to achieve a final concentration of 2µM of RNP. The T cell / RNP solution was transferred into electroporation cuvettes, 100µL / cuvette (Lonza P3 Primary Cell 4D-Nucleofector X Kit L V4XP-3024) andelectroporated using a Lonza 4D-Nucleofector X Unit (Lonza) with pulse code DN-100 / P3. Immediately following electroporation, 600 pL of TCM was added per electroporation cuvette and cells were rested in cuvettes at 37C for 15 minutes. Electroporated cells were pooled and transferred into 96 well flat bottom recovery plates (Coming 351172) containing AAV encoding an exemplary homology directed repair template for insertion of an exemplary anti- BCMA CAR into the TRAC locus at a MOI of 5xl03viral genomes / cell, DNA-PK inhibitors at the indicated concentrations, ImM d-biotin, 100 lU / mL IL-2, 1500 lU / mL IL-7, and 19 lU / mL IL-15 in a final volume of 210pL TCM / well and a final cell density (based on preelectroporation counts) of 5xl05T cells / well. The anti-BCMA CAR is described in WO20 19 / 090003.

[0225] The exemplary anti-BCMA CAR (SEQ ID NO: 198, encoded by SEQ ID NO: 197) included a human IgG-kappa signaling sequence, a human anti-BCMA scFv (Table 5); a modified IgG4-hinge CH2-CH3 (SEQ ID NO: 184, encoded by SEQ ID NO: 183) spacer (which spacer may in some instances be referred to as “LS”; a human CD28 transmembrane domain (SEQ ID NO: 186, encoded by SEQ ID NO: 185); a human 4-lBB-derived intracellular cosignaling sequence (SEQ ID NO: 188, encoded by SEQ ID NO: 187); and a human CD3-zeta derived intracellular signaling domain (SEQ ID NO: 190, encoded by SEQ ID NO: 189).

[0226] The exemplary human anti-BCMA scFv contained an scFv with the following sequences:

[0227] The general structure of the exemplary homology directed repair template polynucleotide was as follows: [5’ homology arm (SEQ ID NO: 191)]-[promoter (SEQ ID NO: 187)]- [transgene sequence encoding the anti-BCMA CAR ((SEQ ID NO: 193)]-[3 ’ homology arm (SEQ ID NO: 192)]. The homology arms included approximately 600 bp of nucleic acid sequences homologous to sequences surrounding the target integration site in exon 1 of the human TCRa constant region (TRAC) gene. The sequence of the entire homology directed repair template polynucleotide that was used is given in SEQ ID NO: 194. Control samples were engineered as described above with the omission of DNA-PK inhibitor treatment (untreated) or AAV (TRAC KO only) in the corresponding wells of the recovery plate.T cell expansion

[0228] 24 hours after electroporation, T cells were transferred into 24 well GREX plates (Wilson Wolf 80192M) in a final volume of 3mL TCM / well supplemented with 100 IU / mL IL-2, 1500 IU / mL IL-7, and 19 IU / mL IL-15. Cells were expanded in GREX plates for a total of 5 days post-electroporation with cytokine replenishment every 2-3 days (final volume of 4mL / well at 5 days post-electroporation). At day 5 post-electroporation the cell viability and count were measured using AOPI staining (Nexcelom CS2-0106) and the CellacaMX automated cell counter (Nexcelom Bioscience). CAR knock-in efficiency was measured by flow cytometry as described below. Flow cytometry

[0229] Following T cell engineering and 5 days of expansion, cells were characterized for TRAC knock-out and CAR knock-in by flow cytometry. Briefly, 2-5x105 cells / well were transferred to 96 well U-bottom plates (Corning 351177) for staining with LIVE / DEAD Fixable near-IR (ThermoFisher L34993) according to the manufacturers protocol, followed by a cocktail of antibodies targeting CD3 (BioLegend, UCHT1), CD4 (BioLegend, OKT4), CD8 (BD Horizon, RPA-T8), and anti-idiotypic antibody (which binds to the extracellular portion of the exemplary anti-BCMA CAR; see WO2021 / 113776) diluted in cell staining buffer (BioLegend D5RE-01386-1) for 30 minutes at 4C. Following staining, cells were washed, resuspended in 100uL cell staining buffer / well, and analyzed using a FACSymphony A5 cytometer (BD Biosciences) using the high throughput plate reader to collect 20,000 live cells / well. Data analysis was performed using FlowJo 10.8.1 (BD Biosciences) and JMP 15.2.0 (SAS Institute Inc.). Total CAR+ T cells were calculated by multiplying %CAR+ by total cell count, and then normalized to the untreated condition by dividing total CAR+ T cells of DNA PK inhibitor treated conditions by the average of three untreated conditions, subtracting 1, and multiplying by 100 to get the total CAR+ cell yield as a percent change relative to the untreated control.

[0230] FIG. 1 shows the effect of DNA-PK inhibitor compounds (e.g. Compound 1) at 0.25 qM, 1.25 qM, and 2.5 qM on cell viability 5 days after electroporation with two donors (donor 1 shown in dark grey bar and donor 2 in light grey bar), respectively. Live cells are shown as a percentage of total cells.

[0231] FIG. 2 shows the effect of DNA-PK inhibitor compounds on T cell proliferation 5 days after electroporation. Total live cell counts (x10e6) are shown.

[0232] FIG.3 shows the effect of DNA-PK inhibitor compounds on CAR insertion into the TRAC locus 5 days after electroporation. Frequency of CAR+ T cells is shown as a percentage of total live cells.

[0233] FIG.4 shows the effect of DNA-PK inhibitor compounds on CAR insertion into the TRAC locus 5 days after electroporation. KI efficiency is shown as percentage change over the untreated control condition (calculated by dividing the % CAR+ of DNA-PKi treated by untreated, subtracting 1, and multiplying by 100).

[0234] FIG.5 shows the effect of DNA-PK inhibitor compounds on total CAR+ cell yields 5 days after electroporation. Relative CAR+ yield is shown as percentage change over the untreated control condition (calculated by dividing the number of CAR+ cells in DNA-PKi treated condition by untreated, subtracting 1, and multiplying by 100).

[0235] Table 6. Sequence TableEQUIVALENTS

[0236] The details of one or more embodiments of the disclosure are set forth in the accompanying description above. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, the preferred methods and materials are now described. Other features, objects, and advantages of the disclosure will be apparent from the description and from the claims. In the specification and the appended claims, the singular forms include plural referents unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to whichthis disclosure belongs. All patents and publications cited in this specification are incorporated by reference.

[0237] The foregoing description has been presented only for the purposes of illustration and is not intended to limit the disclosure to the precise form disclosed, but by the claims appended hereto. EXEMPLARY EMBODIMENTS Enumerated Embodiment 1. A compound of Formula I:or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein: A is a 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5; R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one or more R6; R2is H, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, -CN, OH, CH2OH, NH2, or CH2NH2; R3and R4are each independently selected from the group consisting of -OH, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 haloalkyl, C1-C4 alkylaryl, and aryl; each R5is independently selected from the group consisting of H, halogen, oxo, thioxo, C1-C4alkyl, CD3, CD2CD3, C1-C4 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R6; or two geminal R5together with the intervening geminal carbon atom, form a C3-C6cycloalkyl; each R6is independently selected from the group consisting of H, halogen, NH2, OH, -CN, C(O)NHR7, C1-C4 alkyl, C2-C4 alkenyl, C2-C4 alkynyl, CD3, CD2CD3, C1-C6 alkoxy, C1-C6haloalkyl, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R7; each R7is independently selected from the group consisting of H, Halogen, OH, NH2, CHO, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, or C1-C6 haloalkyl; and n is an integer from 1 to 3. Enumerated Embodiment 2. The compound of enumerated embodiment 1, wherein R1is, wherein B is a 5- or 6- membered aryl or heteroaryl containing one or more heteroatoms selected from the group consisting of N, O, S, and Se. Enumerated Embodiment 3. The compound of enumerated embodiment 1, wherein R1is selected from:wherein: X1, X2, X3, X4and X5are each independently N or C(R6); and m is an integer from 1 to 3. Enumerated Embodiment 4. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ia-1):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 5. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ia-2):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 6. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ia-3):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 7. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-1):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3. Enumerated Embodiment 8. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-2):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3. Enumerated Embodiment 9. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-3):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3. Enumerated Embodiment 10. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-4):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein m is an integer from 1 to 3. Enumerated Embodiment 11. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-5):or a pharmaceuticallyacceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein X1, X2, X3, and X4are each independently N or C(R6); and m is an integer from 1 to 3. Enumerated Embodiment 12. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-6): or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein X5is N or C(R6); and m is an integer from 1 to 3. Enumerated Embodiment 13. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-7):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein X5is N or C(R6); and m is an integer from 1 to 3. Enumerated Embodiment 14. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-8):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein X5is N or C(R6); and m is an integer from 1 to 3. Enumerated Embodiment 15. The compound of any one of the previous enumerated embodiments, wherein the compound is of Formula (Ib-9):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein B is a 5- or 6- membered aryl or heteroaryl, optionally substituted with one or more R6; and m is an integer from 1 to 3. Enumerated Embodiment 16. The compound of enumerated embodiment 1, wherein the compound is selected from the group consisting of the compounds provided in Table 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 17. The compound of enumerated embodiment 1, wherein the compound is selected from the group consisting of the compounds provided in Table 2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 18. The compound of any one of the previous enumerated embodiments, wherein the compound is selected from the group consisting of:or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 19. The compound of any one of the previous enumerated embodiments, wherein the compound is selected from the group consisting of:or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 20. The compound of enumerated embodiment 1, wherein the compound is selected from the group consisting of the compounds provided in Table 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof. Enumerated Embodiment 21. The compound of enumerated embodiment 1, wherein the compound is selected from the group consisting of the compounds provided in Table 2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.Enumerated Embodiment 22. A pharmaceutically acceptable composition comprising the compound according to any one of enumerated embodiments 1-21, and a pharmaceutically acceptable carrier.Enumerated Embodiment 23. A composition comprising: a) a DNA protein kinase inhibitor (DNA-PKI); and b) a DNA cutting agent; wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-21.Enumerated Embodiment 24. The composition of enumerated embodiment 23, further comprising a cell.Enumerated Embodiment 25. The composition of enumerated embodiment 23 or Enumerated Embodiment 24, further comprising a donor DNA.Enumerated Embodiment 26. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 25, wherein the concentration of the DNA-PKI in the composition is about 10 μM or less.Enumerated Embodiment 27. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 25, wherein the concentration of the DNA-PKI in the composition is from about 0.1-10 μM.Enumerated Embodiment 28. The composition of enumerated embodiment Enumerated Embodiment 27, wherein the concentration of the DNA-PKI in the composition is from about 0.25-5 μM.Enumerated Embodiment 29. The composition of any one of enumerated embodiments Enumerated Embodiment 24-Enumerated Embodiment 28, wherein the cell is a eukaryotic cell.Enumerated Embodiment 30. The composition of any one of enumerated embodiments Enumerated Embodiment 24-Enumerated Embodiment 28, wherein the cell is useful in adoptive cell therapy (ACT).Enumerated Embodiment 31. The composition of enumerated embodiment Enumerated Embodiment 30, wherein the cell is a stem cell.Enumerated Embodiment 32. The composition of enumerated embodiment Enumerated Embodiment 31, wherein the stem cell is a hematopoietic stem cell (HSC) or an induced pluripotent stem cell (iPSC). Enumerated Embodiment 33. The composition of any one of enumerated embodiments Enumerated Embodiment 30-Enumerated Embodiment 32, wherein the cell is an immune cell. Enumerated Embodiment 34. The composition of enumerated embodiment Enumerated Embodiment 33, wherein the immune cell is a leukocyte or a lymphocyte. Enumerated Embodiment 35. The composition of enumerated embodiment Enumerated Embodiment 34, wherein the immune cell is a lymphocyte. Enumerated Embodiment 36. The composition of enumerated embodiment Enumerated Embodiment 35, wherein the lymphocyte is a T cell, a B cell, or an NK cell. Enumerated Embodiment 37. The composition of enumerated embodiment Enumerated Embodiment 35, wherein the lymphocyte is a T cell. Enumerated Embodiment 38. The composition of enumerated embodiment Enumerated Embodiment 37, wherein T cell is a primary T cell. Enumerated Embodiment 39. The composition of claim Enumerated Embodiment 37, wherein T cell is a regulatory T cell. Enumerated Embodiment 40. The composition of any one of enumerated embodiments Enumerated Embodiment 37-Enumerated Embodiment 39, wherein the lymphocyte is an activated T cell. Enumerated Embodiment 41. The composition of any one of enumerated embodiments Enumerated Embodiment 37-Enumerated Embodiment 39, wherein the lymphocyte is a non-activated T cell. Enumerated Embodiment 42. The composition of any one of enumerated embodiments Enumerated Embodiment 24-Enumerated Embodiment 41, wherein the cell is a human cell. Enumerated Embodiment 43. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 42, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component.Enumerated Embodiment 44. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 43, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease that generates a double strand DNA break or single strand DNA break. Enumerated Embodiment 45. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 42, wherein the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof. Enumerated Embodiment 46. The composition of enumerated embodiment Enumerated Embodiment 43, wherein the DNA cutting agent is a CRISPR / Cas nuclease component and a guide RNA component. Enumerated Embodiment 47. The composition of enumerated embodiment Enumerated Embodiment 46, wherein the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. Enumerated Embodiment 48. The composition of enumerated embodiment Enumerated Embodiment 46, wherein the CRISPR / Cas nuclease component comprises the Cas nuclease. Enumerated Embodiment 49. The composition of enumerated embodiment Enumerated Embodiment 47 or Enumerated Embodiment 48, wherein the Cas nuclease is a Class 2, Type II Cas nuclease. Enumerated Embodiment 50. The composition of enumerated embodiment Enumerated Embodiment 49, wherein the Cas nuclease is a Cas9 nuclease. Enumerated Embodiment 51. The composition of enumerated embodiment Enumerated Embodiment 50, wherein the Cas nuclease is a S. pyogenes Cas9 nuclease. Enumerated Embodiment 52. The composition of enumerated embodiment Enumerated Embodiment 47 or Enumerated Embodiment 48, wherein the Cas nuclease is a Class 2, Type V Cas nuclease. Enumerated Embodiment 53. The composition of enumerated embodiment Enumerated Embodiment 47 or Enumerated Embodiment 48, wherein the Cas nuclease is a Cas12a nuclease.Enumerated Embodiment 54. The composition of enumerated embodiment Enumerated Embodiment 53, wherein the Cas nuclease is a Acidaminococcus sp. Cas12a nuclease. Enumerated Embodiment 55. The composition of any one of enumerated embodiments Enumerated Embodiment 47-Enumerated Embodiment 54, wherein the Cas nuclease generates a single strand DNA break. Enumerated Embodiment 56. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 55, comprising a modified RNA. Enumerated Embodiment 57. The composition of any one of enumerated embodiments Enumerated Embodiment 43-Enumerated Embodiment 56, wherein the guide RNA component is a guide RNA nucleic acid. Enumerated Embodiment 58. The composition of enumerated embodiment Enumerated Embodiment 57, wherein the guide RNA nucleic acid is a guide RNA (gRNA). Enumerated Embodiment 59. The composition of enumerated embodiment Enumerated Embodiment 57 or Enumerated Embodiment 58, wherein the guide RNA nucleic acid is or encodes a dual-guide RNA (dgRNA) composed of a crRNA and tracrRNA. Enumerated Embodiment 60. The composition of enumerated embodiment Enumerated Embodiment 57 or Enumerated Embodiment 58, wherein the guide RNA nucleic acid is or encodes a single-guide (sgRNA). Enumerated Embodiment 61. The composition of any one of enumerated embodiments Enumerated Embodiment 58-Enumerated Embodiment 60, wherein the gRNA is a modified gRNA. Enumerated Embodiment 62. The composition of enumerated embodiment Enumerated Embodiment 61, wherein the cutting agent is Cas9 and the modified gRNA comprises a fh]b_b\Zmbhg Zm hg^ hk fhk^ h_ ma^ _bklm _bo^ gn\e^hmb]^l Zm ma^ 4^ ^g]- Enumerated Embodiment 63. The composition of enumerated embodiment Enumerated Embodiment 61, wherein the cutting agent is Cas12a and the modified gRNA comprises a DNA / RNA hybrid molecule. Enumerated Embodiment 64. The composition of enumerated embodiments Enumerated Embodiment 61-Enumerated Embodiment 63, wherein the modified gRNA comprises a fh]b_b\Zmbhg Zm hg^ hk fhk^ h_ ma^ eZlm _bo^ gn\e^hmb]^l Zm ma^ 2^ ^g]-Enumerated Embodiment 65. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 64, wherein the composition comprises a guide RNA nucleic acid and a Class 2, Type II or Class 2, Type V Cas nuclease; and the molar ratio of the guide RNA to Cas nuclease is from about 4:1 to 1:4. Enumerated Embodiment 66. The composition of any one of enumerated embodiments Enumerated Embodiment 25-Enumerated Embodiment 65, wherein the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA. Enumerated Embodiment 67. The composition of any one of enumerated embodiments 23-Enumerated Embodiment 66, further comprising a vector. Enumerated Embodiment 68. The composition of enumerated embodiment Enumerated Embodiment 67, wherein the vector encodes the donor DNA. Enumerated Embodiment 69. The composition of enumerated embodiment Enumerated Embodiment 67 or Enumerated Embodiment 68, wherein the vector is a viral vector. Enumerated Embodiment 70. The composition of enumerated embodiment Enumerated Embodiment 67 or Enumerated Embodiment 68, wherein the vector is a non-viral vector. Enumerated Embodiment 71. The composition of enumerated embodiment Enumerated Embodiment 69, wherein the vector is an AAV. Enumerated Embodiment 72. The composition of enumerated embodiment Enumerated Embodiment 24, wherein the cell is not a cancer cell. Enumerated Embodiment 73. The composition of any one of enumerated embodiments 23 to Enumerated Embodiment 72, further comprising an inhibitor of the microhomology mediated end joining (MMEJ) pathway. Enumerated Embodiment 74. A method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-21. Enumerated Embodiment 75. A method of repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA- PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-21.Enumerated Embodiment 76. A method of inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-21. Enumerated Embodiment 77. The method of enumerated embodiment Enumerated Embodiment 76 further comprising contacting the cell with an inhibitor of the microhomology mediated end joining (MMEJ) pathway. Enumerated Embodiment 78. A method of targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of enumerated embodiments 1-21. Enumerated Embodiment 79. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 78, comprising growing the cell in a cell medium free of the DNA-PKI and adding the DNA-PKI to the cell medium. Enumerated Embodiment 80. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 79, comprising contacting the cell with the DNA cutting agent before contacting the cell with the DNA-PKI. Enumerated Embodiment 81. The method of enumerated embodiment Enumerated Embodiment 80, comprising contacting the cell with the DNA-PKI within about six hours of contacting the cell with the DNA cutting agent. Enumerated Embodiment 82. The method of enumerated embodiment Enumerated Embodiment 81, comprising contacting the cell with the DNA-PKI within about three hours of contacting the cell with the DNA cutting agent. Enumerated Embodiment 83. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 79, comprising contacting the cell with the DNA cutting agent simultaneously with the DNA-PKI. Enumerated Embodiment 84. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 79, comprising contacting the cell with the DNA cutting agent after contacting the cell with the DNA-PKI.Enumerated Embodiment 85. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 84, wherein contacting the cell with the DNA cutting agent comprises electroporation. Enumerated Embodiment 86. The method of enumerated embodiment Enumerated Embodiment 84 or Enumerated Embodiment 85, comprising contacting the cell with the DNA cutting agent within about three hours of contacting the cell with the DNA-PKI. Enumerated Embodiment 87. The method of any one of enumerated embodiments Enumerated Embodiment 84-Enumerated Embodiment 86, comprising growing the cell in a cell medium comprising the DNA-PKI. Enumerated Embodiment 88. The method of any one of enumerated embodiments Enumerated Embodiment 84-Enumerated Embodiment 87, wherein the cell is contacted with the DNA cutting agent and the DNA-PKI for at least about one day. Enumerated Embodiment 89. The method of enumerated embodiment Enumerated Embodiment 88, wherein the cell is contacted with the DNA cutting agent and the DNA- PKI for about one day to about two weeks. Enumerated Embodiment 90. The method of enumerated embodiment Enumerated Embodiment 88, wherein the cell is contacted with the DNA cutting agent and the DNA- PKI for about two weeks. Enumerated Embodiment 91. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 90, wherein the cell is contacted with the DNA-PKI in a cell medium, wherein the concentration of the DNA-PKI in the \^ee f^]bnf bl Z[hnm 0 / ^^ hk e^ll- Enumerated Embodiment 92. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 91, wherein the cell is contacted with the DNA-PKI in a cell medium, wherein the concentration of the DNA-PKI in the cell medium is from about 0.1-0 / ^^- Enumerated Embodiment 93. The method of enumerated embodiment Enumerated Embodiment 92, wherein the concentration of the DNA-PKI in the cell medium is from about 0.25-4 ^^-Enumerated Embodiment 94. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 93, wherein the cell is a eukaryotic cell. Enumerated Embodiment 95. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 94, wherein the cell is for use in adoptive cell therapy (ACT). Enumerated Embodiment 96. The method of enumerated embodiment Enumerated Embodiment 95, wherein the cell is for use in autologous cell therapy. Enumerated Embodiment 97. The method of enumerated embodiment Enumerated Embodiment 95, wherein the cell is for use in allogeneic cell therapy. Enumerated Embodiment 98. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 94, wherein the cell is a stem cell. Enumerated Embodiment 99. The method of enumerated embodiment Enumerated Embodiment 98, wherein the stem cell is a hematopoietic stem cell (HSC). Enumerated Embodiment 100. The method of enumerated embodiment Enumerated Embodiment 98, wherein the cell is an induced pluripotent stem cell (iPSC). Enumerated Embodiment 101. The method of enumerated embodiment Enumerated Embodiment 95 or Enumerated Embodiment 96, wherein the cell is an immune cell. Enumerated Embodiment 102. The method of enumerated embodiment Enumerated Embodiment 101, wherein the immune cell is a leukocyte or a lymphocyte. Enumerated Embodiment 103. The method of enumerated embodiment Enumerated Embodiment 102, wherein the immune cell is a lymphocyte. Enumerated Embodiment 104. The method of enumerated embodiment Enumerated Embodiment 103, wherein the lymphocyte is a T cell, a B cell, or an NK cell. Enumerated Embodiment 105. The method of enumerated embodiment Enumerated Embodiment 104, wherein the lymphocyte is a T cell. Enumerated Embodiment 106. The method of enumerated embodiment Enumerated Embodiment 105, wherein T cell is a primary T cell. Enumerated Embodiment 107. The method of enumerated embodiment Enumerated Embodiment 105, wherein T cell is a regulatory T cell.Enumerated Embodiment 108. The method of any one of enumerated embodiments Enumerated Embodiment 104-Enumerated Embodiment 107, wherein the lymphocyte is an activated T cell. Enumerated Embodiment 109. The method of any one of enumerated embodiments Enumerated Embodiment 104-Enumerated Embodiment 107, wherein the lymphocyte is a non-activated T cell. Enumerated Embodiment 110. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 109, wherein the cell is a human cell. Enumerated Embodiment 111. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 110, wherein the DNA cutting agent is selected from a zinc finger nuclease, a TALE effector domain nuclease (TALEN), a CRISPR / Cas nuclease component, and combinations thereof. Enumerated Embodiment 112. The method of enumerated embodiment Enumerated Embodiment 111, wherein the DNA cutting agent is a CRISPR / Cas nuclease component. Enumerated Embodiment 113. The method of enumerated embodiment Enumerated Embodiment 112, wherein the CRISPR / Cas nuclease component comprises a Cas nuclease or an mRNA encoding the Cas nuclease. Enumerated Embodiment 114. The method of enumerated embodiment Enumerated Embodiment 113, wherein the CRISPR / Cas nuclease component comprises an mRNA encoding the Cas nuclease. Enumerated Embodiment 115. The method of enumerated embodiment Enumerated Embodiment 113 or Enumerated Embodiment 114, wherein the Cas nuclease is a Class 2, Type II Cas nuclease. Enumerated Embodiment 116. The method of enumerated embodiment Enumerated Embodiment 113 or Enumerated Embodiment 114, wherein the Cas nuclease is a Class 2, Type V Cas nuclease. Enumerated Embodiment 117. The method of enumerated embodiment Enumerated Embodiment 115, wherein the Cas nuclease is a Cas9 nuclease. Enumerated Embodiment 118. The method of enumerated embodiment Enumerated Embodiment 117, wherein the Cas nuclease is a S. pyogenes Cas9 nuclease.Enumerated Embodiment 119. The method of enumerated embodiment EnumeratedEmbodiment 116, wherein the Cas nuclease is a Casl2a nuclease.Enumerated Embodiment 120. The method of any one of enumerated embodimentsEnumerated Embodiment 74-Enumerated Embodiment 119, further comprising contacting the cell with a modified RNA.Enumerated Embodiment 121. The method of any one of enumerated embodimentsEnumerated Embodiment 74-Enumerated Embodiment 120, further comprising contacting the cell with a guide RNA nucleic acid.Enumerated Embodiment 122. The method of enumerated embodiment EnumeratedEmbodiment 121, wherein the guide RNA nucleic acid is a gRNA.Enumerated Embodiment 123. The method of enumerated embodiment EnumeratedEmbodiment 121 or Enumerated Embodiment 122, wherein the guide RNA nucleic acid is or encodes a dual-guide RNA (dgRNA).Enumerated Embodiment 124. The method of enumerated embodiment EnumeratedEmbodiment 121 or Enumerated Embodiment 122, wherein the guide RNA nucleic acid is or encodes a single-guide (sgRNA).Enumerated Embodiment 125. The method of any one of enumerated embodimentsEnumerated Embodiment 122-Enumerated Embodiment 124, wherein the gRNA is a modified gRNA.Enumerated Embodiment 126. The method of enumerated embodiment EnumeratedEmbodiment 125, wherein the modified gRNA comprises a modification at one or more of the first five nucleotides at the 5’ end.Enumerated Embodiment 127. The method of enumerated embodiment EnumeratedEmbodiment 125 or Enumerated Embodiment 126, wherein the modified gRNA comprises a modification at one or more of the last five nucleotides at the 3 ’ end.Enumerated Embodiment 128. The method of any one of enumerated embodimentsEnumerated Embodiment 121 -Enumerated Embodiment 127, wherein the DNA cutting agent is a Class 2, Type II Cas nuclease or Class 2, Type V Cas nuclease mRNA; and the ratio of the guide RNA nucleic acid to Cas nuclease is from about 4: 1 to 1 :4 by molar ratio.Enumerated Embodiment 129. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 128, further comprising contacting the cell with a donor DNA. Enumerated Embodiment 130. The method of enumerated embodiment Enumerated Embodiment 129, comprising contacting the cell with a vector comprising the donor DNA. Enumerated Embodiment 131. The method enumerated embodiment Enumerated Embodiment 129 or Enumerated Embodiment 130, wherein the donor DNA comprises a template comprising a sequence encoding a protein, a regulatory sequence, or a sequence encoding structural RNA. Enumerated Embodiment 132. The method of enumerated embodiment Enumerated Embodiment 131, wherein the template sequence is integrated into the genome of the cell via homology directed repair (HDR). Enumerated Embodiment 133. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 132, further comprising contacting the cell with a vector. Enumerated Embodiment 134. The method of enumerated embodiment Enumerated Embodiment 133, wherein the vector encodes the DNA cutting agent. Enumerated Embodiment 135. The method of enumerated embodiment Enumerated Embodiment 133 or Enumerated Embodiment 134, wherein the vector encodes a donor DNA. Enumerated Embodiment 136. The method of any one of enumerated embodiments Enumerated Embodiment 133-Enumerated Embodiment 135, wherein the vector is a viral vector. Enumerated Embodiment 137. The method of any one of enumerated embodiments Enumerated Embodiment 133-Enumerated Embodiment 135, wherein the vector is a non- viral vector. Enumerated Embodiment 138. The method of enumerated embodiment Enumerated Embodiment 136, wherein the vector is an AAV. Enumerated Embodiment 139. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 138, wherein the DNA cuttingagent interacts with a target sequence within the genome of the cell, resulting in a double stranded DNA break (DSB). Enumerated Embodiment 140. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 139, wherein the method results in a gene knockout. Enumerated Embodiment 141. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 140, wherein the method results in a gene correction. Enumerated Embodiment 142. The method of any one of enumerated embodiments Enumerated Embodiment 74-Enumerated Embodiment 141, wherein the method results in a gene insertion. Enumerated Embodiment 143. The method of any one of enumerated embodiments Enumerated Embodiment 131-Enumerated Embodiment 142, wherein the donor DNA comprises a template comprising an exogenous nucleic acid encoding a protein. Enumerated Embodiment 144. The method of enumerated embodiment Enumerated Embodiment 143, wherein the protein is selected from the group consisting of a cytokine, an immunosuppressor, an antibody, a receptor, and an enzyme. Enumerated Embodiment 145. The method of enumerated embodiment Enumerated Embodiment 144, wherein the protein is a receptor. Enumerated Embodiment 146. The method of enumerated embodiment Enumerated Embodiment 144 or Enumerated Embodiment 145, wherein the receptor is selected from the group consisting of an immunological receptor, a T-cell receptor (TCR), and a chimeric antigen receptor. Enumerated Embodiment 147. The method of enumerated embodiment Enumerated Embodiment 146, wherein the receptor is an immunological receptor. Enumerated Embodiment 148. The method of enumerated embodiment Enumerated Embodiment 146, wherein the receptor is a TCR. Enumerated Embodiment 149. The method of enumerated embodiment Enumerated Embodiment 143, wherein the exogenous nucleic acid encodes a TCR alpha chain and / or a TCR beta chain.Enumerated Embodiment 150. The method of enumerated embodiment Enumerated Embodiment 146, wherein the receptor a chimeric antigen receptor. Enumerated Embodiment 151. The method of any one of enumerated embodiments Enumerated Embodiment 131-Enumerated Embodiment 150, wherein the DNA cutting agent interacts with a target sequence within the TRAC gene of the T-cell. Enumerated Embodiment 152. The method of enumerated embodiment Enumerated Embodiment 151, comprising contacting the cell with at least two different DNA cutting agents that target different loci. Enumerated Embodiment 153. The method of any one of enumerated embodiments Enumerated Embodiment 143-Enumerated Embodiment 152, wherein the template comprises a first homology arm and a second homology arm that are complementary to sequences located upstream and downstream of the cleavage site, respectively.

Claims

CLAIMS What is claimed is:

1. A compound of Formula I:or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof, wherein: A is a 6-membered heteroaryl or heterocycloalkyl group containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the heteroaryl or heterocycloalkyl is optionally substituted with one or more R5; R1is an aryl or heteroaryl containing at least one heteroatom selected from the group consisting of N, O, and S, wherein the aryl or heteroaryl is optionally substituted with one or more R6; R2is H, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, -CN, OH, CH2OH, NH2, or CH2NH2; R3and R4are each independently selected from the group consisting of -OH, C1-C4 alkyl, C1-C4 alkoxy, C1-C4haloalkyl, C1-C4alkylaryl, and aryl; each R5is independently selected from the group consisting of H, halogen, oxo, thioxo, C1-C4alkyl, CD3, CD2CD3, C1-C4 alkoxy, C1-C6 haloalkyl, C3-C6 cycloalkyl, heterocycloalkyl, heteroaryl, and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R6; or two geminal R5together with the intervening geminal carbon atom, form a C3-C6 cycloalkyl; each R6is independently selected from the group consisting of H, halogen, NH2, OH, -CN, C(O)NHR7, C1-C4alkyl, C2-C4alkenyl, C2-C4alkynyl, CD3, CD2CD3, C1-C6alkoxy, C1-C6haloalkyl, C3-C6cycloalkyl, heterocycloalkyl, heteroaryl and aryl, wherein the alkyl, alkoxy, haloalkyl, cycloalkyl, heterocycloalkyl, heteroaryl, or aryl is optionally substituted with one or more R7;each R7is independently selected from the group consisting of H, Halogen, OH, NH2, CHO, oxo, thioxo, C1-C4 alkyl, C1-C4 alkoxy, or C1-C6 haloalkyl; and n is an integer from 1 to 3.

2. The compound of claim 1, wherein R1iswherein B is a 5- or 6- membered aryl or heteroaryl containing one or more heteroatoms selected from the group consisting of N, O, S, and Se.

3. The compound of claim 1, wherein R1is selected from:wherein: X1, X2, X3, X4and X5are each independently N or C(R6); and m is an integer from 1 to 3.

4. The compound of any one of the previous claims, wherein the compound is of Formula (Ia-1), (Ia-2), or (Ia-3):or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

5. The compound of any one of the previous claims, wherein the compound is of Formula (Ib-1), (Ib-2), (Ib-3), (Ib-4), (Ib-5), (Ib-6), (Ib-7), (Ib-8), or (Ib-9):wherein m is an integer from 1 to 3,wherein m is an integer from 1 to 3,wherein m is an integer from 1 to 3,wherein m is an integer from 1 to 3, whereinX1, X2, X3, and X4are each independently N or C(R6); and m is an integer from 1 to 3,wherein X5is N or C(R6); and m is an integer from 1 to 3,wherein X5is N or C(R6); and m is an integer from 1 to 3,wherein X5is N or C(R6); and m is an integer from 1 to 3, orwherein B is a 5- or 6- membered aryl or heteroaryl, optionally substituted with one or more R6; and m is an integer from 1 to 3, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

6. The compound of claim 1, wherein the compound is selected from the group consisting of the compounds provided in Table 1, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

7. The compound of claim 1, wherein the compound is selected from the group consisting of the compounds provided in Table 2, or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

8. The compound of any one of the previous claims, wherein the compound is selected from the group consisting of:or a pharmaceutically acceptable salt, stereoisomer, solvate, prodrug, or tautomer thereof.

9. A pharmaceutically acceptable composition comprising the compound according to any one of claims 1-8, and a pharmaceutically acceptable carrier.

10. A composition comprising:a) a DNA protein kinase inhibitor (DNA-PKI); and b) a DNA cutting agent; wherein the DNA-PKI is a compound according to any one of claims 1-8.

11. The composition of claim 10, further comprising a cell.

12. The composition of claim 10 or 11, further comprising a donor DNA.

13. The composition of any one of claims 10-12, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease component and optionally a guide RNA component.

14. The composition of any one of claims 10-Enumerated Embodiment 43, wherein the DNA cutting agent comprises a CRISPR / Cas nuclease that generates a double strand DNA break or single strand DNA break.

15. The composition of any one of claims 10-14, further comprising a vector.

16. The composition of any one of claims 10-15, further comprising an inhibitor of the microhomology mediated end joining (MMEJ) pathway.

17. A method for targeted genome editing in a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-8.

18. A method of repairing a double stranded DNA break in the genome of a cell, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-8.

19. A method of inhibiting or suppressing repair of a DNA break in a cell via a nonhomologous end joining (NHEJ) pathway, comprising contacting the cell with a DNA cutting agent and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-8.

20. A method of targeted insertion of a donor DNA into the genome of a cell, comprising contacting the cell with a DNA cutting agent, the donor DNA, and a DNA-PKI, wherein the DNA-PKI is a compound according to any one of claims 1-8.