Synthetic DNA constructs encoding transfer RNA

The synthetic DNA construct with specific leader sequences and motifs enhances the delivery and expression of suppressor tRNA in cells, addressing inefficiencies in current gene therapy methods by providing controlled and efficient tRNA delivery.

JP2026511942APending Publication Date: 2026-04-14UNIV OF HAMBURG
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
JP2025558033
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-04-06
Filing Date
2024-04-04
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Current gene therapy methods for delivering suppressor tRNA to cells, particularly human cells, are limited in efficiency and control, necessitating improved means for targeted and controlled delivery.

Method used

A synthetic DNA construct encoding tRNA, incorporating specific 5' leader sequences and array motifs, enhances the binding of transcription factors TFIIIB and TFIIIC, allowing for controlled expression and delivery of engineered tRNA, such as suppressor tRNA, to mammalian cells.

Benefits of technology

The construct enables high or low expression levels of tRNA, improving the delivery and functional activity of suppressor tRNA within cells, effectively addressing frameshift and nonsense mutations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026511942000001_ABST
    Figure 2026511942000001_ABST
Patent Text Reader

Abstract

The present invention relates to a synthetic DNA construct comprising (A) a nucleic acid encoding transfer RNA and (B) a 5' leader sequence, wherein the 5' leader sequence contains a sequence motif for controlling the expression level of the transfer RNA.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a synthetic DNA construct encoding tRNA, which can be used to deliver transfer RNA to cells, such as human cells. [Background technology]

[0002] Transfer ribonucleic acid (tRNA) is an essential component of the protein synthesis machinery in living cells, as it is necessary for translating the nucleotide sequence of messenger RNA (mRNA) into the amino acid sequence of a protein. Natural tRNA contains an amino acid-binding stem that can covalently bind to amino acids and an anticodon loop containing a base triplet called an "anticodon," which can non-covalently bind to the corresponding base triplet called a "codon" on mRNA. Proteins are synthesized by assembling the amino acids carried by tRNA, using the codon sequence on mRNA as a template, with the help of a multicomponent system that includes ribosomes and several coenzymes.

[0003] Transfer RNA has recently attracted increasing interest as a drug for therapeutic purposes, for example, as part of gene therapy to treat conditions associated with nonsense mutations, i.e., mutations in which a sense codon encoding one of 20 amino acids specified in the genetic code is altered to a premature termination codon (PTC) in the gene sequence (Non-Patent Literature 1; Non-Patent Literature 2). For example, Lueck et al., 2016 (Non-Patent Literature 3), describe how codon-edited tRNA can convert the in-frame stop codon of the CFTR gene to a native amino acid in order to restore the full-length wild-type protein.

[0004] Compared to mRNA, tRNA molecules are significantly more stable and, on average, 10 times shorter, thus mitigating the problem of introduction into target tissues. This has led to attempts to use tRNA in gene therapy to prevent the formation of end-cleavage proteins from mRNA with immature stop codons and instead introduce appropriate amino acids (see, for example, Non-Patent Document 4; Patent Document 1; Patent Document 2). Patent Documents 3 and 4 describe synthetic tRNAs with extended anticodon loops that can be used, for example, as suppressor tRNAs for genetic diseases associated with frameshift mutations. Patent Document 5 discloses engineered tRNA molecules and vectors encoding engineered suppressor tRNA molecules that recognize and read through disease-causing immature stop codons. The use of tRNA in gene therapy, for example, in gene therapy for diseases associated with the presence of immature stop codons (PTCs), is also described, in particular, in Patent Documents 6, 7, 8, 9, and 10.

[0005] tRNA biosynthesis involves several processes, including transcription, 5' and 3' end processing, splicing, post-transcriptional nucleotide modification, CCA addition, and aminoacylation. tRNA transcription involves the transcription factor TFIIIC binding to intragene sequence motifs (promoters) called "A-boxes" and "B-boxes," which encode parts of the D and T arms, respectively, and the recruitment of transcription factor TFIIIB to the 5' upstream region of the tRNA gene, which directs the recruitment of RNA polymerase III (pol III) to transcribe the tRNA gene (see, for example, Non-Patent Literature 5; Non-Patent Literature 6; Non-Patent Literature 7; Non-Patent Literature 8; Non-Patent Literature 9; Non-Patent Literature 10; Non-Patent Literature 11; Non-Patent Literature 12; Non-Patent Literature 13). Zhang et al., 2011 (Non-Patent Literature 14), describe anticodon-dependent sequence motifs within the non-coding 5' upstream region of the tRNA gene that may be involved in regulating tRNA transcription. [Prior art documents] [Patent Documents]

[0006] [Patent Document 1] U.S. Patent Application Publication No. 2003 / 0224479(A1) [Patent Document 2] U.S. Patent No. 6964859 [Patent Document 3] International Publication No. 2017 / 121863(A1) [Patent Document 4] International Publication No. 2020 / 208169(A1) [Patent Document 5] International Publication No. 2021 / 113218(A1) [Patent Document 6] International Publication No. 2020 / 069194(A1) [Patent Document 7] International Publication No. 2021 / 211762(A2) [Patent Document 8] International Publication No. 2021 / 087401(A1) [Patent Document 9] International Publication No. 2021 / 113218(A1) [Patent Document 10] U.S. Patent Application Publication No. 2020 / 291401(A1) [Patent Document 11] International Publication No. 2019 / 175316(A1) [Patent Document 12] International Publication No. 2020 / 208169(A1) [Non-patent literature]

[0007] [Non-Patent Document 1] Ai-Ming Yu, Young Hee Choi and Mei-Juan Tu, RNA Drugs and RNA Targets for Small Molecules: Principles, Progress, and Challenges, Pharmacological Reviews, 2020, 72 (4) 862-898; DOI: 10.1124 / pr.120.019554 [Non-Patent Document 2] Porter, JJ, Heil, CS, Lueck, JD, Therapeutic promise of engineered nonsense suppressor tRNAs, WIREs RNA. 2021; 12:e1641, DOI: 10.1002 / wrna.1641 [Non-Patent Document 3] Lueck, JD, Infield, DT, Mackey, AL, Pope, RM, McCray, PB, Ahern, CA. Engineered tRNA suppression of a CFTR nonsense mutation, bioRxiv 088690; doi: 10.1101 / 088690 [Non-Patent Document 4] Koukuntla, R., 2009, Suppressor tRNA mediated gene therapy, Graduate Theses and Dissertations, 10920, Iowa State University, http: / / lib.dr.iastate.edu / etd / 10920 [Non-Patent Document 5] Kirchner, S., Ignatova, Z. Emerging roles of tRNA in adaptive translation, signaling dynamics and disease, Nat Rev Genet 16, 98-112 (2015), doi: 10.1038 / nrg3861 [Non-Patent Document 6] Schramm L, Hernandez N., Recruitment of RNA polymerase III to its target promoters, Genes Dev. 2002 Oct 15;16(20):2593-620, doi: 10.1101 / gad.1018902 [Non-Patent Document 7] Mitra S., Das P., Samadder A., ​​Das S., Betai R., Chakrabarti J., 2015, Eukaryotic tRNAs fingerprinting invertebrates vis-a-vis vertebrates, Journal of Biomolecular Structure and Dynamics

Outdoor Tools 8

Outdoor Tools9

Outdoor Tools 10

Outdoor Tools 16

Outdoor Track 17

Outdoor Tools 18

Outdoor Tools 19

[0008] The object of the present invention is to improve the means and possibilities of gene therapy for diseases using transfer RNA. In particular, the object of the present invention is to provide an improved means for delivering suppressor tRNA to living cells, such as human cells. [Means for solving the problem]

[0009] To solve the problem, the present invention, in one embodiment, comprises (A) a nucleic acid encoding transfer RNA and (B) a 5' leader sequence, wherein the 5' leader sequence is a) Sequence motif TGACCTAAGTGTAAAGT,I H (Sequence No. 1), TGAGATTTCCTTCAGGTT,II H (Sequence No. 2), TATATAGTTCTGTATGAGACCACTCTTTCCC,III H (Sequence ID 3), ACCATAAACGTGAAATG,I L (Sequence No. 4), TCTTTGGATTTGGGAATC,II L (Sequence No. 5), and TTATAAGTTCTGTATGAGACCACTCTTTCCC,III L Sequence motifs selected from the group consisting of (Sequence ID 6); and / or, b) Sequence motif VNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND,50nt H(SEQ ID NO: 7) and GCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT, 50 nt L An array motif selected from the group consisting of (SEQ ID NO: 8); and / or, c) Array motif GAAATGCCTT, 10 nt H1 (SEQ ID NO: 9), GTGGGAACTA, 10 nt H2 (SEQ ID NO: 10), and GTGTTGCTTG, 10 nt H3 An array motif selected from the group consisting of (SEQ ID NO: 11) To provide a synthetic DNA construct containing the same.

[0010] The present invention provides a novel synthetic DNA construct containing a nucleic acid encoding transfer RNA. The DNA construct can be configured as a gene delivery vehicle (GDV) for delivering transfer RNA, such as suppressor tRNA, to cells, particularly mammalian cells, such as human cells. The synthetic DNA construct of the present invention includes, in addition to the tRNA gene, a 5' leader sequence functionally linked to a nucleic acid encoding tRNA (tRNA gene), and this 5' leader sequence contains an array motif for binding of transcription factor TFIIIB. The present invention provides an array motif having promoter activity, which can be included in the 5' leader sequence of the tRNA encoded downstream of the 5' leader sequence. In a preferred embodiment, additional array motifs, namely A box and / or B box array motifs, can be included in the transfer RNA encoded downstream of the 5' leader sequence to further enhance or better control the binding of transcription factor TFIIIC. Appropriate selection and optional combination of array motifs enable transcriptional control of the downstream tRNA gene. The tRNA encoded by the nucleic acid in the construct can be an engineered tRNA having, for example, a modified anticodon capable of forming a base pair with the stop codon of mRNA, and / or a modified T arm containing a B box array motif. The B box sequence can be, for example, a sequence that enhances the binding of transcription factor TFIIIC to the tRNA gene. [Brief explanation of the drawing]

[0011]

Figure 1

Figure 2

Figure 3

Figure 4

[0012] The terms “DNA construct” or “synthetic DNA construct” refer to artificially designed DNA segments that can be used, for example, to incorporate genetic material into target tissues or cells. The terms “vector,” “synthetic vector,” or “synthetic gene delivery vehicle (GDV)” refer to any means for delivering nucleic acids, such as coding nucleic acids, along with regulatory elements such as promoter sequences and termination signals, into living cells. Many viral and non-viral vectors are known. Examples include plasmids, viruses, cationic liposomes, or polymers.

[0013] Regarding the term "nucleic acid encoding transfer RNA," the terms "transfer RNA gene" or "tRNA gene" can also be used synonymously.

[0014] The term “5' leader sequence,” as used herein, refers to the “upstream” of the 5' end of the tRNA gene, for example, the sequence of nucleotides located approximately 100 nt upstream of the 5' end of the coding sequence of mature tRNA, including the nucleotide sequence that functions as the binding site for the transcription factor TFIIIB. The term “5' leader sequence” specifically refers to the sequence of nucleotides including or consisting of the 5'-100 to -1 positions from the transcription start site of the tRNA gene. “Mature tRNA” refers to fully processed, functional tRNA. The terms “extragenetic leader sequence,” “5' untranslated region (5'UTR),” or “extragenetic pol III binding sequence” may also be used herein.

[0015] The terms "A-box" and "B-box" refer to intra-gene regions, i.e., sequence motifs of the tRNA gene containing the nucleotide sequence to which the RNA polymerase III transcription factor TFIIIC binds. These boxes can also be considered part of the tRNA promoter (the so-called type 2 promoter) or promoter elements. The nucleotide sequence of approximately 10-14 nucleotides that forms the A-box (Non-Patent Literature 15) is located in the region of the tRNA gene encoding part of the D-arm, and the nucleotide sequence of approximately 11 nucleotides that forms the B-box (Non-Patent Literature 16) is located in the region of the tRNA gene encoding part of the T-loop. The 11nt consensus sequence of the B-box has been shown by Mitra et al., 2015 (see above) to be the RGTTCRANNCY spanning nucleotides N52-N62 of mature tRNA. Numbering relating to the tRNA gene or a part thereof, such as the A-box and B-box, refers to nucleotide numbering within mature tRNA according to the tRNA numbering rules (see below).

[0016] The term "encodes" with respect to the nucleotide sequence of a tRNA gene means that the nucleotide sequence is transcribed into tRNA or a portion of tRNA. Direct references to tRNA encoded by the DNA constructs of the present invention, such as references to structural parts of mature tRNA, e.g., the D arm, anticodon arm, T arm, or acceptor stem, are understood to refer to the region of the tRNA gene in the nucleic acid that encodes those structural parts, unless otherwise explicitly stated or clearly discernible from the context. Accordingly, an expression that the encoded tRNA contains, for example, a T arm of a particular sequence whose sequence is represented as DNA (with nucleotides A, C, G, and T), is understood to refer to a sequence within the tRNA gene that encodes the corresponding structure, which appears in the mature tRNA transcribed from the tRNA gene, but where T is replaced by U and, in some cases, may have modified nucleotides.

[0017] The terms "sequence motif" or "sequence signature" refer to a specific sequence or consensus sequence that has a particular function, for example, as a binding site for RNA polymerase.

[0018] The term "transfer ribonucleic acid" or "tRNA" refers to an RNA molecule, typically 73 to 90 nucleotides long, that mediates the translation of the nucleotide sequence of messenger RNA into the amino acid sequence of a protein. tRNA can covalently bind to a specific amino acid at the 3'CCA tail of its acceptor stem and base-pair with the typical 3-nucleotide sequence (codon) of messenger RNA via an anticodon, typically 3-nucleotide, located in the anticodon loop of the anticodon arm. Some anticodons can pair with multiple codons through a phenomenon known as fluctuating base pairing. The secondary "cloverleaf" structure of tRNA includes an acceptor stem that binds to an amino acid and three arms ("D arm," "T arm," and "anticodon arm") that end in a loop (D loop, T loop (TψC loop), anticodon loop), i.e., a section with an unpaired nucleotide. The terms “D stem,” “T stem” (or “TψC stem”), and “anticodon stem” (also known as “AC stem”) refer to the portion of the D arm, T arm, and anticodon arm that contains paired nucleotides, respectively. Aminoacyl-tRNA synthetase adds specific amino acids to tRNA (aminoacylation). Each tRNA contains a distinctly different anticodon triplet sequence that can form base pairs with one or more amino acid codons. By convention, tRNA nucleotides are often numbered from 1 to 76, starting from the 5'-phosphate terminus, based on a “consensus” tRNA molecule consisting of 76 nucleotides, regardless of the actual number of nucleotides in the tRNA, and this is not always 76nt in length due to variable parts such as the tRNA’s D loop or variable loop (see Figure 1). Following this convention, nucleotide positions 34–36 of native tRNA refer to the three nucleotides of the anticodon, and positions 74–76 refer to the terminal CCA tail."Extra" nucleotides can be numbered in the D arm by adding an alphabet to the number of the preceding nucleotide that is part of the consensus tRNA, such as 20a, 20b, etc., according to convention, or by numbering the nucleotide independently and adding a leading letter, as in the case of variable loops, such as e11, e12, etc. (see, for example, Non-Patent Document 17). Hereafter, tRNA-specific numbering will also be referred to as "tRNA numbering rules" or "transfer RNA numbering rules".

[0019] The term "tRNA body" refers to the portion of tRNA located outside the anticodon loop.

[0020] The term "intron" refers to a polynucleotide sequence within a nucleic acid that is present in the genome and in the first nucleic acid product transcribed from the genomic nucleic acid, but is not included in the final nucleic acid product. For example, in the case of a protein gene, an intron is a non-coding polynucleotide sequence that separates coding polynucleotide sequences (exons) and is cut out from the premRNA transcribed from the protein gene in a process called "splicing." For example, in the case of transfer RNA, the term intron refers to a polynucleotide sequence that is cut out (spliced) from the pretRNA transcribed from the tRNA gene.

[0021] The term "intronic tRNA" refers to tRNA whose precursor (pre-tRNA) contains introns that are spliced ​​from the pre-tRNA when the pre-tRNA is processed into the final (mature) tRNA. The term "non-intronic tRNA" refers to tRNA that does not contain introns and is produced from pre-tRNA that does not undergo splicing. The terms "intronic tRNA" and "non-intronic tRNA" encompass both pre-tRNA and mature tRNA.

[0022] As used herein, the term "tDNA" refers to a DNA sequence that encodes tRNA, and more particularly to a DNA sequence having a tRNA sequence in which the uracil nucleotide (U) of tRNA is replaced by a thymine nucleotide (T).

[0023] The terms "engineered transfer ribonucleic acid" or "synthetic tRNA" refer to tRNA or non-natural tRNA that has been modified by chemical or molecular biological methods. The terms "engineered" and "synthetic" are used synonymously here. An example is tRNA that, under natural conditions, is aminoacylated with an amino acid, but possesses an anticodon that pairs with a stop codon rather than the anticodon of the corresponding amino acid.

[0024] The term "codon" refers to a nucleotide triplet, or sequence of three DNA or RNA nucleotides, that corresponds to a specific amino acid or stop signal during protein synthesis. A list of codons (at the mRNA level) and the amino acids they encode is provided below. Amino Acids - Single-letter codes (codons) Ala A GCU, GCC, GCA, GCG Arg R CGU, CGC, CGA, CGG, AGA, AGG Asn N AAU,AAC Asp D GAU,GAC Cys C UGU, UGC Gln Q CAA,CAG Glu E GAA, GAG Gly G GGU, GGC, GGA, GGG His H CAU, CAC Ile I AUU,AUC,AUA Leu L UUA,UUG,CUU,CUC,CUA,CUG Lys K AAA, AAG Met M AUG Phe F UUU,UUC Pro P CCU, CCC, CCA, CCG Ser S UCU, UCC, UCA, UCG, AGU, AGC Thr T ACU,ACC,ACA,ACG Trp W UGG Tyr Y UAU,UAC Val V GUU, GUC, GUA, GUG Start:AUG Ending: UAA, UGA, UAG, abbreviation "X"

[0025] As used herein, the term "sense codon" refers to a codon that codes for an amino acid. The terms "stop codon" or "nonsense codon" refer to a codon in the genetic code, or nucleotide triplet, that does not code for one of the 20 amino acids commonly found in proteins, but instead transmits a signal for the termination of messenger RNA translation.

[0026] A "frameshift mutation" refers to an extra-frame insertion or deletion of a number of nucleotides that is not divisible by 3 (collectively called an "indel"). This disrupts the decoding of nucleotide sequences, which progress in units of 3 nucleotide bases. A "-1 frameshift mutation" refers to a case where a deletion of one nucleotide shifts the reading frame by one nucleotide, and the first nucleotide of the next codon is read as part of the codon from which the nucleotide was deleted. A deletion of one nucleotide from an upstream codon along with several triplets (i.e., deletions of 4, 7, 10 nucleotides, etc.) is also considered a -1 frameshift. The term "+1 frameshift mutation" refers to an insertion of one nucleotide into a triplet or a deletion of two nucleotides. In either case, the reading frame shifts by one nucleotide, and the nucleotide of the upstream codon is read as part of the downstream codon. The insertion of one nucleotide along with several triplets (3n+1 nucleotides, where n is an integer, i.e., insertions of 4, 7, 10 nucleotides, etc.) or the deletion of two nucleotides from an upstream codon along with several triplets (i.e., deletions of 5, 8, 11 nucleotides, etc.) are also considered a +1 frameshift.

[0027] The term "anticodon" refers to a sequence of typically three nucleotides in tRNA that forms a base pair (non-covalent bond) with the three bases (nucleotides) of a codon on mRNA. In natural tRNA, a standard three-nucleotide anticodon is typically represented by nucleotides at positions 34, 35, and 36. Anticodons can also contain modified nucleotides. The term "four-nucleotide anticodon" or "four-base anticodon" refers to an anticodon having four consecutive nucleotides (bases) that pair with four consecutive bases on mRNA. The term "quadraplet nucleotide anticodon" or "quadraplet anticodon" is sometimes used to refer to a "four-nucleotide anticodon." The term "five-nucleotide anticodon" or "five-base anticodon" refers to an anticodon having five consecutive nucleotides (bases) that bind to (form a base pair) with five consecutive bases on mRNA. The term "quintiplet nucleotide anticodon" or "quintiplet anticodon" is sometimes used to refer to a "five-nucleotide anticodon."

[0028] The term "anticodon arm" refers to a portion of tRNA containing an anticodon. An anticodon arm typically consists of a stem portion ("anticodon stem") consisting of 5 base pairs (positions 27-31 and 39-43) and a loop portion ("anticodon loop"), which is a continuous sequence of unpaired nucleotides attached to the anticodon stem. The anticodon arm occupies positions 27-43, and the position numbering follows the transfer RNA numbering rules.

[0029] The term "anticodon loop" refers to the unpaired nucleotides in the anticodon arm containing the anticodon. Natural tRNA typically has seven nucleotides in the anticodon loop, three of which pair with the mRNA codon.

[0030] The term "extended anticodon loop" refers to an anticodon loop in which the number of nucleotides within the loop is greater than that of natural tRNA. An extended anticodon loop may contain more than, for example, 7 nucleotides, such as 8, 9, or 10 nucleotides. In particular, the term refers to an anticodon loop containing more than three consecutive nucleotides, such as 4, 5, or 6 nucleotides, which can form base pairs with the corresponding number of consecutive nucleotides in the mRNA.

[0031] The term "anticodon stem" refers to the paired nucleotides of an anticodon arm that has an anticodon loop.

[0032] The term "T-arm" refers to a portion of tRNA that consists of a stem portion ("T-stem") and a loop portion between the acceptor stem and the variable loop ("T-loop"). The T-arm occupies positions 49–65, and the position numbering follows the transfer RNA numbering rules. The T-stem typically consists of five nucleotide pairs (occupying positions 49–53 and 61–65).

[0033] The term "T-stem" (or "TψC" stem) refers to a paired nucleotide with a T-loop, i.e., an unpaired T-arm.

[0034] The term "D-arm" refers to the tRNA portion composed of a stem ("D-stem"), i.e., the paired nucleotides of the D-arm, and a D-loop, i.e., the unpaired nucleotides of the D-arm between the acceptor stem and the anticodon arm. The D-arm occupies positions 10-25, and the position numbering follows the transfer RNA numbering rules.

[0035] The term "variable loop" refers to the tRNA loop located between the anticodon arm and the T arm. The number of nucleotides constituting the variable loop varies considerably depending on the tRNA. Therefore, the variable loop can be quite short, even absent, or quite large, for example, forming a helix. The term "variable arm" is sometimes used synonymously with the term "variable loop." The use of the term "variable loop" does not exclude the existence of a "stem" portion within the variable loop, i.e., a stretch of consecutive nucleotides in the variable loop that forms base pairs with the other consecutive nucleotides in the variable loop. The variable loop occupies positions 44-48, and the position numbering follows the transfer RNA numbering rules. Note that the variable loop may have a considerable number of additionally numbered nucleotides (see Figure 1).

[0036] The term "acceptor stem" refers to the site where an amino acid binds to tRNA. Acceptor stems are often formed from seven base pairs.

[0037] The terms “codon-base triplet” or “anticodon-base triplet,” as used herein, refer to a sequence of three consecutive nucleotides that form a codon or anticodon. Synonyms may also be used, such as “3-nucleotide codon” (also “3-base codon”) or “3-nucleotide anticodon” (also “3-base anticodon”), or their abbreviations, such as “3nt codon” or “3nt anticodon”.

[0038] The term "base pair" refers to a pair of bases bonded by a hydrogen bond, or the formation of such a pair. The term "Watson-Crick base pair" is also sometimes used for such base pairs. One base in a base pair is usually a purine, and the other is usually a pyrimidine. In RNA, for example, adenine and uracil can form a base pair, and guanine and cytosine can form a base pair. In DNA, thymine usually forms a base pair with adenine instead of uracil. However, the formation of other base pairs ("fluctuation base pairs") is also possible, such as guanine-uracil (GU), hypoxanthine-uracil (IU), hypoxanthine-adenine (IA), and hypoxanthine-cytosine (IC). The term "can form a base pair" refers to the ability of a nucleotide or nucleotide sequence to form a hydrogen bond stabilizing structure with a corresponding nucleotide or nucleotide sequence. Base pairing can occur intramolecularly, for example, within a single-stranded nucleic acid (e.g., tRNA), or intermolecularly, i.e., between different nucleic acid molecules.

[0039] In this specification, the term "base," when used in terms such as "base A, C, G, or U" or "base A, C, G, or T," encompasses or is synonymous with the term "nucleotide," unless otherwise specified by the context.

[0040] The abbreviations used herein to represent bases or nucleotides are as follows, in accordance with the IUPAC nucleotide code and standard ST.26 (version 1.5): IUPAC nucleotide codes bases Adenine C Cytosine G Guanine T (or U) Thymidine (or uracil in RNA) RA or G YC or T / U SG or C WA or T / U KG or T / U MA or C BC or G or T / U DA or G or T / U HA or C or T / U VA, C, or G N is any base . or - gap

[0041] "PTC" refers to an immature termination codon. This is a mutation in which a stop codon introduced into the coding nucleic acid sequence by a nonsense mutation—that is, a sense codon that codes for one of the 20 protein-producing amino acids defined by the standard genetic code—is changed to a chain termination codon. Therefore, this term refers to an immature termination signal in the translation of the genetic code contained in mRNA. The term "immature termination codon" ("PSC") is sometimes used synonymously with immature termination codon, or PTC.

[0042] The terms "frameshift suppression" or "frameshift rescue" refer to mechanisms that mask the effects of frameshift mutations and restore, at least partially, the wild-type phenotype.

[0043] The terms "nonsense suppression," "nonsense mutation suppression," "PTC suppression," or "PTC rescue" refer to mechanisms that mask the effects of nonsense mutations and restore mRNA translation and, at least partially, the wild-type phenotype.

[0044] The term "tRNA sequestration" refers to the irreversible binding of tRNA to tRNA synthetase, where tRNA binds to tRNA synthetase but is not released from tRNA synthetase, or is essentially not released.

[0045] The term "suppressor tRNA" refers to a tRNA that alters the reading of messenger RNA in a given translation system so that, for example, a frameshift mutation or a nonsense mutation is "suppressed," the effects of the frameshift mutation or nonsense mutation are masked, and the wild-type phenotype is at least partially restored. Examples of suppressor tRNAs include those that have amino acids and can base-pair with the PTC of mRNA, or, for example, in the case of tRNAs with an extended anticodon loop and a 4-base, 5-base, or 6-base anticodon, a section on mRNA having two consecutive codons, one or both of which are mutated, or a section having a first codon and a second consecutive codon, one of which is complete and the other has an insertion or deletion. In this way, the translation system can modify the reading frame in the case of a frameshift mutation or read through the PTC in the case of a nonsense mutation.

[0046] The term "decoding activity" in relation to tRNA refers to the property or ability of transfer RNA to be used by the cell's translation machinery as an amino acid donor for protein production. Under physiological conditions, tRNA has "decoding activity" if it is loaded with congener amino acids and the loaded tRNA (aminoacyl-tRNA) is subsequently incorporated into a protein. The decoding activity of a first tRNA for a given amino acid can be compared to the decoding activity of a second tRNA for the same amino acid, for example, by comparing the proportion of the amino acid from the first or second tRNA that is incorporated into the protein. The terms "salvage activity," "suppression activity," "suppression efficiency," or "readthrough activity" refer to the decoding activity or efficiency of suppressor tRNAs, such as frameshift suppressors or nonsense suppressor tRNAs, in particular tRNAs designed to decode immature stop codons of mRNA into amino acids, so that the translation of mRNA into the corresponding protein is not interrupted in an immature state.

[0047] The term "the tRNA encoded by the DNA construct of the present invention still performs its function in the translation machinery of a living cell" refers to the tRNA transcribed from the tRNA gene having decoding activity. In the case of suppressor tRNA, this term refers to the tRNA having greater rescue activity than its spontaneous (stochastic) rescue activity in a given cellular environment.

[0048] The term "aminoacylation" refers to the enzymatic reaction of loading amino acids onto tRNA. Aminoacyl-tRNA synthetase (aaRS) catalyzes the esterification of specific congeneral amino acids or their precursors onto congeneral tRNAs to form aminoacyl-tRNA. Therefore, the term "aminoacyl-tRNA" refers to tRNA to which amino acids have been bound. Each aminoacyl-tRNA synthetase is highly specific to a given amino acid, and multiple tRNAs may exist for the same amino acid, but there is only one aminoacyl-tRNA synthetase for each of the 20 protein-producing amino acids. The terms "loading" or "carrying" are sometimes used synonymously with "aminoacylation."

[0049] The term "expression" refers to the conversion of genetic information into functional products, such as proteins or nucleic acids, such as functional RNA (e.g., transfer RNA). This term encompasses not only the biosynthesis of genetically-based proteins, such as enzymes, including the formation of mRNA based on a DNA template, but also the synthesis of functional RNA molecules, such as tRNA, as well as previous processes such as transcription or splicing, i.e., the formation of mRNA based on a DNA template. With regard to the production of mature tRNA in cells from tRNA genes, the term "transcription" is sometimes used synonymously with "expression," particularly in terms of increasing or decreasing production, and therefore encompasses not only the synthesis of the initial RNA product (i.e., pre-tRNA) but also the processing from the initial RNA product to the final RNA product (i.e., mature tRNA). The terms "expression intensity" or "expression level" refer to the amount of product synthesized from a DNA template. The term "high expression" refers to a high expression level, i.e., an expression level higher than the average expression level observed for a given molecular species, such as tRNA. The term "low expression" refers to a low expression level, i.e., an expression level lower than the average expression level observed for a given molecular species, such as tRNA.

[0050] Nucleic acid-encoded tRNAs, such as suppressor tRNAs, are positioned within a synthetic DNA construct, such as a synthetic vector, so that the encoded tRNA is produced within the cell, preferably using the cell's innate transcription machinery, in a transcribed form, i.e., a form that, when introduced into a living mammalian cell, such as a human cell, is transcribed under natural conditions. The tRNA can be positioned so that it can be transcribed conditionally, i.e., according to specific intracellular conditions. Sequence motifs in the 5' leader sequence cause tRNAs positioned downstream of the 5' leader sequence to be transcribed more strongly (at a higher level) or weaker (at a lower level) than in the absence of these motifs.

[0051] The synthetic DNA construct according to the present invention includes at least one 5' leader sequence motif from feature a), b), or c), or a combination of at least two sequence motifs independently selected from the sequence motifs of feature a), b), or c). In the combination of sequence motifs, all sequence motifs can be selected exclusively from one of the sequence motifs of feature a), b), or c), for example, from the sequence motif of feature b). Alternatively, in the combination of sequence motifs, the first sequence motif can be selected from the sequence motifs of feature a) or b), and the second sequence motif can be selected from the sequence motif of feature b). For example, the synthetic DNA construct according to the present invention includes the sequence motif of feature a), i.e., sequence motif I L II L III L , I H II H , and III H It may include a first sequence motif selected from and a second sequence motif selected from the sequence motif of feature b). The synthetic DNA construct according to the present invention may also include a combination of three or more sequence motifs, for example, three sequence motifs independently selected from the sequence motifs of features a), b), or c). Those skilled in the art may, for example, combine the above-mentioned 5' leader sequence motifs with specific A and / or B boxes contained in the D-arm sequence or T-arm sequence to establish better control of the expression of tRNA encoded by the nucleic acid. The DNA construct of the present invention does not include any natural combination of one or more 5' leader sequence motifs and encoded tRNA.

[0052] In a first embodiment, the present invention promotes high expression of tRNA when it is present in the 5' leader sequence of a tRNA encoded by a DNA construct, which is functionally ligated to the nucleic acid encoding the transfer RNA. H (TGACCTAAGTGTAAAGT, Sequence ID 1), II H (TGAGATTTCCTTCAGGTT, Sequence ID 2) and III HThree sequence motifs called (TATATAGTTCTGTATGAGACCACTCTTTCCC, Sequence ID 3), and three sequence motifs I that promote low tRNA expression L (ACCATAAACGTGAAATG, Sequence ID 4), II L (TCTTTGGATTTGGGAATC, Sequence ID 5) and III L We provide a DNA construct containing (TTATAAGTTCTGTATGAGACCACTCTTTCCC, Sequence ID 6). These sequence motifs can be incorporated into the 5' leader sequence of the relevant tRNA gene to control the tRNA expression level.

[0053] In this preferred embodiment of the first embodiment of the DNA construct of the present invention, sequence motif I H and I L Both cannot exist in the same 5' leader sequence. The same is true for sequence motif II. H and II L and Array Motif III H and III L This also applies to the following. Therefore, in a preferred embodiment of the synthetic DNA construct of the present invention, The 5' leader sequence is sequence motif I L If it includes, sequence motif I H It does not include, and vice versa. ii.5' Leader sequence is sequence motif II L If it includes, Array Motif II H It does not include, and vice versa. iii.5' Leader arrangement is arrangement motif III L If it includes, Array Motif III H It does not include, and vice versa.

[0054] In a preferred embodiment of the first embodiment of the synthetic DNA construct of the present invention, sequence motif I L II L III L , I H II H or III HIf present, it is located upstream of the tRNA-coding nucleic acid at a specific position. In particular, sequence motif I L and I H If present, it is positioned to occupy positions -66 to -50, which are related to the upstream region of the nucleic acid encoding tRNA. Sequence motif II L and II H If present, it is arranged to occupy positions -49 to -32, and is part of the arrangement motif III. L and III H If present, it is positioned to occupy positions -31 to -1. Therefore, in a preferred embodiment of the synthetic DNA construct according to the present invention, the sequence motif is preferably i.5' Leader array is array motif I H or I L If it includes, array motif I H or I L It has positions -66 to -50 in the 5'-3' direction. ii.5' Leader array is array motif II H or II L If it includes, Array Motif II H or II L It has positions -49 to -32 in the 5'-3' direction. iii.5' Leader array is array motif III H or III L If it includes, array motif III H or III L It has positions -31 to -1 in the 5'-3' direction. They are arranged in this manner.

[0055] In a preferred embodiment of the first embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence is sequence motif I L II L III L , I H II H or III H It includes at least two array motifs selected from, and these at least two array motifs are arranged in the 5'-3' direction, I H -II H IIH -III H 、I H -III H 、I L -II L 、II L -III L 、I L -III L 、I<00已0078>-II L 、I H -III L 、II H -III L 、I L -II H 、II L -III H 、またはI L -III H are arranged in the order of.

[0056] As described above, the array motif is preferably at the described position, i.e., array motif I L and I [[ID=5已0]] H are in positions -66 to -50, array motif II L and II H are in positions -49 to -32, array motif III L and III H are arranged to occupy positions -31 to -1.

[0057] In a more preferred embodiment of the synthetic DNA construct according to the present invention, the 5' leader sequence comprises three array motifs selected from array motif I L 、II L 、III L 、I H 、II H またはIII H . Preferably, the array motifs are in the 5'-3' direction in the following order: I L -II L -III L 、I H -II<00已00106>-III H 、I H -II L -III L s 、I L -II H -III L, I L -II L -III H , I H -II H -III L , I H -II L -III H , or I L -II H -III H They are positioned there. Preferably, the sequence motifs are positioned directly one after another without the need for nucleotides or linkers. Here again, the sequence motifs preferably have the positions described.

[0058] In a preferred embodiment of the first embodiment of the DNA construct of the present invention, the 5' leader sequence may have one of the sequences of sequence numbers 12 to 37 according to the following list. P1(I H -II H -III H (Sequence ID 12) TGACCTAAGTGTAAAGTTGAGATTTCCTTCAGGTTTATATAGTTCTGTATGAGACCACTCTTTCCC P2(I L -II L -III L (Sequence ID 13): ACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTTCCC P3(I H , Sequence ID 14): TGACCTAAGTGTAAAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P4(II H (Sequence No. 15) NNNNNNNNNNNNNNNNNNTGAATTTCCTTCAGGTTNNNNNNNNNNNNNNNNNNNNN P5(III H , Sequence ID 16): NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATAGTTCTGTATGAGACCACTCTTTCCC P6(I H -II H (Sequence ID 17) TGACCTAAGTGTAAAGTTGAGATTTCCTTCAGGTTNNNNNNNNNNNNNNNNNNNNNNN P7(II H -III H (Sequence ID 18): NNNNNNNNNNNNNNNNNNTGAATTTCCTTCAGGTTTATATAGTTCTGTATGAGACCACTCTTTCCC P8(I H -III H (Sequence ID 19) TGACCTAAGTGTAAAGTNNNNNNNNNNNNNNNNNNTATATAGTTCTGTATGAGACCACTCTTTCCC P9(I L (Sequence code 20): ACCATAAACGTGAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P10(II L (Sequence ID 21): NNNNNNNNNNNNNNNNNTCTTTGGATTTGGGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P11(III L , Sequence ID 22): NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTATAAGTTCTGTATGAGACCACTCTTTCCC P12(I L -II L (Sequence No. 23) ACCATAAACGTGAAATGTCTTTGGATTTGGGAATCNNNNNNNNNNNNNNNNNNNNNNN P13(II L -IIIL , Sequence ID 24): NNNNNNNNNNNNNNNNNTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCC P14 (Sequence ID 25): ACCATAAACGTGAAATGNNNNNNNNNNNNNNNNTTATAAGTTCTGTATGAGACCACTCTTTCCC P15 (Sequence No. 26): TGACCTAAGTGTAAAGTTCTTTGGATTTGGGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN P16 (Sequence No. 27): TGACCTAAGTGTAAAGTNNNNNNNNNNNNNNNNTTATAAGTTCTGTATGAGACCACTCTTTCCC P17 (Sequence No. 28): NNNNNNNNNNNNNNNNNNTGAGATTTCCTTCAGGTTTTATAAGTTCTGTATGAGACCACTCTTTCCC P18 (Sequence No. 29): ACCATAAACGTGAAATGTGAGATTTCCTTCAGGTTNNNNNNNNNNNNNNNNNNNNNNN P19 (Sequence No. 30): NNNNNNNNNNNNNNNNNTCTTTGGATTTGGGAATCTATATAGTTCTGTATGAGACCACTCTTTCCC P20 (Sequence No. 31): ACCATAAACGTGAAATGNNNNNNNNNNNNNNNNNTATATAGTTCTGTATGAGACCACTCTTTCCC P21 (Sequence No. 32): TGACCTAAGTGTAAAGTTCTTTGGATTTGGGAATCTTATAAGTTCTGTATGAGACCACTCTTTCCC P22 (Sequence No. 33): ACCATAAACGTGAAATGTGAGATTTCCTTCAGGTTTTATAAGTTCTGTATGAGACCACTCTTTCCC P23 (Sequence ID 34): ACCATAAACGTGAAATGTCTTTGGATTTGGGAATCTATATAGTTCTGTATGAGACCACTCTTTTCCC P24 (Sequence ID 35): TGACCTAAGTGTAAAGTTGAGATTTCCTTCAGGTTTTATAAGTTCTGTATGAGACCACTCTTTCCC P25 (Sequence No. 36): TGACCTAAGTGTAAAGTTCTTTGGATTTGGGAATCTATATAGTTCTGTATGAGACCACTCTTTCCC P26 (Sequence ID 37): ACCATAAACGTGAAATGTGAGATTTCCTTCAGGTTTATATAGTTCTGTATGAGACCACTCTTTCCC

[0059] N represents any nucleotide (A, G, C, or T).

[0060] In a preferred embodiment of the first embodiment of the synthetic DNA construct of the present invention, the above 5' leader sequence is flanked by a linker or spacer region containing a repeat of a linker / spacer sequence at its 3' end, i.e., downstream of the tRNA gene, or at its 5' end, i.e., upstream of the tRNA gene and the above 5' leader sequence. The terms “linker” and “spacer” are used synonymously in this context. The spacer region may contain, for example, a nucleotide sequence up to 300 nt in length. The spacer region preferably contains or consists of a series of repeats of a spacer sequence of 8-12, 9-11, or 10 nucleotides, for example, a series of 10-30 repeats. An example of a suitable spacer sequence is ACTCTTTCCC (SEQ ID NO: 38). A 5' leader sequence according to the first embodiment of the synthetic DNA construct of the present invention, including such a spacer region, may have, for example, the following general structure: H -II H -III H -(spacer) n , or (spacer) n -I H -II H -III H (n=10~30). The number and composition of the sequence motifs are as follows: Sequence motif I H II H III H , I L II L , and III LPreferably, the sequence has a combination of at least two or three different sequence motifs selected from and a spacer region at the 5' or 3' end of the combination, but this can vary. The term “sequence motif region” is used for a region having at least one sequence motif or combination of sequence motifs. The spacer region may be directly adjacent to the 5' or 3' end of the sequence motif region, or it may be separated from the sequence motif region by only a number of nucleotides, preferably less than 50, 40, 30, 25, 20, 15, or 10 nucleotides, in the 5' or 3' direction. The above positions are preferably adapted accordingly, in embodiments where the 5' leader sequence includes a spacer repeat, such that the 5' leader sequence extends in the 5' direction by the number of nucleotides covered by the spacer region.

[0061] In a second embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence is 50 nt H The sequence motif called (Sequence ID 7) is VNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND and 50nt L It contains one sequence motif selected from the group consisting of GCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT, known as (Sequence ID 8).

[0062] The abbreviations have the standard meanings shown above (see, for example, ST.26 ver. 1.5).

[0063] Array motif 50nt H This promotes higher expression of downstream tRNA genes, 50nt L This results in lower expression of downstream tRNA genes.

[0064] In this preferred embodiment of the second embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence is a sequence motif 50nt L If it includes the sequence motif 50nt H It does not include, and vice versa.

[0065] More preferably, in this second embodiment, the array motif 50nt H or 50nt L It occupies the -50 to -1 position, i.e., 50nt H If such an arrangement exists, it is preferable that it occupies the -50 to -1 position in the 5'-3' direction, and 50nt L If such an array exists, it occupies positions -50 to -1 in the 5'-3' direction.

[0066] Array motif 50nt H It may have one of the following sequences. P27 (50 nt) H1 (Sequence No. 39) CCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG P28 (50 nt) H2 (Sequence No. 40) AGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT P29 (50 nt) H3 (Sequence No. 41) GCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA P30 (50 nt H4 (Sequence No. 42) GCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG P31 (50 nt) H5 (Sequence No. 43) GGTTCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG P32 50nt H6 (Sequence number 44) CTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA P33 (50nt) H7 (Sequence No. 45) AACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT

[0067] Array motif 50nt L It may have one of the following sequences. P34 (50nt) L1 (Sequence No. 46) GCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT P35 (50nt) L4 (Sequence code 47) ATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA P36 (50nt) L5 (Sequence No. 48) GCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC P37 (50 nt) L6 (Sequence No. 49) AAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC P38 (50nt) L7 (Sequence number 50) CAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT

[0068] In a preferred embodiment of the second embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence contains one of the sequence motifs of SEQ ID NO: 7 or 8 of feature b) above (provided that the 5' leader sequence does not contain one of the sequences of SEQ ID NO: 39, 42, or 46); or if the 5' leader sequence contains one of the sequences of SEQ ID NO: 39 or 46, the encoded transfer RNA is tRNA. Gly Instead, if the 5' leader sequence contains the sequence of sequence number 42, the encoded transfer RNA is tRNA. LeuNo. However, this is preferably limited to synthetic DNA constructs in which the sequence motif of SEQ ID NO: 7 or 8 of feature b) is not combined with one of the sequence motifs of feature a) or c) above (see below). "When the 5' leader sequence contains one of the sequences of SEQ ID NO: 39 or 46, the encoded transfer RNA is tRNA Gly The term "not" means that the nucleic acid of the synthetic DNA construct of the present invention, which contains one of the sequences of SEQ ID NO: 39 or 46 as the 5' leader sequence, does not encode a transfer RNA having a tRNA body that is aminoacylated with glycine in vivo. Similarly, "if the 5' leader sequence contains the sequence of SEQ ID NO: 42, the encoded transfer RNA is tRNA." Leu The term "not" means that the nucleic acid of the synthetic DNA construct of the present invention, which includes the sequence of Sequence ID No. 42 as the 5' leader sequence, does not encode a transfer RNA having a tRNA body that is aminoacylated with leucine in vivo.

[0069] In a further preferred embodiment of the synthetic DNA construct according to the present invention, the 5' leader sequence may include the spacer region described above, as described in feature a) above. L II L III L , I H II H and III H One of the sequence motifs selected from, immediately following it in the 5'-3' direction, is the sequence motif of feature b) described above (50nt). H and 50nt L Includes an array motif selected from. In this embodiment, the array motif I of feature a) described above. H (Sequence ID 1), II H (Sequence ID 2), III H (Sequence ID 3), I L (Sequence ID 4), II L (Sequence ID 5) and III L One of the sequences (SEQ ID NO: 6) is the 50nt sequence motif of feature b) described above. H (Sequence ID 7) or 50ntL It is combined with (Sequence ID 8). Preferably, in this embodiment, the sequence motif 50nt H or 50nt L Immediately following is the arrangement motif I H II H III H , I L II L or III L This continues. Any of these combinations are possible. Therefore, for example, Array Motif II L 50nt array motif L And, Array Motif II L 50nt array motif H or, arrangement motif I H 50nt array motif L Or 50nt H It is possible to combine them. Therefore, the following combinations are possible: H -50nt H I H -50nt L II H -50nt H II H -50nt L III H -50nt H III H -50nt L I L -50nt H I L -50nt L II L -50nt H II L -50nt L III L -50nt H III L -50nt L Therefore, in this embodiment, the 5' leader sequence includes or has sequences of the following sequence numbers 50 to 61. I H -50nt H (Sequence ID 51) TGACCTAAGTGTAAAGTVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND I H -50nt L (Sequence ID 52) TGACCTAAGTGTAAAGTGCNGGDGGCGNGTTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT II H -50nt H (Sequence No. 53) TGAGATTTCCTTCAGGTTVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND II H -50nt L (Sequence ID 54) TGAGATTTCCTTCAGGTTGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT III H -50nt H (Sequence ID 55) TATATAGTTCTGTATGAGACCACTCTTTCCCVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND III H -50nt L (Sequence ID 56) TATATAGTTCTGTATGAGACCACTCTTTCCCGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT I L -50nt H (Sequence ID 57) ACCATAAACGTGAAATGVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND I L -50nt L (Sequence ID 58) ACCATAAACGTGAAATGGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT II L -50nt H (Sequence ID 59) TCTTTGGATTTGGGAATCVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND II L -50nt L (Sequence ID 60) TCTTTGGATTTGGGAATCGCNGGDGGCGNGTTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT III L -50nt H (Sequence ID 61) TTATAAGTTCTGTATGAGACCACTCTTTCCCVNANANTVHANANNTTNNNATRANATTCNGDGVGNAANATABTNCTVGND III L -50nt L (Sequence ID 62) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCNGGDGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNCNTCGGT

[0070] The above 50nt H and 50nt L Considering the motif arrangement (P27~P38), the 5' leader arrangement may include or have one of the following arrangements. TGACCTAAGTGTAAAGTCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (Sequence No. 63) TGACCTAAGTGTAAAGTAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT(Sequence No. 64) TGACCTAAGTGTAAAGTGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (Sequence No. 65) TGACCTAAGTGTAAAGTGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence No. 66) TGACCTAAGTGTAAAGTGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 67) TGACCTAAGTGTAAAGTCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA(Sequence No. 68) TGACCTAAGTGTAAAGTAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT(Sequence No. 69) TGACCTAAGTGTAAAGTGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT(Sequence No. 70) TGACCTAAGTGTAAAGTATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA(Sequence No. 71) TGACCTAAGTGTAAAGTGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC(Sequence No. 72) TGACCTAAGTGTAAAGTAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC(Sequence No. 73) TGACCTAAGTGTAAAGTCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT(Sequence No. 74) TGAGATTTCCTTCAGGTTCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (Sequence No. 75) TGAGATTTCCTTCAGGTTAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 76) TGAGATTTCCTTCAGGTTGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (Sequence No. 77) TGAGATTTCCTTCAGGTTGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence No. 78) TGAGATTTCCTTCAGGTTGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 79) TGAGATTTCCTTCAGGTTCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA(Sequence No. 80) TGAGATTTCCTTCAGGTTAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (Sequence No. 81) TGAGATTTCCTTCAGGTTGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT (Sequence No. 82) TGAGATTTCCTTCAGGTTATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence No. 83) TGAGATTTCCTTCAGGTTGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 84) TGAGATTTCCTTCAGGTTAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (Sequence No. 85) TGAGATTTCCTTCAGGTTCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT (Sequence No. 86) TATATAGTTCTGTATGAGACCACTCTTTCCCCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (Sequence No. 87) TATATAGTTCTGTATGAGACCACTCTTTCCCAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 88) TATATAGTTCTGTATGAGACCACTCTTTCCCGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (Sequence No. 89) TATATAGTTCTGTATGAGACCACTCTTTCCCGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence No. 90) TATATAGTTCTGTATGAGACCACTCTTTCCCGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 91) TATATAGTTCTGTATGAGACCACTCTTTCCCCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA(Sequence ID 92) TATATAGTTCTGTATGAGACCACTCTTTCCCAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT(Sequence No. 93) TATATAGTTCTGTATGAGACCACTCTTTCCCGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT(Sequence No. 94) TATATAGTTCTGTATGAGACCACTCTTTCCCATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence No. 95) TATATAGTTCTGTATGAGACCACTCTTTCCGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 96) TATATAGTTCTGTATGAGACCACTCTTTCCCAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (Sequence No. 97) TATATAGTTCTGTATGAGACCACTCTTTCCCCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT(Sequence No. 98) ACCATAAACGTGAAATGCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (SEQ ID NO: 99) ACCATAAACGTGAAATGAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (Sequence No. 100) ACCATAAACGTGAAATGGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (SEQ ID NO: 101) ACCATAAACGTGAAATGGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (Sequence No. 102) ACCATAAACGTGAAATGGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 103) ACCATAAACGTGAAATGCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA (Sequence ID 104) ACCATAAACGTGAAATGAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (Sequence ID 105) ACCATAAACGTGAAATGGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT(SEQ ID NO: 106) ACCATAAACGTGAAATGATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA(SEQ ID NO: 107) ACCATAAACGTGAAATGGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC(SEQ ID NO: 108) ACCATAAACGTGAAATGAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC(SEQ ID NO: 109) ACCATAAACGTGAAATGCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT(SEQ ID NO: 110) TCTTTGGATTTGGGAATCCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG(SEQ ID NO: 111) TCTTTGGATTTGGGAATCAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT(SEQ ID NO: 112) TCTTTGGATTTGGGAATCGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA(SEQ ID NO: 113) TCTTTGGATTTGGGAATCGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG(SEQ ID NO: 114) TCTTTGGATTTGGGAATCGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG(SEQ ID NO: 115) TCTTTGGATTTGGGAATCCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA(SEQ ID NO: 116) TCTTTGGATTTGGGAATCAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (SEQ ID NO: 117) TCTTTGGATTTGGGAATCGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT (SEQ ID NO: 118) TCTTTGGATTTGGGAATCATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (SEQ ID NO: 119) TCTTTGGATTTGGGAATCGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 120) TCTTTGGATTTGGGAATCAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (SEQ ID NO: 121) TCTTTGGATTTGGGAATCCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT (SEQ ID NO: 122) TTATAAGTTCTGTATGAGACCACTCTTTCCCCCATGATCCCCCACTATTAAGGATATCCGGAGAGGATGCTACCTATCAGG (SEQ ID NO: 123) TTATAAGTTCTGTATGAGACCACTCTTTCCCAGACCAGCTGTATAGCCTCAGAATGATCCGTCCGGAAACCCTTACTAGGT (SEQ ID NO: 124) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCATATTGCAGAACTTGTGAAGAGGCTTTATGCGCCACACACTGCAAGCA (SEQ ID NO: 125) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCAAAAGCAAAAGCATTAAGTAGCTTTCTGGCATAAACATATTGCAGCTG (SEQ ID NO: 126) TTATAAGTTCTGTATGAGACCACTCTTTCCCGGTTGCGGTAAGCATTAGAGGGCTATCAGCAGCATCTTATCGCAGCGGAG (Sequence No. 127) TTATAAGTTCTGTATGAGACCACTCTTTCCCCTGCAGTATAACCTTGAAGTACCATCACGGAGAGAAACAGTGCCATCTCA (SEQ ID NO: 128) TTATAAGTTCTGTATGAGACCACTCTTTCCCAACGACTACGTAGTGTTCTATAACAATCATGAGAAATTTTAGTTCTAGAT (Sequence ID 129) TTATAAGTTCTGTATGAGACCACTCTTTCCCGCTGGTGGCGAGTTCCGCTGTGCCAGCTTCCGTTGGCGTTTGCCATCGGT (Sequence No. 130) TTATAAGTTCTGTATGAGACCACTCTTTCCCATGCGGCCTTGTGTGGTGGCTCATTGTGGTGGGCCAGAAAACGCGTGCAA (Sequence ID 131) TTATAAGTTCTGTATGAGACCACTCTTTCCGCCAGAGGCGCTGGGGCCAGGAGGCGCAAGCCGGGCCCTGAAGCCGCCTC (SEQ ID NO: 132) TTATAAGTTCTGTATGAGACCACTCTTTCCCAAAGAAATTAGGAAATTCCTGTGGAAGCTGGCGCGTTGATGCACTTCGTC (Sequence No. 133) TTATAAGTTCTGTATGAGACCACTCTTTCCCCAACAAACATTTTGCTTTTTTAAAATTGAAAGAACAACTGTTTTCCGGGT (SEQ ID NO: 134)

[0071] In a further preferred embodiment of this embodiment of the synthetic DNA construct according to the present invention, the 5' leader sequence is sequence motif I H II H III H One of them, and immediately after it, in the 5'-3' direction, a sequence motif of 50nt HIncludes; or arrangement motif I L II L III L One of them, and immediately after it, in the 5'-3' direction, a sequence motif of 50nt L Includes. Array motif I H II H III H One of them, and immediately after it, in the 5'-3' direction, a sequence motif of 50nt H The 5' leader sequence containing may contain, or may have, one of the sequences of sequence numbers 51, 53, or 55, or one of the sequences of sequence numbers 63-69, 75-81, or 87-93, for example. Sequence motif I L II L III L One of them. Immediately after that, a sequence motif of 50nt in the 5'-3' direction. L A 5' leader sequence containing may contain, or may have, one of the sequences of sequence numbers 58, 60, or 62, or one of the sequences of sequence numbers 106-110, 118-122, or 130-134, for example. As mentioned above, however, it is also possible to combine any one of the lower-expression motifs (represented by the subscript "L") with any higher-expression motif (represented by the subscript "H").

[0072] In a preferred embodiment of the second embodiment of the synthetic DNA construct according to the present invention, the 5' leader sequence is i) the sequence motif I of feature a) described above. H II H III H , I L II L , and III L One of the sequence motifs selected from, and immediately thereafter, in the 5'-3' direction, a spacer region comprising or consisting of 10-30 repeats of a spacer sequence of 8-12, preferably 9-11, more preferably 10 nucleotides, and immediately thereafter, in the 5'-3' direction, the sequence motif of feature b) described above, 50 nucleotides L and 50nt Hii) a spacer region comprising or consisting of 10 to 30 repeats of a spacer sequence of 8 to 12, preferably 9 to 11, more preferably 10 nucleotides at the 5' end, and the 3' end of the 5' end of the sequence motif of feature b) described above (50 nucleotides). L and 50nt H One of the array motifs selected from is adjacent to array motif I of the above characteristic a). H II H III H , I L II L , and III L It includes one of the sequence motifs selected from. The spacer sequence may have, for example, the sequence ACTCTTTCCC (sequence number 38). The term "first sequence motif region" refers to sequence motif I H II H III H , I L II L , and III L The term "second sequence motif region" can be used for regions containing or composed of sequence motifs selected from the sequence motif 50nt L and 50nt H It can be used in a region that includes or is composed of array motifs selected from. As described above with respect to the first embodiment, the number and composition of array motifs in the first array motif region is array motif I H II H III H , I L II L , and III L A combination of at least two or three different sequence motifs selected from, a spacer region at the 5' or 3' end of the first sequence motif region, and the sequence motif 50nt of feature b) above at the 3' end of the combination. L and 50nt HIt is preferable to have a sequence motif selected from, but it can vary. The spacer region at the 5' end of the first sequence motif region may be directly adjacent to the 5' end of the first sequence motif region, or it may be separated from the first sequence motif region by only a number of nucleotides in the 5' direction, preferably less than 50, 40, 30, 25, 20, 15, or 10 nucleotides.

[0073] The synthetic DNA construct of the present invention includes a sequence motif I arranged in a row, which may or may not include the above-described spacer region at the 5' or 3' end. L II L III L , I H II H III H Arrange any two or three of the motifs 50nt H or 50nt L It can also be combined with one of the others.

[0074] In a preferred embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence and the encoded transfer RNA do not originate from the same tRNA if the tRNA is a natural tRNA; that is, if the nucleic acid of the synthetic DNA construct of the present invention encodes a natural transfer RNA, the 5' leader sequence does not originate from the said natural transfer RNA.

[0075] In a third embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence of the nucleic acid encoding the transfer RNA is 10nt H1 The sequence motif called (SEQ ID NO: 9), GAAATGCCTT, 10nt H2 GTGGGAACTA, called (Sequence ID 10), and 10nt H3 It contains at least one sequence motif selected from GTGTTGCTTG, called (Sequence ID 11). To promote higher expression of tRNA genes located downstream of the 5' leader sequence in the synthetic DNA construct, 10nt H1 , 10nt H2 and 10nt H3Sequence motifs known as can be advantageously used. These motifs are preferably located within the region -100 to -1 relative to the tRNA gene.

[0076] Preferably, in a third embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence is a sequence motif 10nt H1 , 10nt H2 and 10nt H3 It includes at least two array motifs selected from the following. Preferably, these at least two array motifs are as follows: i.GAAATGCCTT,10nt H1 (Sequence ID 9) and GTGTTGCTTG,10nt H3 (Sequence ID 11), the sequence motif is arranged in the 5'-3' direction in the following order: GTGTTGCTTG (Sequence ID 11)-GAAATGCCTT (Sequence ID 9), i.e., 10nt H3 -10nt H1 To be placed, or ii. GAAATGCCTT,10nt H1 (Sequence ID 9) and GTGGGAACTA,10nt H2 (Sequence ID 10), the sequence motif is arranged in the 5'-3' direction in the following order: GAAATGCCTT (Sequence ID 9)-GTGGGAACTA (Sequence ID 10), i.e., 10nt H1 -10nt H2 To be placed, or iii.GTGGGAACTA,10nt H2 (Sequence ID 10) and GTGTTGCTTG,10nt H3 (Sequence ID 11), the sequence motif is arranged in the 5'-3' direction in the following order: GTGTTGCTTG (Sequence ID 11)-GTGGGAACTA (Sequence ID 10), i.e., 10nt H3 -10nt H2 It will be placed there.

[0077] More preferably, in this third embodiment of the synthetic DNA construct of the present invention, the 5' leader sequence is all three sequence motifs GAAATGCCTT (SEQ ID NO: 9), 10nt H1,GTGGGAACTA(Sequence ID 10),10nt H2 , and GTGTTGCTTG (SEQ ID NO: 11), 10nt H3 Preferably, in the 5'-3' direction, in the following order: GTGTTGCTTG (SEQ ID NO: 11)-GAAATGCCTT (SEQ ID NO: 9)-GTGGGAACTA (SEQ ID NO: 10), i.e., 10nt H3 -10nt H1 -10nt H2 Includes.

[0078] The tRNA encoded by the nucleic acid may be a native tRNA or an engineered tRNA, for example, a microbiologically engineered tRNA. Preferably, the tRNA may be engineered to have, for example, a modified anticodon, such as an anticodon that forms a base pair with a stop codon in mRNA, or an extended anticodon loop containing, for example, a 4-base, 5-base, or 6-base anticodon, or a modified D-arm, anticodon arm, T-arm, or acceptor stem.

[0079] In a preferred embodiment of the synthetic DNA construct according to the present invention, the nucleic acid encoding tRNA is sequence H 54 T 55 C 56 G 57 A 58 N 59 T 60 Preferably, T 54 T 55 C 56 G 57 A 58 N 59 T 60The B-box contains the following sequence: the index represents the nucleotide position of the transfer RNA, the position numbering follows the transfer RNA numbering rules, N represents any nucleotide (A, C, G, or T), and H represents A, C, or T. Nucleotides 54-60 are located within the T-arm of mature tRNA, forming a T-loop. tRNAs containing the B-box with the above sequence are transcribed more strongly than tRNAs lacking such a B-box. The encoded tRNA can be native or synthetic (manipulated) transfer RNA.

[0080] A transfer RNA encoded by nucleic acid may have an anticodon arm containing a "regular" anticodon arm, i.e., an anticodon stem consisting of 10 nucleotides and an anticodon loop consisting of 7 nucleotides, which contains a 3-base anticodon that forms a base pair with each codon on the mRNA. The anticodon can be designed, for example, to form a base pair with an immature stop codon on the mRNA and function as a suppressor tRNA. Alternatively, the encoded transfer RNA may have an extended anticodon loop having a 4-base, 5-base, or 6-base anticodon (see Patent Documents 11 and 12, which are incorporated herein by reference in their entirety as part of this specification).

[0081] In one embodiment, the nucleic acid encoding transfer RNA may also contain one or more introns. These introns may be native introns. In a preferred embodiment, the introns are inserted into the nucleic acid encoding tRNA that does not naturally contain introns. However, the tRNA encoded by the nucleic acid, such as suppressor tRNA, may also be a tRNA whose gene or pre-tRNA naturally contains one or more introns, but preferably different from the introns inserted into the nucleic acid according to the present invention. By including one or more introns, in at least some applications, it is possible to approximate native tRNA transcription using factors (enzymes) that co-modify the tRNA, resulting in more stable production of functional tRNA.

[0082] In preferred embodiments, the encoded tRNA may be structurally modified in such a way that it has a structurally modified D arm, anticodon arm, variable loop, and / or T arm. “Structurally modified” means that the mature tRNA includes a modified anticodon arm and / or variable loop and / or T arm and / or D arm, i.e., it has a different nucleotide sequence in the stem or loop portion than, for example, the D arm and / or anticodon arm and / or variable loop and / or T arm of a comparable native tRNA. “Comparable” tRNA is a tRNA aminoacylated by the same aminoacyl-tRNA synthetase. Particularly preferably, the encoded tRNA, in its mature form, includes a D arm, anticodon arm, and / or variable loop and / or T arm that are not present in native tRNA. It should be noted that the present invention also relates to tRNAs such as those described below.

[0083] The anticodon arm of a mature tRNA encoded by nucleic acid may have one of the following general structures, for example, with a modified stem portion. 5'-GCAGG-AC-Loop-CCTGT-3' 5’-TTGGG-AC-loop-CTCAA-3’ 5’-TTGGA-AC-loop-TTCAA-3’ 5’-ATGGT-AC-loop-ACCAT-3’ 5’-GCGGA-AC-loop-TCCGC-3’ 5’-GCGGT-AC-loop-ACCGC-3’ 5’-GGCGG-AC-loop-CCGCC-3’ 5’-GGCGC-AC-loop-GCGCC-3’ 5’-TTGGG-AC-loop-CCCAA-3’ 5’-CTGGA-AC-loop-TCCAG-3’ 5’-CCGGA-AC-loop-TCCGG-3’ 5’-GCTGC-AC-loop-GCAGT-3’

[0084] The preferred anticodon (AC) arm of the encoded tRNA may have the following general sequences. GCAGGNN NNN NNCCTGT (SEQ ID NO: 135) GCAGGNN NNNN NNCCTGT (SEQ ID NO: 136) GCAGGNN NNNNN NNCCTGT (SEQ ID NO: 137) GCAGGNN NNNNNN NNCCTGT(SEQ ID NO: 138) TTGGGNN NNN NNCTCAA (SEQ ID NO: 139) TTGGGNN NNNN NNCTCAA (SEQ ID NO: 140) TTGGGNN NNNNN NNCTCAA (SEQ ID NO: 141) TTGGGNN NNNNNN NNCTCAA(SEQ ID NO: 142) TTGGANN NNN NNTTCAA (SEQ ID NO: 143) TTGGANN NNNN NNTTCAA (SEQ ID NO: 144) TTGGANNNNNNN NNTTCAA (Sequence ID 145) TTGGANN NNNNNN NNTTCAA (Sequence ID 146) ATGGTNN NNN NNACCAT (Sequence ID 147) ATGGTNN NNNN NNACCAT (SEQ ID NO: 148) ATGGTNN NNNNN NNACCAT (SEQ ID NO: 149) ATGGTNN NNNNNN NNACCAT (SEQ ID NO: 150) GCGGANN NNN NNTCCGC (Sequence ID 151) GCGGANN NNNN NNTCCGC (Sequence ID 152) GCGGANN NNNNN NNTCCGC (Sequence ID 153) GCGGANN NNNNNN NNTCCGC (Sequence ID 154) GCGGTNN NNN NNACCGC (SEQ ID NO: 155) GCGGTNN NNNN NNACCGC (Sequence ID 156) GCGGTNN NNNNN NNACCGC (Sequence ID 157) GCGGTNN NNNNNN NNACCGC (Sequence ID 158) GGCGGNN NNN NNCCGCC (Sequence ID 159) GGCGGNN NNNN NNCCGCC (Sequence ID 160) GGCGGNN NNNNN NNCCGCC (Sequence ID 161) GGCGGNN NNNNNN NNCCGCC (Sequence ID 162) GGCGCNN NNN NNGCGCC (Sequence ID 163) GGCGCNN NNNN NNGCGCC (Sequence ID 164) GGCGCNNNNNNN NNGCGCC (Sequence ID 165) GGCGCNN NNNNNN NNGCGCC (Sequence ID 166)

[0085] The underlined N represents a 3nt, 4nt, 5nt, or 6nt anticodon. N = A, C, G, or T, or any modified base (in the final tRNA).

[0086] In a preferred embodiment, the encoded tRNA includes, for example, one anticodon (AC) arm from the following sequences: GCAGGCT NNN AACCTGT (Sequence ID 167) GCAGGCT NNNN AACCTGT (Sequence ID 168) GCAGGCT NNNNN AACCTGT (Sequence ID 169) GCAGGCT NNNNNN AACCTGT (Sequence ID 170) TTGGGCT NNN AACTCAA (Sequence ID 171) TTGGGCT NNNN AACTCAA (Sequence ID 172) TTGGGCT NNNNN AACTCAA (Sequence ID 173) TTGGGCT NNNNNN AACTCAA (Sequence ID 174) TTGGACT NNN AATTCAA (Sequence ID 175) TTGGACT NNNN AATTCAA (Sequence ID 176) TTGGACT NNNNN AATTCAA (Sequence ID 177) TTGGACT NNNNNN AATTCAA (Sequence ID 178) ATGGTCT NNN AAACCAT (Sequence ID 179) ATGGTCT NNNN AAACCAT (Sequence ID 180) ATGGTCTNNNNN AAACCAT (Sequence ID 181) ATGGTCT NNNNNN AAACCAT (Sequence ID 182) GCGGACT NNN AATCCGC (Sequence ID 183) GCGGACT NNNN AATCCGC (Sequence ID 184) GCGGACT NNNNN AATCCGC (Sequence ID 185) GCGGACT NNNNNN AATCCGC (Sequence ID 186) GCGGTCT NNN AAACCGC (Sequence ID 187) GCGGTCT NNNN AAACCGC (Sequence ID 188) GCGGTCT NNNNN AAACCGC (Sequence ID 189) GCGGTCT NNNNNN AAACCGC (Sequence ID 190) GGCGGCT NNN AACCGCC (Sequence ID 191) GGCGGCT NNNN AACCGCC (Sequence ID 192) GGCGGCT NNNNN AACCGCC (Sequence ID 193) GGCGGCT NNNNNN AACCGCC (Sequence ID 194) GGCGCCT NNN AAGCGCC (Sequence ID 195) GGCGCCT NNNN AAGCGCC (Sequence ID 196) GGCGCCT NNNNN AAGCGCC (Sequence ID 197) GGCGCCT AAGCGCC (Sequence ID 198)

[0087] The underlined N represents a 3nt, 4nt, 5nt, or 6nt anticodon. N = A, C, G, or T, or any modified base (in the final tRNA).

[0088] In a further preferred embodiment of the present invention, the encoded tRNA includes a variable loop (V-loop) having one of the following sequences, either in combination with one of the AC arms described above, or alone, i.e., without being combined with one of the AC arms described above. TGGGGTTTCCCC (Sequence ID 199) AGGGGAAACCCC (Sequence ID 200)

[0089] In a further preferred embodiment of the present invention, the tRNA encoded by the present invention includes a T arm having the following general sequence, either in combination with one of the above AC arms and / or in combination with one of the above V loops, or alone, i.e., without being combined with one of the above AC arms and / or without being combined with one of the above V loops. GCGGG-T-Loop-CCCGT ACGGG-T-Loop-CCCGT GTAGG-T-Loop-CCCAT GTCGG-T-Loop-CCCGT GGCGG-T-Loop-CCGGT GCAGG-T-Loop-CCCGT GCCGG-T-Loop-CCGGT

[0090] Preferably, the T-loop (positions 54-60 according to the tRNA numbering rules) has the sequence HTCGANT (where H is A, C, or T), i.e., CTCGANT, ATCGANT, or TTCGANT, more preferably TTCGANT, for example, TTCGAAT or TTCGAGT, preferably TTCGAGT.

[0091] In a preferred embodiment, the tRNA encoded by the present invention includes, for example, one T-arm from the following sequences. GCGGGTTCGAATCCCGT (Sequence ID 201) ACGGGTTCGAATCCCGT (Sequence ID 202) GCGGGTTCGAGTCCCGT (Sequence ID 203) ACGGGTTCGAGTCCCGT (Sequence ID 204) GTAGGTTCGAGTCCCAT (Sequence ID 205) GTCGGTTCGAGTCCGAT (Sequence ID 206) GCCGGTTCGAGTCCGGT (Sequence ID 207) GCAGGTTCGAGTCCCGT (Sequence ID 208) GCCGGTTCGAGTCCGGT (Sequence ID 209)

[0092] The loop portion is shown in italics. The T-arm has a stem of 5 base pairs.

[0093] In a further preferred embodiment of the present invention, the tRNA encoded by the present invention comprises an acceptor stem having the following general sequence, either in combination with one of the above AC arms and / or in combination with one of the above V loops and / or in combination with one of the above T arms, or alone, i.e., without combination with one of the above AC arms and / or without combination with one of the above V loops and / or without combination with one of the above T arms. 5'-GGCTCTG-rest tRNA-CAGAGTC-3' 5'-GGGCTG-rest tRNA-CAGCGTC-3' 5'-GGCGCGG-rest tRNA-CGGCGTC-3'

[0094] The term "rest tRNA" refers to the portion of tRNA between the 5' and 3' ends of the acceptor stem, including the D arm, V loop, and T arm.

[0095] As described above, for a given tRNA encoded by the synthetic DNA construct of the present invention, the anticodon arm, or at least the anticodon stem, V-loop, T-arm, or at least the T-stem, and the acceptor stem can be selected independently of the anticodon arm / stem, V-loop, T-arm / stem, and acceptor stem described above. Accordingly, the encoded tRNA may include only the anticodon arm / stem, V-loop, T-arm / stem, for example, an anticodon arm having the sequence of SEQ ID NO: 171, or any combination thereof, for example, an anticodon arm having the sequence of SEQ ID NO: 195 and a T-arm having the sequence of SEQ ID NO: 203, or an anticodon arm having the sequence of SEQ ID NO: 171 and an acceptor stem as described above.

[0096] Those skilled in the art are aware that tRNAs are aminoacylated with specific amino acids by specific aminoacyl-tRNA synthetases (aaRS), and that aaRS can recognize its homologous tRNAs via a unique identity element located in the acceptor stem and / or anticodon loop of the tRNA. To include in the DNA construct of the present invention a tRNA gene of a tRNA that, in its mature form, is loaded with its homologous amino acids in vivo, those skilled in the art design a unique identity element appropriate for the encoded tRNA.

[0097] In the transfer RNA encoded in the synthetic DNA construct of the present invention, the anticodon loop can be extended by a number of nucleotides sufficient to accommodate a 4-base, 5-base, or 6-base anticodon. The anticodon loop of the mature transfer RNA encoded by the synthetic vector of the present invention may consist of, for example, 7 to 12, preferably 7 to 10 or 8 to 10, and more preferably 8 or 9 nucleotides.

[0098] The synthetic DNA construct may be, for example, a synthetic vector, and therefore may be, for example, any suitable biological nucleic acid delivery vehicle, in particular a delivery vehicle suitable for the delivery of nucleic acids to mammalian living cells, such as human cells. Suitable vehicles include, for example, viral vectors such as adeno-associated virus (AAV) viral vectors, nanoparticles, such as encapsulation or binding to lipid nanoparticles, and others. Preferably, the vector is a viral vector. Examples of viral vectors include adeno-associated (AAV) viruses, adenoviruses (e.g., AAV3, AAV8, or AAV9), and retroviruses (see, for example, Non-Patent Document 18; Non-Patent Document 19).

[0099] In a second embodiment, the present invention relates to a pharmaceutical composition comprising a synthetic DNA construct according to the present invention and a pharmaceutically acceptable carrier. Examples of simple carriers include buffer solutions or physiological salt solutions.

[0100] In further embodiments, the present invention relates to a synthetic DNA construct according to a first aspect of the present invention, or a pharmaceutical composition according to a second aspect of the present invention, for use as a pharmaceutical agent. The synthetic DNA construct or pharmaceutical composition of the present invention is particularly useful for treating patients with diseases associated with nonsense mutations, i.e., immature stop codons (PTCs), or frameshifts that cause the absence or dysfunction of functional proteins. Examples of diseases in which the tRNA of the present invention can be advantageously used include Hurler syndrome (MPS I, ICD code E76.0), beta-thalassemia (ICD-10 code D56.1), neurofibromatosis type 1 (NF1, ICD-10 code Q85.0), Duchenne muscular dystrophy (DMD, ICD-10 code G71.0), Crohn's disease (CD, ICD-10 code K50), cystic fibrosis (CF, ICD-10 code E84), neuronal ceroid lipofuscinosis (NCL, ICD-10 code E75.4), and Tay-Sachs disease (TSD, ICD-10 code E75.0). The DNA constructs of the present invention, such as vectors, are also useful in treating patients with diseases at least partially caused by tRNA sequestration leading to depletion of the tRNA cell pool, such as Charcot-Marie-Tooth disease (CMT disease, ICD-10 code DG600).

[0101] The DNA constructs or pharmaceutical compositions of the present invention can be advantageously used in the treatment of diseases in which natural tRNA is sequestered due to mutations in aminoacyl-tRNA synthetase, for example, and cannot be used or is not fully utilized by the cell's translation machinery, such as hereditary motor and sensory neuropathy (Charcot-Marie-Tooth (CMT) disease).

[0102] In a further embodiment, the present invention relates to a method for treating a person having a disease associated with a nonsense (PTC) mutation or a frameshift mutation, comprising administering to the person an effective amount of the synthetic DNA construct of the present invention or a pharmaceutical composition comprising the synthetic DNA construct of the present invention. In a preferred embodiment, the method is for treating Hurler syndrome (MPS I, ICD code E76.0), beta-thalassemia (ICD-10 code D56.1), neurofibromatosis type 1 (NF1, ICD-10 code Q85.0), Duchenne muscular dystrophy (DMD, ICD-10 code G71.0), Crohn's disease (CD, ICD-10 code K50), cystic fibrosis (CF, ICD-10 code E84), neuronal ceroid lipofuscinosis (NCL, ICD-10 code E75.4), or Tay-Sachs disease (TSD, ICD-10 code E75.0).

[0103] In a further embodiment, the present invention also relates to any of the structurally modified tRNAs described above in the form of mature tRNA. In the tRNA, the nucleotide thymine must be replaced with the nucleotide uracil.

[0104] In further embodiments, the present invention also relates to synthetic DNA constructs comprising or containing one of the above-described encoded modified tRNAs. Since tRNA is encoded in DNA, encoded tRNA may also be called tDNA. The T nucleotides of the encoded form of tRNA in the synthetic DNA construct are replaced with U nucleotides when the encoded tRNA is transcribed. The synthetic DNA construct comprises or consists of DNA encoding a structurally modified tRNA such that the tRNA, i.e., the tRNA produced by the transcription of the synthetic construct, has a structurally modified D arm, anticodon arm, variable loop and / or T arm. The synthetic DNA construct may also include a 5' leader sequence containing regulatory elements other than those described above for the synthetic DNA construct according to the first embodiment of the present invention, such as a promoter, which affect transcription. The DNA construct may be a synthetic vector, for example, an expression vector for the delivery and expression of tRNA in cells, for example, human cells.

[0105] For example, the anticodon arm of the tRNA encoded by the construct may have one of the following general structures with a modified stem portion (see above). 5'-GCAGG-AC-Loop-CCTGT-3' 5'-TTGGG-AC-loop-CTCAA-3' 5'-TTGGA-AC-loop-TTCAA-3' 5'-ATGGT-AC-Loop-ACCAT-3' 5'-GCGGA-AC-loop-TCCGC-3' 5'-GCGGT-AC-Loop-ACCGC-3' 5'-GGCGG-AC-loop-CCGCC-3' 5'-GGCGC-AC-loop-GCGCC-3' 5'-TTGGG-AC-loop-CCCAA-3' 5'-CTGGA-AC-Loop-TCCAG-3' 5'-CCGGA-AC-Loop-TCCGG-3' 5'-GCTGC-AC-Loop-GCAGT-3'

[0106] The preferred anticodon arm of the encoded tRNA may have one of the sequences from sequence numbers 135-198 (see above).

[0107] In a further preferred embodiment of the present invention, the encoded tRNA includes a variable loop (V loop) having one of the following sequences of sequence numbers 199-200, either in combination with one of the AC arms M described above, or alone, i.e., without being combined with one of the AC arms described above (see above).

[0108] In a further preferred embodiment of the present invention, the tRNA encoded by the present invention includes a T arm having the following general sequence, either in combination with one of the above AC arms and / or in combination with one of the above V loops, or alone, i.e., without combination with one of the above AC arms and / or without combination with one of the above V loops (see above). GCGGG-T-Loop-CCCGT ACGGG-T-Loop-CCCGT GTAGG-T-Loop-CCCAT GTCGG-T-Loop-CCCGT GGCGG-T-Loop-CCGGT GCAGG-T-Loop-CCCGT GCCGG-T-Loop-CCGGT

[0109] Preferably, the T-loop (positions 54-60 according to the tRNA numbering rules) has the sequence HTCGANT (where H is A, C, or T), i.e., CTCGANT, ATCGANT, or TTCGANT, more preferably TTCGANT, for example, TTCGAAT or TTCGAGT, preferably TTCGAGT.

[0110] In a preferred embodiment, the tRNA encoded by the present invention includes, for example, one T-arm from the sequences of SEQ ID NOs. 201 to 209.

[0111] In a more preferred embodiment of the present invention, the tRNA encoded in the synthetic DNA construct according to this aspect of the present invention comprises an acceptor stem having the following general sequence, either in combination with one of the above AC arms and / or in combination with one of the above V loops and / or in combination with one of the above T arms, or alone, i.e., without being combined with one of the above AC arms and / or without being combined with one of the above V loops and / or without being combined with one of the above T arms. 5'-GGCTCTG-rest tRNA-CAGAGTC-3' 5'-GGGGCTG-rest tRNA-CAGCGTC-3' 5'-GGCGCGG-rest tRNA-CGGCGTC-3'

[0112] The term "rest tRNA" refers to the portion of tRNA between the 5' and 3' portions of the acceptor stem, including the D arm, V loop, and T arm. Naturally, "rest tRNA" is not considered part of the acceptor stem.

[0113] In preferred embodiments, the synthetic DNA construct of the present invention comprises or includes a nucleic acid encoding a transfer RNA, wherein the encoded transfer RNA is a) Anticodon arms having or containing one of the sequences of sequence numbers 135-198, and / or b) A variable loop having or containing one of the sequences with sequence numbers 199-200, and / or c) T-arms having or containing one of the sequences of sequence numbers 201-209, and / or d) Acceptor stem having the structure 5'-GGCTCTG-rest tRNA-CAGAGTC-3' or 5'-GGCGCTG-rest tRNA-CAGCGTC-3' This includes "rest tRNA," which is not considered part of the acceptor stem.

[0114] It should be noted that when referring to tRNA structures within a DNA construct (e.g., T-arms, AC-arms, etc.), it is understood to mean the DNA sequences that encode these structures within the DNA construct. When transcribed into mature tRNA, these sequences are transcribed into RNA sequences that form the structure of the mature tRNA.

[0115] In a further embodiment, the present invention relates to a pharmaceutical composition comprising a synthetic DNA construct according to the present invention and a pharmaceutically acceptable carrier, as described immediately above this paragraph. Simple examples of carriers include buffer solutions or physiological salt solutions. [Examples]

[0116] The present invention will be described below with reference to examples and accompanying drawings, for illustrative purposes only.

[0117] Figure 1 shows an example of a tRNA numbered according to conventional numbering applied to generalized “consensus” tRNA, starting at 1 at the 5' end and ending at 76 at the 3' end. This tRNA consists of 11 tRNA nucleotides and has the typical cloverleaf structure of tRNA, including an acceptor stem 2 with a CCA tail 10, a T arm 3 with a TψC loop 6, a D arm 4 with a D loop 7, and an anticodon arm 5 with a 5-nucleotide stem portion 8 and an anticodon loop 9. In such a “consensus” tRNA, the nucleotides of the native anticodon triplet 25 are always at positions 34, 35, and 36, regardless of the actual number of preceding nucleotides. For example, the tRNA may contain additional nucleotides between positions 1 and 34, e.g., within the D loop 7, and within the variable loop 24 between positions 45 and 46. Additional nucleotides can be numbered by adding letters, e.g., 20a, 20b. In variable loop 24, additional nucleotides are numbered with a preceding "e" followed by a number, depending on their position within the loop. The positions of the modified nucleotides within the tRNA of this invention are indicated by black-filled circles.

[0118] Figure 2 shows the arrangement motif I H , I L II H II L III H and III L Figure 2A schematically shows some of three examples of the first embodiment of the synthetic DNA construct of the present invention, which includes three different combinations of the sequence motif I. H II H and III H An embodiment of the DNA construct (P1, SEQ ID NO: 12) containing sequence motif I is shown. Figure 2B shows the sequence motif I L II L and III L Figure 2C shows an embodiment of the vector (P2, sequence number 13) containing sequence motif I L II L and III H An embodiment of the vector (P23, SEQ ID NO: 34) containing the above is shown.

[0119] Figure 3 schematically shows some of three examples of the second embodiment of the synthetic DNA construct of the present invention. In these embodiments, sequence motif I H II L and III H Each of the arrangement motifs is 50nt H Combine with this. In Figure 3A, the arrangement motif I H Array motif 50nt H In combination with (Sequence No. 51), Figure 3B shows Sequence Motif II L Array motif 50nt H In combination with (Sequence No. 59), Figure 3C shows the sequence motif III. H Array motif 50nt H Combine with (Sequence No. 55).

[0120] Figure 4 shows the rescue activity of various suppressor tRNA variants. tRNA variants embedded in different vectors were co-transfected in HEK293 cells with a vector encoding firefly luciferase having a PTC (TGA) instead of an arginine codon (CGA, "R69X UGA"). Luciferase expression was measured 24 hours after transfection, and tRNA suppression activity (rescue %) was expressed as a percentage relative to wild-type luciferase. The following suppressor tRNAs were examined: (i) tR, (ii) tRT6, (iii) tRT6 retaining an intron sequence, and (iv) tRAC1T6. Mock transfected cells (empty) were used as negative controls. For this purpose, cells were transfected with an empty vector that did not contain luciferase, but the same transfection procedure was followed, i.e., treatment with the same amount of lipofectamine, which slightly alters cell growth.

[0121] To investigate the read-through efficiency of suppressor tRNAs, we used a reporter plasmid embedded in the pTwist EF1 Alpha Puro plasmid backbone, containing EF1a-driven firefly luciferase (FLuc) and mutated at codon 69 of the reporter FLuc, i.e., arginine, to the stop codon UGA, in order to achieve the desired arginine PTC. The tRNAs were also encoded using a plasmid system driven by a U6 promoter embedded in the pcDNA3.1 plasmid backbone, with the desired suppressor tRNAs in their DNA form (some of which retain introns).

[0122] HEK293 cells were placed in a 96-well cell culture plate at a rate of 1 × 10⁶ 4Cells were seeded in wells and grown in Dulbecco's Modified Essential Medium (DMEM, Pan Biotech) supplemented with 10% fetal bovine serum (FBS, Pan Biotech) and 2 mM L-glutamine (Thermo Fisher Scientific). After 16–24 hours, cells were co-transfected in 3 replicates with 25 ng of R69X PTC-FLuc or WT Fluc plasmid and 100 ng of each suppressor tRNA variant or empty control plasmid using lipofectamine 3000 (Thermo Fisher Scientific). The medium was changed after 4–6 hours, and 24 hours after transfection, cells were lysed with 1× passive lysis buffer (Promega). Luciferase activity was measured using a luciferase assay system (Promega) and a Spark microplate reader (Tecan). Readthrough activity was expressed as a percentage of the activity of WT luciferase expressed with a different expression vector.

[0123] First, tRNA Arg (TCT 3-1, source tRNA database: http: / / gtrnadb.ucsc.edu / genomes / eukaryota / Hsapi38 / ) The anticodon was replaced to pair with the UGA PTC to create tR (Figure 3). Next, in the tR, the TψC stem was modified (creating the tRT5 mutant), and at the same time, the TψC stem and acceptor stem were also modified (tRAC1T6 mutant). Furthermore, since introns usually provide expression benefits to tRNA, tRNA ArgThe native intron was maintained (mutant tRT6(intron)). For activity screening, all tRNA mutants were cloned into plasmid (pTwist EF1 Alpha Puro) and co-transfected HEK293 cells with a plasmid containing a firefly luciferase (FLuc) reporter along with arginine PTC (R69X). After 24 hours, luciferase activity was measured and normalized to wild-type luciferase activity (recovery %), Figure 3. All tRNA mutants efficiently restored R69X luc expression (of wild-type luciferase; the numbers shown in Figure 3 (n=3 independent biological replicates) are the mean values ​​of recovered luciferase activity) in the range of 12–20%.

[0124] The sequence of the tRNA mentioned above is as follows (anticodon is underlined; T stem, AC stem, T stem and acceptor stem are double underlined; introns are lowercase). tR(based on natural tRNA-Arg-TCT-3-1(Arg-chr9.tRNA5), with UCA anticodon substitution, 5'-3'; SEQ ID NO: 210: NNNNNN TG GGCTCTG AATGGATA GCGC A GCGC CT TTGGA AA TCA AGGTT TTCAA TTCGAGT GTGGG G tRT6 (Arg-chr9.tRNA5,5'-3' with modified T stem; SEQ ID NO: 211): CCCACCAGAGTC TG GGCTCTG AATGGATA GCGC A CT GCGC AA TTGGA AGGTT TCA TTCGAGT TTCAA G tRT6 (intron) (Arg-chr9.tRNA5,5'-3' with modified T stem while maintaining the intron; SEQ ID NO: 212): GCGGG TG CCCGTCAGAGTC AATGGATA GGCTCTGA GCGC CT GCGC AgctgagcctagtgtggtcA TTGGA AGGTT TCA TTCGAGT TTCAA G tRAc1T6 (tRT6 with modified acceptor stem; Sequence ID 213): GCGGG TG CCCGTCAGAGTC AATGGATA GGCGCTG A GCGC CU GCGC AA TTGGA AGGTT TCA TTCGAGT TTCAA GCGGG CCCGTCAGCGTC G

[0125] The positions of the D stem, anticodon stem, T stem, and acceptor stem of the above tRNA are as follows (anticodon 34-36): Sequences that do not contain introns (sequences 127, 128, 130) 5' part 3' part Acceptor stem: 1..7; 66..72 D-stem: 10..13; 22..25 Anticodon stems: 27..31; 39..43 T-stem: 49..53 61..65 Sequence containing introns (SEQ ID NO: 129; Introns: 38..55) 5' part 3' part Acceptor stem: 1..7; 84..90 D-stem: 10..13; 22..25 Anticodon stem: 27..31; 57..61 T-stem: 67..71 79..83

Claims

1. (A) A nucleic acid encoding transfer RNA, and (B) a 5' leader sequence, The aforementioned 5' leader arrangement is a) Sequence motif TGACCTAAGTGTAAAAGT, I H (Sequence No. 1), TGAGATTTCCCTTCAGGTT, II H (Sequence No. 2), TATATAGTTCCTGTTAGAGAACCACTCTTCCC, III H (Sequence ID 3), ACCATAAACGTGAAAATG, I L (Sequence No. 4), TCTTTGGATTTGGGAATC, II L (Sequence No. 5), and TTATAAGTTCTGTTAGAGAACCACTCTTTCC, III L Sequence motifs selected from the group consisting of (Sequence No. 6); and / or b) Sequence motif VNAANANTVHANANNTTTNNNATRANAATTCNGDGVGNAANATABTNCTVGND,50nt H (Sequence No. 7) and GCNGGDGGGCGNGTTCBBCTGTNVNAGCNTNCGDNGNCGTTTNNNCNTCGGT, 50nt L Sequence motifs selected from the group consisting of (Sequence No. 8); and / or c) An array motif GAAATGCCTT, 10 nt H1 (SEQ ID NO: 9), GTGGGACTAA 10 nt H2 (SEQ ID NO: 10), and GTGTTGCTTG 10 nt H3 An array motif selected from the group consisting of (SEQ ID NO: 11) including A synthetic DNA construct characterized by the following features.

2. The 5' leader sequence contains one of the sequence motifs in b) above (provided that the 5' leader sequence does not contain one of the sequences of SEQ ID NOs. 39, 42, or 46); or if the 5' leader sequence contains one of the sequences of SEQ ID NOs. 39 or 46, the encoded transfer RNA is tRNA. Gly Instead, if the 5' leader sequence contains the sequence of sequence number 42, the encoded transfer RNA is tRNA. Leu Not The synthetic DNA construct according to claim 1.

3. aa) Regarding the above a), i. The 5' leader sequence is sequence motif I L If it includes, sequence motif I H It does not include, and vice versa. ii. The aforementioned 5' leader sequence is sequence motif II L If it includes, Array Motif II H It does not include, and vice versa, iii. The 5' leader sequence is sequence motif III. L If it includes, Array Motif III H It does not include, and vice versa; or, bb) Regarding the above b), the 5' leader sequence is the sequence motif 50nt L If it includes, the sequence motif 50nt H Does not include, and vice versa. A synthetic DNA construct according to claim 1 or 2.

4. aa) Regarding the above a), i. The 5' leader array is array motif I H or I L If it includes the aforementioned array motif I H or I L It has positions -66 to -50 in the 5'-3' direction, ii. The 5' leader array is array motif II H or II L If it includes the aforementioned sequence motif II H or II L It has positions -49 to -32 in the 5'-3' direction, iii. The 5' leader array is array motif III H or III L If it includes the aforementioned sequence motif III H or III L It has positions -31 to -1 in the 5'-3' direction; or, bb) Regarding the above b), the sequence motif 50nt H or 50nt L It has positions -50 to -1 in the 5'-3' direction. A synthetic DNA construct according to any one of claims 1 to 3.

5. The aforementioned 5' leader arrangement is aa) Regarding the above a), arrangement motif I L II L , III L , I H II H or III H , at least two array motifs selected from, the at least two array motifs in the 5'-3' direction, I H -II H II H -III H , I H -III H , I L -II L II L -III L , I L -III L , I H -II L , I H -III L II H -III L , I L -II H II L -III H , or I L -III H They are arranged in the following order; or, cc) Regarding the above c), the sequence motif 10nt H1 , 10nt H2 , and 10nt H3 At least two array motifs, the at least two array motifs being: i. GAAATGCCTT, 10nt H1 (Sequence No. 9) and GTGTTGCTTG, 10nt H3 (Sequence ID 11), the sequence motif is arranged in the 5'-3' direction in the following order: 10nt H3 -10nt H1 They are arranged in, or ii. GAAATGCCTT, 10nt H1 (Sequence No. 9) and GTGGGAACTA, 10nt H2 (Sequence ID 10), the sequence motif is arranged in the 5'-3' direction in the following order: 10nt H1 -10nt H2 They are arranged in, or iii. GTGGGAACTA, 10nt H2 (Sequence number 10) and GTGTTGCTTG, 10nt H3 (Sequence ID 11), the sequence motif is arranged in the 5'-3' direction in the following order: 10nt H3 -10nt H2 It is placed including A synthetic DNA construct according to any one of claims 1 to 4.

6. The aforementioned 5' leader arrangement is aa) Regarding a) above, array motif I L , II L , III L , I H , II H or III H Three array motifs selected from, preferably in the 5'-3' direction, the following order: I L - II L - III L , I H - II H - III H , I H - II L - III L , I L - II H - III L , I L - II L - III H , I H - II H - III L , I H - II L - III H , or I L - II H - III H ; or cc) Regarding the above c), three sequence motifs 10nt H1 , 10nt H2 , and 10nt H3 All of them, preferably in the 5'-3' direction, in the following order: 10nt H3 -10nt H1 -10nt H2 including A synthetic DNA construct according to any one of claims 1 to 5.

7. The aforementioned 5' leader arrangement is The above a) arrangement motif I H II H , III H , I L II L , and III L One of the array motifs selected from, immediately following it in the 5'-3' direction, is the array motif 50nt of feature b) described above. L and 50nt H Includes one of the array motifs selected from A synthetic DNA construct according to any one of claims 1 to 3.

8. The 5' leader sequence includes or has one of the sequences of sequence numbers 51 to 62, preferably one of the sequences of sequence numbers 63 to 134. The synthetic DNA construct according to claim 7.

9. The aforementioned 5' leader array is array motif I H II H , III H One of them, in the 5'-3' direction, immediately follows an array motif 50nt H Includes; or arrangement motif I L II L , III L One of them, immediately following in the 5'-3' direction, is the sequence motif 50nt L including The synthetic DNA construct according to claim 7.

10. The aforementioned 5' leader arrangement is i) The arrangement motif I of a) above H II H , III H , I L II L , and III L One of the sequence motifs selected from, immediately following it in the 5'-3' direction, is a spacer region comprising or consisting of 10-30 repeats of a spacer sequence of 8-12, preferably 9-11, more preferably 10 nucleotides, immediately following it in the 5'-3' direction, the sequence motif 50 nt of b) above. L and 50nt H One of the sequence motifs selected from, or ii) a spacer region comprising 10 to 30 repeats of a spacer sequence of 8 to 12, preferably 9 to 11, more preferably 10 nucleotides at the 5' end, and adjacent to it, and the sequence motif of characteristic b) described above at the 3' end, 50 nt L and 50nt H One of the array motifs selected from the above is adjacent to array motif I of characteristic a) above. H II H , III H , I L II L , and III L Includes one of the array motifs selected from A synthetic DNA construct according to any one of claims 1 to 3.

11. The nucleic acid encodes a natural transfer RNA, and the 5' leader sequence does not originate from the natural transfer RNA. A synthetic DNA construct according to any one of claims 1 to 10.

12. The aforementioned 5' leader arrangement is aa) Regarding the above a), one of the sequences from sequence numbers 12 to 37, bb) Regarding b) above, one of the sequences from sequence numbers 39 to 50 Having or including A synthetic DNA construct according to any one of claims 1 to 11.

13. Array H 54 T 55 C 56 G 57 A 58 N 59 T 60 Preferably, T 54 T 55 C 56 G 57 A 58 N 59 T 60 Further includes a coding sequence of natural or synthetic transfer RNA containing a B-box (where the index represents the nucleotide position of the transfer RNA, and the position numbering follows the transfer RNA numbering rules). A synthetic DNA construct according to any one of claims 1 to 12.

14. The 5' leader array is the array motif 50nt of b) above. H or 50nt L One of these, preferably immediately following, is the arrangement motif I of the above feature a). L II L , III L , I H II H and III H Includes an array motif selected from, wherein the 5' leader array is the array motif 50nt L If it includes, preferably immediately following it is sequence motif I L II L , and III L The array motif selected from there follows, and the 5' leader array is the array motif 50nt H If it includes, preferably immediately following it is sequence motif I H II H , and III H The sequence of motifs selected from follows. The synthetic DNA construct according to claim 13.

15. If the 5' leader sequence does not contain one of the sequences of sequence numbers 39, 42, or 46; or if the 5' leader sequence contains one of the sequences of sequence number 39 or 46, the encoded transfer RNA is tRNA. Gly Instead, if the 5' leader sequence contains the sequence of sequence number 42, the encoded transfer RNA is tRNA. Leu Not The synthetic DNA construct according to claim 14.

16. tRNA, which is encoded by nucleic acids, a) Anticodon arms having or containing one of the sequences of sequence numbers 135-198, and / or b) A variable loop having or containing one of the sequences of sequence numbers 199 to 200, and / or c) A T-arm having or including one of the sequences of sequence numbers 201 to 209, and / or d) Acceptor stem having the structure 5'-GGCUCUG-rest tRNA-CAGAGUC-3' or 5'-GGGCGCUG-rest tRNA-CAGCGUC-3' including A synthetic DNA construct according to any one of claims 1 to 15.

17. A synthetic vector, preferably a viral vector. A synthetic DNA construct according to any one of claims 1 to 16.

18. A synthetic DNA construct according to any one of claims 1 to 17 and a pharmaceutically acceptable carrier A pharmaceutical composition characterized by the following features.

19. A synthetic DNA construct according to any one of claims 1 to 17 or a pharmaceutical composition according to claim 18, for use as a pharmaceutical agent.

20. For use as a drug in diseases at least partially caused by nonsense or frameshift mutations that result in the production of a protein that is dysfunctional or non-functional compared to the wild-type protein, or at least partially caused by intracellular sequestration of tRNA that results in the depletion of the tRNA cell pool. A synthetic DNA construct according to any one of claims 1 to 17, or a pharmaceutical composition according to claim 18.

21. For use as a drug to treat Harler syndrome, beta-thalassemia, Crohn's disease, Tay-Sachs disease, Duchenne muscular dystrophy, cystic fibrosis, neuronal ceroid lipofuscinosis, neurofibromatosis type 1, or Charcot-Marie-Tooth disease. A synthetic DNA construct according to any one of claims 1 to 17, or a pharmaceutical composition according to claim 18.

22. A nucleic acid comprising a transfer RNA encoding, or containing a nucleic acid encoding a transfer RNA, wherein the encoded transfer RNA is a) Anticodon arms having or containing one of the sequences of sequence numbers 135 to 198 , and / or, b) A variable loop having or containing one of the sequences of sequence numbers 199 to 200, and / or c) A T-arm having or including one of the sequences of sequence numbers 201 to 209, and / or d) Acceptor stem having the structure 5'-GGCUCUG-rest tRNA-CAGAGUC-3' or 5'-GGGCGCUG-rest tRNA-CAGCGUC-3' including A synthetic DNA construct characterized by the following features.

Citation Information

Patent Citations

  • Suppressor tRNA system

    US20030224479A1

  • Methods of rescuing stop codons via genetic reassignment with ace-trna

    US20200291401A1

  • Suppressor tRNA system

    US6964859B2

  • Methods for the production of rhamnosylated flavonoids

    WO2017121863A1

  • Synthetic transfer RNA with extended anticodon loop

    WO2019175316A1