Detection and quantification method for soybean cyst nematodes

A primer set and probe targeting the COI gene of mitochondrial DNA in soybean cyst nematodes address the issue of varying quantitative values, enabling precise detection and quantification across populations.

JP7745916B1Active Publication Date: 2025-09-30NAT AGRI & FOOD RES ORG
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
JP2024119323
Authority / Receiving Office
JP · JP
Patent Type
Patents
Current Assignee / Owner
Filing Date
2024-07-25
Publication Date
2025-09-30
Estimated Expiration
2044-07-25

AI Technical Summary

Technical Problem

Existing methods for detecting and quantifying soybean cyst nematodes using real-time PCR suffer from significant variations in quantitative values between populations, making it difficult to compare and accurately detect the nematodes.

Method used

Designing a primer set and probe targeting a specific region of the COI gene of mitochondrial DNA with minimal inter-population variation and significant inter-species variation, allowing for a common calibration curve to quantify all soybean cyst nematode populations.

Benefits of technology

The method enables specific and efficient detection of soybean cyst nematodes with minimal variation in Ct values between populations, facilitating accurate quantification and comparison across different populations.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 0007745916000004
    Figure 0007745916000004
  • Figure 0007745916000005
    Figure 0007745916000005
  • Figure 0007745916000006
    Figure 0007745916000006
Patent Text Reader

Abstract

The object of the present invention is to provide a method for specifically and efficiently detecting the soybean cyst nematode, a serious pest of beans. [Solution] A method for detecting soybean cyst nematodes includes a step of performing a PCR amplification reaction of a target nucleic acid region of soybean cyst nematode using a soybean cyst nematode-specific primer set designed based on the sequence of the COI gene of the soybean cyst nematode's mitochondrial DNA.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a method for detecting the soybean cyst nematode (Heterodera glycines), which is a serious pest of, for example, beans. [Background technology]

[0002] The soybean cyst nematode (hereinafter referred to as "this nematode") is a nematode that attacks bean crops and is a particular problem in Hokkaido, which is home to major soybean and adzuki bean production areas. In order to predict the damage caused by this nematode and to implement appropriate control measures, it is necessary to clarify the actual occurrence of this nematode in fields.

[0003] Conventionally, screening for this nematode involves observing nematode populations isolated from soil under a microscope and identifying and counting the nematodes. However, this screening method requires a great deal of effort and a high level of expertise, which is problematic. Therefore, there is a need to develop a method for efficiently detecting and quantifying this nematode using simple manual procedures, such as real-time PCR.

[0004] Meanwhile, several techniques for specifically detecting and quantifying this nematode by real-time PCR have been reported (Non-Patent Documents 1 to 3).

[0005] In Non-Patent Document 1, a primer set and probe were developed and used to detect the nematode by real-time PCR using the probe method. The primer set and probe in this document were designed on a DNA region amplified with certain RAPD primers, so it is unclear what gene is encoded by the primer set and probe, but the nematode can be specifically detected and quantified.

[0006] In Non-Patent Document 2, a primer set was designed for the COI gene of the mitochondrial DNA of this nematode, and this nematode was specifically detected and quantified by real-time PCR using the intercalator method.

[0007] In Non-Patent Document 3, a primer set and probe were designed on the uncoordinated-78 gene of this nematode, and this nematode was detected and quantified by real-time PCR using the probe method.

[0008] However, when the present inventors performed real-time PCR using DNA from domestic populations of this nematode as a template and the primer set and probe described in Non-Patent Document 1, large differences in Ct values ​​were observed between populations (maximum of approximately 7, Figure 4). Therefore, when quantifying this nematode, it is necessary to use different calibration curves for each population, which is problematic in terms of practicality.

[0009] Furthermore, when real-time PCR was performed using the primer set described in Non-Patent Document 2, a rather large difference in Ct value occurred between populations (maximum of approximately 3.5, Figure 5). Therefore, as with Non-Patent Document 1, this method has problems with practicality.

[0010] Furthermore, when real-time PCR was performed using the DNA of various cyst nematode species as a template and the primer set and probe described in Non-Patent Document 3, the sugar beet cyst nematode and clover cyst nematode, which are closely related to this nematode, were also detected (Table 3). These two species have already occurred in Japan, and the clover cyst nematode in particular is commonly found in Hokkaido, making this method unsuitable for practical use.

[0011] As described above, the known primer sets and probes had the problem that the quantitative values ​​varied greatly between soybean cyst nematode populations, making it impossible to compare populations and specifically detect the soybean cyst nematode. [Prior art documents] [Non-patent literature]

[0012] [Non-Patent Document 1] Ye (2012) Journal of Nematology 44:284-290 [Non-patent document 2] Ko et al. (2019) The plant pathology journal 35:654-661 [Non-patent document 3] Li et al. (2014) PLoS One 9(2):e89887 Summary of the Invention [Problem to be solved by the invention]

[0013] In view of the above-mentioned circumstances, an object of the present invention is to provide a method for efficiently detecting soybean cyst nematodes specifically and while suppressing differences in quantitative values ​​between soybean cyst nematode populations, thereby enabling comparison of quantitative values ​​between populations. [Means for solving the problem]

[0014] As a result of intensive research to solve the above problems, the inventors compared the COI gene sequences of mitochondrial DNA of various cyst nematode populations, selected regions in which the sequence differences between populations were small and those between species were large, designed a primer set and a probe, and found that real-time PCR using the primer set and probe could specifically detect soybean cyst nematodes.Furthermore, since the difference in Ct values ​​between populations was at most about 1, it was possible to quantify all soybean cyst nematode populations using a common calibration curve, which led to the completion of the present invention.

[0015] That is, the present invention includes the following. [1] A primer set for specifically detecting the soybean cyst nematode by amplifying a nucleotide sequence specific to the soybean cyst nematode by PCR, comprising the following primers (1) and (2): (1) a primer containing the nucleotide sequence set forth in SEQ ID NO: 1; and (2) A primer containing the base sequence set forth in SEQ ID NO: 2. [2] A primer and probe set for specifically detecting soybean cyst nematodes, comprising the primer set described in [1] and a probe for specifically detecting soybean cyst nematodes, which comprises the base sequence described in SEQ ID NO: 3, and amplifying a base sequence specific to soybean cyst nematodes by real-time PCR. [3] A kit for specifically detecting soybean cyst nematodes by amplifying a nucleotide sequence specific to the soybean cyst nematode by PCR, the kit comprising the primer set described in [1]. [4] A kit for specifically detecting soybean cyst nematodes by amplifying a base sequence specific to the soybean cyst nematode by real-time PCR, the kit comprising the set of primers and probes described in [2]. [5] A method for detecting soybean cyst nematodes, comprising a step of carrying out a PCR amplification reaction of a target nucleic acid region of the soybean cyst nematode using the primer set according to [1] or the kit according to [3]. [6] A method for quantitatively detecting soybean cyst nematodes, comprising a step of carrying out real-time PCR amplification of a target nucleic acid region of the soybean cyst nematode using the set of primers and probes described in [2] or the kit described in [4]. [Effects of the Invention]

[0016] According to the present invention, it is possible to specifically and efficiently detect the soybean cyst nematode, which is a serious pest of beans. [Brief explanation of the drawings]

[0017] [Figure 1] 1 shows the positions of the primer set and probe according to the present invention in the alignment of partial sequences of the COI gene region of mitochondrial DNA among the soybean cyst nematode, the sugar beet cyst nematode, and the clover cyst nematode. "." indicates that the base is the same as that of the soybean cyst nematode. [Figure 2] 1 is a graph showing Ct values ​​(mean ± SE, n = 3) obtained by real-time PCR according to the method of the present invention using DNA extracted from one larva of each population of soybean cyst nematode in Example 1. [Figure 3] 1 is a graph showing the relationship between DNA concentration and Ct value in real-time PCR performed by the method according to the present invention in Example 1. The DNA concentration indicates the number of soybean cyst nematodes contained in the sample. [Figure 4] 1 is a graph showing the Ct values ​​(mean ± SE, n = 3) obtained by real-time PCR according to the method of Non-Patent Document 1 using DNA extracted from one larva of each population of soybean cyst nematode in Comparative Example 1. [Figure 5] 1 is a graph showing the Ct values ​​(mean ± SE, n = 3) obtained by real-time PCR according to the method of Non-Patent Document 2 using DNA extracted from one larva of each population of soybean cyst nematode in Comparative Example 2. DETAILED DESCRIPTION OF THE INVENTION

[0018] The present invention will be described in detail below. The primer set of the present invention includes a pair of primers that selectively hybridize with a nucleotide sequence specific to the soybean cyst nematode, and is used to amplify the nucleotide sequence specific to the soybean cyst nematode by PCR and specifically detect the soybean cyst nematode.

[0019] FIG. 1 shows the positions of the primer set and probe according to the present invention in an alignment of partial sequences of the COI (cytochrome c oxidase subunit I) gene region of mitochondrial DNA between the soybean cyst nematode, the sugar beet cyst nematode closely related to the soybean cyst nematode, and the clover cyst nematode.

[0020] The primer set according to the present invention comprises the following pair of soybean cyst nematode-specific primers: (1) a primer containing or consisting of the nucleotide sequence set forth in SEQ ID NO: 1 (forward primer, Table 1); and (2) A primer containing or consisting of the nucleotide sequence set forth in SEQ ID NO: 2 (reverse primer, Table 1).

[0021] Alternatively, the primer set of the present invention may alternatively include primers that have a base sequence in which one or several (e.g., 1 to 10, 1 to 5, 1 to 3, and preferably 1 or 2) bases have been deleted, substituted, inserted, or added in the base sequence shown by the SEQ ID NO of each primer, and that have the respective primer functions (i.e., primers that hybridize to DNA derived from the COI gene of the mitochondrial DNA of the soybean cyst nematode under stringent conditions (preferably, highly stringent conditions)). Here, "stringent conditions" refers to, for example, hybridization conditions of "5x SSPE, 5x Denhardt's solution, 0.5% SDS, 50% formamide, 200 μg / mL salmon sperm DNA, overnight at 42°C," and washing conditions of "0.5x SSC, 0.1% SDS, 42°C." "Highly stringent conditions" refers to, for example, hybridization conditions of "5x SSPE, 5x Denhardt's solution, 0.5% SDS, 50% formamide, 200 μg / mL salmon sperm DNA, overnight at 42°C" and washing conditions of "0.2x SSC, 0.1% SDS, 65°C."

[0022] The primer set of the present invention can be combined with a probe for specifically detecting soybean cyst nematodes (FIG. 1 and Table 1), which contains or consists of the nucleotide sequence set forth in SEQ ID NO: 3. This set is used for real-time PCR. That is, the probe is a fluorescent dye probe that binds complementarily within the amplified region (e.g., a fluorescent dye probe having a nucleotide sequence that can specifically anneal to a sequence present between the regions to which the primers used anneal, and labeled with a reporter dye (e.g., FAM) at the 5' end and a quencher (e.g., ZEN, IABkFQ) within the sequence and / or at the 3' end).

[0023] Real-time PCR can be carried out using the primer and probe set according to the present invention, and the amplified product can be quantified using the fluorescent signal from the fluorescent dye probe as an index.

[0024] Like the primer, the probe of the present invention may have a base sequence in which one or several (e.g., 1 to 10, 1 to 5, 1 to 3, preferably 1 or 2) bases have been deleted, substituted, inserted or added in the base sequence shown in SEQ ID NO: 3 of the probe, and may also be a probe having probe function (a probe that hybridizes under stringent conditions (preferably under highly stringent conditions) to DNA derived from the COI gene of the mitochondrial DNA of the soybean cyst nematode).

[0025] The present invention also relates to a kit for detecting soybean cyst nematodes by PCR or real-time PCR, which comprises the primer set of the present invention or the set of primers and probes of the present invention. The kit may further comprise, for example, DNA polymerase, nucleic acid synthesis substrates (dNTPs), buffer solutions, salts, containers, reagents necessary for detecting PCR amplification products (e.g., agarose gel, ethidium bromide, etc.), instructions for use, etc.

[0026] Furthermore, the present invention relates to a method for detecting soybean cyst nematodes (hereinafter referred to as "the method"), which comprises a step of carrying out an amplification reaction of a target nucleic acid region of the soybean cyst nematode by PCR or real-time PCR using the primer set of the present invention, the primer and probe set of the present invention, or the kit of the present invention described above. Real-time PCR enables quantitative detection of an amplified product using a fluorescent signal from a fluorescent dye probe as an indicator.

[0027] In this method, DNA is first extracted and purified from an isolate containing larvae, cysts, and / or eggs isolated from, for example, a field soil sample containing or suspected of containing the soybean cyst nematode (e.g., a field soil sample with a history of growing legumes such as soybeans or adzuki beans), or from the larvae, cysts, and / or eggs isolated from the field soil sample. Examples of DNA extraction methods include those using commercially available DNA extraction reagents.

[0028] Next, the purified DNA is used as a template in PCR using the primer set of the present invention. The PCR reaction solution is prepared so that, for example, per 10 μL of reaction solution, each primer included in the primer set of the present invention is at a final concentration of 200 to 300 nM (preferably 200 nM), 1 to 2 μL (preferably 1 μL) of template DNA, and the respective volumes of DNA polymerase and dNTPs according to the manufacturer's manual. Thermal cycling conditions for PCR include, for example, 30 to 40 cycles (preferably 40 cycles) of the following: initial denaturation at 95°C for 30 seconds → (denaturation at 95°C for 5 seconds → annealing and extension at 59 to 61°C (preferably 60°C) for 25 to 35 seconds (preferably 30 seconds)).

[0029] After the PCR reaction, the reaction mixture is subjected to agarose gel electrophoresis, and the presence or absence of an amplification product of the expected size is confirmed by staining with ethidium bromide, etc. The presence or absence of an amplification product allows the detection of the presence of soybean cyst nematodes.

[0030] On the other hand, when real-time PCR is performed in this method, the probe (fluorescent dye probe) according to the present invention is added to the PCR reaction solution described above, for example, at a final concentration of 100 to 200 nM (preferably 200 nM) per 10 μL of reaction solution, and PCR is performed. The amplified product is quantified using the fluorescent signal from the probe as an indicator. For example, real-time PCR is performed using serially diluted DNA derived from soybean cyst nematodes of known amounts as a standard, and a calibration curve is created by plotting the cycle number (threshold cycle; Ct value) at which a certain amount of amplified product is obtained on the horizontal axis (or vertical axis) and the amount of added DNA on the vertical axis (or horizontal axis). On the other hand, real-time PCR is performed on a sample to be detected, the Ct value is determined, and the amount of DNA in the sample to be detected can be determined from the created calibration curve. [Example]

[0031] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to these examples.

[0032] Example 1: Method for detecting and quantifying soybean cyst nematodes The COI gene sequences of mitochondrial DNA from various cyst nematode populations were compared, and regions with minimal inter-population sequence variation and significant inter-species variation were selected to design primer sets and probes (Table 1). Figure 1 shows the positions of the primer set and probes according to the present invention in an alignment of partial sequences of the COI gene region of mitochondrial DNA from the soybean cyst nematode, sugar beet cyst nematode, and clover cyst nematode. "." indicates a base that is identical to that of the soybean cyst nematode.

[0033] [Table 1]

[0034] Using these primers and probes, real-time PCR was performed using DNA from various nematode species as templates. Specifically, real-time PCR was carried out using a reaction solution having the following composition: Probe qPCR Mix (Takara): 5.0 μl Forward primer: 0.2-0.3 μM (preferably 0.2 μM) Reverse primer: 0.2-0.3 μM (preferably 0.2 μM) Probe: 0.1 to 0.2 μM (preferably 0.2 μM) Template DNA: 1.0 μl Adjust the final volume to 10 μl with nuclease-free water. In this example, all primers and probes were tested at 0.2 μM.

[0035] The PCR reaction was carried out under the following temperature conditions: 30 to 40 cycles (preferably 40 cycles) of initial denaturation: 95°C for 30 seconds → (denaturation: 95°C for 5 seconds → annealing and extension: 59 to 61°C (preferably 60°C) for 25 to 35 seconds (preferably 30 seconds)). In this example, the annealing and extension reactions were all carried out at 60° C. for 30 seconds, with 40 cycles.

[0036] PCR was performed using the Mic real-time PCR system (Bio Molecular Systems).

[0037] The results are shown in Table 2 and Figures 2 and 3.

[0038] Real-time PCR using the primer set and probe according to the present invention specifically detected the soybean cyst nematode (Table 2).

[0039] [Table 2]

[0040] Furthermore, since the difference in Ct values ​​between populations was at most about 1 (Figure 2), it is highly likely that all soybean cyst nematode populations can be quantified using a common calibration curve.

[0041] Furthermore, a strong negative correlation was observed between the concentration of soybean cyst nematode DNA and the Ct value (Figure 3), demonstrating the feasibility of quantification. The lowest-concentration DNA solution used in this example contained the DNA of one soybean cyst nematode in the sample, and this was also detectable by real-time PCR. Therefore, the detection sensitivity was sufficiently high.

[0042] [Comparative Example 1] Real-time PCR of Non-Patent Document 1 (Ye (2012) Journal of Nematology 44:284-290) Real-time PCR was carried out as follows using the primers and probes described in Non-Patent Document 1. The primer and probe sequences are as follows: Forward primer: AAATTCCAGGCCGCTATCTC Reverse primer: CGTGGACTGAACTGGACAAAG Probe: FAM / TGGGCTGGG / ZEN / TGCTTCTAGAACTTTT / 3IABkFQ (All 5'→3', FAM is the reporter, ZEN and 3IABkFQ are quenchers).

[0043] The composition of the PCR reaction solution is as follows: Probe qPCR Mix: 5.0 μl Each primer and probe: 0.2 μM Template DNA: 1.0 μl Adjust the final volume to 10 μl with nuclease-free water.

[0044] Real-time PCR was performed using DNA from seven populations of soybean cyst nematodes as templates under the following temperature conditions: Initial denaturation: 95°C 30 seconds → (denaturation: 95°C 5 seconds → annealing and extension: 62°C 30 seconds) × 50

[0045] The results are shown in Figure 4. When real-time PCR was performed using DNA from domestic soybean cyst nematode populations as a template and the primer set and probe described in Non-Patent Document 1, large differences in Ct values ​​were observed between populations (maximum of approximately 7, Figure 4). Therefore, when quantifying soybean cyst nematodes, it is necessary to use different calibration curves for each population, which is problematic in terms of practicality.

[0046] [Comparative Example 2] Real-time PCR of Non-Patent Document 2 (Ko et al. (2019) The Plant Pathology Journal 35:654-661) Using the primers described in Non-Patent Document 2, real-time PCR was carried out as follows. The primer sequences are as follows: Forward primer: GGTTTAGTTAGATTAACTATC Reverse primer: TAGTAGCTGCACTAAAATAC (All 5'→3').

[0047] The composition of the PCR reaction solution is as follows: TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara): 5 μl Each primer: 0.4 μM Template DNA: 1.0 μM Adjust the final volume to 10 μl with nuclease-free water.

[0048] Real-time PCR was performed using DNA from seven populations of soybean cyst nematodes as templates under the following temperature conditions: Initial denaturation: 95°C 30 seconds → (denaturation: 95°C 5 seconds → annealing: 56°C 30 seconds → extension: 72°C 30 seconds) x 35 → melting curve analysis: 95°C 15 seconds → 60°C 1 minute → [increase temperature by 0.3°C per second] → 95°C

[0049] The results are shown in Figure 5. When real-time PCR was performed using the primer set described in Non-Patent Document 2, a rather large difference in Ct value occurred between populations (maximum of approximately 3.5, Figure 5). Therefore, as with Non-Patent Document 1, this method has problems with practicality.

[0050] [Comparative Example 3] Real-time PCR of Non-Patent Document 3 (Li et al. (2014) PLoS One 9(2):e89887) Real-time PCR was performed as follows using the primers and probes described in Non-Patent Document 3. The primer and probe sequences are as follows: Forward primer: CGTTTTTGGGACACCACACA Reverse primer: TGCTGTCCTCAGACCACGAA Probe: FAM / GAAGTCGGAGTTCGCTCTTCTTTCG / BHQ1 (All 5'→3', FAM is the reporter, BHQ1 is the quencher).

[0051] The PCR reaction mixture had the following composition: Probe qPCR Mix: 5.0 μl Each primer and probe: 0.2 μM Template DNA: 1.0 μl Adjust the final volume to 10 μl with nuclease-free water.

[0052] Real-time PCR was performed using DNA from various cyst nematode populations as templates under the following temperature conditions: Initial denaturation: 95°C 30 seconds → (denaturation: 95°C 5 seconds → annealing and extension: 62°C 30 seconds) × 50

[0053] The results are shown in Table 3. Using DNA from various cyst nematode species as a template, real-time PCR was performed using the primer set and probe described in Non-Patent Document 3, and the sugar beet cyst nematode and clover cyst nematode, which are closely related to the soybean cyst nematode, were also detected (Table 3). These two species have already occurred in Japan, and the clover cyst nematode in particular is commonly found in Hokkaido, making this method unsuitable for practical use.

[0054] [Table 3]

Claims

1. A primer set for specifically detecting the soybean cyst nematode, comprising the following primers (1) and (2), which amplifies a nucleotide sequence specific to the soybean cyst nematode by PCR. (1) a primer consisting of the nucleotide sequence set forth in SEQ ID NO: 1; and (2) A primer consisting of the base sequence set forth in SEQ ID NO:

2.

2. A primer and probe set for specifically detecting soybean cyst nematodes, comprising the primer set described in claim 1 and a probe for specifically detecting soybean cyst nematodes, consisting of the base sequence described in sequence number 3, by amplifying a base sequence specific to soybean cyst nematodes by real-time PCR.

3. 2. A kit for specifically detecting the soybean cyst nematode, comprising the primer set according to claim 1, and amplifying a nucleotide sequence specific to the soybean cyst nematode by PCR.

4. A kit for specifically detecting the soybean cyst nematode by amplifying a nucleotide sequence specific to the soybean cyst nematode by real-time PCR, the kit comprising the set of primers and probes according to claim 2.

5. A method for detecting soybean cyst nematode, comprising a step of carrying out a PCR reaction to amplify a target nucleic acid region of the soybean cyst nematode using the primer set according to claim 1 or the kit according to claim 3.

6. A method for quantitatively detecting soybean cyst nematode, comprising a step of carrying out an amplification reaction of a target nucleic acid region of the soybean cyst nematode by real-time PCR using the set of primers and probes according to claim 2 or the kit according to claim 4.

Citation Information

Patent Citations

  • Method for detecting and determining nematode in soil, and consolidation tool of soil sample usable for the method

    JP2009195147A

  • Racking Unracking System

    KR102602272B1

  • Soil Pathogen Testing

    US20220162666A1

  • Primer set for detection of Heterodera glycines, and detection method by using the same

    KR1020220085502A