Composition containing fusion peptide having tripeptide and biotin bound therein as active ingredient effective for skin whitening, antioxidation, skin condition improvement, hair loss prevention or alleviation, and hair growth promotion

Abstract

The present invention relates to a composition containing a fusion peptide having tripeptide and biotin bound to each other therein as an active ingredient which is effective for skin whitening, antioxidation, skin condition improvement, hair loss prevention or alleviation, and hair growth promotion. The fusion peptide in which tripeptide and biotin are bound to each other according to the present invention inhibits melanin biosynthesis, promotes cell proliferation, enhances antioxidative activity, and provides effects such as skin whitening, skin regeneration, wound healing, hair loss suppression, and hair growth promotion, and thus can be utilized as a material for cosmetics, pharmaceuticals, and food products.

Description

A composition containing a fusion peptide in which tripeptide and biotin are combined as an effective ingredient having skin whitening, antioxidant, skin condition improvement, hair loss prevention or improvement, and hair growth promotion effects.

[0001] The present invention relates to a composition containing biotinoyl tripeptide, which is a fusion peptide in which a tripeptide and biotin are combined, as an effective ingredient having skin whitening, antioxidant, skin condition improvement, hair loss prevention or improvement, and hair growth promotion effects.

[0002] The skin is composed of the epidermis, dermis, and subcutaneous fat, and not only functions as an outer wall that protects the body, but also plays an important role in aesthetic function and social meaning that expresses emotions.

[0003] The skin is essential for maintaining homeostasis and is an important organ that performs various functions, including body temperature regulation, water loss prevention, sensory receptors, synthesis of various biochemical substances, and excretion of small amounts of waste, in addition to its protective function.

[0004] However, compared to other organs, the skin is exposed to numerous external stimuli and direct contact with various pathogens. In particular, absorption of ultraviolet rays by the skin triggers a photochemical reaction, which can lead to skin lesions. Furthermore, the number of patients with skin diseases caused by common factors in modern society, such as psychological stress, obesity, alcohol, and tobacco, is rapidly increasing.

[0005] Accordingly, active development is underway for various skin protectants to prevent skin damage and protect skin cells. However, these products primarily contain synthetic compounds as active ingredients, which can cause skin damage or lead to side effects such as itchiness and blemishes. Therefore, there is a pressing need to develop new natural materials that exhibit superior skin damage prevention and strengthening properties without causing side effects.

[0006] In addition, improvements in living standards and advancements in biotechnology and pharmaceuticals have brought about changes in consumers' cosmetic consumption patterns, leading to an explosive increase in demand for cosmetics that enhance functional aspects such as skin whitening, antioxidant protection, and skin regeneration. To meet these consumer demands, the cosmetics industry is also focusing on developing new functional materials.

[0007] Meanwhile, the hair loss market is rapidly growing in modern society due to the increasing number of people suffering from hair loss. Interest in and importance of scalp and hair health, along with skin health, is also growing. While anti-hair loss shampoos, scalp and hair care products, and hair loss treatments are continuously being developed, the development of effective ingredients remains limited. Recently, finasteride and minoxidil, previously approved products, have been found to have side effects when used in high concentrations, creating a pressing need for new alternatives.

[0008] The purpose of the present invention is to provide a cosmetic composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, which contains a fusion peptide represented by chemical formula 1 as an active ingredient.

[0009] Another object of the present invention is to provide a pharmaceutical composition for preventing or improving skin diseases or hair loss, which comprises a fusion peptide represented by chemical formula 1 as an active ingredient.

[0010] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating skin diseases or hair loss, which comprises a fusion peptide represented by chemical formula 1 as an active ingredient.

[0011] Another object of the present invention is to provide a food composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, which contains a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0012] Another object of the present invention is to provide a feed composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, which contains a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0013] Another object of the present invention is to provide a method for preventing or treating skin diseases or hair loss, comprising a step of administering to a subject a composition comprising a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0014] Another object of the present invention is to provide a method for improving skin condition or promoting hair growth, which comprises a step of applying a composition containing a fusion peptide represented by Chemical Formula 1 as an active ingredient to the skin or mucous membrane of an individual.

[0015] Another object of the present invention is to provide a use of a composition comprising a fusion peptide represented by chemical formula 1 as an active ingredient for preventing or treating skin diseases or hair loss.

[0016] Another object of the present invention is to provide a use of a composition comprising a fusion peptide represented by chemical formula 1 as an active ingredient for improving skin condition or promoting hair growth.

[0017] Another object of the present invention is to provide a use of a composition comprising a fusion peptide represented by chemical formula 1 as an active ingredient for the manufacture of a drug for preventing or treating skin diseases or hair loss.

[0018] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not limited by the specific descriptions described below.

[0019] As one aspect for achieving the above purpose, the present invention provides a composition for improving skin condition, preventing hair loss, or promoting hair growth, which comprises biotinoyl tripeptide, which is a fusion peptide in which tripeptide and biotin are combined, as an active ingredient.

[0020] The inventors of the present invention have made great efforts to develop a peptide that exhibits various skin condition improvement effects, and as a result, they have completed the present invention by confirming that a composition including a fusion peptide linking a tripeptide composed of three amino acids, glutamic acid, cysteine, and glycine, and biotin has excellent effects in preventing skin aging, whitening the skin, anti-oxidation, inhibiting hair loss, or promoting hair growth.

[0021] As another aspect for achieving the above purpose, the present invention provides a cosmetic composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, which comprises a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0022] [Chemical Formula 1]

[0023]

[0024] In the present invention, the 'fusion peptide' is a fusion peptide that links a tripeptide composed of three amino acids, glutamic acid, cysteine, and glycine, and biotin, and may be represented by the chemical formula 1, and the biotin may be linked to the N-terminus of the tripeptide.

[0025] The above fusion peptide may be synthesized by solid-phase peptide synthesis (SPSS). In one embodiment of the present invention, a tripeptide was synthesized by sequentially adding amino acids with protecting groups to an insoluble polystyrene resin, and then, without separating it from the synthesis support, biotin, the final sequence, was bound to thereby synthesize the fusion peptide.

[0026] In the present invention, the term 'active ingredient' means an ingredient that exhibits the desired activity alone or can exhibit activity together with a carrier that is inactive in itself.

[0027] In the present invention, the meaning of 'including as an effective ingredient' means including an effective amount that can exhibit effects such as improving skin condition, preventing or improving hair loss, and promoting hair growth.

[0028] In the present invention, "improving skin condition" means any action that improves or benefits the condition of the skin by including the fusion peptide represented by Chemical Formula 1 as an active ingredient. The "improving skin condition" may mean, but is not limited to, skin regeneration, skin soothing, skin whitening, wound improvement, or skin aging prevention.

[0029] In the present invention, "skin regeneration" refers to the process of skin tissue recovery from damage caused by external and internal factors. Damage caused by external factors may include ultraviolet rays, external pollutants, wounds, trauma, and the like, while damage caused by internal factors may include, but is not limited to, stress.

[0030] In the present invention, 'skin soothing' means the process of relieving the heat or pain of stimulated skin and returning it to its original state.

[0031] In the present invention, "skin whitening" not only brightens skin tone by inhibiting melanin synthesis, but also improves hyperpigmentation of the skin caused by ultraviolet rays, hormones, or genetics. Hyperpigmentation of the skin may include, but is not limited to, freckles, liver spots, age spots, brown spots, or liver spots.

[0032] In the present invention, 'wound' means a breakdown of the normal continuity of the skin structure due to physical damage to the skin, and specifically, it comprehensively means damage to a part of an object, such as contusion or bruise, laceration, avulsion, penetrating wound, non-healing traumatic wound, destruction of tissue by radiation exposure, abrasion, bone gangrene, gun-shot wound, cut, burn, frostbite, skin ulcer, dry skin, keratosis, crack, burst, dermatitis, pain due to dermatophytosis, surgical wound, vascular disease wound, corneal wound, etc., bedsore, ulcer, condition related to diabetes and poor circulation, chronic ulcer, suture site after plastic surgery, spinal injury wound, gynecological wound, chemical wound, and acne.

[0033] In the present invention, 'prevention of skin aging' means both preventing or delaying natural (endogenous) aging that occurs due to physiological changes in the body over time and photoaging that occurs in areas exposed to sunlight.

[0034] The skin aging of the present invention may be photoaging caused by UV-B ultraviolet rays, but is not limited thereto. Specifically, photoaging of skin cells may be promoted by light with a wavelength of 280 nm to 40 nm contained in sunlight. In particular, irradiation with ultraviolet rays such as UV-B having a wavelength in the range of 280 nm to 320 nm may cause damage to the skin or fibers, and may cause a sooting phenomenon in which the skin is blackened. When irradiated with UV-B, the accumulation of reactive oxygen species (e.g., H2O2) and free radicals in skin cells is promoted, and the radicals may stimulate the intracellular signaling system, causing oxidative stress to biomolecules such as DNA, proteins, and lipids, which may result in damage to skin tissue. When oxidative stress in skin cells increases, keratinocytes in the epidermis or fibroblasts in the dermis are stimulated, and through a series of intracellular signaling processes, the expression of genes such as matrix metalloproteinase (MMP), an enzyme that breaks down collagen, can increase, and collagen, which is the main component of the skin and accounts for 90% of the dermis and provides strength and tension to the skin, protecting it from external stimuli or force, can be reduced, which can lead to skin aging or the formation of wrinkles.

[0035] The improvement in skin condition of the present invention may be due to cell proliferation promoting activity, and specifically, may be due to the proliferation promoting activity of human keratinocytes or fibroblasts, but is not limited thereto.

[0036] In the present invention, "hair loss" refers to a phenomenon in which hair falls out from the scalp or a phenomenon in which hair becomes thicker or thinner. Hair loss in the present invention may include androgenetic alopecia, telogen effluvium, anagen effluvium, alopecia areata, drug-induced telogen effluvium, postpartum telogen effluvium, etc. In addition, it may include all types of hair loss that form abnormal hair loss patterns such as vellus hair, short hair in group hair, and atrophy of hair follicles due to a series of factors.

[0037] In the present invention, 'prevention' means any act of suppressing or delaying hair loss through the composition of the present invention, and 'improvement' means any act of improving or benefiting hair loss or the condition of hair through the composition.

[0038] In the present invention, 'hair growth promotion' means not only the function of generating new hair or the function of improving hair growth, but also the function of promoting the delay from the growth phase to the regression phase and allowing existing hair to grow healthily.

[0039] In the present invention, the composition may enhance antioxidant activity, and specifically, may have DPPH radical scavenging activity. The term "antioxidant" refers to an action that inhibits oxidation. The human body has a balance of prooxidants and antioxidants, but when this balance becomes unbalanced due to various factors and tilts toward promoting oxidation, oxidative stress is induced, causing potential cell damage and pathological diseases. Reactive oxygen species (ROS), which are the direct cause of this oxidative stress, are unstable and highly reactive, easily react with various biological substances, and attack macromolecules in the body, causing irreversible damage to cells and tissues or leading to mutations, cytotoxicity, and carcinogenesis. Reactive nitrogen species (RNS) such as NO, HNO2, and ONOO- are produced in large quantities due to the immune response of macrophages, neutrophils, and other immune cells during an inflammatory response, and ROS are also produced during this process. As mentioned above, reactive oxygen species oxidize and destroy cells in the body, thereby exposing them to various diseases. Furthermore, antioxidant activity refers to the function of inhibiting cell oxidation caused by highly reactive free radicals or reactive oxygen species (ROS) due to oxidative stress resulting from intracellular metabolism or ultraviolet rays, and includes reducing cell damage caused by free radicals or reactive oxygen species by eliminating them.

[0040] In the present invention, the composition may inhibit L-tyrosine or L-dopa oxidation activity, and may inhibit the activity of tyrosinase toward an L-tyrosine substrate.

[0041] In the present invention, the composition may reduce the expression of tyrosinase, tyrosinase-related protein-1 (TRP1), dopachrome tautomerase (DCT), microphthalmia-associated transcription factor (MITF), Dickkopf-related protein 1 (DKK-1), or steroid 5 alpha-reductase 1 (SRD5A1), and specifically, may reduce the gene expression of the above factors.

[0042] In the present invention, the composition may increase the expression amount of Noggin, and specifically, may increase the gene expression amount of Noggin.

[0043] The composition of the present invention may contain the fusion peptide in various amounts, as long as it has effects of skin regeneration, skin whitening, wound improvement, prevention of skin aging, or prevention or improvement of hair loss, and specifically, the fusion peptide may be contained in an amount of 0.1 to 10 wt% based on the total weight of the composition. This ratio is merely an exemplary range, and it is apparent to those skilled in the art that even when the composition is contained in amounts of 20%, 30%, or more, the composition also has effects of skin regeneration, skin whitening, wound improvement, prevention of skin aging, or prevention or improvement of hair loss.

[0044] In addition to the fusion peptide, the cosmetic composition according to the present invention may be composed by blending various components generally used in cosmetic compositions, such as water-soluble components, powder components, oils, surfactants, moisturizers, viscosity modifiers, preservatives, antioxidants, fragrances, pigments, etc., within a range that does not impair the effects of the present invention, as needed.

[0045] Non-limiting examples of the surfactants that can be used include anionic surfactants, cationic surfactants, nonionic surfactants, and amphoteric surfactants. More specifically, examples of the anionic surfactants include alkylbenzene sulfonates, polyoxyalkylene alkyl sulfate ester salts, alkyl sulfate ester salts, olefin sulfonates, alkyl phosphates, polyoxyalkylene alkyl ether phosphates, dialkyl sulfosuccinates, and fatty acid salts, and examples of the nonionic surfactants include polyoxyethylene alkyl ethers, polyoxyethylene fatty acid esters, polyhydric alcohol fatty acid partial esters, polyoxyethylene polyhydric alcohol fatty acid partial esters, polyglycerin fatty acid esters, polyoxyethylene hydrogenated castor oil derivatives, and fatty acid diethanolamides. In addition, examples of cationic surfactants include tertiary aliphatic amine salts, alkyltrimethylammonium halides, dialkyldimethylammonium halides, etc., and examples of amphoteric surfactants include amide betaine type, imidazolinium betaine type, sulfo betaine type, etc.

[0046] Examples of the above-mentioned moisturizers include glycerin, propylene glycol, 1,3-butylene glycol, dipropylene glycol, sorbitol, etc. Examples of the above-mentioned preservatives include benzoic acid, dehydroacetic acid, parahydroxybenzoic acid esters (methyl parahydroxybenzoate, butyl parahydroxybenzoate, etc.), phenoxyethanol, etc. In addition, examples of the above-mentioned antioxidants include ascorbic acid, BHA, etc. In addition, ultraviolet absorbers, anti-inflammatory agents, and refreshing agents, etc. can be added.

[0047] The cosmetic composition of the present invention can be prepared in a formulation selected from the group consisting of, but not limited to, a solution, an external ointment, a cream, a foam, a nourishing toner, an emollient toner, a pack, an emollient, a milky lotion, a makeup base, an essence, a soap, a liquid cleanser, a bath agent, a sunscreen cream, a sun oil, a suspension, an emulsion, a paste, a gel, a lotion, a powder, a soap, a surfactant-containing cleansing, an oil, a powder foundation, an emulsion foundation, a wax foundation, a patch, and a spray.

[0048] The cosmetic composition of the present invention may additionally include one or more carriers acceptable for cosmetic formulations, and may appropriately mix conventional ingredients such as oil, water, surfactants, moisturizers, lower alcohols, thickeners, chelating agents, pigments, preservatives, fragrances, etc., but is not limited thereto. Here, the term "acceptable carrier for cosmetic formulations" refers to a compound or composition already known and used, or a compound or composition to be developed in the future, that can be included in cosmetic formulations and that does not have toxicity, instability, or irritation beyond what the human body can adapt to when in contact with the skin. The carrier may be included in the composition of the present invention in an amount of about 1 wt% to about 99.99 wt% based on the total weight of the composition, preferably about 90 wt% to about 99.99 wt% of the weight of the composition. However, since the above ratio varies depending on the formulation in which the composition of the present invention is prepared, its specific application site (face, neck, etc.), its preferred application amount, etc., the above ratio should not be construed as limiting the scope of the present invention in any way.

[0049] In the cosmetic formulation included in the cosmetic composition of the present invention, acceptable carriers vary depending on the formulation of the cosmetic composition.

[0050] When the formulation of the present invention is an ointment, paste, cream, or gel, animal oil, vegetable oil, wax, paraffin, starch, tragacanth, cellulose derivatives, polyethylene glycol, silicone, bentonite, silica, talc, zinc oxide, etc. may be used as carrier components, but are not limited thereto. These may be used alone or in combination of two or more.

[0051] When the formulation of the present invention is a powder or spray, lactose, talc, silica, aluminum hydroxide, calcium silicate, polyamide powder, etc. can be used as a carrier component, and especially in the case of a spray, a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether can be additionally included, but is not limited thereto, and these can be used alone or in a mixture of two or more.

[0052] When the formulation of the present invention is a solution or emulsion, a solvent, a solubilizer or an emulsifier may be used as a carrier component, for example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butyl glycol oil, etc. may be used, and in particular, cottonseed oil, peanut oil, corn germ oil, olive oil, castor oil and sesame oil, glycerol fatty acid ester, polyethylene glycol or fatty acid ester of sorbitan may be used, but is not limited thereto, and these may be used alone or in a mixture of two or more.

[0053] When the formulation of the present invention is a suspension, liquid diluents such as water, ethanol or propylene glycol, suspending agents such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar or tragacanth may be used as carrier components, but are not limited thereto, and these may be used alone or in a mixture of two or more.

[0054] When the formulation of the present invention is soap, alkali metal salts of fatty acids, fatty acid hemiester salts, fatty acid protein hydrolysates, isethionates, lanolin derivatives, fatty alcohols, vegetable oils, glycerol, sugars, etc. may be used as carrier components, but are not limited thereto, and these may be used alone or in a mixture of two or more.

[0055] The cosmetic composition of the present invention can be manufactured by including the fusion peptide as an active ingredient, and the manufacturing method thereof can be selected by a person skilled in the art according to the technical knowledge known in the relevant technical field, and is not particularly limited thereto.

[0056] As another aspect for achieving the above purpose, the present invention provides a pharmaceutical composition for preventing or improving skin disease or hair loss, comprising a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0057] The above 'fusion peptide', 'active ingredient', 'including as an active ingredient' and 'hair loss' are as described above.

[0058] In the present invention, 'skin disease' means a disease occurring on the skin, and the skin disease may mean, but is not limited to, skin pigmentation, skin wounds, and skin scars.

[0059] In the present invention, non-limiting examples of 'skin wounds' and 'skin scars' include abrasions, scars caused by abrasions, etc.

[0060] In the present invention, "skin pigmentation" refers to any disease caused by skin pigmentation due to increased melanin production. Non-limiting examples of skin pigmentation diseases include melasma, freckles, spots, solar lentigines, post-drug pigmentation, post-inflammatory pigmentation, and pregnancy-induced pigmentation.

[0061] In the present invention, 'hair loss' may include, but is not limited to, alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, telogen effluvium, etc.

[0062] In the present invention, 'prevention' means any act of inhibiting or delaying skin diseases such as skin wounds, skin scars, and skin pigmentation by administering or applying the fusion peptide of the present invention to a subject, and any act of inhibiting or delaying hair loss.

[0063] In the present invention, 'improvement' means any act of improving or benefiting skin diseases such as skin wounds, skin scars, and skin pigmentation by using the fusion peptide of the present invention, and any act of improving or benefiting hair loss or hair condition.

[0064] In the present invention, 'quasi-drug' means an article other than a device, machine or apparatus used for the purpose of diagnosing, treating, alleviating, managing or preventing a disease of a human or animal, and an article other than a device, machine or apparatus used for the purpose of exerting a pharmacological effect on the structure and function of a human or animal, and may include, but is not limited to, an internal preparation, and the method of formulation, dosage, method of use, components, etc. of a quasi-drug may be appropriately selected from conventional techniques known in the art.

[0065] In the present invention, the above-mentioned quasi-drug may further include, in addition to the above-mentioned fusion peptide, a pharmaceutically acceptable carrier, excipient, or diluent, as needed. The pharmaceutically acceptable carrier, excipient, or diluent is not limited as long as it does not impair the effects of the present invention, and may include, for example, fillers, bulking agents, binders, wetting agents, disintegrants, surfactants, lubricants, sweeteners, fragrances, preservatives, etc. Representative examples of pharmaceutically acceptable carriers, excipients or diluents include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, maltitol, starch, gelatin, glycerin, acacia gum, alginate, calcium phosphate, calcium carbonate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, mineral oil, propylene glycol, polyethylene glycol, vegetable oil, injectable esters, withepsol, macrogol, Tween 61, cacao butter, lauric acid, etc.

[0066] In addition, the quasi-drug composition of the present invention may contain one or more active ingredients exhibiting the same or similar functions in addition to the fusion peptide, for example, ingredients exhibiting known effects of skin regeneration, skin soothing, antioxidant, skin whitening, and hair growth promotion, etc. The quasi-drug composition of the present invention may include, but is not limited to, a disinfectant, a shower foam, an ointment, a wet tissue, a coating agent, etc., and the formulation method, dosage, method of use, components, etc. of the quasi-drug may be appropriately selected from conventional techniques known in the art.

[0067] As another aspect for achieving the above purpose, the present invention provides a pharmaceutical composition for preventing or treating skin diseases or hair loss, comprising a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0068] The above 'fusion peptide', 'active ingredient', 'including as active ingredient', 'skin disease', 'hair loss' and 'prevention' are as described above.

[0069] In the present invention, 'treatment' means any act of improving, alleviating, or beneficially treating skin diseases such as skin wounds, skin scars, and skin pigmentation, or hair loss symptoms by administering the composition of the present invention to a subject.

[0070] The pharmaceutical composition of the present invention may further comprise a pharmaceutically acceptable carrier. Examples of such pharmaceutically acceptable carriers include carriers for oral administration or carriers for parenteral administration. Carriers for oral administration may include lactose, starch, cellulose derivatives, magnesium stearate, stearic acid, and the like.

[0071] Additionally, carriers for parenteral administration may include water, suitable oils, saline, aqueous glucose, and glycols. They may also contain stabilizers and preservatives. Suitable stabilizers include antioxidants such as sodium bisulfite, sodium sulfite, or ascorbic acid. Suitable preservatives include benzalkonium chloride, methyl- or propyl-paraben, and chlorobutanol.

[0072] The pharmaceutical composition of the present invention can be administered to mammals, including humans, by any method. For example, it can be administered orally or parenterally, and parenteral administration methods can include intravenous, intramuscular, intraarterial, central, intramedullary, intrathecal, intracardiac, transdermal, subcutaneous, intraperitoneal, intranasal, enteral, topical, sublingual, or rectal administration, and preferably, central administration is used, but is not limited thereto.

[0073] The pharmaceutical composition of the present invention may be formulated as a preparation for oral or parenteral administration, depending on the route of administration as described above. When formulated, it may be prepared using one or more buffers (e.g., saline or PBS (phosphate buffered saline)), antioxidants, bacteriostatic agents, chelating agents (e.g., EDTA or glutathione), fillers, bulking agents, binders, adjuvants (e.g., aluminum hydroxide), suspending agents, thickening agents, wetting agents, disintegrating agents, surfactants, diluents, or excipients.

[0074] Solid preparations for oral administration include tablets, pills, powders, granules, liquids, gels, syrups, slurries, suspensions, capsules, etc., and these solid preparations can be prepared by mixing the pharmaceutical composition of the present invention with at least one excipient, for example, starch (including corn starch, wheat starch, rice starch, potato starch, etc.), calcium carbonate, sucrose, lactose, dextrose, sorbitol, mannitol, xylitol, erythritol maltitol, cellulose, methyl cellulose, sodium carboxymethylcellulose, and hydroxypropylmethyl-cellulose, or gelatin. For example, tablets or sugar-coated tablets can be obtained by mixing an active ingredient with a solid excipient, grinding the mixture, adding a suitable auxiliary agent, and then processing the mixture into a granule mixture.

[0075] In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid preparations for oral administration include suspensions, solutions, emulsions, and syrups. In addition to the commonly used simple diluents such as water or liquid paraffin, various excipients such as wetting agents, sweeteners, flavoring agents, or preservatives may be included. In addition, cross-linked polyvinylpyrrolidone, agar, alginic acid, or sodium alginate may be added as disintegrants, and anticoagulants, lubricants, wetting agents, flavoring agents, emulsifiers, and preservatives may be additionally included.

[0076] When administered parenterally, the pharmaceutical composition of the present invention may be formulated in the form of injections, transdermal administration agents, and nasal inhalants together with a suitable parenteral carrier according to methods known in the art. The injections must be sterilized and protected from contamination by microorganisms such as bacteria and fungi. Suitable carriers for injections include, but are not limited to, solvents or dispersion media containing water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), mixtures thereof, and / or vegetable oils. More preferably, suitable carriers include Hanks' solution, Ringer's solution, PBS containing triethanolamine, or isotonic solutions such as sterile water for injection, 10% ethanol, 40% propylene glycol, and 5% dextrose. To protect the injections from microbial contamination, various antibacterial and antifungal agents such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal may be additionally included. Additionally, the above injections may in most cases additionally contain isotonic agents such as sugar or sodium chloride.

[0077] Transdermal administration includes ointments, creams, lotions, gels, topical solutions, pastes, liniments, and aerosols. "Transdermal administration" here refers to topically administering a pharmaceutical composition to the skin, thereby delivering an effective amount of the active ingredient contained in the pharmaceutical composition into the skin.

[0078] For inhalation administration, the compositions used according to the present invention may conveniently be delivered in the form of an aerosol spray from a pressurized pack or nebulizer using a suitable propellant, such as dichlorofluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or another suitable gas. For pressurized aerosols, the dosage unit may be determined by providing a valve to deliver a metered amount. For example, gelatin capsules and cartridges for use in inhalers or insufflators may be formulated to contain a powder mixture of the compound and a suitable powder base such as lactose or starch. Formulations for parenteral administration are described in the well-known prescription book of pharmaceutical chemistry (Remington's Pharmaceutical Science, 15th Edition, 1975 Mack Publishing Company, Easton, Pennsylvania 18042, Chapter 87: Blaug, Seymour).

[0079] The pharmaceutical composition of the present invention may vary in the amount of active compound in a unit dose formulation, and specifically, may be adjusted to about 0.01 mg to about 1 g per dose based on a human weighing an average of 70 kg. However, the dosage may vary depending on the needs of the human or mammal, the severity of the disease being treated, and the final composition of the compound used. Determining the appropriate dosage for a particular situation is within the purview of those skilled in the art.

[0080] The pharmaceutical composition of the present invention may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy or biological response modifiers.

[0081] As another aspect for achieving the above purpose, the present invention provides a food composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, which comprises a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0082] The above 'fusion peptide', 'active ingredient', 'including as an active ingredient', 'improvement of skin condition', 'hair loss', 'prevention', 'improvement' and 'promotion of hair growth' are as described above.

[0083] The food composition of the present invention includes all forms, including functional foods, nutritional supplements, health foods, food additives, and feeds, and is intended for consumption by humans or animals, including livestock. The above-mentioned types of food compositions can be manufactured in various forms using conventional methods known in the art.

[0084] The above type of food composition can be manufactured in various forms according to conventional methods known in the art. General foods include, but are not limited to, beverages (including alcoholic beverages), fruits and processed foods thereof (canned fruits, bottled fruits, jams, marmalades, etc.), fish, meats and processed foods thereof (ham, sausages, corned beef, etc.), breads and noodles (udon, buckwheat noodles, ramen, spagate, macaroni, etc.), fruit juices, various drinks, cookies, taffy, dairy products (butter, cheese, etc.), edible plant oils, margarine, vegetable proteins, retort foods, frozen foods, various seasonings (soybean paste, soy sauce, sauces, etc.), etc., and the above-mentioned effective ingredient can be added thereto to manufacture the composition.

[0085] In addition, nutritional supplements can be manufactured by adding the above-mentioned active ingredient to capsules, tablets, pills, etc. In addition, health functional foods can be manufactured in the form of tea, juice, and drinks, and can be consumed by liquefying, granulating, encapsulating, and powdering them so that they can be consumed as health drinks, but are not limited thereto. In addition, in order to use the above-mentioned fusion peptide in the form of a food additive, it can be manufactured and used in the form of a powder or concentrate. In addition, it can be manufactured in the form of a composition by mixing it with known active ingredients known to be effective in improving muscle disease, bone disease, muscle loss, bone loss, etc.

[0086] In addition to the above, the health food of the present invention may contain various nutrients, vitamins, electrolytes, flavoring agents, coloring agents, pectic acid, salts of pectic acid, alginic acid, salts of alginic acid, organic acids, protective colloid thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, or carbonating agents.

[0087] As another aspect for achieving the above purpose, a feed composition for improving skin condition, preventing or improving hair loss, or promoting hair growth is provided, which contains a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0088] The above 'fusion peptide', 'active ingredient', 'including as an active ingredient', 'improvement of skin condition', 'hair loss', 'prevention', 'improvement' and 'promotion of hair growth' are as described above.

[0089] The term 'feed' of the present invention refers to any natural or artificial diet, meal, etc. or ingredients of the meal for animals to eat, ingest, and digest, and can be manufactured into various forms of feed known in the art, and specifically includes, but is not limited to, concentrate feed, forage, feed additives, feed supplements, pet nutrients, or special feed.

[0090] The feed additive of the present invention corresponds to a supplementary feed under the Feed Management Act, and may additionally include mineral preparations such as sodium bicarbonate (sodium bicarbonate), bentonite, magnesium oxide, and complex minerals; mineral preparations that are trace minerals such as zinc, copper, cobalt, and selenium; vitamins such as carotene, vitamin E, vitamin A, D, E, nicotinic acid, and vitamin B complex; protected amino acids such as methionine and lysic acid; protected fatty acids such as fatty acid calcium salts; live bacteria such as probiotics (lactic acid bacteria), yeast cultures, and mold fermentations; and yeast agents.

[0091] Concentrated feed includes, but is not limited to, seed products including grains such as wheat, oats, and corn; bran including rice bran, wheat bran, and barley bran as by-products obtained from refining grains; sesame cakes which are by-products obtained from extracting soybeans, sesame seeds, linseeds, and coconut oil; residual starch which is the main component of starch residue left after removing starch from sweet potatoes, potatoes, etc.; animal feed such as fish meal, fish waste, fish soluble which is concentrated fresh liquid obtained from fish, meat meal, blood meal, feather meal, skim milk powder, dried whey which is the residue when manufacturing cheese from milk or casein from skim milk; yeast, chlorella, and seaweed. Forage includes, but is not limited to, raw grass feed such as wild grass, pasture, and green grass; root vegetables such as forage turnips, forage beets, and a type of turnip called luterberger; silage, which is stored feed made by filling a silo with raw grass, green grass crops, and grain and fermenting it with lactic acid; hay made by cutting and drying wild grass and pasture; straw from crops for breeding stock; and leaves of legumes. Special feed includes, but is not limited to, mineral feed such as oyster shells and rock salt; urea feed such as urea or its derivative diuretic isobutane; feed additives and dietary supplements, which are substances added in small amounts to compound feed to supplement ingredients that are likely to be lacking when only natural feed ingredients are mixed or to increase the storability of feed.

[0092] The feed composition of the present invention may further include ingredients added to conventional feed. Examples of ingredients added to such feed may include grain powder, meat powder, and legumes. The grain powder may be at least one selected from rice flour, wheat flour, barley flour, and corn flour. The meat powder may be a powdered meat powder obtained by pulverizing at least one selected from chicken, beef, pork, and ostrich meat. The legumes may be at least one selected from soybeans, kidney beans, peas, and black beans.

[0093] The feed composition of the present invention may, in addition to the grain powder, meat powder, and legumes that are ingredients added to the conventional feed mentioned above, add at least one selected from among nutrients and minerals to increase the nutritional value of the feed, and may include at least one selected from among antifungal agents, antioxidants, anticoagulants, emulsifiers, and binders to prevent deterioration of feed quality.

[0094] The feed or feed additive of the present invention can be applied to the diets of a number of animals, including mammals, poultry, and fish.

[0095] As another aspect for achieving the above object, the present invention provides a method for preventing or treating skin disease or hair loss, comprising a step of administering to a subject a composition comprising a fusion peptide represented by Chemical Formula 1 as an active ingredient.

[0096] In the present invention, 'fusion peptide', 'active ingredient', 'including as active ingredient', 'skin disease', 'hair loss', 'prevention' and 'treatment' are as described above.

[0097] The above object may be a mammal, specifically, but not limited to, a human, cow, sheep, goat, horse, pig, dog, cat, rabbit, rat, mouse, fish, bird, etc.

[0098] A composition containing a fusion peptide represented by Chemical Formula 1 as an active ingredient may be appropriately administered by a person skilled in the art according to the patient's age, sex, weight, severity of symptoms, and route of administration. The administration may be once daily or several times daily, and may be repeated at appropriate intervals.

[0099] The dosage of the composition containing the fusion peptide represented by the above chemical formula 1 as an active ingredient varies depending on the condition and weight of the individual, the degree of the disease, the form of the drug, the route and period of administration, and can be appropriately selected by a person skilled in the art. Specifically, 10 5 About 10 13 It may be administered in pfu (plaque forming units) and may include various numbers or ranges between the above ranges.

[0100] In the method for treating skin diseases or hair loss of the present invention, the composition may be administered via any common route as long as it can reach the target tissue. The composition of the present invention is not particularly limited thereto, but may be administered via oral or rectal administration, and, in some cases, may be administered via other routes depending on the intended purpose.

[0101] In the present invention, the method for preventing or treating skin disease or hair loss includes a treatment method through combined use with a conventionally known skin disease agent or hair loss agent and a skin disease and hair loss treatment therapy.

[0102] As another aspect for achieving the above purpose, a method for improving skin condition or promoting hair growth is provided, comprising a step of applying a composition containing a fusion peptide represented by Chemical Formula 1 as an active ingredient to the skin or mucous membrane of an individual.

[0103] As another aspect for achieving the above purpose, the present invention provides a use of a composition comprising a fusion peptide represented by chemical formula 1 as an active ingredient for preventing or treating skin diseases or hair loss.

[0104] As another aspect for achieving the above purpose, the present invention provides a use of a composition comprising a fusion peptide represented by chemical formula 1 as an active ingredient for improving skin condition or promoting hair growth.

[0105] As another aspect for achieving the above purpose, the present invention provides a use of a composition comprising a fusion peptide represented by chemical formula 1 as an active ingredient for the manufacture of a drug for preventing or treating skin diseases or hair loss.

[0106] In the present invention, 'fusion peptide', 'active ingredient', 'comprising an active ingredient', 'skin disease', 'hair loss', 'substance', 'hair growth promotion', 'improvement', 'prevention' and 'treatment' are as described above.

[0107] The fusion peptide of the present invention, in which a tripeptide and biotin are combined, inhibits melanin biosynthesis or promotes cell proliferation, and has effects such as skin whitening, skin regeneration, wound improvement, hair loss inhibition, and hair growth promotion, and can be used as a material for cosmetics, pharmaceuticals, etc.

[0108] Figure 1 shows the structural formula of the biotinoyl tripeptide (hereinafter referred to as “fusion peptide”) synthesized in the present invention.

[0109] Figure 2 shows the HPLC analysis results of the fusion peptide purified after synthesis in the present invention.

[0110] Figure 3 shows the results of measuring cell viability for human keratinocytes according to treatment with the fusion peptide and tripeptide of the present invention.

[0111] Figure 4 shows the results of measuring cell viability for human fibroblasts following treatment with the fusion peptide of the present invention.

[0112] Figure 5 shows the results of measuring the survival rate of human breast papilla cells according to treatment with the fusion peptide and biotin + tripeptide (hereinafter, “simple mixture”) of the present invention.

[0113] Figure 6 shows the results of comparing the wound area microscopic photographs (A) and the wound area area (B) of the fusion peptide treatment group of the present invention and the untreated group.

[0114] Figure 7 shows the results of comparing the antioxidant effects of the fusion peptide, tripeptide, and simple mixture of the present invention through DPPH radical scavenging activity.

[0115] Figure 8 shows the results comparing the inhibitory effects of the fusion peptide, tripeptide, and simple mixture of the present invention on the activity of tyrosinase on the L-DOPA substrate.

[0116] Figure 9 shows the results comparing the inhibitory effects of the fusion peptide, tripeptide, and simple mixture of the present invention on the activity of tyrosinase on the L-tyrosine substrate.

[0117] Figure 10 shows the results of electrophoresis to confirm changes in mRNA expression levels for whitening factors (Tyrosinase, TRP1, DCT, and MITF) according to treatment with the fusion peptide of the present invention.

[0118] Figure 11 is a graph showing the change in mRNA expression levels for whitening factors (Tyrosinase, TRP1, DCT, and MITF) according to treatment with the fusion peptide of the present invention.

[0119] Figure 12 shows the results of electrophoresis confirming changes in mRNA expression levels for hair growth and hair loss related factors (DKK-1, SRD5A1, and Noggin) according to treatment with the fusion peptide of the present invention.

[0120] Figure 13 is a graph showing the change in the mRNA expression level of Noggin according to treatment with the fusion peptide of the present invention.

[0121] Figure 14 is a graph showing the change in the mRNA expression level of DKK-1 according to treatment with the fusion peptide of the present invention.

[0122] Figure 15 is a graph showing the change in mRNA expression level of SRD5A1 according to treatment with the fusion peptide of the present invention.

[0123] Hereinafter, the present invention will be described in more detail through the following examples. However, these examples are intended to exemplify the present invention and the scope of the present invention is not limited to these examples.

[0124]

[0125] Example 1. Synthesis and purification of the fusion peptide of the present invention

[0126] 1-1. Fusion peptide synthesis

[0127] The biotinoyl tripeptide of the present invention (hereinafter referred to as the 'fusion peptide') is a novel fusion peptide that links a tripeptide composed of three amino acids, glutamic acid, cysteine, and glycine, to biotin. The biotinoyl tripeptide was synthesized using solid-phase peptide synthesis (SPSS).

[0128] Specifically, a tripeptide was synthesized by sequentially adding amino acids with protecting groups to an insoluble polystyrene resin. This tripeptide was then conjugated to the final sequence, biotin, without being separated from the synthetic support. Unbound biotin was then removed from the reactant, resulting in the synthesis of a high-purity fusion peptide.

[0129] The structural formula of the fusion peptide synthesized in the present invention is as shown in Figure 1.

[0130]

[0131] 1-2. Purification of fusion peptides

[0132] The fusion peptide synthesized in Example 1-1 was purified by Reverse Phase-High Performance Liquid Chromatography (RP-HPLC). A C18 column was used as the column, and solvents A (water containing 0.1% TFA) and solvent B (acetonitrile containing 0.1% TFA) were used as the purification solvents, and the purification was performed using solvent gradient conditions. As a result, the purity was confirmed to be 95% or higher (Fig. 2).

[0133]

[0134] Experimental Example 1. Confirmation of the cell stability of fusion peptides in human keratinocytes.

[0135] 1-1. Human keratinocyte culture

[0136] In order to confirm whether the fusion peptide synthesized in Example 1 can show an improvement effect without skin irritation even when used for a long period of time, the presence or absence of cytotoxicity toward human keratinocytes was tested.

[0137] HaCaT, a keratinocyte cell line, a human skin component cell, was cultured in a 5% CO2 incubator at 37°C. When the culture reached 85 to 90% of the surface area of ​​the culture vessel, the cells were detached by trypsin treatment and counted, and the 5X10 3 cells / cm 2 Subculture was performed. For cell culture, DMEM (Delbecco's Modified Eagle Medium, GIBCO) medium supplemented with 10% FBS (GIBCO) 100 U / ml, penicillin, and streptomycin 100 μg / ml was used.

[0138]

[0139] 1-2. Confirmation of stability against human keratinocytes

[0140] For each of the fusion peptide and tripeptide synthesized in Example 1, a safety test on human keratinocytes was performed and then compared.

[0141] First, human keratinocytes were seeded in 24-well plates at 5X10 3 Cells were counted equally per well using a hemacytometer and then dispensed. After culturing for 48 hours in DMEM medium containing 10% fetal bovine serum (FBS), when ~70% of the cultured surface area of ​​the culture vessel was cultured, the culture was replaced with FBS-free DMEM containing the fusion peptide or tripeptide of the present invention diluted at various concentrations and cultured for an additional 24 hours. After culturing, 50 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655) solution (2.5 mg / ml) was added and cultured for an additional 3 hours. Afterwards, the entire cell culture medium was discarded, 300 ㎕ of DMSO (dimethyl sulfoxide, Sigma D2650) was treated per well, stirred, and 100 ㎕ was taken into each 96 wells, and the absorbance was measured at 570 nm using ELISA (Enzyme-Linked Immunosorbent Assay). The degree of cytotoxicity was expressed as a percentage based on the absorbance intensity of the control group using pure water.

[0142] The cytotoxicity test of the fusion peptide on human keratinocytes showed no significant toxicity even at the highest tested treatment concentration of 2 mM (Fig. 3). In addition, when the fusion peptide of the present invention was treated in the range of 0.05 to 1 mM, cell proliferation of human keratinocytes was confirmed compared to the untreated group. In particular, the cell viability was confirmed to increase by 127.67% in the 0.05 mM treatment group of the fusion peptide of the present invention compared to the untreated group, and by 131.38% in the 0.1 mM treatment group.

[0143] On the other hand, it was confirmed that the cell viability decreased to approximately 80% in the 0.5 mM treatment group of tripeptide, and that the cell viability decreased to below 20% at test concentrations of 1 mM or higher (Fig. 3).

[0144] From the above results, it was confirmed that the fusion peptide of the present invention has much better cell safety for human keratinocytes than the tripeptide.

[0145]

[0146] Experimental Example 2. Confirmation of the cell stability of the fusion peptide in human fibroblasts.

[0147] 2-1. Human fibroblast culture

[0148] In order to confirm whether the fusion peptide synthesized in Example 1 can show an improvement effect without skin irritation even when used for a long period of time, the presence or absence of cytotoxicity toward human fibroblasts was tested.

[0149] Human fibroblast cells, CCD-986sk, were cultured in a 5% CO2 incubator at 37°C. When the culture reached 85 to 90% of the surface area of ​​the culture vessel, the cells were detached by trypsin treatment and counted. 5X10 3 cells / cm 2 Subculture was performed. DMEM (Delbecco's Modified Eagle Medium, GIBCO) supplemented with 10% FBS (GIBCO), 100 U / ml penicillin, and 100 μg / ml streptomycin was used for cell culture.

[0150]

[0151] 2-2. Confirmation of stability against human fibroblasts

[0152] Fibroblast cells CCD-986sk were seeded at 5X10 in a 24-well plate 3After counting cells / well equally using a hemacytometer, the cells were dispensed and cultured. After culturing in DMEM containing 10% FBS for 48 hours and reaching ~70% of the culture vessel surface area, the cells were replaced with FBS-free DMEM containing and diluting the fusion peptide of the present invention and cultured for an additional 24 hours.

[0153] After additional culture, 50 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655, USA) solution (2.5 mg / ml) was added and cultured for an additional 3 hours. Afterwards, the entire cell culture medium was discarded, 300 μl of dimethyl sulfoxide (DMSO, Sigma D2650, USA) was treated to each well, stirred, and 100 μl was taken into 96 wells each, and the absorbance was measured at 570 nm using an Enzyme-Linked Immunosorbent Assay (ELISA). For relative evaluation, the degree of cytotoxicity was expressed as a percentage based on the absorbance intensity of the control group using FBS-free DMEM containing no sample.

[0154] As a result, it was confirmed that the fusion peptide of the present invention has no cytotoxicity toward human fibroblasts (Fig. 4).

[0155]

[0156] Experimental Example 3. Confirmation of the cell stability of the fusion peptide in human breast papilla cells.

[0157] 3-1. Human mammary gland cell culture

[0158] To determine whether the fusion peptide synthesized in Example 1 could exhibit an improvement effect without skin irritation even with long-term use, cytotoxicity toward human dermal papilla cells was tested. A simple mixture of biotin and tripeptide, called "biotin + tripeptide" (hereinafter, "simple mixture"), was also tested and compared.

[0159] Human Follicle Dermal Papilla Cells (HFDPC) were cultured in a 5% CO2 incubator at 37°C. When the culture reached 85 to 90% of the surface area of ​​the culture vessel, the cells were detached by trypsin treatment and counted, and 5X10 3 cells / cm 2 Subculture was performed. DMEM (Delbecco's Modified Eagle Medium, GIBCO) supplemented with 10% FBS (GIBCO), 100 U / ml penicillin, and 100 μg / ml streptomycin was used for cell culture.

[0160]

[0161] 3-2. Stability verification for human breast papilla cells

[0162] Human mammary papilla cells (HFDPC) were seeded in 24-well plates at 5X10 3 After counting cells / well equally using a hemacytometer, the cells were dispensed and cultured. After culturing in DMEM containing 10% FBS for 48 hours, when ~70% of the culture vessel surface area was cultured, the cells were replaced with FBS-free DMEM containing the fusion peptide or simple mixture of the present invention diluted and cultured for an additional 24 hours.

[0163] After additional culture, 50 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT, Sigma M5655, USA) solution (2.5 mg / ml) was added and cultured for an additional 3 hours. Thereafter, the entire cell culture medium was discarded, 300 μl of dimethyl sulfoxide (DMSO, Sigma D2650, USA) was treated to each well, stirred, and 100 μl was taken into 96 wells each, and the absorbance was measured at 570 nm using an Enzyme-Linked Immunosorbent Assay (ELISA). For relative evaluation, the degree of cytotoxicity was expressed as a percentage based on the absorbance intensity of the control group using FBS-free DMEM containing no sample.

[0164] As a result, it was confirmed that the fusion peptide of the present invention had no cytotoxicity toward human breast papilla cells even at 100 ppm, but the simple mixture showed a survival rate of less than 40% compared to the untreated group (Fig. 5).

[0165]

[0166] Experimental Example 4. Confirmation of the skin regeneration effect of fusion peptides.

[0167] The degree of wound regeneration was confirmed as one of the main physiological activity mechanisms of the composition having skin regeneration and skin soothing effects. The keratinocyte cell line HaCaT was cultured in a 6-well plate at a density of 2X10 5Cells were seeded at 1 / well and cultured in 10% FBS / DMEM medium for 48 hours to form a keratinocyte monolayer. The culture medium was removed, and a cell-free zone (scratch wound) was formed in each well using a wound maker. Afterwards, each well was washed three times with 1 ml of phosphate buffer (pH 7.4), and 3 ml of the fusion peptide serially diluted with FBS-free DMEM medium was added to each well, followed by culture in a CO2 incubator for 24 hours. The control group treated only with FBS-free DMEM medium without the peptide sample was set to 100 (%), and the regenerative ability (healing ability) of the fusion peptide was measured. The regenerative ability was measured by comparing the wound area with that of the untreated group after cell staining through a microscope. Figure 6 shows a comparison of the microscopic photograph of the wound area (Figure 6A) and the area of ​​the wound area (Figure 6B).

[0168] As a result, the fusion peptide of the present invention showed a superior skin regeneration effect compared to the untreated group. When the untreated group (control) was set at 100 (%) and compared to the fusion peptide treatment group, the treatment group treated with the 0.25 mM fusion peptide showed a wound healing effect of approximately 116.27%, and the treatment group treated with the 0.5 mM concentration showed a wound healing effect of approximately 163.27%. From the above results, it was confirmed that the fusion peptide of the present invention has excellent skin regeneration efficacy.

[0169]

[0170] Experimental Example 5. Confirmation of the antioxidant effect of fusion peptides.

[0171] The antioxidant effect of the fusion peptide synthesized in Example 1 was measured by the free radical scavenging effect of the sample using DPPH (2,2-diphenyl-1-picrylhydrazyl). The lyophilized fusion peptide was diluted with each phosphate buffer (pH 7.4) and prepared. 100 μL of a 0.2 mM DPPH methanol solution was added to 100 μL of each sample solution, and the mixture was reacted at room temperature for 30 minutes. Afterwards, 100 μL of methanol was added to each 100 μL of the sample solution as a blank, and the DPPH methanol solution was used as a negative control. The absorbance was measured at 520 nm, and the DPPH scavenging activity (antioxidant rate) was calculated. At this time, the free radical scavenging effect of the tripeptide and the simple mixture was also measured for comparison, and the results were compared.

[0172] As a result of the experiment, it was confirmed that the fusion peptide of the present invention has DPPH radical scavenging activity by showing an antioxidant rate of 40.33% to 72.23% (Table 1).

[0173] Concentration of fusion peptide treatment (mM) Untreated group 0.75 1.0 1.5 2.0 Antioxidant rate (%) 0 4 0.3 3 4 8.5 2 6 0.1 6 7 2.23

[0174] On the other hand, in the case of tripeptide, when treated with the same molar concentration, the antioxidant rate was similar to or lower than that of the fusion peptide of the present invention (Table 2). Specifically, it was confirmed that the antioxidant activity increased as the treatment concentration of the fusion peptide increased, and at the highest concentration tested, 2 mM, the antioxidant activity was approximately 20% higher than that of the tripeptide. Meanwhile, it was confirmed that the simple mixture of biotin and tripeptide had a lower antioxidant rate than when the tripeptide was treated alone (Table 3).

[0175] Tripeptide treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 Antioxidant rate (%) 0 4 5.5 6 4 8.1 6 4 9.1 6 5 2.25

[0176] Simple mixture treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 Antioxidant rate (%) 0 15.16 27.5 134.30 38.87

[0177] That is, it was confirmed that the fusion peptide of the present invention has an excellent antioxidant rate compared to the tripeptide alone and simple mixture (Fig. 7).

[0178]

[0179] Experimental Example 6. Confirmation of the L-DOPA inhibitory effect of the fusion peptide.

[0180] The effect of the whitening ingredient was evaluated by measuring the inhibition of the DOPA oxidation reaction of tyrosinase, which catalyzes the rate-determining step of melanin synthesis, using the L-DOPA inhibition test method. For a comparative test with the freeze-dried fusion peptide of the present invention, biotin, tripeptide, and a simple mixture of biotin and tripeptide were diluted with sodium phosphate buffer (0.1 M, pH 6.8) to prepare. 850 ul of sodium phosphate buffer (0.1 M, pH 7.0), 50 ul of the sample diluted to an appropriate concentration, and 50 ul of mushroom tyrosinase solution were sequentially added to a test tube and reacted at 37°C for 6 minutes. 50 ul of 0.06 mM L-DOPA (L-3,4-dihydroxyphenylalanine, Sigma D9628-25G) solution was added to this solution and reacted at 37°C for 1 minute. After the reaction was completed, the absorbance was measured at 475 nm using an ELISA reader.

[0181] As a result, the fusion peptide treatment group showed a very strong inhibitory activity against the L-DOPA substrate compared to the untreated control group, showing an inhibitory activity of 85.92% at the highest concentration tested of 2 mM (Table 4).

[0182]

[0183] Distinctive fusion peptide treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 L-DOPA inhibition ability (%) 0 6 8.0 4 8 2.3 2 8 6.3 3 8 5.92

[0184] On the other hand, in the case of tripeptide, the 2 mM concentration treatment group showed an inhibitory activity of 64.23%, which showed a difference of about 21% compared to the inhibitory activity of the fusion peptide (Table 5). In the case of biotin, the 2 mM concentration treatment group showed almost no effect with an inhibitory activity of about 2.5%. Meanwhile, in the case of the simple mixture sample, the 2 mM concentration treatment group showed an effect that was 21.35% lower than the inhibitory activity of the fusion peptide of the present invention (Table 6 and Fig. 8).

[0185]

[0186] Tripeptide treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 L-DOPA inhibition ability (%) 0 5 8.7 9 6 3.6 0 6 4.0 2 6 4.23

[0187] Simple mixture treatment concentration (mM) Untreated group 0.75 1.0 1.5 2.0 L-DOPA inhibition ability (%) 0 5 4.3 2 6 2.7 6 4.1 6 4.57

[0188]

[0189] Experimental Example 7. Confirmation of the L-tyrosine inhibitory effect of the fusion peptide.

[0190] The fusion peptide synthesized in Example 1 and the tripeptide as a control group were diluted with sodium phosphate buffer (0.1 M, pH 6.8) so that the final concentration of the entire reaction solution was 0.25 mM to 2.0 mM. 290 μL of sodium phosphate buffer, 100 μL of the prepared sample, 10 mM, and 100 μL of the substrate were added to a 2 mL tube, and pre-incubated at 37 °C for 5 minutes. Afterwards, 10 μL of each 2,500 unit / mL tyrosinase solution was added, and the reaction was performed at 37 °C for 10 minutes. After completion of the reaction, the absorbance was measured at 475 nm, and 0.1 M phosphate buffer (pH 7.0) was used as a blank solution instead of the sample solution.

[0191] As a result, it was observed that the fusion peptide treatment group showed strong inhibitory activity against the tyrosine substrate compared to the untreated control group, and it was confirmed that the inhibitory activity was 63.53% to a maximum of 79.11% (Table 7, Fig. 9).

[0192] Distinctive fusion peptide treatment concentration (mM) Untreated group 0.25 0.5 0.75 1.0 2.0 L-tyrosine inhibition ability (%) 0 6 3.5 3 7 8.2 3 7 8.2 3 7 9.1 1 7 8.93

[0193] On the other hand, in the case of tripeptide, the maximum inhibitory activity of 79.01% was shown in the 2 mM concentration treatment group (Table 8), but considering that the 2 mM concentration of tripeptide showed cytotoxicity in the cell safety test on human keratinocytes conducted previously, it was expected that the fusion peptide of the present invention could be utilized as a tyrosinase activity inhibitor without skin irritation.

[0194] In addition, it was confirmed that the inhibitory ability of the fusion peptide of the present invention was lower than that of the simple mixture treated at all test concentrations (Table 9).

[0195] Tripeptide treatment concentration (mM) Untreated group 0.25 0.5 0.7 5 1.0 2.0 L-tyrosine inhibition ability (%) 0.5 3.0 3.7 0.1 6.7 4.7 6.7 7.3 4.7 9.01

[0196] Simple mixture treatment concentration (mM) Untreated group 0.25 0.5 0.75 1.0 2.0 L-tyrosine inhibition ability (%) 0 6 2.0 5 7 4.1 1 7 4.5 5 7 3.1 7 3.44

[0197]

[0198] Experimental Example 8. Confirmation of the Effect of Fusion Peptide on Whitening Factor mRNA Expression

[0199] 8-1. Melanocyte culture

[0200] B16F10 cells were seeded in 6-well plates at 1X10 4 Cells were seeded at 1 cell / well and cultured in 10% FBS / DMEM medium for 24 hours. Then, each well was treated with the fusion peptide serially diluted in FBS-free DMEM medium. The negative control group was treated with only FBS-free DMEM medium without any sample treatment.

[0201]

[0202] 8-2. Confirmation of changes in whitening factor mRNA expression levels following fusion peptide treatment

[0203] After 24 hours of sample processing, the samples were washed with phosphate buffered saline (PBS) and 1 ml of Trizol reagent was added to extract RNA. 5 x Prime Script RT master mix (Takara, Japan) was added to the extracted RNA and incubated at 37°C for 15 minutes to synthesize cDNA, followed by RT-PCR. For RT-PCR, 2 μl of each primer was added to 1 μl of the synthesized cDNA, 25 μl of EmeraldAmp GT PCR Master Mix (Takara, Japan) and 20 μl of triple-sterilized water were added, and mixed well. Denaturation was performed at 95°C for 30 seconds, and extension was performed at 72°C for 1 minute, for a total of 30 cycles. The annealing temperature was the optimal temperature for each primer. The primer types for evaluating mRNA expression levels were primers for tyrosinase, tyrosinase-related protein-1 (TRP1), dopachrome tautomerase (DCT), and microphthalmia-associated transcript factor (MITF), and the corresponding primer sequences are shown in Table 10 below.

[0204]

[0205] Type Forward sequence (5' → 3') Reverse sequence (5' → 3') TyrosinaseGGCCAGCTTTCAGGCAGAGGT (SEQ ID NO: 1) TGGTGCTTCATGGGCAAAATC (SEQ ID NO: 2) TRP1 GTCATTGCCACAAGGAGGTT (SEQ ID NO: 3) CCCAGTTGCAAAATTCCAGT (SEQ ID NO: 4) DCTTGTGCAAGATTGCCTGTCTC (SEQ ID NO: 5) GTTGCTCTGCGGTTAGGAAG (SEQ ID NO: 6) MITFAGCGTGTATTTTCCCCACAG (SEQ ID NO: 7) CCTTAGCTCGTTGCTGTTCC (SEQ ID NO: 8)

[0206] The higher the ability to suppress the expression of melanin synthesis factors, the better the whitening effect can be evaluated as the more melanin synthesis is suppressed. After treating B16F10 cells with the fusion peptide of the present invention, it was confirmed that the mRNA expression levels of tyrosinase, TRP1, DCT, and MITF, which are factors that promote melanin synthesis, were all reduced (Fig. 10). Specifically, the fusion peptide of the present invention was confirmed to have 50.62% of the tyrosinase mRNA expression level, 56.95% of the TRP1 mRNA expression level, 70.08% of the DCT mRNA expression level, and 39.66% of the MITF mRNA expression level compared to the untreated group (Control) through electrophoresis band quantification (Fig. 11).

[0207]

[0208] Experimental Example 9. Confirmation of the effect of fusion peptides on hair growth promoting factor mRNA expression.

[0209] 9-1. Human mammary gland cell culture

[0210] Human mammary gland cells were seeded in 6-well plates at 1X10 4 Cells were seeded at 1 cell / well and cultured in 10% FBS / DMEM medium for 24 hours. Then, each well was treated with the fusion peptide serially diluted in FBS-free DMEM medium. The negative control group was treated with only FBS-free DMEM medium without any sample treatment.

[0211]

[0212] 9-2. Confirmation of changes in hair growth promoting factor mRNA expression levels following fusion peptide treatment

[0213] After 24 hours of sample processing, the samples were washed with phosphate buffered saline (PBS) and 1 ml of Trizol reagent was added to extract RNA. 5 x Prime Script RT master mix (Takara, Japan) was added to the extracted RNA and incubated at 37°C for 15 minutes to synthesize cDNA, followed by RT-PCR. For RT-PCR, 2 μl of each primer was added to 1 μl of the synthesized cDNA, 25 μl of EmeraldAmp GT PCR Master Mix (Takara, Japan) and 20 μl of triple-sterilized water were added, and mixed well. Denaturation was performed at 95°C for 30 seconds, extension was performed at 72°C for 1 minute, and a total of 30 cycles were performed. The annealing temperature was the optimal temperature for each primer. The primer types used for evaluating mRNA expression levels were DKK-1 (Dickkopf-related protein 1), SRD5A1 (Steroid 5 Alpha-Reductase 1), and Noggin, and the sequences are as shown in Table 11 below.

[0214] Type Forward sequence (5' → 3') Reverse sequence (5' → 3') DKK-1TGATGAGTACTGCGCTAGTC (SEQ ID NO: 9) CTCCTATGCTTGGTACACAC (SEQ ID NO: 10) SRD5A1ACTGCATCCTCCTGGCCATGTTC (SEQ ID NO: 11) GGCATAGCCACACCACTCCATGA (SEQ ID NO: 12) NogginGGCACCCAGCGACAACCT (SEQ ID NO: 13) CAGCCACATCTGTAACTTCCTC (SEQ ID NO: 14)

[0215] As a result of the experiment, it was confirmed that the fusion peptide according to the present invention increases the expression level of Noggin, a factor involved in hair growth promotion, and decreases the expression levels of DKK-1 and SRD5A1, factors involved in hair loss promotion, in human dermal papilla cells (Fig. 12). Specifically, when the fusion peptide was treated at 10 and 100 ppm, the expression level of Noggin was up to 123% compared to the untreated group (Fig. 13), and in the case of DKK-1, the mRNA expression level was reduced by about 74.11% compared to the untreated group (Fig. 14), and in the case of SRD5A1, the mRNA expression level was reduced by 54.64% compared to the untreated group (Fig. 15).

[0216]

[0217] From the above results, it was confirmed that the fusion peptide of the present invention is a fusion peptide effective for skin whitening, anti-oxidation, improvement of skin condition, and hair loss inhibition.

[0218]

[0219] While specific aspects of the present invention have been described in detail above, it will be apparent to those skilled in the art that these specific descriptions merely represent preferred embodiments and are not intended to limit the scope of the present invention. Therefore, the substantial scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A cosmetic composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising a fusion peptide represented by the following chemical formula 1 as an effective ingredient. [Chemical Formula 1] 2. In paragraph 1, A cosmetic composition, wherein the improvement of the skin condition is at least one selected from the group consisting of skin regeneration, skin soothing, skin whitening, wound improvement, and skin aging prevention.

3. In paragraph 1, A cosmetic composition wherein the composition enhances antioxidant activity.

4. In paragraph 1, A cosmetic composition wherein the composition inhibits L-tyrosine or L-dopa oxidation activity.

5. In paragraph 1, A cosmetic composition, wherein the composition reduces the expression of at least one selected from the group consisting of tyrosinase, TRP1, DCT, MITF, DKK1 and SRD5A1.

6. In paragraph 1, A cosmetic composition, wherein the composition increases the expression of Noggin.

7. A pharmaceutical composition for preventing or improving skin disease or hair loss, comprising a fusion peptide represented by the following chemical formula 1 as an active ingredient. [Chemical Formula 1] 8. In paragraph 7, A pharmaceutical composition, wherein the above skin disease is at least one selected from the group consisting of skin pigmentation, skin wounds, and skin scars.

9. In paragraph 7, The composition is a quasi-drug composition that prevents or improves at least one alopecia selected from the group consisting of alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, and telogen effluvium.

10. A pharmaceutical composition for preventing or treating skin disease or hair loss, comprising a fusion peptide represented by the following chemical formula 1 as an active ingredient. [Chemical Formula 1] 11. In paragraph 10, A pharmaceutical composition, wherein the skin disease is at least one selected from the group consisting of skin pigmentation, skin wounds and skin scars.

12. In paragraph 10, A pharmaceutical composition for preventing or treating at least one alopecia selected from the group consisting of alopecia areata, androgenetic alopecia, tinea capitis, hypotrichosis, hereditary hypotrichosis simplex, circumscribed alopecia, alopecia congenitalis, alopecia pubis, alopecia seborrheica, alopecia senilis, alopecia totalis, alopecia universalis, and telogen effluvium.

13. A food composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising a fusion peptide represented by the following chemical formula 1 as an effective ingredient. [Chemical Formula 1] 14. A feed composition for improving skin condition, preventing or improving hair loss, or promoting hair growth, comprising a fusion peptide represented by the following chemical formula 1 as an effective ingredient. [Chemical Formula 1] 15. A method for preventing or treating skin disease or hair loss, comprising a step of administering to a subject a composition containing a fusion peptide represented by the following chemical formula 1 as an active ingredient. [Chemical Formula 1] 16. A method for improving skin condition, comprising a step of applying a composition containing a fusion peptide represented by the following chemical formula 1 as an active ingredient to the skin or mucous membrane of an individual. [Chemical Formula 1] 17. Use of a composition comprising a fusion peptide represented by the following chemical formula 1 as an active ingredient for preventing or treating skin disease or hair loss. [Chemical Formula 1] 18. Use of a composition containing a fusion peptide represented by the following chemical formula 1 as an effective ingredient for improving skin condition. [Chemical Formula 1] 19. Use of a composition comprising a fusion peptide represented by the following chemical formula 1 as an active ingredient for the manufacture of a drug for preventing or treating skin disease or hair loss. [Chemical Formula 1]

Images