Model mouse with microglia-specific VDBP gene knocked out and construction method therefor

The vitamin D binding protein gene in microglia was specifically knocked out in a mouse model using the Cre-loxP recombination system, which solved the functional research difficulties caused by overall knockdown, achieved a knockdown efficiency of more than 80%, and supported more in-depth functional research.

WO2025213459A1PCT designated stage Publication Date: 2025-10-16SHENZHEN INST OF ADVANCED TECH

Patent Information

Application Number
PCT/CN2024/087519
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2024-04-12
Publication Date
2025-10-16

AI Technical Summary

Technical Problem

Existing studies have knocked down the vitamin D binding protein gene as a whole in mice, making it difficult to study its function at specific locations.

Method used

Using the Cre-loxP recombination system, by constructing VDBPloxp/loxp gene mice and crossing them with Cre/ERT2 gene mice, the vitamin D binding protein gene in microglia was specifically knocked out, and the induced expression of the Cre gene was used to achieve specific knockdown of the vitamin D binding protein gene in microglia.

Benefits of technology

The specific knockdown efficiency of the vitamin D binding protein gene in microglia reached over 80%, which is conducive to more detailed research on the function of this molecule in the brain.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024087519_16102025_PF_FP_ABST
    Figure CN2024087519_16102025_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a model mouse with a microglia-specific vitamin D binding protein (VDBP) gene knocked out and a construction method therefor. The construction method comprises the following steps: constructing a VDBPloxp / loxp gene mouse; hybridizing the VDBPloxp / loxp gene mouse with a Cre / ERT2 gene mouse to obtain a Cre+ / --VDBP+ / + gene mouse, wherein the microglia of the Cre / ERT2 gene mouse carry Cre gene; and inducing the expression of the Cre gene in the Cre+ / --VDBP+ / + gene mouse to obtain the model mouse with a microglia-specific VDBP gene knocked out. According to the construction method, a VDBP in the microglia of the model mouse can be specifically knocked out on the basis of Cre-loxP recombination, specific knockdown of the expression of the gene of the VDBP in the microglia is achieved, and the knockdown efficiency reaches 80% or more, facilitating more detailed study of the function of the molecule in the brain.
Need to check novelty before this filing date? Find Prior Art

Description

Model mouse with VDBP gene of microglia origin knocked out and construction method thereof TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a model mouse with VDBP gene of microglia origin knocked out and a construction method thereof. BACKGROUND

[0002] Vitamin D binding protein (VBDP) contains 4581 amino acid residues, has high affinity for vitamin D1, and only 51% of the binding sites are occupied in blood, and the binding ability of various vitamin D1 to VBDP is different. VDBP elevation is mainly seen after estrogen therapy and pregnancy. VDBP reduction is mainly seen in nephrotic syndrome. In the existing research, the vitamin D binding protein gene in mice is knocked down as a whole, which is not conducive to the study of the function of the VDBP in a specific part.

[0003] SUMMARY

[0004] Therefore, the present application provides a model mouse with VDBP gene of microglia origin knocked out and a construction method thereof.

[0005] A construction method of a model mouse with VDBP gene of microglia origin knocked out, comprising the following steps:

[0006] constructing a VDBP loxp / loxp gene mouse;

[0007] crossing the VDBP loxp / loxp gene mouse with a Cre / ERT2 gene mouse to obtain a Cre + / - -VDBP + / + gene mouse, wherein the Cre / ERT2 gene mouse carries a Cre gene in microglia cells;

[0008] inducing expression of the Cre gene in the Cre + / - -VDBP + / + gene mouse to obtain the model mouse with VDBP gene of microglia origin knocked out.

[0009] The construction method based on Cre-loxP recombination can specifically knock out vitamin D binding protein in microglia cells of the mouse model, which is conducive to more detailed study of the function of the molecule in the brain. Through experimental verification, the constructed mouse model realizes specific knockdown of the expression of the vitamin D binding protein gene in microglia cells, and the knockdown efficiency reaches more than 80%.

[0010] In one of the embodiments, the Cre / ERT2 gene mouse is a Cx3cr1tm2.1-cre / ERT2 gene mouse, and the Cre is induced by tamoxifen + / - -VDBP + / + The step of expressing the Cre gene in the gene mouse comprises: injecting tamoxifen into the Cre + / - -VDBP + / + gene mouse.

[0011] In one of the embodiments, the step of constructing the VDBP loxp / loxp gene mouse comprises:

[0012] The Cas9 / sgRNA plasmid and the targeting vector are microinjected into the wild-type mouse zygote, and then transplanted into the pseudo-pregnant female mouse to produce the F0 generation mouse;

[0013] The F0 generation mouse is mated with the wild-type mouse to obtain the heterozygous F1 generation mouse;

[0014] The heterozygous F1 generation mouse is mated to obtain the VDBP loxp / loxp gene mouse.

[0015] In one of the embodiments, before the step of microinjecting the Cas9 / sgRNA plasmid and the targeting vector into the wild-type mouse zygote, the step of constructing the Cas9 / sgRNA plasmid comprises: connecting sgRNA to a vector carrying a Cas9 gene to obtain the Cas9 / sgRNA plasmid, wherein the sgRNA is multiple, and the multiple sgRNA is respectively located in the non-conserved region downstream of the first intron and the fourth intron of the VDBP gene.

[0016] In one of the embodiments, the sgRNA is 16, and 8 sgRNAs are respectively designed in the 5' target site and the 3' target site region, the 8 sgRNAs designed in the 5' target site region correspond to the target sequence as shown in SEQ ID NO. 1-SEQ ID NO. 8, and the 8 sgRNAs designed in the 3' target site region correspond to the target sequence as shown in SEQ ID NO. 9-SEQ ID NO. 16.

[0017] And / or, the vector carrying the Cas9 gene is a pCS-4G vector.

[0018] In one of the embodiments, the sgRNAs are designed in the non-conserved regions downstream of Intron 1 and Intron 4 of the EGE-YMX-011-A gene, respectively, and the targeting vector is EGE-YMX-011-A LSCKO-2G-LR-A-RR, the length of the 5' homologous arm is 1.7 kb, and the length of the 3' homologous arm is 0.9 kb.

[0019] In one of the embodiments, after the step of obtaining the F0 generation mice, the method further comprises a step of genotyping the F0 generation mice: using a first primer combination to perform PCR amplification detection on the genomic DNA of the F0 generation mice to identify whether the F0 generation mice are positive flox mice, the first primer combination comprising primers with base sequences as shown in SEQ ID NO. 17-SEQ ID NO. 20.

[0020] In one of the embodiments, after the step of obtaining the F0 generation mice, the method further comprises a step of genotyping the F0 generation mice: using a first primer combination to perform PCR amplification detection on the genomic DNA of the F0 generation mice to identify whether the F0 generation mice are positive flox mice, the first primer combination comprising primers with base sequences as shown in SEQ ID NO. 17-SEQ ID NO. 20.

[0021] using a first primer combination to perform PCR amplification detection on the genomic DNA of the F0 generation mice to identify whether the F0 generation mice are positive flox mice, the first primer combination comprising primers with base sequences as shown in SEQ ID NO. 17-SEQ ID NO. 20.

[0022] According to the PCR detection result, the F1 generation mice that are flox positive are screened out, and then Southern blot detection and sequencing are performed to verify whether the F1 generation mice are positive F1 generation flox mice.

[0023] In one of the embodiments, the step of breeding the F1 generation heterozygous mice to obtain the VDBP loxp / loxp gene mice comprises:

[0024] The F1 generation heterozygous mice are bred to obtain Fn+1 generation mice, and n is greater than or equal to 1.

[0025] using a second primer combination to perform PCR amplification detection on the genomic DNA of the Fn+1 generation mice, genotyping the Fn+1 generation mice according to the PCR amplification detection result, and screening out homozygous Fn+1 generation mice to obtain the VDBP loxp / loxp gene mice, wherein the second primer combination comprises a first primer pair and a second primer pair, the first primer pair is used to detect whether the 5' end loxp site is integrated in the genome of the mouse to be identified, and the second primer pair is used to detect whether the 3' end loxp site is integrated in the genome of the mouse to be identified.

[0026] In one of the embodiments, the nucleotide sequence of the first primer pair is shown as SEQ ID No. 21-SEQ ID No. 22, and the nucleotide sequence of the second primer pair is shown as SEQ ID No. 23-SEQ ID No. 24.

[0027] In one of the embodiments, the wild-type mouse is C57BL / 6N mouse.

[0028] A model mouse with knocked-out VDBP gene of microglial cell origin is constructed by the construction method described above. BRIEF DESCRIPTION OF DRAWINGS

[0029] Fig. 1 is a schematic diagram of a targeting vector;

[0030] Fig. 2 is a schematic diagram of a Southern blot screening strategy;

[0031] Fig. 3 is a pre-cut pCS vector map;

[0032] Fig. 4 is the activity detection result of sgRNA, wherein: (a) is the activity detection diagram of sgRNA1-sgRNA8, (b) is the activity detection diagram of sgRNA9-sgRNA16;

[0033] Fig. 5 is a targeting vector map;

[0034] Fig. 6 is the results of enzyme digestion identification and sequencing detection;

[0035] Fig. 7 is a schematic diagram of primer design principle for detection of flox mouse genotype;

[0036] Fig. 8 is the detection result of EGE-YMX-011-A-L-GT-F / cKO-5'-DO-F primer pair on F0 generation mice, wherein: (a), (b) are the gel electrophoresis detection diagrams of 5' end allele insertion of E7X11-0010 gene, (c), (d) are the gel electrophoresis detection diagrams of 5' end allele insertion of E7X11-0025, E7X11-0027, E7X11-0033 genes, (e), (f) are the gel electrophoresis detection diagrams of 5' end allele insertion of E7X11-0105 gene;

[0037] Fig. 9 is the detection result of cKO-3'-DO-R / EGE-YMX-011-A-R-GT-R primer pair on F0 generation mice, wherein: (a), (b) are the gel electrophoresis detection diagrams of 3' end allele insertion of E7X11-0010 gene;

[0038] Figure 10 is the detection result of F0 generation mice by cKO-3'-DO-R / EGE-YMX-011-A-R-GT-R primer pair, wherein: (a), (b) are the gel electrophoresis detection figures of E7X11-0025, E7X11-0027, E7X11-0033 gene 3' end allele insertion;

[0039] Figure 11 is the detection result of F1 generation mice by EGE-YMX-011-A-L-GT-F / cKO-5'-DO-F primer pair, wherein: (a), (b) are the gel electrophoresis detection figures of 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012 gene 5' end allele insertion, (c), (d) are the gel electrophoresis detection figures of 1E7X11-0033 gene 5' end allele insertion;

[0040] Figure 12 is the detection result of F1 generation mice by cKO-3'-DO-R / EGE-YMX-011-A-R-GT-R primer pair, wherein: (a), (b), (c) are the gel electrophoresis detection figures of 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012, 1E7X11-0033 gene 3' end allele insertion;

[0041] Figure 13 is the Southern blot detection result, wherein: (a), (b) are the Southern blot detection results of 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012, 1E7X11-0033 mouse gene 3' end and 5' end;

[0042] Figure 14 is the schematic diagram of wild type and mutant alleles;

[0043] Figure 15 is the gel electrophoresis figure of PCR products of EGE-YMX-011-A-5'loxP-F / EGE-YMX-011-A-5'loxP-R primer pair, wherein: (a), (b) are the gel electrophoresis detection figures proving that EGE-YMX-011-A-5'loxP-F / EGE-YMX-011-A-5'loxP-R primer pair can effectively identify 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012, 1E7X11-0033 mouse 5' end allele insertion;

[0044] Figure 16 is a gel electrophoresis diagram of PCR products of the primer pair EGE-YMX-011-A-3'loxP-F / EGE-YMX-011-A-3'loxP-R, wherein: (a), (b) are gel electrophoresis detection diagrams for proving that the primer pair EGE-YMX-011-A-3'loxP-F / EGE-YMX-011-A-3'loxP-R can effectively identify the 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012, 1E7X11-0033 mouse 3' end allele insertions;

[0045] Figure 17 is a DNA marker used for agarose gel electrophoresis;

[0046] Figure 18 is a schematic diagram of the coding and marking rules of the mouse;

[0047] Figure 19 is a detection result diagram of different types of neural cells screened by flow cytometry;

[0048] Figure 20 is a detection result diagram of RT-qPCR verification of VDBP gene expression after extracting RNA from the cells screened by flow cytometry. DETAILED DESCRIPTION

[0049] In order to make the above-mentioned objects, features and advantages of the present application more apparent and easy to understand, the specific embodiments of the present application will be described in detail below with reference to the accompanying drawings. In the following description, a large number of specific details are set forth in order to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without departing from the scope of the present application, so the present application is not limited to the specific embodiments disclosed below.

[0050] An embodiment of the present application provides a method for constructing a model mouse with a knocked-out VDBP gene of microglial cell origin, comprising the following steps S110-S130:

[0051] S110, constructing a VDBP loxp / loxp gene mouse;

[0052] S120, crossing the VDBP loxp / loxp gene mouse with a Cre / ERT2 gene mouse to obtain a Cre + / - -VDBP + / + gene mouse, wherein the Cre / ERT2 gene mouse carries a Cre gene in the microglial cells;

[0053] S130, inducing the Cre + / - -VDBP + / +The Cre gene is expressed in the gene mouse to obtain a model mouse in which the VDBP gene of the microglial cell source is knocked out.

[0054] The construction method based on Cre-loxP recombination can specifically knock out the vitamin D binding protein in the microglial cells of the mouse model, which is conducive to more detailed study of the function of the molecule in the brain. Through experimental verification, the constructed mouse model realizes the specific knockdown of the expression of the vitamin D binding protein gene in the microglial cells, and the knockdown efficiency reaches more than 80%.

[0055] In some embodiments, the Cre / ERT2 gene mouse is a Cx3cr1tm2.1-cre / ERT2 gene mouse, and the Cre + / - -VDBP + / + The step of expressing the Cre gene in the gene mouse includes: injecting the Cre + / - -VDBP + / + The tamoxifen (i.e., tamoxifen) is injected into the gene mouse.

[0056] In some embodiments, the step of constructing the VDBP loxp / loxp The step of constructing the VDBP

[0057] S111, the Cas9 / sgRNA plasmid and the targeting vector are microinjected into the fertilized eggs of the wild type mouse, and then transplanted into the pseudopregnant mother mouse to produce F0 generation mice;

[0058] S112, the F0 generation mice are mated with wild type mice to obtain heterozygous F1 generation mice;

[0059] S113, the heterozygous F1 generation mice are mated to obtain the VDBP loxp / loxp gene mouse.

[0060] The structure of the VDBP gene is analyzed, and Exon2-4 of the VDBP gene can be floxed. The sgRNA is designed in the non-conserved region downstream of Intron1 and Intron4 of the VDBP gene.

[0061] Before the step of microinjecting the Cas9 / sgRNA plasmid and the targeting vector into the fertilized eggs of the wild type mouse, the step of constructing the Cas9 / sgRNA plasmid is further included: connecting the sgRNA to the vector carrying the Cas9 gene to obtain the Cas9 / sgRNA plasmid, the sgRNA has multiple, and the multiple sgRNAs are located in the non-conserved region downstream of the first intron and the fourth intron of the VDBP gene.

[0062] Further, the sgRNA has 16, and 8 sgRNAs are designed in the 5' target site and 3' target site region respectively, the target sequence corresponding to the 8 sgRNAs designed in the 5' target site is shown as SEQ ID NO. 1-SEQ ID NO. 8, and the target sequence corresponding to the 8 sgRNAs designed in the 3' target site is shown as SEQ ID NO. 9-SEQ ID NO. 16.

[0063] Specifically, the target sequence corresponding to the 16 sgRNAs is shown in Table 1 below:

[0064] Table 1 Target sequence corresponding to 16 sgRNAs

[0065] In a specific example, the vector carrying the Cas9 gene is pCS-4G vector.

[0066] In the formula, the sgRNA is designed in the non-conserved region downstream of Intron1 and Intron4 of EGE-YMX-011-A gene, and the targeting vector is EGE-YMX-011-A LSCKO-2G-LR-A-RR, the length of the 5' homologous arm is 1.7 kb, and the length of the 3' homologous arm is 0.9 kb.

[0067] In the formula, the step of obtaining the F0 generation mouse further includes the step of genotyping the obtained F0 generation mouse: using a first identification primer composition to perform PCR amplification detection on the genomic DNA of the F0 generation mouse to identify whether the F0 generation mouse is a positive flox mouse, and the first identification primer composition includes primers with base sequences shown as SEQ ID NO. 17-SEQ ID NO. 20.

[0068] Specifically, the first identification primer composition is shown in Table 2 below:

[0069] Table 2 First identification primer composition

[0070] In the formula, the step of obtaining the F1 generation mouse further includes the steps S1121-S1122 of genotyping the F1 generation mouse:

[0071] S1121, using a first identification primer composition to perform PCR amplification detection on the genomic DNA of the F1 generation mouse to obtain a PCR detection result.

[0072] The description of the first identification primer composition is detailed above and will not be repeated here.

[0073] S1122, screening the hybrid F1 generation mice positive for flox according to the PCR detection result, and then performing Southern blot detection and sequencing to verify whether the hybrid F1 generation mice are positive F1 generation flox mice.

[0074] The hybrid F1 generation mice are mated to obtain VDBP loxp / loxp The steps of the gene mice include S1131-S1132:

[0075] S1131, the hybrid F1 generation mice are mated to obtain Fn+1 generation mice, and n is greater than or equal to 1.

[0076] S1132, the genomic DNA of the Fn+1 generation mice is subjected to PCR amplification detection using a second identification primer composition, the genotypes of the Fn+1 generation mice are identified according to the PCR amplification detection result, and homozygous Fn+1 generation mice are screened to obtain VDBP loxp / loxp The gene mice, wherein the second identification primer composition includes a first primer pair and a second primer pair, the first primer pair is used to detect whether the 5' end loxp site is integrated in the genome of the to-be-identified mice, and the second primer pair is used to detect whether the 3' end loxp site is integrated in the genome of the to-be-identified mice.

[0077] The nucleotide sequence of the first primer pair is shown in SEQ ID No. 21-SEQ ID No. 22, and the nucleotide sequence of the second primer pair is shown in SEQ ID No. 23-SEQ ID No. 24.

[0078] Specifically, the sequence shown in SEQ ID No. 21 is CAGCAGAGCCTGGAGCAGATTACAG, the sequence shown in SEQ ID No. 22 is CAACATGACCTGTGGTAAAGGCACT, the sequence shown in SEQ ID No. 23 is TGGCATCATGGAGATGGTGGAAACA, and the sequence shown in SEQ ID No. 24 is CTGAAACTTGCAGCAATCCCCTGC. The above nucleic acid composition is used to detect whether the allele site is inserted in the genome of the to-be-identified mice, which can be used for genotype identification of mice by genetic engineering means, and is fast and accurate.

[0079] The design strategy of the first primer pair and the second primer pair is shown in Figure 14. In Figure 14, the arrows represent the position and direction of primer design. As can be seen from Figure 14, the first primer pair is named EGE-YMX-011-A-5'loxP-F, EGE-YMX-011-A-5'loxP-R. The first primer pair is used to confirm whether the 5' end loxP site has been integrated into the genome, and the two primers are designed on the two sides of a loxP site, respectively; for hybrid animals, two products will be obtained when PCR is performed using this pair of primers: the PCR product of the wild-type allele, and the PCR product of the mutant allele. Therefore, using this pair of primers can distinguish the genotype of the animal: homozygote / heterozygote / wild type. The second primer pair is named EGE-YMX-011-A-3'loxP-F, EGE-YMX-011-A-3'loxP-R. The second primer pair is used to confirm whether the 3' end loxP site has been integrated into the genome, and the two primers are designed on the two sides of a loxP site, respectively; for hybrid animals, two products will be obtained when PCR is performed using this pair of primers: the PCR product of the wild-type allele, and the PCR product of the mutant allele. Therefore, using this pair of primers can distinguish the genotype of the animal: homozygote / heterozygote / wild type.

[0080] In one embodiment, the wild-type mouse is a C57BL / 6N mouse. It should be noted that the wild-type mouse is not limited to a C57BL / 6N mouse, but can also be other mouse models.

[0081] Cre-loxP recombination is a specific site recombination enzyme technology, which can perform deletion, insertion, translocation and inversion at specific sites of DNA, and can modify the DNA in cells for specific cell types or using specific external stimuli. It is suitable for both eukaryotic and prokaryotic systems. In existing studies, the vitamin D binding protein gene in mice has been knocked down as a whole, and in this study, the vitamin D binding protein (VDBP) in mouse microglial cells is specifically knocked out using the Cre-loxP recombination enzyme system, which is conducive to more detailed research on the function of the molecule in the brain.

[0082] Mouse microglial cells, neurons, astrocytes, oligodendrocytes, etc. have been screened by flow cytometry, and then RT-qPCR experiments have been performed to verify the expression of the vitamin D binding protein gene. The results prove that the mouse model constructed in this application achieves specific knockdown of the expression of the vitamin D binding protein gene in microglial cells, and the knockdown efficiency reaches more than 80%.

[0083] The following are specific embodiments.

[0084] The drugs and instruments used in the examples are all selected according to the conventional selection in the art, unless otherwise specified. The experimental methods not specified in the examples are usually carried out according to the conventional conditions, such as the conditions described in the literature, books or the methods recommended by the kit manufacturers.

[0085] Design of EGE-YMX-011-A flox model mice

[0086] 1. Targeting strategy

[0087] EGE-YMX-011-A gene is located on the reverse strand of chromosome 5, with a full length of 40.4 kb. Gene ID: 14473. Analysis of the structure of EGE-YMX-011-A gene showed that Exon2-4 of EGE-YMX-011-A gene could be floxed. The sgRNA was designed in the non-conserved region downstream of Intron1 and Intron4 of EGE-YMX-011-A gene. The homologous arms at the 5' end and the 3' end were 1.7 kb and 0.9 kb, respectively. The EGE system based on CRISPR / Cas9 was used to prepare the model mice. The schematic diagram of the targeting vector is shown in Figure 1.

[0088] 2. Southern blot screening strategy

[0089] In order to screen the gene targeting mice with correct recombination, PCR and Southern blot methods were used for verification. The F1 generation positive mice were verified by using 3' Probe and LR Probe. The schematic diagram of the Southern blot screening strategy is shown in Figure 2.

[0090] The specific design is shown in Table 3:

[0091] Table 3

[0092] NcoI and AseI were used as the Southern blot enzyme digestion sites. 3' Probe was used to detect whether correct recombination occurred. If correct recombination occurred, wild type and mutant bands would appear. LR Probe was used to detect whether random insertion occurred. If there was no random insertion, wild type and mutant bands would appear.

[0093] Example 2 Preparation of EGE-YMX-011-A flox model mice

[0094] 1. CRISPR / sgRNA design and construction

[0095] (1) Design of sgRNA

[0096] Based on the design principle of sgRNA, 8 sgRNAs were designed in the 5' target site and 3' target site region, respectively, and the corresponding target sequences are shown in Table 1, see above, which will not be repeated here.

[0097] (2) Construction of Cas9 / sgRNA plasmid

[0098] According to the designed sgRNA sequence, oligos were synthesized and connected into pCS-4G vector by Gibson method. The ligation product was transformed and sent for sequencing verification after transformation.

[0099] 2. sgRNA activity detection

[0100] The existing general CRISPR / Cas9 activity detection method-UCATM method was used. It has the advantages of no species limitation, high throughput, wide adaptability, high sensitivity and simplicity. EGE-YMX-011-A-sgRNA1 and EGE-YMX-011-A-sgRNA9 were selected for the next experiment. The activity detection results of sgRNA are shown in Figure 4.

[0101] 3. Construction of targeting vector

[0102] According to the targeting strategy of Example 1, primers were designed to construct the targeting vector, and enzyme digestion and sequencing were used to confirm the completion of the construction of the targeting vector. The targeting vector map is shown in Figure 5. The enzyme digestion and sequencing detection results are shown in Figure 6.

[0103] 4. Zygote microinjection

[0104] Cas9 / sgRNA and targeting vector were microinjected into mouse zygotes, and the birth of F0 generation mice after injection is shown in Table 4.

[0105] Table 4

[0106] 5. Genotype identification of F0 generation flox mice

[0107] The present application uses the method of injecting zygotes with Cas9 / sgRNA to prepare flox mice. Since the zygote injection method may obtain F0 mice that are chimeras / heterozygotes / homozygotes, the genotype of F0 mice obtained by genotype identification of F0 mice tail is only for reference and cannot represent that it is a heritable genetic mutation type. The heritable genotype needs to be determined after F1 generation mice genotype identification.

[0108] Principle of primer design for genotyping of F0 mice is shown in Figure 7 (to detect whether correct recombination has occurred). Specific information of primers is shown in Table 2 above, which will not be repeated here. PCR reaction conditions (Touchdown) are shown in Table 5 below, and the enzyme used in PCR reaction is KOD-FX. The results of identification are shown in Figures 8-10. Figure 8 is the result of detection of F0 mice by primer pair EGE-YMX-011-A-L-GT-F / cKO-5'-DO-F; Figure 9 is the result of detection of F0 mice by primer pair cKO-3'-DO-R / EGE-YMX-011-A-R-GT-R; and Figure 10 is the result of detection of F0 mice by primer pair cKO-3'-DO-R / EGE-YMX-011-A-R-GT-R.

[0109] As can be seen from Figures 8-10, through PCR amplification and product sequencing, it is shown that E7X11-0027 and E7X11-0033 are F0 positive flox mice. E7X3-0010, E7X11-0025 and E7X11-0105 are F0 suspected PCR positive flox mice.

[0110] Table 5

[0111] 6. Genotyping and Southern blot identification of F1 mice

[0112] Some of the above F0 positive mice are mated with wild type mice to obtain F1 generation. The mating results are shown in Table 6 below. The principle of primer design for genotyping of F1 mice is the same as that for genotyping of F0 mice, and the results of identification are shown in Figures 11 and 12. Figure 11 is the result of detection of F1 mice by primer pair EGE-YMX-011-A-L-GT-F / cKO-5'-DO-F; and Figure 12 is the result of detection of F1 mice by primer pair cKO-3'-DO-R / EGE-YMX-011-A-R-GT-R.

[0113] As can be seen from Figures 11 and 12, through PCR identification, it is shown that 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012 and 1E7X11-0033 are PCR positive F1 flox mice.

[0114] Table 6

[0115] 7. Southern blot detection of F1 PCR positive mice

[0116] Southern blot screening strategy was shown in Example 1. The results of Southern blot were shown in Figure 13. As shown in Figure 13, the results indicated that 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012 and 1E7X11-0033 were all correct recombination without random insertion.

[0117] In summary, 1E7X11-0001, 1E7X11-0007, 1E7X11-0009, 1E7X11-0012 and 1E7X11-0033 were all PCR positive, Southern blot correct recombination without random insertion, sequencing correct, and were positive F1 flox mice.

[0118] Example 3

[0119] (I) The mating scheme of positive Fn+1 flox homozygous mice:

[0120] The F1 heterozygous mice (+ / flox) were self-crossed, and in the offspring, 25% of the homozygous cKO mice (flox / flox), 50% of the heterozygous cKO mice (+ / flox), and 25% of the wild-type mice.

[0121] (II) Genotype verification of F1 and Fn+1 mice:

[0122] The reagents used below were shown in Table 7, unless otherwise specified.

[0123] Table 7: List of reagents

[0124] 1. The information of experimental animals was shown in Table 8.

[0125] Table 8: Information of experimental animals

[0126] Explanation:

[0127] 1) Mark: The number of the mark was explained in “4. Coding and marking rules of mice”;

[0128] 2) fl: the abbreviation of flanked by loxP, indicating mutant alleles; +: wild-type alleles. fl / +: heterozygous genotype.

[0129] 2. Genotype identification information of transported animals

[0130] The tissue sample for genotyping was derived from the tail of the transport animals, at least 2 times of tail tissue sampling for each transport animal, genomic DNA extraction, and genotyping. PCR primers were designed to identify wild-type and mutant alleles, which were used to distinguish the specific genotype of the animals: homozygous / heterozygous / wild-type

[0131] 2.1 Primer design strategy

[0132] The design strategy of the first primer pair and the second primer pair is shown in Figure 14. In Figure 14, the arrow represents the position and direction of primer design.

[0133] As can be seen from Figure 14, the first primer pair is named EGE-YMX-011-A-5'loxP-F, EGE-YMX-011-A-5'loxP-R. The first primer pair is used to confirm whether the 5' end loxP site has been integrated into the genome, and the two primers are designed on both sides of a loxP site; for heterozygous animals, two products will be obtained when this pair of primers is used for PCR: PCR product of wild-type allele, PCR product of mutant allele. Therefore, using this pair of primers can distinguish the genotype of the animals: homozygous / heterozygous / wild-type. The second primer pair is named EGE-YMX-011-A-3'loxP-F, EGE-YMX-011-A-3'loxP-R. The second primer pair is used to confirm whether the 3' end loxP site has been integrated into the genome, and the two primers are designed on both sides of a loxP site; for heterozygous animals, two products will be obtained when this pair of primers is used for PCR: PCR product of wild-type allele, PCR product of mutant allele. Therefore, using this pair of primers can distinguish the genotype of the animals: homozygous / heterozygous / wild-type.

[0134] 2.2 Primer design details are shown in Table 9, in which WT: wild-type allele; Mut: mutant allele.

[0135] Table 9 Primer and product information

[0136] 3、DNA Marker

[0137] The DNA marker used for agarose gel electrophoresis is shown in Figure 17.

[0138] 4、Size mouse coding and marking rules

[0139] The coding and marking rules of the size mouse are shown in Figure 18.

[0140] 4.1 The marking rules are explained as follows

[0141] 4.1.1 The pups are about 7 days old, and the end of different toes are cut off to determine the number of the mouse. This method does not need to be anesthetized, only the end of the toe is cut off to prevent the nail from growing back.

[0142] 4.1.2 Symbolic explanation: the forelimbs are represented by the letter F (front leg), and the hind limbs are represented by the letter R (rear leg). The first mouse is marked as R1; the 11th mouse is marked as R10R1; the 51st mouse is marked as F4R1.

[0143] 4.1.3 Using this method combined with the ID of the mouse, all tail-cut mice can be marked, including F1 generation mice, F2 generation mice, etc.

[0144] 4.1.4 If the number exceeds 100, the right ear will be cut horizontally by 1 / 3. When the mouse ID from 101 to 200 is compiled, the right ear is cut according to the marking rule at the same time, so the 101st mouse is marked as RR1; the 111th mouse is marked as RR10R1; the 151st mouse is marked as RF4R1.

[0145] 4.1.5 If the number exceeds 200, the left ear will be cut horizontally by 1 / 3. When the mouse ID from 201 to 300 is compiled, the left ear is cut according to the marking rule at the same time, so the 201st mouse is marked as LR1; the 211th mouse is marked as LR10R1; the 251st mouse is marked as LF4R1.

[0146] 4.1.6 If the number exceeds 300, the left and right ears will be cut horizontally by 1 / 3 at the same time. When the mouse ID from 301 to 400 is compiled, the left and right ears are cut according to the marking rule at the same time, so the 301st mouse is marked as RLR1; the 311th mouse is marked as RLR10R1; the 351st mouse is marked as RLF4R1.

[0147] 4.1.7 If the number exceeds 400, the right ear will be cut horizontally by 1 / 3. When the mouse ID from 401 to 600 is compiled, the right ear is cut according to the marking rule at the same time, so the 401st mouse is marked as R1; the 411th mouse is marked as R10R1; the 451st mouse is marked as R4R1; the 501st mouse is marked as R1; the 511th mouse is marked as R10R1; the 551st mouse is marked as F4R1.

[0148] 4.1.8 If the number exceeds 600, when the mouse ID of 601-800 is prepared in combination with the simultaneous cut left ear notch, follow the simultaneous cut left ear notch rule of this marking, so the 601st mouse is marked as L notch one R1; the 611st mouse is marked as L notch one R10R1; the 651st mouse is marked as L notch one F4R1; the 701st mouse is marked as L notch two R1; the 711st mouse is marked as L notch two R10R1; the 751st mouse is marked as L notch two F4R1.

[0149] 4.1.9 If the number exceeds 800, when the mouse ID of 801-1000 is prepared in combination with the simultaneous cut right left ear notch, follow the simultaneous cut right left ear notch rule of this marking, so the 801st mouse is marked as RL notch one R1; the 811st mouse is marked as RL notch one R10R1; the 851st mouse is marked as RL notch one F4R1; the 901st mouse is marked as RL notch two R1; the 911st mouse is marked as RL notch two R10R1; the 951st mouse is marked as RL notch two F4R1.

[0150] 5. Extraction of Genomic DNA from Mouse Tail

[0151] 5.1 Preparation of Mouse Tail Lysis Solution

[0152] The composition and concentration of the mouse tail lysis solution are shown in Table 10, and an example of the preparation system of the mouse tail lysis solution is shown in Table 11.

[0153] Table 10: Concentration of Mouse Tail Lysis Solution

[0154] Table 11: Preparation System of Mouse Tail Lysis Solution (Total Volume: 10 mL)

[0155] 5.2 Extraction Steps of Genomic DNA from Mouse Tail

[0156] 5.2.1 The tail can be cut off when the mouse is about 7 days old, and the length of the cut tail is 0.5 cm, which is immediately placed in a 1.5 mL centrifuge tube placed on an ice bag.

[0157] 5.2.2 It is recommended to immediately start lysis and extraction of genomic DNA from the mouse tail after cutting the tail. If the mouse tail cannot be lysed on the same day, the cut tail needs to be placed in a -80°C refrigerator. If transportation is required, the low temperature state needs to be maintained during transportation, and dry ice or ice blocks are recommended.

[0158]

[0159] 5.2.3 Add 500 μL of prepared lysis solution (containing 10 mg / mL of protease K 5 μL) to each tube.

[0160] 5.2.4 Place in a hybridization oven at 55°C and rotate overnight. ​

[0161] 5.2.5 Take out the centrifuge tube from the hybridization oven, let it stand at room temperature for 10-15 min to let the sample temperature drop to room temperature, and invert the centrifuge tube to mix well.

[0162] 5.2.6 Centrifuge at 13000 rpm at room temperature for 15 min.

[0163] 5.2.7 Take 400 μL of the supernatant into another new centrifuge tube.

[0164] 5.2.8 Add an equal volume of isopropanol, immediately gently flip up and down to mix well, at this time a white flocculent precipitate will appear, centrifuge at 12000 rpm at room temperature for 10 min, discard the supernatant.

[0165] 5.2.9 Add 700 μL of ice-cold 75% ethanol to the centrifuge tube, mix well by gently flipping up and down.

[0166] 5.2.10 Centrifuge at 12000 rpm at room temperature for 5 min, discard the supernatant, and after centrifugation, aspirate the residual liquid.

[0167] 5.2.11 Dry in the clean bench for about 3-5 min.

[0168] 5.2.12 Resuspend with 50-100 μL of Gibco pure water (determine the amount of water according to the amount of DNA), dissolve at 55°C for 2 h, and mix well by inverting during the dissolution process to ensure complete dissolution of the DNA.

[0169] 5.2.13 Detect the concentration of the DNA, and take 100-200 ng of the DNA as the template for PCR.

[0170] 6. PCR reaction

[0171] The genomic DNA extracted in the "5.2 Genomic DNA extraction steps" was subjected to PCR reaction using the primers shown in Table 9. The PCR reaction system is shown in Table 12. The PCR reaction program is shown in Table 13.

[0172] Table 12 PCR reaction system of 2xTaq Plus Master Mix (Dye Plus) DNA polymerase (total volume: 20 μL).

[0173] Table 13: 2xTaq Plus Master Mix (Dye Plus) DNA polymerase PCR reaction program

[0174] 7. Perform agarose gel electrophoresis on the PCR product.

[0175] The results are shown in Figures 15 and 16. Figure 15 is a gel electrophoresis diagram of PCR products of primer pair EGE-YMX-011-A-5'loxP-F / EGE-YMX-011-A-5'loxP-R; Figure 16 is a gel electrophoresis diagram of PCR products of primer pair EGE-YMX-011-A-3'loxP-F / EGE-YMX-011-A-3'loxP-R; in Figures 15 and 16, 2% agarose gel was used to separate DNA by electrophoresis, PC: the genotype of the positive control sample is fl / +, WT: the genotype of the wild type control sample is + / +, H20: blank control.

[0176] 8. Reference standard for judging the genotype of animals, as shown in Table 14.

[0177] In Table 14, N: no PCR product of expected length is detected by gel electrophoresis; Y: PCR product of expected length is detected by gel electrophoresis; fl / fl: homozygous genotype; fl / +: heterozygous genotype; + / +: wild type.

[0178] Table 14: Genotype of animals determined according to expected gel electrophoresis results of 2 groups of PCR products

[0179] It is identified that the homozygous Fn+1 generation mice are VDBP loxp / loxp knockout mice.

[0180] Example 4 Construction of microglia-derived VDBP knockout mice

[0181] The B6.129P2(Cg)-Cx3cr1tm2.1(cre / ERT2)Litt / WganJ gene mice are crossed with the VDBP loxp / loxp knockout mice constructed in the above example to obtain Cre + / - -VDBP + / + knockout mice.

[0182] The Cre + / - -VDBP + / + knockout mice are injected intraperitoneally with 75 mg / kg tamoxifen for 5 consecutive days, and then normally fed after injection to obtain microglia-derived VDBP knockout mice.

[0183] Example 5 Detection of vitamin D binding protein gene knockout of the constructed model mice

[0184] Flow cytometry screening and gene knockout identification:

[0185] The brain tissue of the microglia-derived VDBP knockout mouse constructed in Example 4 was made into a single cell suspension, and the microglial cells were screened using a BD FACSLyric flow sorting system. First, the single cell population was selected by gating to remove clumped cells, and the viable cell population was obtained by DAPI signal, and the microglial cells and macrophages were distinguished and sorted by CD11b hi and CD45 low antibody signals. After the RNA of the microglial cells was quickly extracted and reverse transcribed into cDNA, a fluorescent DNA binding dye was used, and the fluorescence intensity was proportional to the fluorescence signal intensity of the PCR product molecules. By plotting the fluorescence intensity and cycle number, the qPCR instrument generated an amplification curve, which represented the accumulation of products during the entire PCR process. Through this process, quantification was achieved. The experimental results are shown in Figures 19-20. Figure 19 is a detection result graph of different types of neural cells screened by flow cytometry; and Figure 20 is a detection result graph of RT-qPCR verification of VDBP gene expression after RNA extraction from the cells screened by flow cytometry. As can be seen from Figures 19 and 20, the mouse microglial cells, neurons, astrocytes, oligodendrocytes, etc. were screened by flow cytometry, and then the RT-qPCR experiment was performed to verify the expression of the vitamin D binding protein gene. The results prove that the mouse achieves specific knockdown of the expression of the vitamin D binding protein gene in microglial cells, and the knockdown efficiency reaches more than 80%.

[0186] The technical features of the above-described embodiments can be combined in any manner. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described, but as long as the combinations of the technical features do not contradict, they should be considered within the scope of the present disclosure.

[0187] The above-described embodiments only express several embodiments of the present application, and the description is more specific and detailed, but it should not be understood as limiting the scope of the patent. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of the present application. Therefore, the scope of protection of the present application should be subject to the appended claims.

Claims

1. A method for constructing a model mouse with a knockout of the microglia-derived VDBP gene, characterized in that: The steps include: Building VDBP loxp / loxp Genetic mice; The VDBP loxp / loxp Cre / ERT2 gene mice were hybridized with Cre / ERT2 gene mice to obtain Cre + / - -VDBP + / + Genetic mice, wherein the microglial cells of the Cre / ERT2 gene mice carry the Cre gene; Inducing the Cre + / - -VDBP + / + The Cre gene is expressed in the gene mouse to obtain the model mouse with the microglia-derived VDBP gene knocked out.

2. The construction method according to claim 1, characterized in that The Cre / ERT2 gene mouse is a Cx3cr1tm2.1-cre / ERT2 gene mouse, which induces the Cre + / - -VDBP + / + The steps of expressing Cre gene in gene mice include: + / - -VDBP + / + Genetic mice were injected with tamoxifen.

3. The construction method according to any one of claims 1 to 2, characterized in that Constructing the VDBP loxp / loxp The steps for creating genetically modified mice include: The Cas9 / sgRNA plasmid and targeting vector were microinjected into wild-type mouse fertilized eggs, which were then transplanted into pseudopregnant female mice to produce F0 generation mice. The F0 generation mice are mated with wild-type mice to obtain heterozygous F1 generation mice; The heterozygous F1 generation mice are mated and bred to obtain the VDBP loxp / loxp Genetic mouse.

4. The construction method according to claim 3, characterized in that Before the step of microinjecting the Cas9 / sgRNA plasmid and the targeting vector into wild-type mouse fertilized eggs, the method further includes the step of constructing the Cas9 / sgRNA plasmid: connecting the sgRNA to a vector carrying the Cas9 gene to obtain the Cas9 / sgRNA plasmid, wherein the sgRNAs are multiple, and the multiple sgRNAs are respectively located in the non-conserved regions downstream of the first intron and the fourth intron of the VDBP gene.

5. The construction method according to claim 4, characterized in that There are 16 sgRNAs, 8 of which are designed in the 5' target site and 8 in the 3' target site regions. The targeting sequences corresponding to the 8 sgRNAs designed in the 5' target site region are shown in SEQ ID NO.1 to SEQ ID NO.8, and the targeting sequences corresponding to the 8 sgRNAs designed in the 3' target site region are shown in SEQ ID NO.9 to SEQ ID NO.

16. And / or, the vector carrying the Cas9 gene is a pCS-4G vector.

6. The construction method according to claim 4, characterized in that The sgRNAs were designed in the non-conserved regions downstream of Intron1 and Intron4 of the EGE-YMX-011-A gene, respectively. The targeting vector was EGE-YMX-011-A LSCKO-2G-LR-A-RR, with a 5' homology arm of 1.7 kb and a 3' homology arm of 0.9 kb.

7. The construction method according to claim 3, characterized in that: After the step of obtaining the F0 generation mice, the method further includes the step of performing genotyping identification on the obtained F0 generation mice: using a first identification primer combination to perform PCR amplification detection on the genomic DNA of the F0 generation mice to identify whether the F0 generation mice are positive flox mice, wherein the first identification primer combination includes primers with base sequences as shown in SEQ ID NO.17-SEQ ID NO.

20.

8. The construction method according to claim 3, characterized in that: After the step of obtaining the heterozygous F1 generation mice, the method further includes the step of performing genotyping on the heterozygous F1 generation mice: Performing PCR amplification detection on the genomic DNA of the heterozygous F1 generation mouse using a first identification primer combination to obtain a PCR detection result, wherein the first identification primer combination includes primers with base sequences shown as SEQ ID NO.17 to SEQ ID NO.20; The heterozygous F1 generation mice that are flox-positive are screened out according to the PCR test results, and then Southern blot detection and sequencing are performed to verify whether the heterozygous F1 generation mice are positive F1 generation flox mice.

9. The construction method according to claim 3, characterized in that: The heterozygous F1 generation mice are mated and bred to obtain the VDBP loxp / loxp The steps for creating genetically modified mice include: mating and breeding the heterozygous F1 generation mice to obtain Fn+1 generation mice, where n is greater than or equal to 1; The second identification primer combination is used to perform PCR amplification detection on the genomic DNA of the Fn+1 generation mice, and the genotype of the Fn+1 generation mice is identified according to the PCR amplification detection results, and the homozygous Fn+1 generation mice are screened out to obtain the VDBP loxp / loxp Genetic mouse, wherein the second identification primer combination includes a first primer pair and a second primer pair, the first primer pair is used to detect whether a 5' end loxP site is integrated into the genome of the mouse to be identified, and the second primer pair is used to detect whether a 3' end loxP site is integrated into the genome of the mouse to be identified.

10. The construction method according to claim 9, characterized in that: The nucleotide sequence of the first primer pair is shown as SEQ ID No.21-SEQ ID No.22, and the nucleotide sequence of the second primer pair is shown as SEQ ID No.23-SEQ ID No.

24.

11. The construction method according to any one of claims 4 to 9, characterized in that: The wild-type mice are C57BL / 6N mice.

12. A model mouse with microglial cell-derived VDBP gene knockout, characterized in that: The method is constructed according to any one of claims 1 to 11.

Citation Information

Patent Citations

  • Application of interferon regulatory factor 5 and inhibitor thereof to cerebral stroke diseases

    CN106474491A

  • Construction method of VDR gene conditionality knockout floxed mouse model

    CN110408653A

  • Methods of reducing symptoms of opioid withdrawal syndrome and risk of relapse to drug seeking

    US20220233481A1

Cited By

  • Establishment method of mouse model with hereditary neurodevelopment disorder

    CN121718576A