Oligonucleotide compounds and methods for treating down syndrome and related pathologies
Oligonucleotide compounds targeting the SIM2 gene normalize its expression, addressing the need for therapeutic targets in Down syndrome by reducing SIM2 overexpression and improving associated phenotypes.
Patent Information
- Application Number
- PCT/US2025/027103
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-04-30
- Filing Date
- 2025-04-30
- Publication Date
- 2025-11-06
AI Technical Summary
There is a need for therapeutic targets to treat Down syndrome and related pathologies, particularly through the use of SIM2 antisense oligonucleotides to address SIM2 overexpression, which contributes to the complex phenotypes associated with the disorder.
Development of oligonucleotide compounds, including modified antisense oligonucleotides, designed to target the Single-minded homolog 2 (SIM2) gene transcript, with specific sequences and modifications to normalize SIM2 expression, administered in a pharmaceutical composition for treating Down syndrome and related conditions.
The oligonucleotide compounds effectively reduce SIM2 overexpression, leading to partial normalization of phenotypic features in Down syndrome models, including craniofacial abnormalities and metabolic disorders, demonstrating therapeutic potential for treating Down syndrome and related pathologies.
Smart Images

Figure IMGF000018_0001 
Figure IMGF000019_0001 
Figure 00000031_0000
Abstract
Description
[0001] OLIGONUCLEOTIDE COMPOUNDS AND METHODS FOR TREATING DOWN SYNDROME AND RELATED PATHOLOGIES
[0002] Cross-Reference to Related Applications
[0003] This international patent application claims benefit of priority under 35 U.S.C. §119(e) of provisional patent application U.S. Serial No. 63 / 640,805, filed April 30, 2024, the entirety of which is hereby incorporated in its entirety.
[0004] BACKGROUND OF THE INVENTION
[0005] Field of the Invention
[0006] The present invention relates generally to the fields of genetic medicine and antisense oligonucleotides. More specifically, the present invention relates to antisense oligonucleotides as therapeutics to prevent or treat Down syndrome and pathologies related thereto.
[0007] Description of the Related Art
[0008] Down Syndrome (DS) is the most common type of genetic disorder affecting approximately 1 / 750 newborns in the United States each year and is caused by an extra copy of all or part of the long arm of human chromosome 21 (HSA21 ). The DS phenotype is highly complex and variable including common phenotypes such as characteristic facial features, intellectual disability, skeletal muscle weakness and variable phenotypes including heart defects, increased incidence of Alzheimer’s disease, type 2 diabetes, and obesity (1 ). Singleminded-2s (Sim2) is a member of the bHLH / PAS family of transcription factors and is one of two mammalian orthologs of the Drosophila single-minded (s / m) gene, which is considered a “master regulator of neurogenesis” and midline gene expression (2,3). Human SIM2 was initially identified by positional cloning around the Down syndrome critical region (DSCR) of chromosome 21 and is amplified in DS patients and mouse models (2,3). The murine Sim2 maps to mouse chromosome 16 in a region homologous with HSA21 (4). SIM2 is expressed early during development in numerous tissues including those affected in DS patients including brain, palate, vertebrae, heart, skeletal muscle, kidney and breast. In the brain, S / M2-expressing brain regions correspond to the altered structures in DS patients (2 3). Transgenic mice overexpressing Sim2 demonstrate abnormal anxiety-related / reduced exploratory behavior and sensitivity to pain, similar with the phenotypes of the partial trisomy 16 mice models of DS (4).
[0009] Moreover, recent studies found human SIM2 variants associated with developmental disorders including intellectual disabilities and craniofacial abnormalities (5,6). These findings confirm that SIM2 triplication contributes to the spectrum of pathogenesis observed in DS patients.
[0010] Thus, there is a need in the art to identify HSA21 genes to provide therapeutic targets to improve Down syndrome and its related pathologies. Specifically, there is a need for SIM2 antisense oligonucleotides as therapeutics and methods of treatment against Down syndrome and other associated pathologies. The present invention fulfills this long-standing need in the art.
[0011] SUMMARY OF THE INVENTION
[0012] The present invention is directed to an oligonucleotide compound. The compound is a chain of nucleobases with a sequence designed to target a Single-minded homolog 2 (SIM2) gene transcript. The present invention is directed to a related oligonucleotide compound further comprising at least one modification in the chain of nucleobases.
[0013] The present invention is further directed to a pharmaceutical composition comprising the oligonucleotide compound described herein and a pharmaceutically acceptable carrier or diluent.
[0014] The present invention is directed further to a method for treating a disorder or a disease associated with SIM2 overexpression in a subject in need thereof. In the method an amount of the pharmaceutical composition described herein effective to normalize the overexpression of SIM2 is administered at least once to the subject, thereby treating the disorder or the disease.
[0015] The present invention is directed further still to a method for normalizing expression of a Single-minded homolog 2 (SIM2) gene. In this method, an RNA transcript of the SIM2 gene is contacted with at least one of the oligonucleotide compounds described herein.
[0016] The present invention is directed further still to a modified antisense oligonucleotide (ASO). The modified antisense oligonucleotide is a chain of nucleosides with a modified internucleoside linkage between adjacent nucleosides. The chain has at least one 5’ flanking nucleoside and at least one 3’ flanking nucleoside each with a 2’ modification to its sugar. The chain is modified with a plurality of 5-methylcytosines.
[0017] The present invention is directed further still to a pharmaceutical composition comprising the modified antisense oligonucleotide compound described herein and a pharmaceutically acceptable carrier or diluent.
[0018] The present invention is directed further still to a method for treating Down syndrome in a patient in need thereof. In this method, a therapeutically effective amount of at least one of the modified antisense oligonucleotides described herein or a pharmaceutical composition thereof is administered to the patient at least once. Other and further aspects, features, benefits, and advantages of the present invention will be apparent from the following description of the presently preferred embodiments of the invention given for the purpose of disclosure.
[0019] BRIEF DESCRIPTION OF THE DRAWINGS
[0020] So that the matter in which the above-recited features, advantages and objects of the invention, as well as others that will become clear, are attained and can be understood in detail, more particular descriptions of the invention briefly summarized above may be had by reference to certain embodiments thereof that are illustrated in the appended drawings. These drawings form a part of the specification. It is to be noted, however, that the appended drawings illustrate preferred embodiments of the invention and therefore are not to be considered limiting in their scope.
[0021] FIG. 1 is a graphic showing the location of Exon 1 antisense oligonucleotides (ASOs) 1-4 and Exon 9 ASOs 5-7.
[0022] FIGS. 2A-2G show the pharmacodynamic analysis of candidate ASOs. Data shows fitted dose response curves of normalized SIM2 steady state RNA levels in HEK293 cells and IC50 values with four ASOs targeting SEQ ID NO: 1 (ASO-1 , ASO-2, ASO-3, ASO-4; FIGS. 2A-2D) and three ASOs target Exon 9, Seq ID NO: 3 (ASO-5, ASO-6, ASO-7; FIGS. 2E-2G). Graphs represent fitted models with the Y axis representing relative SIM2 mRNA levels and X axis represents the molar (M) concentration of ASOs.
[0023] FIGS. 3A-3B show that sustained mitochondrial respiration by Sim2 leads to mitochondrial DNA damage. FIG. 3A shows basal oxygen consumption of primary mammary epithelial cells (PMEC) from control (FVB) and Sim2 overexpressing (MMTV-S / m2) virgin mice. FIG. 3B are images of mammary glands from L42 FVB and MMTV-S / m2 mice stained with 8-OhdG. Images taken at 40X. (* p<0.05)
[0024] FIGS. 4A-4C show Sim2+I~ mice are resistant to diet induced obesity. FIGS. 4A-4B are, respectively, an image and a graph of body weight gain in WT and Sim2+I~ mice on a high-fat diet (45% calories from fat) starting at 8 weeks of age and measured for 20 weeks. FIG. 4C is a comparison of gonadal, peritoneal, and mesenteric fat depot weights in WT and Sim2+I~ mice on a high fat diet (* p<0.05).
[0025] FIGS. 5A-5B are a comparison of metabolism across wild-type (WT), Dpi 6 (Down syndrome model), and Sim2 / Dp16 (SIM2-normalized) mice. FIG. 5A shows the RER calculated over a 24 hr period for WT, Dp16 and Sim2 / Dp16 mice. FIG. 5B shows the total energy expenditure in WT, Dp16 and Sim2 / Dp16 mice (*p<0.05, **p<0.01 ).
[0026] FIGS. 6A-6C are a comparison of craniofacial morphology across wild-type (WT), Dpi 6 (Down syndrome model), and Sim2 / Dp16 (SIM2-normalized) mice. FIG. 6A show representative high-resolution lateral skull images from 12-week-old male mice in each genotype group. Key morphometric landmarks, Nasion, Bregma, Lambda, bilateral Zygion, Prosthion, and Gnathion, are overlaid in red. A 5 mm scale bar is included in each panel. Dpi 6 skulls exhibit an expanded cranial vault, mandibular elongation, and widened zygomatic arches. These features are partially normalized in Sim2 / Dp16 mice. FIG. 6B shows the Procutes Alignment of WT, Dpi 6 and Sim2 / Dp16 mice showing partial craniofacial shape normalization in the Sim2 / Dp16 mice. FIG. 6C are heatmaps that show spatial deviations in craniofacial shape compared to WT using Procrustes-aligned landmark differences. The Dpi 6 vs. WT heatmap highlights major shape deformation in the cranial vault and mandible. In Sim2 / DP16 mice, these deviations are substantially reduced, reflecting partial phenotypic rescue through SIM2 dosage normalization.
[0027] DETAILED DESCRIPTION OF THE INVENTION
[0028] As used herein, the articles "a" and "an" when used in conjunction with the term “comprising” in the claims and / or the specification, may refer to “one”, but it is also consistent with the meaning of “one or more”, “at least one”, and “one or more than one”. Some embodiments of the invention may consist of or consist essentially of one or more elements, components, method steps, and / or methods of the invention. It is contemplated that any composition, component or method described herein can be implemented with respect to any other composition, component or method described herein.
[0029] As used herein, the term “or” in the claims refers to “and / or” unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and “and / or”.
[0030] As used herein "another" or “other” may mean at least a second or more of the same or different claim element or components thereof.
[0031] As used herein, the terms "comprise" and "comprising" are used in the inclusive, open sense, meaning that additional elements may be included.
[0032] As used herein, the terms "consist of" and "consisting of" are used in the exclusive, closed sense, meaning that additional elements may not be included.
[0033] As used herein, the term “includes” or “including” refers to “including, but not limited to”. The terms “includes, “including” and “including, but not limited to” are used interchangeably.
[0034] As used herein, the term “about” refers to a numeric value, including, for example, whole numbers, fractions, and percentages, whether or not explicitly indicated. The term “about” generally refers to a range of numerical values (e.g., ± 5-10% of the recited value) that one of ordinary skill in the art would consider equivalent to the recited value (e.g., having the same function or result). In some instances, the term “about” may include numerical values that are rounded to the nearest significant figure.
[0035] As used herein, the term “subject” refers to any vertebrate individual, including humans and veterinary patients.
[0036] As used herein, the term “patient” refers to a subject undergoing clinical treatment.
[0037] As used herein, the term “therapeutically effective amount” refers to a dosage sufficient to achieve a measurable improvement in disease or disorder symptoms or progression, though not necessarily a cure.
[0038] As used herein, the term “pharmaceutically acceptable” refers to a composition that is safe and suitable for use in contact with tissues in accordance with established medical practices.
[0039] As used herein, the term “treatment” refers to interventions aimed at curing, alleviating, preventing, or stabilizing a disease or pathological condition.
[0040] As used herein, the term “contacting” refers to any suitable method of bringing a compound or a pharmaceutical composition into contact with a cell in vivo, in vitro or ex vivo. For in vivo applications, any known method of administration is suitable as described herein.
[0041] As used herein, the term “inhibit” denotes a reduction in activity, which may range from partial to complete suppression. In certain embodiments, inhibition refers to a decrease of at least 10%, 20%, 50%, or even 100% compared to control levels.
[0042] As used herein, gene names presented in all capital letters refer to human genes, for example, “SIM2, while gene names with only the first letter capitalized refer to murine genes, for example, “Sim2”.
[0043] As used herein, the term “oligonucleotide” refers to a molecule comprising two or more covalently linked nucleosides, also referred to as nucleic acid molecules or oligomers.
[0044] As used herein, the term “antisense oligonucleotide” refers to an oligonucleotide capable of modulating gene expression by hybridizing to a target nucleic acid sequence, typically as a single-stranded molecule that binds to a complementary contiguous sequence on the target.
[0045] As used herein, the term “contiguous nucleotide sequence” refers to the region of the oligonucleotide complementary to the target nucleic acid and is interchangeable with the term “oligonucleotide motif sequence.”
[0046] As used herein, the terms “nucleotides” and “nucleosides” are interchangeable with “units” or “monomers”.
[0047] As used herein, the term “modified nucleoside” refers to a nucleoside in which the sugar or base moiety has been altered relative to the naturally occurring DNA or RNA nucleoside and is interchangeable with “nucleoside analogues”. As used herein, the term “nucleobase” refers to both naturally occurring purines and pyrimidines, (i.e., adenine, guanine, thymine, cytosine, and uracil) and modified nucleobases that retain hybridization function.
[0048] As used herein, the term “complementarity” refers to the ability of two nucleic acid strands to form Watson-Crick base pairs.
[0049] As used herein, the term “% complementary” refers to the calculation made by or is calculated by comparing the number of aligned base pairs between two sequences and expressing this as a percentage of the total length.
[0050] As used herein, the term “hybridizing” refers to the ability of two nucleic acid strands to form hydrogen bonds and duplexes.
[0051] As used herein, the term “modulation of expression” refers to an oligonucleotide’s ability to alter the expression level of a target gene, such as SIM2, which is measured relative to baseline expression or compared to untreated controls.
[0052] In one embodiment of the present invention, there is provided an oligonucleotide compound, comprising a chain of nucleobases with a sequence designed to target a Single- minded homolog 2 (SIM2) gene transcript. Further to this embodiment, the oligonucleotide compound comprises at least one modification in the chain of nucleobases.
[0053] In this further embodiment, the modification may be a modified internucleoside linkage between adjacent nucleobases. Particularly, each modified internucleoside linkage may be a phosphorothioate linkage. Also, in this further embodiment, at least one nucleobase at the 5’ end of the chain or at least one nucleobase at the 3’ end of the chain or a combination thereof may have a 2’ modification to its sugar. In a non-limiting example, three nucleobases at the 5’ end of the chain and three nucleobases at the 3’ end of the chain may comprise a locked nucleic acid as the 2’ modification. In addition, a plurality of the nucleobases may be 5-methyl modified cytosines. In one aspect of this further embodiment, the oligonucleotide compound may be a modified antisense oligonucleotide. Particularly, the modified antisense oligonucleotide may have a nucleotide sequence selected from the group consisting of SEQ ID NO: 103-109 and a combination thereof.
[0054] In both embodiments, the chain of nucleobases may comprise a contiguous sequence of about 12 to about 25 nucleobases. Also, in both embodiments, the oligonucleotide compound may be an antisense oligonucleotide, a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or a nuclease-directed guide RNA (gRNA). Particularly, the antisense oligonucleotide may have a a nucleotide sequence selected from the group consisting of SEQ ID NOS: 29-45, 58-69, 75-79, and 91-101 and a combination thereof. In another embodiment of the present invention, there is provided a pharmaceutical composition comprising the oligonucleotide compound as described supra and a pharmaceutically acceptable carrier or diluent.
[0055] In yet another embodiment of the present invention, there is provided a method for treating a disorder or a disease associated with SIM2 overexpression in a subject in need thereof, comprising administering at least once to the subject an amount of the pharmaceutical composition as described supra effective to normalize or regulate the overexpression of SIM2, thereby treating the disorder or the disease. In this embodiment, the disorder or disease may be Down syndrome, obesity, diabetes, musculoskeletal related, or related to mitochondrial dysfunction.
[0056] In yet another embodiment of the present invention, there is provided a method for normalizing expression of a Single-minded homolog 2 (SIM2) gene, comprising contacting an RNA transcript of the SIM2 gene with at least one of the oligonucleotide compounds as described supra.
[0057] In yet another embodiment of the present invention, there is provided a modified antisense oligonucleotide, comprising a chain of nucleosides with a modified internucleoside linkage between adjacent nucleosides; said chain comprising at least one 5’ flanking nucleoside and at least one 3’ flanking nucleoside each with a 2’ modification to its sugar; and said chain modified with a plurality of 5-methylcytosines.
[0058] In this embodiment, the modified internucleoside linkage may be a phosphorothioate linkage. Also, in this embodiment, the 2’ modification to the sugar on the at least one 5’ flanking nucleoside and the at least one 3’ flanking nucleoside may be a locked nucleic acid. In addition, the chain of nucleosides may consist of 18 nucleobases in a 3-12-3 gapmer structure with 3 modified 5’ flanking nucleobases, 12 contiguous nucleobases with a plurality of the 5- methylcytosines and 3 modified 3’ flanking nucleobases. In a non-limiting example, the modified antisense oligonucleotide may comprise a nucleotide sequence selected from the group consisting of SEQ ID NOS: 103-109 and a combination thereof.
[0059] In yet another embodiment of the present invention, there is provided a pharmaceutical composition comprising the modified antisense oligonucleotide as described supra and a pharmaceutically acceptable carrier or diluent.
[0060] In yet another embodiment of the present invention, there is provided a method for treating Down syndrome in a patient in need thereof, comprising administering to the patient at least once a therapeutically effective amount of at least one of the modified antisense oligonucleotides as described supra or a pharmaceutical composition thereof. In an aspect of this embodiment, the modified antisense oligonucleotide may be administered in utero. Provided herein are oligonucleotide compounds, for example, antisense oligonucleotides (ASOs), and pharmaceutical compositions thereof, specifically designed as therapeutics or medicaments to target the SIM2 transcript in order to reduce or to normalize SIM2 expression in a subject or patient in need thereof, particularly in Down syndrome and related pathologies. The ASOs described herein target sequences located within the SIM2 gene. As presented herein, the target region of the disclosed ASOs includes one of four distinct nucleotide sequences located on two exons within witin the SIM2 gene, that is, specifically, positions 36,699,777-36,699,814 (exon 1 ), 36,699,849-36,699,877 (exon 1 ), 36,743,392-36,743,416 (exon 9), and 36,743,464-36,743,491 (exon 9).
[0061] Single-minded homolog 2 (SIM2) gene
[0062] The human Single-minded homolog 2 (SIM2) gene is located on chromosome 21q22.13 within the Down syndrome critical region (DSCR), spanning genomic coordinates chr21 :36,699, 115-36,749,917 (GRCh38 / hg38) and covering approximately 50.8 kilobases. SIM2 is composed of 11 exons and 10 introns and encodes a transcription factor of the basic helix-loop-helix PAS (bHLH-PAS) family. This gene plays essential roles in development, including regulation of neurogenesis, craniofacial patterning, and mammary gland differentiation. SIM2 undergoes alternative splicing to yield multiple isoforms, with the most characterized being SIM2 long (SIM2I) and SIM2 short (SIM2s). SIM2I includes all 11 exons and encodes the full-length protein containing a DNA-binding bHLH domain, PAS dimerization domains, and a C-terminal repression domain. In contrast, SIM2s is generated by alternative splicing that omits exon 11 , resulting in a truncated protein lacking the repression domain while retaining the bHLH and PAS domains.
[0063] The murine ortholog of SIM2 is located on chromosome 16, band B3, in a region syntenic with human chromosome 21 . In the GRCm39 / mm39 mouse genome assembly, the Sim2 gene spans coordinates chr16:31 ,417,038-31 ,430,762, covering approximately 13.7 kilobases. Similar to the human gene, murine Sim2 contains 11 exons and 10 introns and undergoes alternative splicing to produce Sim2 long (Sim2l) and Sim2 short (Sim2s) isoforms. Sim2l encodes a full-length transcription factor with functional bHLH, PAS, and repression domains, while Sim2s lacks the C-terminal repression domain due to exon 11 exclusion but retains the bHLH and PAS domains necessary for DNA binding and dimerization.
[0064] Oligonucleotides
[0065] Oligonucleotides are commonly synthesized in the laboratory via solid-phase chemical synthesis and subsequently purified. References to oligonucleotide sequences pertain to the order of nucleobase moieties or their modifications along the covalently linked nucleosides or nucleotides. The oligonucleotides described herein are synthetic and may include one or more modified nucleosides or nucleotides. The oligonucleotides may have a region of contiguous nucleotides or motif complementary to the target nucleic acid. Alternatively, in some embodiments the entire oligonucleotide sequence is complementary to the target. In other embodiments, the oligonucleotide sequence includes additional nucleotides or linker regions, which may or may not be complementary and may include functional groups. Nucleotides, the building blocks of oligonucleotides and polynucleotides, may be naturally occurring or non- naturally occurring. In nature, nucleotides include a ribose sugar, a nucleobase, and one or more phosphate groups, whereas nucleosides lack the phosphate group.
[0066] The oligonucleotide may comprise one or more modified nucleosides or nucleoside analogs. Such modifications may involve changes to the sugar ring (e.g., LNA, HNA, UNA) or substitution on the sugar positions (e.g., 2'-O-methyl, 2'-fluoro). Modified nucleosides or nucleoside analogues improve properties such as nuclease resistance and binding affinity. Modified internucleoside linkages differ from natural phosphodiester linkages and are used to covalently link nucleosides in ways that enhance nuclease resistance. Examples of modified linkages include, but are not limited to, phosphorothioate, diphosphorothioate, and boranophosphate, In some embodiments, greater than 50%, and up to 100%, of the internucleoside linkages in an oligonucleotide are modified, which contributes to enhanced stability, particularly in vivo. Phosphorothioate linkages are of particular interest due to their nuclease resistance, pharmacokinetic advantages, and compatibility with RNase H activity. The internucleoside linkages connecting the oligonucleotide to a functional group or conjugate may be either phosphodiester or modified linkages.
[0067] In some embodiments, the oligonucleotide comprises one or more neutral internucleoside linkages, such as methylphosphonate, phosphotriester, or others described in International Publication Nos. W02009 / 124238 or W02007 / 031091 , each of which is incorporated herein by reference. Regions of the oligonucleotide designed to recruit nucleases, such as RNase H, often utilize phosphorothioate linkages to ensure stability and activity. Non-nuclease recruiting regions or affinity-enhancing flanks may contain modified or natural linkages depending on the structural and pharmacological design. Inclusion of phosphodiester linkages in non-recruiting regions, particularly adjacent to modified nucleosides, can modulate bioavailability and tissue distribution. Oligonucleotides may contain 100% phosphorothioate and / or boranophosphate linkages in certain embodiments.
[0068] The oligonucleotides may have at least one or a plurality of modified nucleobases that retain hybridization function and may include, but are not limited to, isocytosine, 5- methylcytosine, or diaminopurine. These may be represented by their corresponding letter codes, for example, A, T, G, C, and U, where such letters optionally include functional equivalents. The strength of hybridization may be described by the melting temperature (Tm) or, more accurately, by the standard state Gibbs free energy (AG°). Hybridization is considered favorable when AG° is below -10 kcal / mol, and in preferred embodiments may range from -15 to -30 kcal / mol for 8-30 nucleotide oligonucleotides.
[0069] Oligonucleotides disclosed herein may hybridize to a target nucleic acid with estimated AG° values ranging from -10 to -60 kcal / mol, depending on length and sequence composition. In some embodiments, the oligonucleotide comprises a contiguous sequence of at least 8 nucleotides, preferably 12 to 25 nucleotides, that binds to the target RNA or DNA. Such oligonucleotides may function as antisense inhibitors, steric-block inhibitors, siRNA, shRNA, or CRISPR guide RNAs to inhibit, delete, or mutate target nucleic acid sequences.
[0070] Oligonucleotides may also contain sugar-modified nucleosides for increased stability and binding affinity. These include modifications to the 2' position (e.g., 2'-OMe, MOE, F-ANA), locked ring structures (e.g., LNA), or other non-sugar backbones (e.g., PNA, morpholino). Such modifications may improve pharmacokinetics, reduce immunogenicity, and enhance target specificity. Locked Nucleic Acids (LNAs) are particularly advantageous due to their bridged ribose structures, which confer high thermal stability and binding affinity.
[0071] Some embodiments utilize RNase H-mediated cleavage, wherein oligonucleotides form duplexes with the target RNA, resulting in its enzymatic degradation. Common designs include gapmers, which contain a central DNA region for RNase H recruitment flanked by affinity-enhancing modified nucleosides. Variants such as headmers and tailmers lack one of the flanking regions, but retain functional activity. In some embodiments, the target sequence is at exonic boundaries. Target sequences consist of 36-40 nucleotides tiled across each exonic boundary of each exon (18-20 nucleotides representing the 5’ and 3’ end of adjacent exons). These ASOs can be used as gapmers or as steric-block ASOs, which are chemically modified (2’-O-methyl (2’-OMe) and 2’-O-methoxyethyl (2’-MOE)) groups to enhance affinity and nuclease resistance and sterically hinder access of the splicesome. The binding of the ASO physically prevents the recognition of splice sites by the spliceosomal machinery or associated RNA-binding proteins, for example, SR proteins or hnRNPs), thereby redirecting splicing outcomes.
[0072] Oligonucleotides may also be conjugated to non-nucleotide moieties to enhance delivery and pharmacological properties. Conjugates may include carbohydrates, peptides, antibodies, vitamins, lipids, or small molecules. In certain embodiments, the conjugate facilitates tissue-specific delivery, such as GalNAc (N-acetylgalactosamine) targeting hepatocytes or antibody fragments targeting the transferrin receptor for delivery across the blood-brain barrier. Conjugates may enhance bioavailability, cellular uptake, distribution, metabolism, and reduce off-target effects. Suitable conjugation strategies are disclosed in International Publication Nos. WO1993 / 07883, WO2012 / 143379, and WO2013 / 033230, all of which are incorporated herein by reference.
[0073] The disclosed oligonucleotides can also be incorporated into expression vectors suitable for microbial or mammalian systems, allowing for intracellular production or delivery. Techniques such as PCR amplification, restriction digestion, ligation, or gap repair may be used as are known in the art.
[0074] The oligonucleotide may be synthesized using established phosphoramidite chemistry. In some embodiments, synthesis includes conjugation to a ligand or deliveryenhancing moiety. Stereo-controlled synthesis methods may be employed for chiral linkages, as described in references including WO2010 / 064146, W02014 / 012081 , WO2015 / 107425, WO2016 / 079183, WO2016 / 079181 , WO2016 / 096938, WO2017 / 194498 and
[0075] WO2018 / 177825.
[0076] Antisense oligonucleotides (ASO)
[0077] ASO design strategies and methodologies are well known in the art. In some embodiments, the disclosed ASOs are directed toward sequences that are conserved among human subjects. In other embodiments, the targeted sequences are conserved across primate species. The ASOs described herein may incorporate one or more chemical modifications that improve pharmacological properties, including enhanced stability, solubility, hybridization affinity, cellular distribution, and uptake. For instance, the ASOs may include sugar-modified nucleosides, modified nucleobases, and / or modified internucleoside linkages. In certain embodiments, internucleoside linkages are altered from the natural phosphodiester backbone to alternative chemistries that exhibit increased resistance to nuclease-mediated degradation. In some cases, the oligonucleotides contain nucleobase modifications that deviate from naturally occurring forms while retaining hybridization functionality.
[0078] The disclosed ASOs may comprise DNA, RNA, or a combination of deoxyribonucleotides and ribonucleotides. In some embodiments, the ASO adopts the format of a gapmer, headmer, or tailmer. For gapmers, a central region of DNA monomers is flanked by modified ribonucleotide blocks designed to protect the DNA core from exonuclease degradation. For example, the DNA core may consist of 7 to 10 natural deoxynucleotides sufficient to support RNase H-mediated cleavage of the RNA target, flanked on the 5’ and 3’ ends by 3 to 5 modified ribonucleotides. In certain embodiments, these flanking modified ribonucleotides may include 2'-O-ethyl (2'-OMe), 2'-O-methoxyethyl (MOE), or 2'-Locked Nucleic Acids (LNAs), which are known to enhance nuclease resistance and hybridization affinity. Antisense oligonucleotides were designed to target exons in SIM2, corresponding to position 36,699,115 to 36,749,917 on human chromosome 21 human genome assembly hg38 to inhibit SIM2 expression. In some embodiments, the target nucleic acid is one of four locations on two exons in the 5’-end of SIM2, which correspond to positions 36,699,777-
[0079] 36,699,814 (Exon 1 ), 36,699,849-36,699,877 (Exon 1 ) and 3’ end corresponding to positions
[0080] 36,743,392-36,743,416 (Exon 9), 36,743,464-36,743,491 (Exon 9).
[0081] In some embodiments, therefore, the target nucleic acid is Exon 1 ,
[0082] SEQ ID NO: 1 : ACCAGGAGGGAGAAGGAAAATGGCGAGTTTTACGAGCT.
[0083] In some embodiments, the target nucleic acid is Exon 1 , SEQ ID NO: 2:
[0084] TCGCAGCTGGACAAAGCGTCCATCATCCG.
[0085] In some embodiments, the target nucleic acid is Exon 9, SEQ ID NO: 3: TTGAATACAAGGAACTTCAGCTGTC.
[0086] In some embodiments, the target nucleic acid is Exon 9, SEQ ID NO: 4:
[0087] CCTTGTCTACCTCACAAGAAACTAGGAA.
[0088] In some embodiments, the disclosed ASO has the nucleic acid sequence ASO 1 , SEQ ID NO: 5: ATTTTCCTTCTCCCTCCT.
[0089] In some embodiments, the disclosed ASO has the nucleic acid sequence ASO 2, SEQ ID NO: 6: TCGCCATTTTCCTTCTCC.
[0090] In some embodiments, the disclosed ASO has the nucleic acid sequence ASO 3, SEQ ID NO: 7: CTCGCCATTTTCCTTCTC
[0091] In some embodiments, the disclosed ASO has the nucleic acid sequence ASO 4, SEQ ID NO: 8: AACTCGCCATTTTCCTTC
[0092] In some embodiments, the disclosed ASO has the nucleic acid sequence ASO 5, SEQ ID NO: 9: CAGCTGAAGTTCCTTGTA
[0093] In some embodiments, the disclosed ASO has the nucleic acid sequence ASO 6, SEQ ID NO: 10: ACAGCTGAAGTTCCTTGT
[0094] In some embodiments, the disclosed ASO has the nucleic acid sequence ASO 7, SEQ ID NO: 11 : GACAGCTGAAGTTCCTTG
[0095] Additional ASOs that can target exon 1 SEQ ID NO: 1 of SIM2 are shown in Table 1 .
[0096] TABLE 1
[0097] Exon 1 ASOs (from Target Seq ID NO: 1 )
[0098] Target Sequence (5' —> 3') SEQ ID NO: ASO (5' — > 3') SEQ ID NO:
[0099] ACCAGGAGGGAGAAGGAA 12 TTCCTTCTCCCTCCTGGT 29
[0100] CCAGGAGGGAGAAGGAAA 13 TTTCCTTCTCCCTCCTGG 30
[0101] CAGGAGGGAGAAGGAAAA 14 I I I I CCTTCTCCCTCCTG 31
[0102] GGAGGGAGAAGGAAAAUG 15 CA I I I I CCTTCTCCCTCC 32 GAGGGAGAAGGAAAAUGG 16 CCA 1 1 1 1 CC 1 1 C 1 CCC 1 C 33
[0103] AGGGAGAAGGAAAAUGGC 17 GCCA I I I I CCTTCTCCCT 34
[0104] GGGAGAAGGAAAAUGGCG 18 CGCCA I I I I CCTTCTCCC 35
[0105] AGAAGGAAAAUGGCGAGU 19 ACTCGCCA I I I I CCTTCT 36
[0106] AAGGAAAAUGGCGAGUUU 20 AAACTCGCCA I I I I CCTT 37
[0107] AGGAAAAUGGCGAGUUUU 21 AAAACTCGCCA I I I I CCT 38
[0108] GGAAAAUGGCGAGUUUUA 22 TAAAACTCGCCA I I I I CC 39
[0109] GAAAAUGGCGAGUUUUAC 23 GTAAAACTCGCCA I I I I C 40
[0110] AAAAUGGCGAGUUUUACG 24 CGTAAAACTCGCCA I I I I 41
[0111] AAAUGGCGAGUUUUACGA 25 TCGTAAAACTCGCCATTT 42
[0112] AAUGGCGAGUUUUACGAG 26 CTCGTAAAACTCGCCATT 43
[0113] AUGGCGAGUUUUACGAGC 27 GCTCGTAAAACTCGCCAT 44
[0114] UGGCGAGUUUUACGAGCU 28 AGCTCGTAAAACTCGCCA 45
[0115] Example ASOs that target exon 1 SEQ ID NO: 2 of SIM2 are shown in Table 2.
[0116] TABLE 2
[0117] Exon 1 ASOs (from Target Seq ID NO: 2)
[0118] Target Sequence (5' —> 3') SEQ ID NO: ASO (5' — > 3') SEQ ID NO:
[0119] UCGCAGCUGGACAAAGCG 46 CGCTTTGTCCAGCTGCGA 58
[0120] CGCAGCUGGACAAAGCGU 47 ACGCTTTGTCCAGCTGCG 59
[0121] GCAGCUGGACAAAGCGUC 48 GACGCTTTGTCCAGCTGC 60
[0122] CAGCUGGACAAAGCGUCC 49 GGACGCTTTGTCCAGCTG 61
[0123] AGCUGGACAAAGCGUCCA 50 TGGACGCTTTGTCCAGCT 62
[0124] GCUGGACAAAGCGUCCAU 51 ATGGACGCTTTGTCCAGC 63
[0125] CUGGACAAAGCGUCCAUC 52 GATGGACGCTTTGTCCAG 64
[0126] UGGACAAAGCGUCCAUCA 53 TGATGGACGCTTTGTCCA 65
[0127] GGACAAAGCGUCCAUCAU 54 ATGATGGACGCTTTGTCC 66
[0128] GACAAAGCGUCCAUCAUC 55 GATGATGGACGCTTTGTC 67
[0129] ACAAAGCGUCCAUCAUCC 56 GGATGATGGACGCTTTGT 68
[0130] CAAAGCGUCCAUCAUCCG 57 CGGATGATGGACGCTTTG 69
[0131] Example ASOs that target exon 9 SEQ ID NO: 3 of SIM2 are are shown in Table 3.
[0132] TABLE 3
[0133] Exon 9 ASOs (from Target Seq ID NO: 3)
[0134] Target Sequence (5' —> 3') SEQ ID NO: ASO (5' — > 3') SEQ ID NO:
[0135] UUGAAUACAAGGAACUUC 70 GAAGTTCCTTGTATTCAA 75
[0136] UGAAUACAAGGAACUUCA 71 TGAAGTTCCTTGTATTCA 76
[0137] GAAUACAAGGAACUUCAG 72 CTGAAGTTCCTTGTATTC 77
[0138] AAUACAAGGAACUUCAGC 73 GCTGAAGTTCCTTGTATT 78
[0139] AUACAAGGAACUUCAGCU 74 AGCTGAAGTTCCTTGTAT 79 Example ASOs that target exon 9 SEQ ID NO: 4 of SIM2 are shown in Table 4.
[0140] TABLE 4
[0141] Exon 9 ASOs (from Target Seq ID NO: 4)
[0142] Target Sequence (5' —> 3') SEQ ID NO: ASO (5' — > 3') SEQ ID NO:
[0143] CCUUGUCUACCUCACAAG 80 CTTGTGAGGTAGACAAGG 91
[0144] CUUGUCUACCUCACAAGA 81 TCTTGTGAGGTAGACAAG 92
[0145] UUGUCUACCUCACAAGAA 82 TTCTTGTGAGGTAGACAA 93
[0146] UGUCUACCUCACAAGAAA 83 TTTCTTGTGAGGTAGACA 94
[0147] GUCUACCUCACAAGAAAC 84 GTTTCTTGTGAGGTAGAC 95
[0148] UCUACCUCACAAGAAACU 85 AGTTTCTTGTGAGGTAGA 96
[0149] CUACCUCACAAGAAACUA 86 TAGTTTCTTGTGAGGTAG 97
[0150] UACCUCACAAGAAACUAG 87 CTAGTTTCTTGTGAGGTA 98
[0151] ACCUCACAAGAAACUAGG 88 CCTAGTTTCTTGTGAGGT 99
[0152] CCUCACAAGAAACUAGGA 89 TCCTAGTTTCTTGTGAGG 100
[0153] CUCACAAGAAACUAGGAA 90 TTCCTAGTTTCTTGTGAG 101
[0154] Target modulation by the disclosed antisense oligonucleotide is achieved through hybridization between a contiguous nucleotide sequence of the oligonucleotide and the target nucleic acid. In certain embodiments, the oligonucleotide may include one or more mismatches relative to the target sequence. Despite these mismatches, binding may still be sufficient to effectively modulate SIM2 expression. Any reduction in binding affinity caused by mismatches can be offset by increasing the oligonucleotide length and / or incorporating affinity-enhancing modified nucleosides, such as 2'-modified nucleosides like locked nucleic acids (LNAs).
[0155] The antisense oligonucleotide may be 10 to 30 nucleotides in length and exhibit at least 90% sequence complementarity — preferably 91 % to 100% — to one of the eleven exons located at the 5' end of the SIM2 gene. The oligonucleotide design includes a defined pattern of nucleoside sugar modifications, which may include DNA, RNA, and / or arabino nucleic acid (ANA) nucleosides. In various embodiments, the sequence includes both sugar-modified and natural nucleosides.
[0156] The antisense oligonucleotide may incorporate at least 1 to 16 modified nucleosides, with preferred ranges from 4 to 7. The backbone may also feature modified internucleoside linkages, such as phosphorothioate or boranophosphate bonds, to enhance nuclease resistance and stability. In particular, 2'-sugar-modified nucleosides may include LNAs or analogs where the 2' position is substituted with groups such as -F, -CF3, -CN, -N3, or other alkyl, alkenyl, or alkynyl moieties. LNAs may also include 2'-4' biradical bridges such as -O- CH2- or -O-CH(Et)-. Additional variants include thio-LNA, amino-LNA, oxy-LNA, or ENA in either beta-D or alpha-L configurations, with all cytosine residues optionally methylated at the 5-position. In some embodiments, LNA units are strategically positioned, for example, at least one at the 5' end and at least two at the 3' en, to enhance target affinity and stability. All nucleosides in the flanking regions may be LNA or a mix of LNA and other modified or unmodified nucleosides.
[0157] The antisense oligonucleotide may also be configured as a gapmer, comprising three distinct regions: a 5' flank, a central "gap," and a 3' flank (F-G-F' architecture). The flanking regions consist of modified nucleosides, typically LNAs, while the gap consists of at least five contiguous nucleotides capable of recruiting RNase H. Suitable RNase H-recruiting nucleosides include DNA, alpha-L-oxy-LNA, 2'-fluoro-ANA, and UNA. The flanking regions provide duplex stability but do not recruit nucleases.
[0158] Antisense oligonucleotides ASO 1-ASO 7 plus a scrambled AOS (AOS scr) were modified and designed with 18 nucleotides in a 3-12-3 architecture. The modified AOSs have a phosphorothioate backbone for RNA and DNA, RNA nucleosides modified with a locked nucleic acid (LNA, Affinity Plus) at the 5' flank and the 3' flank and at least one 5- methylcytosine (5-methyl-dC) as shown in Table 5.
[0159] TABLE 5
[0160] Human SIM2 Modified Antisense Oligonucleotides
[0161] ASO Sequence Sequence SEQ ID NO
[0162] ASO-Scr +A*+T*+T*A7iMe-dC / 7iMe-dC / * G*G* SEQ ID NO: 102
[0163] T*G*A*T*G*A7iMe-dC / * +T*+C*+T
[0164] ASO-1 +A*+T*+T*T*T7iMe-dC / 7iMe-dC / *T* SEQ ID NO: 103
[0165] T7iMe-dC / *T7iMe-dC / 7iMe-dC / 7 iMe-dC / *T*+C*+C*+T
[0166] ASO-2 +T*+C*+G7iMe-dC / 7iMe-dC / *A* SEQ ID NO: 104
[0167] T*T*T*T* / iMe.dC / * / iMe.dC / *T*T* / iMe-dC / *+T*+C*+C
[0168] ASO-3 +C*+T*+C*G7iMe-dC / 7iMe-dC / *A*T* SEQ ID NO: 105
[0169] T*T*T7iMe-dC / 7iMe-dC / *T*T*+C*+T*+C
[0170] ASO-4 +A*+A*+C*T7iMe-dC / *G7iMe-dC / 7iMe-dC / * SEQ ID NO: 106
[0171] A*T*T*T*T* / iMe.dC / * / iMe.dC / *+T*+T*+C
[0172] ASO-5 +C*+A*+G7iMe-dC / *T*G*A*A*G*T*T* SEQ ID NO: 107
[0173] / iMe-dC / 7iMe-dC / *T*T*+G*+T*+A
[0174] ASO-6 +A*+C*+A*G7iMe-dC / *T*G*A*A*G* SEQ ID NO: 108
[0175] T*T7iMe-dC / 7iMe-dC / *T*+T*+G*+T
[0176] ASO-7 +G*+A*+C*A*G7iMe-dC / *T*G*A*A* SEQ ID NO: 109
[0177] G*T*T7iMe-dC / 7iMe-dC / *+T*+T*+G
[0178] *, phosphorothioate; +, Locked Nucleic Acid (LNA); / iMe-dc / , 5-Methylcytosin (5-methyl-dC)
[0179] Additional features, objects, and advantages of the invention will be apparent from the detailed description and accompanying drawings. Those skilled in the art will appreciate that the disclosed compositions and methods demonstrate the utility of targeting specific sequences within the SIM2 gene to modulate gene expression and, further, that a variety of oligonucleotide chemistries and formats can be applied to these sequences. The invention is not limited by any particular mechanism of action. For example, while certain embodiments may function via an antisense mechanism involving RNase H-mediated degradation of RNA, other formats such as small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), or nuclease-directed guide RNAs (gRNAs) that are complementary to the same target sequences are equally contemplated herein.
[0180] In analogous fashion, the described sequences may also be deployed as part of expression constructs or nucleic acid vectors designed for transcription in vivo or in vitro. Thus, the term “ASO” as used herein is exemplary and not limiting, and encompasses a wide variety of synthetic or expressed oligonucleotides that act via different mechanistic pathways. Those skilled in the art will recognize from the present disclosure that suitable structural and functional features may be incorporated into such oligonucleotides depending on the intended mechanistic context. For example, ASOs may be designed for RNase H-mediated mechanisms, steric-block ASOs, which are chemically modified (2’-O-methyl (2’-0Me) and 2’- O-methoxyethyl (2’-M0E)) groups to enhance affinity and nuclease resistance and sterically hinder access of the splicesome, siRNAs may engage the RISC complex; and guide RNAs may be tailored for function with CRISPR-Cas nucleases. In some embodiments, the disclosed nucleic acids may incorporate format or structural features known in the art to be beneficial in one or more of these mechanistic contexts. Accordingly, the present disclosure provides both specific target sequences within SIM2 and the structural and functional frameworks within which they may be applied across a range of nucleic acid-based therapeutic modalities.
[0181] Pharmaceutical compositions
[0182] Disclosed herein are pharmaceutical compositions comprising one or more of the aforementioned ASOs formulated with pharmaceutically acceptable diluents, carriers, salts, and / or adjuvants. Methods are also disclosed for the in vivo or in vitro suppression of SIM2 expression in target cells and organs. Moreover, the present invention includes methods for treating or preventing diseases, disorders, or dysfunctions associated with in vivo activity of SIM2. Such methods include administering a therapeutically or prophylactically effective amount of at least one of the disclosed ASOs to a subject suffering from or at risk for such diseases or conditions, including but not limited to Down syndrome.
[0183] Pharmaceutical compositions may include the oligonucleotide compounds or oligonucleotide conjugates with pharmaceutically acceptable carriers, diluents, for example, PBS or aCSF, salts, or adjuvants. Formulation and route of administration, such as topical, enteral, or parenteral, may depend on the disease context and therapeutic requirements. Parenteral routes include intravenous, subcutaneous, in utero, intramuscular, intrathecal, intracerebral, or intracisternal injection. In some embodiments, the oligonucleotide compound, such as the antisense oligonucleotide, is formulated as a prodrug, in which the conjugated moiety is cleaved within the target tissue.
[0184] Therapeutic methods and treatments
[0185] Disclosed are methods for treating or preventing disease by administering a therapeutically effective amount of the antisense oligonucleotide, its conjugate, or pharmaceutical composition to a subject in need thereof. These therapies or treatment methods may be administered to subjects with confirmed Down syndrome (DS), identified through genetic testing, developmental history, or laboratory markers associated with DS- related pathologies. One of ordinary skill in the art is well-able to determine doses and treatment regimens for a specific subject or patient depending at least on the age, sex and overall health thereof.
[0186] These oligonucleotides may also be used in the manufacture of medicaments intended for therapeutic intervention in DS and related disorders including:
[0187] In certain embodiments, a therapeutic regimen for the treatment of DS comprises the administration of one or more doses of a pharmaceutical composition that includes or facilitates the delivery of a nucleic acid therapeutic, such as an oligonucleotide, for example, an antisense oligonucleotide, as disclosed herein.
[0188] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. EXAMPLE 1
[0189] Materials and Methods
[0190] Sequence conservation of the human and mouse S / M2 transcripts
[0191] Pairwise sequence alignments between the mouse and human SIM2 transcripts and the corresponding genomic sequences were performed using NCBI BLAST (blastn).
[0192] Antisense oligonucleotide (ASO) design
[0193] Antisense oligonucleotides were designed to target specific sequences in the SIM2 transcript. The ASOs were designed using Soligo. ASOs with the lowest binding site disruption energy and free binding energy were identified for each target sequence and then inspected for motifs with increased effectiveness. ASOs were further filtered based on accessibility within the predicted lowest free energy centroid secondary structure of target sequence generated by Soligo. The ASOs were designed to target unique sequences (no off-target sites) and to have a GC between 40 and 60%. The ASOs were manufactured by Integrated DNA Technologies.
[0194] Treatment of cells with ASO
[0195] HEK293 cells were used to assess the in vitro pharmacological properties of the ASOs. Cells were grown in 10OpL 10% FBS DMEM media (ThermoFisher Scientific) in 96 well plates. The intracellular delivery of the ASOs was achieved using Genejuice, a transfection reagent. ASOs were resuspended in sterile water and then the treatment concentrations were mixed to 2X with the cell-culture media. 100p.L of the 2X ASO mixture was added to each well to achieve 1X concentrations. The viability of the cells was inspected by light microscopy prior to treatment and at harvesting. Signs of potential ASO toxicity were assessed by inspecting the raw Ct values generated during the quantitative RT-PCR analyses. The ASOs were manufactured by Integrated DNA Technologies.
[0196] Quantitative RT-PCR analysis of SIM2s in MCF7 and HEK293 cells
[0197] TaqMan™ quantitive RT-PCR assays were used to quantify SIM2 (Hs00894176_m1 ), SIM2 (Hs00894178_m1 ), SIM2 (Hs00894170_m1 ). GAPDH (Hs99999905_m1 ) and ACTB (Hs99999903_m1 ) were used as internal controls. RNA was isolated from each well (96 well plate) of the cell cultures using the Cells-to-CT kit (ThermoFisher Scientific) in a lysate volume of 55 pL. cDNA synthesis was performed with the same kit using an input of 10 pL lysate for a total volume of 50uL. Assays were evaluated with a 5-point serial dilation curve of input to estimate efficiency, R2, and slope. Primers with efficiencies that did not fall between 75% - 125% were discarded. Cycling conditions were 2 min at 50°C, 2 min at 95°C, and 40 cycles of 15 seconds at 95°C and 1 min at 60°C, with readings taken at the 60°C step of every cycle. Reactions were run on a BIO-RAD CFX384 Real-Time PCR Detection System (Bio-Rad). Data were retrieved and analyzed with the BIORAD CFX Maestro software (Bio-Rad). Samples with internal control Ct values > 35 were filtered. The quality of data was then visually inspected to identify discrepancies between technical replicates or, in some instances, plate effects.
[0198] Cells and culture conditions
[0199] HEK293 cells were purchased from American Type Culture Collection (ATCC) and maintained in high glucose DMEM (ThermoFisher Scientific) supplemented with 10% fetal bovine serum (R&D Systems) and 1 % penicillin-streptomycin (ThermoFisher Scientific) at 37°C and 5% CO2.
[0200] In Vivo Studies
[0201] Mice
[0202] Male mice were used for all craniofacial analyses and were aged to 12 weeks at the time of euthanasia. The following genotypes were analyzed:
[0203] 1 ) Wild-type (WT) C57BL / 6J mice (JAX stock #000664), ii) Dpi 6 (Dp(16)1Yey / +, (JAX stock #013530), a segmental trisomy mouse model of Down syndrome that carries a duplication of the entire Hsa21-syntenic region on mouse chromosome 16, and ill) Sim2 / Dp16, generated by crossing Dp(16)1Yey / + mice with Sim2Atm1 Lex / + mice, generated at Texas A&M University, to normalize Sim2 dosage to diploid levels within the Dpi 6 trisomic background.
[0204] All mice were maintained on a C57BL / 6J genetic background. Breeding strategies were designed to ensure littermate controls where possible. Mice were housed in a specificpathogen-free (SPF) barrier facility under a 12-hour light / dark cycle with ad libitum access to food and water. Genotyping was performed using standard PCR protocols with primers specific to the Dpi 6 duplication and Sim2 null alleles.
[0205] High-fat diet study
[0206] WT and Sim2 mice were housed at the TIGM facility under a standard 12-h photoperiod and provided access to food and water ad libitum. Mice were given a control diet (10% calories from fat) or a high fat diet (45% calories from fat) (Research Diets) and their body weights were measured daily for 20 weeks. Through the study mice were given access to running wheels which measured the distance and duration the mice ran. At the end of the study, gonadal, peritoneal, and mesenteric fat was isolated and measured. In Vivo metabolic characterization
[0207] WT, Sim2, Dpi 6 and Sim2 / Dp16 mice were housed at the TIGM facility under a standard 12-h photoperiod and provided access to food and water ad libitum. When male mice were 12 weeks old, they were placed in placed in PhenoMaster metabolic systems (TSE) in the TIGSS facility. After a 24hr acclamation period, data was collected for 48 hrs to measure oxygen consumption (VO2), carbon dioxide expulsion (VCO2), movement, food consumption, and water consumption. Data was collected and analyzed by the PhenoMaster V5.9.7 software (TSE). At the end of data collection, the mice were weighed, and fat composition was determined using an EchoMRI-100H.
[0208] Skull collection and imaging
[0209] At 12 weeks of age, mice were euthanized, and skulls were carefully dissected to preserve craniofacial structure. Following fixation in 4% paraformaldehyde, skulls were imaged using micro-computed tomography (micro-CT). Scans were performed at TIGM using a Scanco pCT50 with an isotropic voxel size of 10 m. Reconstructed 3D volumes were exported and visualized in standardized lateral orientation using 3D rendering software. Images were saved in high-resolution JPEG or PDF format for morphometric analysis.
[0210] Craniofacial landmark identification
[0211] Seven morphometric landmarks were assigned to each skull based on established anatomical criteria:
[0212] Nasion - midpoint of the frontal-nasal suture,
[0213] Bregma - intersection of the coronal and sagittal sutures,
[0214] Lambda - intersection of the sagittal and lambdoid sutures,
[0215] Zygion (left and right) - lateral-most points of the zygomatic arch,
[0216] Prosthion - most anterior midline point of the upper jaw, and
[0217] Gnathion - most inferior midline point of the lower jaw.
[0218] Landmarks were manually annotated by a trained observer blinded to genotype to minimize bias.
[0219] Morphometric and statistical analysis
[0220] Two-dimensional coordinates were extracted from lateral-view images using custom Python-based image analysis pipelines. The following morphometric analyses were performed:
[0221] 1 ) Linear distances between landmark pairs were used to quantify regional size differences. 2) Procrustes alignment (via scipy. spatial. procrustes) was used to assess global shape variation relative to WT reference skulls.
[0222] 3) Euclidean displacement of each landmark from the WT average position was calculated.
[0223] 4) Heatmaps of landmark deviation were generated using scipy. interpolate.griddata and visualized with matplotlib.
[0224] Summary metrics included mean distance from WT to estimate overall phenotypic divergence and procrustes shape disparity, where lower values indicate increased morphological similarity to WT.
[0225] EXAMPLE 2
[0226] Identification of lead SIM2 ASO target
[0227] Four ASOs targeting Exon 1 , SEQ ID NO: 1 , in SIM2 (ASO-1 , ASO-2, ASO-3, ASO-4; SEQ ID NOS: 103-106) and three ASOs targeting Exon 9, SEQ ID NO: 3, (ASO-5, ASO-6, ASO-7, SEQ ID NOS: 7-9) consisting of a phosphorothioate backbone with LNA modifications and 5-methyl modified cytosines were designed to identify potential lead ASOs (Table 5). HEK293 cells were treated with a 10-point ! log dose response curve [1 nM, 3 nM, 10 nM, 30 nM, 100 nM, 300 nM, 1 pM, 3 pM, 10 pM, and 30 pM (n = 3)] of each ASO to compare the IC50 values. Following treatment, steady state RNA levels of SIM2 were measured and dose response curves were fitted (FIGS. 2A-2G). Based on the relative potencies and internal selection criteria, ASO-2 and ASO-3 from Exon 1 and ASO-5 and ASO-7 from Exon-9 were selected for further study.
[0228] EXAMPLE 3
[0229] SIM2 and Down syndrome related pathologies
[0230] Determine the effect of SIM2 overexpression on mtDNA damage
[0231] There is increasing evidence that persons with DS exhibit severe muscle weakness due to mitochondrial dysfunction and homeostasis (7-11 ). Oxidative stress is thought to be an underlying factor in the development of DS-related pathologies including muscle weakness and mass. Therefore, determining the molecular mechanism underlying increased oxidative stress in DS leads to more effective therapeutic approaches for treatment of DS.
[0232] It was demonstrated that overexpression of Sim2 in cells increases mitochondrial activity including oxygen consumption, ATP and ROS. To determine if increased Sim2 expression as observed in persons with DS promotes increased mitochondrial activity in vivo, primary mammary epithelial cells from virgin FVB and MMTV-S / m2 mice were analyzed, which over-express Sim22-4 fold over normal levels. The results showed that basal respiration was significantly elevated in MMTV-S / m2 mammary epithelial cells (FIG. 3A), consistent with the cell culture results. Moreover, we found that sustaining elevated levels of Sim2 during lactation in the MMTV-S / m2 mice resulted in a significant increase in 8-OHdG staining (FIG. 3B). Together, these results show for the first time that increased SIM2-dependent mitochondrial respiration and oxidative stress in vivo leads to mtDNA damage. These data suggest that triplication of Sim2 plays a key role in the etiology of DS through up-regulation of mitochondrial activity, resulting in sustained oxidative stress and mitochondrial dysfunction.
[0233] Sim2+I~ mice are resistant to diet-induced obesity
[0234] To determine if the metabolic phenotype observed in vitro has an impact on obesity and metabolism, female WT and Sim2+I~ mice fed either a low-fat (LFD, 10% calories from fat, Research Diets) or high-fat diet (HFD; 45% calories from fat, Research Diets) were analyzed. The results show that female Sim2+I~ mice were resistant to diet-induced obesity as compared to control mice (FIG. 4A-4B). However, no effect on food intake between WT and Sim2+I~ mice (data not shown) was observed. Comparison of fat depots in WT and Sim2+I~ mice showed a significant decrease in gonadal fat and decreased trend in perineal and mesenteric fat (FIG. 4C). To the best of our knowledge, this is the first example of a metabolic phenotype in a mouse model missing one copy of a Down syndrome critical region gene. This suggests that single copy differences in Sim2 in vivo has a dramatic impact on mitochondrial function.
[0235] SIM2 normalization partially rescues overall metabolism in the Dpi 6 DS mouse model
[0236] Mitochondrial dysfunction and oxidative stress is thought to be a key factor in skeletal muscle weakness and other DS-associated pathologies (8,12). The analysis of DS case resulting from partial trisomies of HSA21 and the development of a number of mouse models of this condition have provided insight on the causative role of dosage-sensitive genes on DS phenotypes (7,8,10,11 ,13). To investigate the role of triplication of Sim2 in DS, the well- established Dp(16)1Yey DS mouse model (Dpi 6) was utilized. The Dpi 6 mice are trisomic for the human 21 q11-q22.3 syntenic region, exhibit mitochondrial and cognitive defects and have been confirmed to overexpress Sim2 (49).
[0237] To determine if the triplication of Sim2 plays a role in the DS phenotype, Dpi 6 mice were crossed with Sim2+I~ mice maintained on a B6 background and metabolic outputs were measured using the TSE PhenoMaster system. This system measures oxygen and carbon dioxide flow to calculate energy expenditure and the respiratory exchange ratio (RER) through indirect gas calorimetry. RER was found to be significantly lower in male Sim2+ / ~ and Dpi 6 mice compared to WT controls, whereas RER levels were normalized in the Dpi 6 Sim2+ / ~ mice (FIG. 5A). Decreased RER in Sim2+ / ~ and Dpi 6 mice indicates an increased ratio of lipids to carbohydrates being utilized for metabolism, and therefore increased lipid oxidation. Additionally, total energy expenditure was increased in the Sim2+ / ~ and Dpi 6 mice and trending downward in the normalized Dp16:S / m2+ / ' mice (FIG. 5B). These measures suggest inefficient (or glycolytic) metabolism is occurring in Sim2+ / ~ and Dpi 6 mice. These findings indicate that a single copy decrease in Sim2 leads to systemic lipid oxidation and normalization of Sim2 leads to significant improvement in metabolism in the Dpi 6 mice.
[0238] SIM2 normalization partially rescues craniofacial dysmorphology in the Dpi 6 Down syndrome mouse model
[0239] Craniofacial development is highly dependent upon mitochondria both in terms of energy and regulation of signaling pathways that guide differentiation. Indeed, patients with mitochondrial disease including Leigh syndrome and Barth syndrome often present with craniofacial abnormalities. Consistent with SIM2’s role in mitochondria, studies have found human SIM2 variants associated with developmental disorders including intellectual disabilities and craniofacial abnormalities (5,6).
[0240] To determine whether the gene dosage of SIM2 contributes to craniofacial abnormalities observed in Down syndrome, a morphometric and visual comparative analysis of skulls from wild-type (WT), Dpi 6 trisomic, and Sim2 / Dp16 mice was conducted, the latter carrying only two copies of Sim2 within the Dpi 6 trisomic background. High-resolution lateral images of skulls from 12-week-old male mice were analyzed across these genotypes (FIG. 6A). Seven key craniofacial landmarks, Nasion, Bregma, Lambda, bilateral Zygion, Prosthion, and Gnathion, were overlaid onto representative skulls from each group. In addition, a scale bar (5 mm) was included to provide dimensional reference.
[0241] Qualitative comparison of skull morphology revealed that Dpi 6 mice exhibited a visibly enlarged cranial vault, widened zygomatic arches, and elongated mandibles, consistent with Down syndrome-associated craniofacial dysmorphology. In contrast, Sim2 / Dp16 skulls showed partial correction of these phenotypes, with skull proportions and mandibular projection approaching WT levels. Quantitative analysis confirmed these observations. Euclidean distances from WT for each landmark showed that Dpi 6 mice had a mean deviation of 7.96 pixels, whereas Sim2 / Dp16 mice showed a reduced mean deviation of 4.68 pixels. Procrustes shape analysis further demonstrated that Dpi 6 skulls had a shape disparity of 0.00441 , which was reduced by more than half in Sim2 / Dp16 mice (0.00181 ), indicating partial morphometric normalization of craniofacial structure (FIG. 6B).
[0242] To further visualize spatial variation, heatmaps were generated by interpolating landmark-wise deviations from WT across a 2D shape grid. The heatmap comparing Dpi 6 to WT showed intense deformation in both the cranial vault and lower mandible. In contrast, the Sim2 / Dp16 vs WT heatmap exhibited reduced intensity and spatial spread of deformation, particularly in regions corresponding to the zygomatic arch and cranial vault (FIG. 6C). These patterns further support that reducing Sim2 dosage partially rescues craniofacial abnormalities in the Dpi 6 model. Together, these data demonstrate that SIM2 gene dosage is a critical contributor to the craniofacial phenotype in the Dpi 6 model of Down syndrome, and that normalization of SIM2 levels leads to measurable, anatomically specific improvement in skull morphology.
[0243] EXAMPLE 4
[0244] Additional SIM2 target nucleic acids and antisense oligonucleotides
[0245] Identification of conserved human and mouse SIM2 ASOs
[0246] Additional target nucleic acid locations conserved between human and mouse SIM2 were elucidated on exons 1-11 in the SIM2, which can correspond to positions 36,699,888- 36,699,907 (exon 1 ), 36,709,171-36,709,196 (exon 2), 36,712,563-36,712,588 (exon 3), 36,712,591-36,712,615 (exon 3), 36,719,833-36,719,855 (exon 4), 36,726,158-36,726,186 (exon 6), 36,726,197-36,726,225 (exon 6), 36,726,263-36,726,300 (exon 6), 36,741 ,720- 36,741 ,744 (exon 8), 36,741 ,746-36,741 ,767 (exon 8), 36,741 ,782-36,741 ,822 (exon 8), 36,741 ,833-36,741 ,858 (exon 8), 36,743,514-36,743,536 (exon 9), 36,744,740-36,744,759 (exon 10), 36,744,906-36,744,930 (exon 10), 36,744,947-36,744,975 (exon 10), 36,744,995- 36,745,018 (exon 10), 36,747,712-36,747,746 (exon 11 ). ASOs may be identified from target nucleic acids similarly to those identified in Example 1 .
[0247] In some embodiments the target nucleic acid is Exon 1 , SEQ ID NO: 110: AGCTACCTGAAGATGCGCGC.
[0248] In some embodiments, the target nucleic acid is Exon 1 , SEQ ID NO: 111 : TAGGAGACGCGTGGGGACAGCCGAGC.
[0249] In some embodiments, the target nucleic acid is Exon 3, SEQ ID NO:112:GTGGTGGCCTCTGATGGCAAAATCATGTATATATC, or Exon 3, SEQ ID NO: 113: AGACCGCTTCTGTCCATTTAGGCTT.
[0250] In some embodiments, the target nucleic acid is Exon 4, SEQ ID NO: 114: GGCAACAGTATTTATGAATACAT.
[0251] In some embodiments, the target nucleic acid is Exon 6, SEQ ID NO: 115: ATGCTGGACATGTCCCTGTACGACTCCTG, Exon 6, SEQ ID NO: 116: GTGGGG CTGGTGGCCGTGGGCCAGTCGCT, or Exon 6, SEQ ID NO: 117: AACATGTTCAT GTTCAGGGCCACCTTGACCTGAAGCT.
[0252] In some embodiments, the target nucleic acid is Exon 8, SEQ ID NO: 118: TGGTGAAGGGCCAGGTCACCACCAA, Exon 8, SEQ ID NO: 119: TACTACCG GCTGCTGTCCAAGC, Exon 8, SEQ ID NO: 120: TGGGTGCAGAGCTACGCCACC GTGGTGCACAACAGCCGCTC, or Exon 8, SEQ ID NO:121 : CACTGCATCGTGAG TGTCAATTATGT.
[0253] In some embodiments, the target nucleic acid is Exon 9, SEQ ID NO:122: AAGATGAAGACAAAGCTGAGAAC.
[0254] In some embodiments, the target nucleic acid is Exon 10, SEQ ID NO: 123: TTCCAAATGGACAAACTGGA, Exon 10, SEQ ID NO: 124: TGGACTCTCACGTCTT CAGCAGCAA, Exon 10, SEQ ID NO:125: GCCAAGTTC GGGCA GCC CCA AGGATCCCC, or Exon 10, SEQ ID NO:126: TTCCTGAGCACACTGCCAGCCAGC.
[0255] In some embodiments, the target nucleic acid is Exon 11 , SEQ ID NO:127: AGCTTCCCGAGCTGCGGCCACTACCGCGAGGAGCC.
[0256] ASOs targeting across all human SIM2 exons
[0257] All other possible target nucleic acid locations may be elucidated on multiple exons in SIM2, which can correspond to positions 36,699,115-36,699,921 (exon 1 ), 36,712,531- 36,712,623 (exon 2), 36,712,533-36,712,622 (exon 3), 36,719,821-36,719,929 (exon 4), 36,723,045-36,723,130 (exon 5), 36,726,119-36,726,319 (exon 6), 36,731 ,045-36,731 ,151 (exon 7), 36,741 ,717-36,741 ,864 (exon 8), 36,743,387-36,743,555 (exon 9), 36,744,728- 36,746,324 (exon 10), 36,747,665-36,749,917 (exon 11 ). The ASOs may be designed as described herein.
[0258] ASOs targeting SIM2 exonic boundaries
[0259] The target sequence is an exonic boundary involving SIM2 exons 1-11. Target sequences consist of 36-40 nucleotides tiled across each exonic boundary of each exon (18- 20 nucleotides representing the 5’ and 3’ end of adjacent exons). These ASOs may be used as gapmers or as steric-block ASOs, which are chemically modified (2’-O-methyl (2’-OMe) and 2’-O-methoxyethyl (2’-MOE)) groups to enhance affinity and nuclease resistance and sterically hinder access of the splicesome. The binding of the ASO physically prevents the recognition of splice sites by the spliceosomal machinery or associated RNA-binding proteins, for example, SR proteins or hnRNPs), thereby redirecting splicing outcomes. This approach has been employed to either promote exon skipping or exon inclusion, depending on the location and sequence context of the target site. Importantly, because steric-blocking ASOs do not activate RNase H-mediated cleavage, they are well suited for therapeutic applications where transcript preservation is necessary, such as splice-switching therapies. The target exonic junctions are 36,699,115-36,699,921 (exon 1 ), 36,712,531-36,712,623 (exon 2), 36,712,533-36,712,622 (exon 3), 36,719,821-36,719,929 (exon 4), 36,723,045-36,723,130 (exon 5), 36,726,119-36,726,319 (exon 6), 36,731 ,045-36,731 ,151 (exon 7), 36,741 ,717- 36,741 ,864 (exon 8), 36,743,387-36,743,555 (exon 9), 36,744,728-36,746,324 (exon 10), 36,747,665-36,749,917 (exon 11 ). The 18-, 19- and 20-mer ASOs targeting the exonic junctions may be designed similarly as described herein.
[0260] EXAMPLE 5
[0261] Additional oligonucleotides targeting SIM2 exons 1-11
[0262] Oligonucleotides targeting SIM2 may be a functional nucleic acid, for example, small interfering RNAs (siRNAs), short hairpin RNAs (shRNAs), or nuclease guide RNAs (gRNAs). Such oligonucleotides are designed based on the target nucleic acids described herein effective to inhibit, mutate or delete the target nucleic acid sequence.
[0263] References
[0264] 1 . Dawson, et al. Nat Cell Biol 2020.
[0265] 2. Chrast, et al. Genome Res 1997, 7(6): 615-624.
[0266] 3. Chrast et al.. Hum Mol Genet 2000, 9 12., 1853-1864.
[0267] 4. Ema et al.. Hum Mol Genet 1999, 8 8., 1409-1415.
[0268] 5. Al-Kurbi, et al.. Eur J Med Genet 2022, 654., 104455.
[0269] 6. . Button, et al.. The Biochemical Journal 2022.
[0270] 7. et al.. Am J Physiol Regul Integr Comp Physiol 2012, 303 12., R1251-1260.
[0271] 8. Izzo, et al.. Mol Med 2018, 24 1.
[0272] 9. Carter, et al.. J Physiol 2018, 596 16., 3567-3584. DOI: 10.1113 / JP275998.
[0273] 10. Mollo, et al.. International journal of molecular sciences 2020, 21 9.
[0274] 11 . Picca, et al.. Antioxidants Basel. 2020, 9(8).
[0275] 12. Seth, et al.. The Journal of clinical investigation 2019, 129(3):915-925.
[0276] 13. Jauvin, et al.. Mol Ther Nucleic Acids 2017, 7:465-474.
Claims
WHAT IS CLAIMED IS:1 . An oligonucleotide compound, comprising: a chain of nucleobases with a sequence designed to target a Single-minded homolog 2 (SIM2) gene transcript.
2. The oligonucleotide compound of claim 1 , further comprising at least one modification in the chain of nucleobases.
3. The oigonucleotide compound of claim 2, wherein the modification is a modified internucleoside linkage between adjacent nucleobases.
4. The oligonucleotide compound of claim 3, wherein each modified internucleoside linkage is a phosphorothioate linkage.
5. The oligonucleotide compound of claim 2, wherein at least one nucleobase at the 5’ end of the chain or at least one nucleobase at the 3’ end of the chain or a combination thereof has a 2’ modification to its sugar.
6. The oligonucleotide compound of claim 5, wherein three nucleobases at the 5’ end of the chain and three nucleobases at the 3’ end of the chain comprise a locked nucleic acid as the 2’ modification.
7. The oligonucleotide compound of claim 2, wherein a plurality of the nucleobases are 5-methyl modified cytosines.
8. The oligonucleotide compound of claim 2, comprising a modified antisense oligonucleotide.
9. The oligonucleotide compound of claim 8, wherein the modified antisense oligonucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NO: 103-109 and a combination thereof.
10. The oligonucleotide compound of claim 1 , wherein the chain of nucleobases comprises a contiguous sequence of about 12 to about 25 nucleobases.
11. The oligonucleotide compound of claim 1 , comprising an antisense oligonucleotide, a small interfering RNA (siRNA), a short hairpin RNAs (shRNA), or a nuclease-directed guide RNA (gRNA).
12. The oligonucleotide compound of claim 11 , wherein the antisense oligonucleotide has a nucleotide sequence selected from the group consisting of SEQ ID NOS: 29-45, 58-69, 75-79, and 91-101 and a combination thereof.
13. A pharmaceutical composition comprising the oligonucleotide compound of claim 1 and a pharmaceutically acceptable carrier or diluent.
14. A method for treating a disorder or a disease associated with SIM2 overexpression in a subject in need thereof, comprising: administering at least once to the subject an amount of the pharmaceutical composition of claim 13 effective to normalize the overexpression of SIM2, thereby treating the disorder or the disease.
15. The method of claim 14, wherein the disorder or disease is Down syndrome, obesity, diabetes, musculoskeletal related, or related to mitochondrial dysfunction.
16. A method for normalizing expression of a Single-minded homolog 2 (SIM2) gene, comprising: contacting an RNA transcript of the SIM2 gene with at least one of the oligonucleotide compounds of claim 1 .
17. The method of claim 16, wherein the contacting step is in vivo or in vitro.
18. The method of claim 17, wherein the in vivo contacting step comprises administering the oligonucleotide compound to a patient in need thereof.
19. A modified antisense oligonucleotide, comprising: a chain of nucleosides with a modified internucleoside linkage between adjacent nucleosides; said chain comprising at least one 5’ flanking nucleoside and at least one 3’ flanking nucleoside each with a 2’ modification to its sugar; and said chain modified with a plurality of 5-methylcytosines.
20. The modified antisense oligonucleotide of claim 19, wherein the modified internucleoside linkage is a phosphorothioate linkage.21 . The modified antisense oligonucleotide of claim 19, wherein the 2’ modification to the sugar on the at least one 5’ flanking nucleoside and the at least one 3’ flanking nucleoside is a locked nucleic acid.
22. The modified antisense oligonucleotide of claim 19, wherein the chain of nucleosides consists of 18 nucleobases in a 3-12-3 gapmer structure with 3 modified 5’ flanking nucleobases, 12 contiguous nucleobases with a plurality of the 5-methylcytosines and 3 modified 3’ flanking nucleobases.
23. The modified antisense oligonucleotide of claim 22, comprising a nucleotide sequence selected from the group consisting of SEQ ID NOS: 103-109 and a combination thereof.
24. A pharmaceutical composition comprising the modified antisense oligonucleotide of claim 19 and a pharmaceutically acceptable carrier or diluent.
25. A method for treating Down syndrome in a patient in need thereof, comprising: administering to the patient at least once a therapeutically effective amount of at least one of the modified antisense oligonucleotides of claim 16 or a pharmaceutical composition thereof.
26. The method of claim 25, wherein the modified antisense oligonucleotide is administered in utero.
Citation Information
Patent Citations
Association of SIM2 with cancer
US6780642B2