Cellular encapsulation methods for improved single cell sequencing

Abstract

Disclosed are methods and microfluidic devices for successfully co-encapsulating single cells and single beads in single droplets in a high-throughput, high efficiency manner. Cells and beads are organized into two or more ordered streams flowing through separate microchannels of the microfluidic device, which can include non-rectangular microchannels. Cells and beads in the ordered streams are sufficiently spaced such that at a junction of the microfluidic device, single droplets are generated at higher co-encapsulation efficiencies that beat Poisson statistics. Single droplets including a cell and a bead can undergo single-cell sequencing.

Description

Docket Number: SBT-004WO CELLULAR ENCAPSULATION METHODS FOR IMPROVED SINGLE CELL SEQUENCING CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to, and the benefit of, U.S. Prov. App. No. 63 / 643,872, U.S. Prov. App. No.63 / 643,868, and U.S. Prov. App. No.63 / 643,873, each of which was filed on May 7, 2024, and each of which is incorporated by reference in its entirety for all purposes. BACKGROUND

[0002] Current single cell sequencing methods involve encapsulating single cells in droplets to enable downstream sequencing to interrogate properties of individual cells. For example, methods may involve encapsulating a single cell with a bead functionalized with nucleic acids (e.g., barcodes). The barcodes are incorporated and the downstream sequencing can reveal the origin of a sequenced nucleic acid.

[0003] However, current methods are often inefficient as beads and single cells are encapsulated in droplets in accordance with Poisson statistics. Thus, either beads or cells or both are often heavily diluted to avoid encapsulating multiple beads in a droplet (leading to a loss of single-cell information from the cell’s RNA being diluted across multiple beads), or to avoid encapsulating multiple cells in a droplet (leading to cross-contamination in single-cell sequencing data). Heavy dilution of either one or both of these elements produces droplets that often lack one or both a single cell and a bead (e.g., droplets that only include a bead, droplets that only include a cell, or droplets that do not include either a bead or a cell), rendering such droplets useless for purposes of single cell sequencing. Given that beads and cells are often limited in quantity (e.g., beads are expensive and time-consuming to manufacture), there is a need for improved encapsulation methods to further improve methods for single-cell sequencing and other applications that require single-cell resolution. SUMMARY

[0004] Disclosed herein are methods for performing improved single-cell sequencing by increasing the efficiency of generating single droplets including a single cell and a bead. In various embodiments, methods involve generating single droplets from two or more ordered streams (e.g., an ordered stream of cells and an ordered stream of beads), such that an 1 IPTS / 128953967.1Docket Number: SBT-004WO improved fraction of single droplets contain one cell from the ordered stream of cells and one bead of the ordered stream of beads. In particular embodiments, the fraction of the plurality of single droplets that comprise a single cell from the ordered stream of cells and a bead from the ordered stream of beads exceeds a predicted fraction predicted using a Poisson distribution. By beating Poisson statistics, this eliminates the use of high concentrations of beads and further avoids scenarios where large proportions of droplets lack one or both of a single cell and a single bead (e.g., droplets that only include a bead, droplets that only include a cell, droplets that do not include either a bead or a cell, or droplets that have more than one cell and / or more than one bead).

[0005] Altogether, the disclosed methods enable the generation of single droplets in a high-throughput manner while achieving high efficiency and minimizing numbers of empty droplets. Single droplets may be one liquid droplet of which one or more beads and / or one or more cells may be encapsulated within. To generate single droplets that contain one cell from an ordered stream of cells and one bead from an ordered stream of beads in a high-throughput and efficient manner, the cells in the ordered stream of cells and the beads in the ordered stream of beads are organized and sufficiently spaced to achieve successful co-encapsulation. In various embodiments, the cells in the ordered stream of cells and / or the beads in the ordered stream of beads are lined up in a single file through a process known as inertial focusing caused by Dean forces. Inertial focusing pushes cells or beads in a tangential direction to the direction of flow, until the cells or beads reach an equilibrium position. Once the cells and beads of the ordered streams arrive at a droplet-generation zone, also referred to herein as a junction, of the microfluidic device, one cell from the first ordered stream of cells and one bead from the ordered stream of beads are controllably encapsulated inside single droplets.

[0006] Notably, the generation of single droplets that encapsulate one cell from the ordered stream of cells and one bead from the ordered stream of beads cannot be accomplished by simply merging together two streams of cells and beads. In particular, the rate of inertial focusing increases with increasing flow velocity. However, increasing the flow velocity can prevent droplet generation due to the creation of “jetting” or “co-flow” regimes when the aqueous streams meet with the oil-phase sheath fluid. Thus, under increased flow velocity conditions, the addition of an ordered stream of beads to an ordered stream of cells will add too much aqueous flow velocity for droplet generation to occur. Conversely, if flow velocity is lowered to allow droplet generation, the cells and beads in the 2 IPTS / 128953967.1Docket Number: SBT-004WO ordered streams are not sufficiently inertially focused and therefore, fail to be controllably co- encapsulated in single droplets. Altogether, to achieve successful co-encapsulation of a single cell and a single bead, with a population frequency that exceeds Poisson statistics predictions, various competing parameters are to be simultaneously tuned to achieve sufficient ordering and droplet co-encapsulation.

[0007] The present disclosure provides in an embodiment a method for performing single cell sequencing for a plurality of cells, the method comprising: flowing a first aqueous phase comprising an ordered stream of cells of the plurality of cells in a first microchannel towards a junction; flowing a second aqueous phase comprising an ordered stream of barcoded beads in a second microchannel towards the junction; flowing an oil phase in a third microchannel towards the junction; and at the junction, generating a population of single droplets formed from the first aqueous phase, the second aqueous phase, and the oil phase, wherein a fraction of the population of single droplets comprises a single cell from the ordered stream of cells and a single barcoded bead from the ordered stream of barcoded beads; for each of one or more single droplets within the fraction of the population of single droplets, incorporating barcode sequences of the barcoded bead into nucleic acids of the cell; and sequencing at least the incorporated barcode sequences to perform single cell sequencing.

[0008] In various embodiments, the fraction of single droplets comprising a single cell from the ordered stream of cells and a single barcoded bead from the ordered stream of barcoded beads exceeds a predicted fraction of single droplets comprising a single cell from the ordered stream of cells and a single barcoded bead from the ordered stream of barcoded beads predicted using a Poisson distribution. In various embodiments, the fraction exceeds the predicted fraction by a factor ranging from 2-3. In various embodiments, the fraction of the population of single droplets are generated at a rate of at least 1 million single cells per hour. In various embodiments, the fraction of the population of single droplets are generated at a rate of at least 8 million single cells per hour. In various embodiments, incorporating barcode sequences of the barcoded bead into nucleic acids of the cell comprises performing nucleic acid amplification. In various embodiments, wherein performing nucleic acid amplification comprises performing polymerase chain reaction.

[0009] In various embodiments, the nucleic acids of the cell comprise one or more of genomic DNA, RNA, or cDNA. In various embodiments, methods disclosed herein further comprise: prior to incorporating barcode sequences of the barcoded bead into nucleic acids of the cell, reverse transcribing RNA of the cell to produce cDNA. In various embodiments, 3 IPTS / 128953967.1Docket Number: SBT-004WO sequencing at least the incorporated barcode sequences to perform single cell sequencing further comprises assigning sequence reads to cells of the plurality of cells according to presence of incorporated barcode sequences. In various embodiments, cells of the ordered stream of cells are aligned along a central axis or edge of the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned along a central axis or edge of the second microchannel. In various embodiments, cells of the ordered stream of cells are aligned through inertial focusing while flowing through the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned through inertial focusing while flowing through the second microchannel. In various embodiments, the inertial focusing of the cells is generated by flowing the first aqueous phase through a curved region of the first microchannel and the inertial focusing of the barcoded beads is generated by flowing the second aqueous phase through a curved region of the second microchannel. In various embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 45 degree change in a flow vector across a length of the undulating portion. In various embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 60 degree change, at least a 90 degree change, at least a 120 degree change, at least a 150 degree change, or at least a 180 degree change in a flow vector across a length of the undulating portion. In various embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises between 60-120 undulating portions. In various embodiments, an inter-cell spacing for at least 80% of cells in the ordered stream of cells is between 1 times an average cell diameter and 3.5 times an average cell diameter. In various embodiments, an inter-cell spacing for at least 60% of cells in the ordered stream of cells is between 1.5 times an average cell diameter and 3 times an average cell diameter. In various embodiments, a standard deviation of inter-cell spacing between pairs of successive cells is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent cells in the ordered stream of cells.

[0010] In various embodiments, an inter-cell spacing for at least 80% of barcoded beads in the ordered stream of barcoded beads is between 1 times an average bead diameter and 3.5 times an average bead diameter. In various embodiments, an inter-cell spacing for at least 60% of barcoded beads in the ordered stream of barcoded beads is between 1.5 times an average bead diameter and 3 times an average bead diameter. In various embodiments, a 4 IPTS / 128953967.1Docket Number: SBT-004WO standard deviation of inter-cell spacing between pairs of successive beads is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent beads in the ordered stream of barcoded beads.

[0011] Additionally disclosed herein is an improved method for performing single cell sequencing, comprising: flowing a first aqueous phase comprising a plurality of cells in a first microchannel towards a junction; flowing a second aqueous phase comprising a plurality of barcoded beads in a second microchannel towards the junction; flowing an oil phase in a third microchannel towards the junction; at the junction, generating a population of single droplets formed from the first aqueous phase, the second aqueous phase, and the oil phase, wherein a fraction of the population of single droplets comprises a cell from the first ordered stream of cells and a barcoded bead from the second ordered stream of cells, for each of one or more single droplets within the fraction of the population of single droplets, incorporating barcode sequences of the barcoded bead into nucleic acids of the cell; and sequencing at least the incorporated barcode sequences to perform single cell sequencing, the improvement comprising: wherein flowing the first aqueous phase comprising cells of the plurality of cells in the first microchannel comprises flowing the cells in an ordered stream in the first microchannel, wherein flowing the second aqueous phase comprising the plurality of barcoded beads in the second microchannel comprises flowing the barcoded beads in an ordered stream in the second microchannel, wherein the fraction exceeds a predicted fraction of single droplets comprising a cell from the first ordered stream and a barcoded bead from the second ordered stream predicted using a Poisson distribution.

[0012] In various embodiments, the fraction of single droplets comprising a single cell from the first ordered stream and a single barcoded bead from the second ordered stream exceeds a predicted fraction of single droplets comprising a single cell from the first ordered stream and a single barcoded bead from the second ordered stream predicted using a Poisson distribution. In various embodiments, the fraction exceeds the predicted fraction by a factor ranging from 2-3. In various embodiments, the fraction of the population of single droplets are generated at a rate of at least 1 million single cells per hour. In various embodiments, the fraction of the population of single droplets are generated at a rate of at least 8 million single cells per hour. In various embodiments, incorporating barcode sequences of the barcoded bead into nucleic acids of the cell comprises performing nucleic acid amplification. In various embodiments, performing nucleic acid amplification comprises performing polymerase chain reaction. In various embodiments, the nucleic acids of the cell comprise one or more of genomic DNA, 5 IPTS / 128953967.1Docket Number: SBT-004WO RNA, or cDNA. In various embodiments, methods disclosed herein further comprise: prior to incorporating barcode sequences of the barcoded bead into nucleic acids of the cell, reverse transcribing RNA of the cell to produce cDNA. In various embodiments, sequencing at least the incorporated barcode sequences to perform single cell sequencing further comprises assigning sequence reads to cells of the plurality of cells according to presence of incorporated barcode sequences. In various embodiments, cells of the ordered stream of cells are aligned along a central axis or edge of the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned along a central axis or edge of the second microchannel. In various embodiments, cells of the ordered stream of cells are aligned through inertial focusing while flowing through the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned through inertial focusing while flowing through the second microchannel. In various embodiments, the inertial focusing of the cells is generated by flowing the first aqueous phase through a curved region of the first microchannel and the inertial focusing of the barcoded beads is generated by flowing the second aqueous phase through a curved region of the second microchannel. In various embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 45 degree change in a flow vector across a length of the undulating portion. In various embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 60 degree change, at least a 90 degree change, at least a 120 degree change, at least a 150 degree change, or at least a 180 degree change in a flow vector across a length of the undulating portion. In various embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises between 60-120 undulating portions. In various embodiments, an inter-cell spacing for at least 80% of cells in the ordered stream of cells is between 1 times an average cell diameter and 3.5 times an average cell diameter. In various embodiments, an inter-cell spacing for at least 60% of cells in the ordered stream of cells is between 1.5 times an average cell diameter and 3 times an average cell diameter. In various embodiments, a standard deviation of inter-cell spacing between pairs of successive cells is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent cells in the ordered stream of cells. In various embodiments, an inter-cell spacing for at least 80% of barcoded beads in the ordered stream of barcoded beads is between 1 times an average bead diameter and 3.5 times an average bead diameter. In various embodiments, an inter-cell 6 IPTS / 128953967.1Docket Number: SBT-004WO spacing for at least 60% of barcoded beads in the ordered stream of barcoded beads is between 1.5 times an average bead diameter and 3 times an average bead diameter. In various embodiments, a standard deviation of inter-cell spacing between pairs of successive beads is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent beads in the ordered stream of barcoded beads. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0013] These and other features, aspects, and advantages of the present invention will become better understood with regard to the following description and accompanying drawings. It is noted that wherever practicable similar or like reference numbers may be used in the figures and may indicate similar or like functionality. For example, a letter after a reference numeral, such as “aqueous well 105A,” indicates that the text refers specifically to the element having that particular reference numeral. A reference numeral in the text without a following letter, such as “aqueous well 105,” refers to any or all of the elements in the figures bearing that reference numeral (e.g. “aqueous well 105” in the text refers to reference numerals “aqueous well 105A” and / or “aqueous well 105B” in the figures).

[0014] Figure (FIG.) 1A shows an example schematic of a microfluidic device for encapsulating a single cell and a single bead in a single droplet, in accordance with an embodiment.

[0015] FIG.1B shows an example junction of a microfluidic device, in accordance with an embodiment.

[0016] FIG.2 depicts a flow diagram for ordering cells and beads and further encapsulating a single cell and a single bead into a single droplet, in accordance with an embodiment.

[0017] FIGs.3A and 3B depicts an example curved region of a serpentine microfluidic channel for ordering cells and / or beads, in accordance with an embodiment.

[0018] FIG.3C depicts an example curved region of a spiral microfluidic channel for ordering cells and / or beads, in accordance with an embodiment.

[0019] FIG.4 shows example flow paths using pillars which combine cells or beads into a single stream to assist in ordering, in accordance with an embodiment.

[0020] FIG.5 depicts an example junction of a microfluidic device, in accordance with an embodiment.

[0021] FIG.6 depicts an example microfluidic device with serpentine microchannels.

[0022] FIG.7A depicts an example microfluidic device with spiral microchannels. 7 IPTS / 128953967.1Docket Number: SBT-004WO

[0023] FIG.7B depicts an example curved region of a spiral microchannel of the example microfluidic device shown in FIG.7A at a higher magnification.

[0024] FIG.8 is a flow diagram showing steps for performing single cell sequencing, in accordance with an embodiment.

[0025] FIG.9A shows an example schematic of a microfluidic device for encapsulating two or more cells in a single droplet, in accordance with an embodiment.

[0026] FIG.9B shows a first ordered stream of cells, a second ordered stream of cells, and the encapsulation of two cells in a single droplet, in accordance with an embodiment.

[0027] FIG.9 C illustrates a parabolic flow of fluid through a channel, with velocity differences across the channel width.

[0028] FIG.9D illustrates a crowding of cells in a parabolic flow.

[0029] FIGs.9E-F illustrate cell crowding in a rectangular microchannel and lack of cell crowding in an asymmetric microchannel.

[0030] FIGs.9H-M illustrate various shapes of non-rectangular microchannels.

[0031] FIG.10 depicts a flow diagram for ordering and encapsulating two cells into a single droplet, in accordance with an embodiment.

[0032] FIG.11A shows an example schematic of a microfluidic device for encapsulating three or more cells in a single droplet, in accordance with an embodiment.

[0033] FIG.11B shows a first ordered stream of cells, a second ordered stream of cells, a third ordered stream of cells, and the encapsulation of three cells in a single droplet, in accordance with an embodiment.

[0034] FIG.12 depicts a flow diagram for ordering and encapsulating multiple cells and / or beads into a single droplet, in accordance with an embodiment.

[0035] FIG.13 depicts an example junction of a microfluidic device, in accordance with an embodiment.

[0036] FIG.14 depicts an example of an air blade in use with a junction of two or more microchannels.

[0037] FIG.15 depicts an image illustrating co-encapsulation of cells and beads into single droplets.

[0038] FIG.16 illustrates a distribution of cells and beads within droplets.

[0039] FIG.17 illustrates a graph showing average DNA concentration extracted from droplets.

[0040] FIG.18 illustrates a graph showing experiment results of single cell sequencing. 8 IPTS / 128953967.1Docket Number: SBT-004WO

[0041] FIG.19 illustrates a three-channeled microfluidic device.

[0042] FIGs.20A-B illustrate views of a non-rectangular microchannel of a microfluidic device. DETAILED DESCRIPTION Definitions

[0043] Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0044] As used herein, "about" will be understood by persons of ordinary skill and will vary to some extent depending on the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill given the context in which it is used, "about" will mean up to plus or minus 10% of the particular value.

[0045] The term “subject” or “patient” are used interchangeably and encompass an organism, human or non-human, mammal or non-mammal, male or female.

[0046] In some embodiments, the discrete entities as described herein are droplets. The terms “emulsion,” "drop," "droplet," and "microdroplet" are used interchangeably herein, to refer to small, generally spherically structures, containing at least a first fluid phase, e.g., an aqueous phase (e.g., water), bounded by a second fluid phase (e.g., oil) which is immiscible with the first fluid phase. In some embodiments, droplets according to the present disclosure may contain a first fluid phase, e.g., oil, bounded by a second immiscible fluid phase, e.g. an aqueous phase fluid (e.g., water). In some embodiments, the second fluid phase will be an immiscible phase carrier fluid. Thus droplets according to the present disclosure may be provided as aqueous-in-oil emulsions or oil-in-aqueous emulsions. Droplets may be sized and / or shaped as described herein for discrete entities. For example, droplets according to the present disclosure generally range from 1 μm to 1000 μm, inclusive, in diameter. Droplets according to the present disclosure may be used to encapsulate cells, nucleic acids (e.g., DNA), enzymes, reagents, reaction mixture, and a variety of other components. The term emulsion may be used to refer to an emulsion produced in, on, or by a microfluidic device and / or flowed from or applied by a microfluidic device.

[0047] As used herein, a "fluid" is given its ordinary meaning, i.e., a liquid or a gas. A fluid cannot maintain a defined shape and will flow during an observable time frame to fill the container in which it is put. Thus, the fluid may have any suitable viscosity that permits flow. If two or more fluids are present, each fluid may be independently selected among 9 IPTS / 128953967.1Docket Number: SBT-004WO essentially any fluids (liquids, gases, and the like) by those of ordinary skill in the art. Certain embodiments provide a plurality of droplets. In some embodiments, the plurality of droplets is formed from a first fluid, and may be substantially surrounded by a second fluid. As used herein, a droplet is "surrounded" by a fluid if a closed loop can be drawn around the droplet through only the fluid. A droplet is "completely surrounded" if closed loops going through only the fluid can be drawn around the droplet regardless of direction. A droplet is "substantially surrounded" if the loops going through only the fluid can be drawn around the droplet depending on the direction (e.g., in some cases, a loop around the droplet will comprise mostly of the fluid by may also comprise a second fluid, or a second droplet, etc.).

[0048] In most, but not all embodiments, the droplets and the fluid containing the droplets are substantially immiscible. In some cases, however, they may be miscible. In some cases, a hydrophilic liquid may be suspended in a hydrophobic liquid, a hydrophobic liquid may be suspended in a hydrophilic liquid, a gas bubble may be suspended in a liquid, etc. Typically, a hydrophobic liquid and a hydrophilic liquid are substantially immiscible with respect to each other, where the hydrophilic liquid has a greater affinity to water than does the hydrophobic liquid. Examples of hydrophilic liquids include, but are not limited to, water and other aqueous solutions comprising water, such as cell or biological media, ethanol, salt solutions, etc.

[0049] The phrase “at a junction” refers to a step that occurs at or within the vicinity of a microfluidic junction formed by the meeting of two or more microchannels. In various embodiments, “at a junction” refers to a step that occurs immediately downstream of a junction (e.g., within 1mm, within 2mm, within 3mm, within 4mm, or within 5mm downstream of a junction). In particular embodiments, a junction is described herein in reference to droplet generation, and can be also referred to as a “droplet generation region.”

[0050] The phrase “ordered stream of cells” refers to an alignment of flowing cells within a microfluidic channel. In some embodiments, a flowing stream of cells is an “ordered stream of cells” if a parallel line that is drawn relative to the direction of a flow vector of the cells successfully crosses through each cell in the flowing stream. In some embodiments, a flowing stream of cells is an “ordered stream of cells” if a parallel line that is drawn relative to the direction of a flow vector of the cells successfully crosses through at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the cells in the flowing stream. In some embodiments, a flowing stream of cells is an “ordered stream of cells” if a line drawn parallel to the direction of a 10 IPTS / 128953967.1Docket Number: SBT-004WO flow vector of the cells successfully crosses through the center of each cell in the flowing stream.

[0051] The phrase “ordered stream of beads” or “ordered stream of barcoded beads” refers to an alignment of flowing beads within a microfluidic channel. In some embodiments, a flowing stream of beads is an “ordered stream of beads” if a parallel line that is drawn relative to the direction of a flow vector of the beads successfully crosses through each bead in the flowing stream. In some embodiments, a flowing stream of beads is an “ordered stream of beads” if a parallel line that is drawn relative to the direction of a flow vector of the beads successfully crosses through at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of the beads in the flowing stream. In some embodiments, a flowing stream of beads is an “ordered stream of beads” if a line drawn parallel to the direction of a flow vector of the beads successfully crosses through the center of each bead in the flowing stream.

[0052] The phrase “average cell diameter” refers to the average e.g., mean diameter of a particular type of cell within an ordered stream of cells within a microfluidic channel. As further described herein, the average cell diameter can influence the inter-cell spacing between pairs of cells within an ordered stream of cells within a microfluidic channel.

[0053] The term “bead” refers to a particle that may interact with a cell. For example, a particle (bead) can include polystyrene, polyethylene, or any other suitable polymer or non- polymeric material (e.g., a silicate). In some cases, the particle may be a polymer-coated particle such as polystyrene coated gold particle, polyethylene coated silica particle etc. In some embodiments, the particle may be a gel particle or a hydrogel particle. The particle may be spherical or non-spherical, and may be of any suitable size, e.g., less than about 10 micrometers, less than about 3 micrometers, less than about 1 micrometer, less than about 300 nm, less than about 100 nm, etc. In some cases, the particle may be modified to promote attachment of antibodies or other agents to the surface of the particle. For instance, in one set of embodiments, the particle may be coated with streptavidin and the antibody modified with a biotinylated portion that can bind to the streptavidin, thereby immobilizing the antibody relative to the surface of the particle.

[0054] The phrase “average bead diameter” refers to the average e.g., mean diameter of a bead within an ordered stream of beads within a microfluidic channel. As further described herein, the average bead diameter can influence the inter-bead spacing between pairs of beads within an ordered stream of beads within a microfluidic channel. 11 IPTS / 128953967.1Docket Number: SBT-004WO

[0055] The phrase “non-rectangular microchannel” encompasses a microchannel in which the cross-section of the microchannel is not rectangular. In various embodiments, a non-rectangular microchannel is an asymmetrical microchannel in which the asymmetrical microchannel includes one or fewer axes of symmetry (whereas a rectangular microchannel is symmetric across two axes). Thus, cross-section of an asymmetrical microchannel is not identical on both sides of at least one central line. For example, given a central line, the cross-section of an asymmetrical microchannel does not have two halves, sides, or parts, that are the same in shape or size. Examples of non-rectangular or asymmetrical microchannels include triangular microchannels (e.g., isosceles triangular or scalene triangular), trapezoidal microchannels (e.g., irregular trapezoidal), or U-shaped microchannels (e.g., asymmetrical U- shape). Here, these example microchannels have one or fewer axes of symmetry.

[0056] The phrase “maximum concentration” refers to a theoretical maximum concentration of cells or beads for a given microchannel design. In various embodiments, the maximum concentration of cells or beads defined by: ^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^ ^^^^ ^^^^^^^^^^ ^ wherein andwherein cross-sectional area refers to a cross-sectional area of the microchannel. Thus, the maximum concentration is a fixed value based on variables of spacing, diameter of cells or beads, and / or cross-sectional area of a microchannel. In various embodiments, the disclosed methods implement non-rectangular microchannels, which enable use of concentrations that are at least 30% of the maximum concentration (in contrast to rectangular microchannels which may only enable use of concentrations less than 30% of the maximum concentration). Overview

[0057] Described herein are methods for ordering and co-encapsulating single cells and single beads in droplets in a high-throughput and efficient manner. As described in further detail herein, methods can further involve performing single-cell sequencing to identify presence or absence of one or more mutations (e.g., insertions, deletions, polymorphisms, copy number variations, and gene fusions) of the cell. Further disclosed herein are 12 IPTS / 128953967.1Docket Number: SBT-004WO microfluidic systems for ordering streams of cells and beads and co-encapsulating single cells and single beads in single droplets. In some embodiments, encapsulation of two or more cells and / or two or more beads in a single droplet may occur through systems and methods described herein. For instance, two cells may be encapsulated with a single bead in a single droplet, two beads may be encapsulated with a single cell in a single droplet, or any other combination of cells and / or beads may be encapsulated into a single droplet.

[0058] In various embodiments, methods for co-encapsulating single cells and single beads in single droplets in a high-throughput and efficient manner generally involve the following steps: 1. Ordering a stream of cells and ordering a stream of beads through curved regions of two microchannels, where the cells and beads experience inertial focusing forces that result in the ordering of the cells and beads (e.g., in an equilibrium of substantially equally distanced cells or beads lined up in a single line in the microchannels) 2. Providing the two ordered streams (e.g., of cells and beads) to a microchannel junction where they further encounter an oil phase. By tuning the speed of the oil phase, the oil phase cuts each of the ordered streams, thereby resulting in co- encapsulation of a single cell (from the ordered stream of cells) and a single bead (from the ordered stream of beads).

[0059] Disclosed herein are methods for performing single-cell sequencing for a plurality of cells, the method comprising: flowing a first aqueous phase comprising an ordered stream of cells in a first microchannel towards a junction; flowing a second aqueous phase comprising an ordered stream of barcoded beads in a second microchannel towards the junction; flowing an oil phase in a third microchannel towards the junction; and at the junction, generating the single droplet formed from the first aqueous phase, the second aqueous phase, and the oil phase, the single droplet comprising a cell from the ordered stream of cells and a barcoded bead from the ordered stream of barcoded beads. In various embodiments, the disclosed methods achieve a high co-encapsulation efficiency, wherein at least 15% of droplets in the plurality of droplets include a single cell from the ordered stream of cells and a single barcoded bead from the ordered stream of barcoded beads. In various embodiments, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of droplets in the plurality of droplets include a single cell from the ordered stream of cells and a single bead from the ordered stream of beads. 13 IPTS / 128953967.1Docket Number: SBT-004WO

[0060] As described in further detail herein, single cell sequencing can be performed on the single cell co-encapsulated in the single droplet with the barcoded bead. For example, methods disclosed herein involve further incorporating a barcode sequence of the barcoded bead into nucleic acids derived from the cell and sequencing at least the incorporated barcode sequence. The barcode sequence can be used to trace back the origin of the sequence (e.g., traced back to the single cell), thereby enabling the identification of a presence or absence of one or more mutations in the single cell. In various embodiments, following co- encapsulation of the single cell with the single barcoded bead in the droplet, methods involve lysing the cell within the single droplet and capturing nucleic acids of the cell on the barcoded bead, reverse transcribing the captured nucleic acids to generate cDNA, amplifying the cDNA to generate amplicons comprising barcode sequences of the barcoded bead, and sequencing at least the incorporated barcode sequence. Example Methods for Encapsulating a Single Cell and Bead in a Single Droplet

[0061] Generally, methods for encapsulating a single cell and a bead in a single droplet involve at least the steps of 1) ordering streams of cells and beads in two separate microchannels, and 2) at a junction at which the two separate microchannels meet, generating the single droplet comprising a cell from the ordered stream of cells and a bead from the ordered stream of beads. As described herein, the parameters (e.g., concentration of cells and / or beads in aqueous fluid, flow rate of aqueous phase including cells and / or beads, flow rate of oil phase, microchannel width, inter-cell spacing within an ordered stream of cells, and inter-bead spacing within an ordered stream of beads) that are conducive for ordering cells or beads into ordered streams may not be conducive for co-encapsulation of single cells and single beads into single droplets. Thus, the parameters are to be tuned to achieve a fluid flow regime that achieves both ordering of streams and co-encapsulation of a single cell and a single bead into a single droplet.

[0062] Generally, within a microfluidic device, the ordering of cells and / or the ordering of beads occurs within a curved region of a microchannel of the microfluidic device. Generally, the ordering of cells and / or the ordering of beads within a curved region of a microchannel is due to inertial focusing forces arising from the curvature of the curved region of the microchannel. These secondary forces cause secondary flow, also referred to as Dean flow. For example, under sufficient Dean flow, the equilibrium positions within a microchannel become unstable owing to the impingement of the secondary flow on cells or 14 IPTS / 128953967.1Docket Number: SBT-004WO beads. This can leave a single lateral equilibrium position within the microchannel e.g., at the inside wall of the curve, thereby causing cells and / or beads to align in an ordered stream. Further details of cell ordering and Dean flow is described in Martel JM, et al. Inertial focusing in microfluidics. Annu Rev Biomed Eng.2014 Jul 11;16:371-96, which is hereby incorporated by reference in its entirety.

[0063] The co-encapsulation of a single cell and a single bead into a single droplet occurs at a junction of the microfluidic device. Generally, the junction represents the meeting of two or more microchannels, where a first microchannel carrying an ordered stream of cells and a second microchannel carrying an ordered stream of beads (e.g., ordered as described above due to inertial focusing forces arising from curved regions of microchannels). Furthermore, at least one microchannel carrying an immiscible oil phase (immiscible relative to the aqueous fluid carrying the ordered stream of cells) flows to the junction. Thus, the meeting of the two microchannels carrying ordered streams of cells and beads and the one or more microchannels carrying an immiscible oil phase results in the generation of single droplets that include a cell from the ordered stream of cells and a bead from the ordered stream of beads. Notably, the flow of the aqueous fluids carrying the ordered stream of cells and the ordered stream of beads and the flow of the immiscible oil phase are carefully controlled to avoid the entering into “jetting” or “co-flow” regimes in which droplet formation fails to occur.

[0064] Reference is now made to Figure (FIG.) 1, which shows an example schematic of a microfluidic device for encapsulating a single cell and a single bead in a single droplet, in accordance with an embodiment. FIG.1A is shown for purposes of introducing a first aqueous well 105A, a second aqueous well 105B, a first microchannel 115A, a curved region 110A of the first microchannel 115A, a second microchannel 115B, a curved region 110B of the second microchannel 115B, a first oil phase well 120A, a third microchannel 125A fluidically connected to the first oil phase well 120A, a second oil phase well 120B, a fourth microchannel 125B fluidically connected to the second oil phase well 120B, a junction 130, a collection well 140, and a sixth microfluidic channel 135 fluidically connecting the junction 130 to the collection well 140. Generally, the operation of the microfluidic device shown in FIG.1A involves flowing solutions from the left (e.g., from wells 105A and 105B) towards the right (e.g., to the collection well 140).

[0065] FIG.1A shows one example embodiment of a microfluidic device for encapsulating a single cell and a single bead in a single droplet. In some embodiments, the 15 IPTS / 128953967.1Docket Number: SBT-004WO device may be differently configured. As one example, the microfluidic device need not include two separate oil phase wells 120A and 120B and instead, includes a single oil phase well that is fluidically connected to provide the oil phase to the junction 130. Such example microfluidic devices are shown in FIG.6 and FIG.7A.

[0066] FIG.1A shows two sets of an aqueous well 105, microchannel 115, and curved region 110 of microchannel 115 leading to the junction 130. In various embodiments, a microfluidic device may include additional sets of an aqueous well 105 connected to an additional microchannel 115 with a curved region 110. For example, a microfluidic device may include three sets, four sets, five sets, six sets, seven sets, eight sets, nine sets, or ten sets of an aqueous well 105 connected to an additional microchannel 115 with a curved region 110. This enables the co-encapsulation of various types of cells and / or reagents that are provided through the various aqueous wells that lead to the junction 130. For example, in various embodiments, a microfluidic device can enable co-encapsulation of two cells or beads, three cells or beads, four cells or beads, five cells or beads, six cells or beads, seven cells or beads, eight cells or beads, nine cells or beads, or ten or more cells or beads (or combinations of any of the aforementioned cells and beads) within a single droplet.

[0067] Generally, cells are provided to the first aqueous well 105A. Beads (e.g., barcoded beads) are provided to the second aqueous well 105B. Under microfluidic control, the cells are driven from the first aqueous well 105A through at least the curved region 110A of the first microchannel 115A. Here, the curved region 110A of the first microchannel 115A imparts inertial focusing forces on the cells to generate an ordered stream of cells upon entering into the junction 130. Similarly, under microfluidic control, the beads are driven from the second aqueous well 105B through at least the curved region 110B of the second microchannel 115B. Here, the curved region 110B of the second microchannel 115B imparts inertial focusing forces on the beads to generate an ordered stream of beads upon entering into the junction 130. For simple diagrammatic purposes, curved regions 110A and 110B are shown as serpentine portions of the first microchannel 115A and second microchannel 115B. However, as discussed in further detail herein (e.g., and as shown in FIG.6 and 9A), the curved regions 110A and 110B can be, in various embodiments, significantly more complicated.

[0068] In various embodiments, reagents may be further provided to one or both of the aqueous wells 105 shown in FIG.1A, such that upon co-encapsulation of the single cell and single bead at the junction 130, the reagents, or portions thereof, are similarly encapsulated in 16 IPTS / 128953967.1Docket Number: SBT-004WO the single droplet. In various embodiments, reagents may be useful for performing single- cell sequencing. In various embodiments, the reagents are provided to aqueous well 105A with the barcoded beads. In various embodiments, the reagents are provided to aqueous well 105A with the cells. Exemplary reagents include lysis reagents, chemical stimuli, a proteinase (e.g., proteinase K), chelators, nucleic acid extension reagents, replication, transcription or amplification reagents such as polymerases, reverse transcriptases, transposases which can be used for transposon based methods, nucleoside triphosphates or NTP analogues, primer sequences and additional cofactors such as divalent metal ions used in such reactions, ligation reaction reagents, such as ligase enzymes and ligation sequences, dyes, labels, or other tagging reagents. In various embodiments, certain reagents are provided to aqueous well 105B such that they do not prematurely interact with the cell in aqueous well 105A. For example, lysis reagents may be provided to aqueous well 105B with the barcoded beads such that the lysis reagents contact the cells upon co-encapsulation at the junction 130 (and not prior to co-encapsulation). Exemplary lysis reagents include surfactant based lysis solutions such as non-ionic surfactants (e.g., TritonX-100 and Tween 20) or ionic surfactants (e.g., sarcosyl and sodium dodecyl sulfate (SDS)).

[0069] In various embodiments, as shown in FIG.1A, the first channel 115A may include a non-curved region 118A leading up to the junction 130. Thus, the non-curved region 118A is located proximal to the junction 130 in comparison to the curved region 110A of the first microchannel 115A. Similarly, the second microchannel 115B may include a non-curved region 118B leading up to the junction 130. Thus, the non-curved region 118B is located proximal to the junction 130 in comparison to the curved region 110B of the second microchannel 115B. Here, the non-curved region 118A and 118B leading up the junction 130 enable the respective ordered streams to approach the junction 130 while experiencing reduced, limited, or no inertial focusing forces.

[0070] An immiscible oil phase is provided to the oil phase well 120. Here, under microfluidic control, the oil phase flows through the third microchannel 125A and / or the fourth microchannel 125B to meet at the junction 130. Reference is now made to FIG.1B, which shows a zoomed in view of the junction 130. In particular, FIG.1B shows a first ordered stream of cells 150A entering the junction 130 through the first microchannel 115A, a second ordered stream of cells 150B entering the junction 130 through the second microchannel 115B, and the immiscible oil phases entering the junction 130 through the third microchannel 125A and the fourth microchannel 125B. The flowing aqueous fluids 17 IPTS / 128953967.1Docket Number: SBT-004WO including the two ordered streams of cells are pinched by the flowing oil phases, thereby causing droplet formation downstream of the junction 130. Specifically, as shown in FIG. 1B, a single droplet 155 includes two or more cells 160, where one cell originates from the first ordered stream of cells 150A and another cell originates from the second ordered stream of cells 150B.

[0071] Exemplary oils that are used as an immiscible oil phase can be selected based upon chemical properties e.g., molecular structure, content, solvating strength, viscosity, boiling point, thermal expansion coefficient, oil-in-water solubility, water-in-oil solubility, dielectric constant, polarity, water-in-oil surface tension, and / or oil-in-water surface tension. Examples of suitable oils can include fluorinated oils, non-fluorinated oils, alkanes (e.g., hexane, decane, octane, and the like), mineral oils, plant oils, vegetable oils, comestible oils, mineral oil, oleic acid, embryo-tested mineral oil, light mineral oil, heavy mineral oil, PCR mineral oil, AS4 silicone oil, AS 100 silicone oil, AR20 silicone oil, AR 200 silicone oil, AR 1000 silicone oil, AP 100 silicone oil, AP 1000 silicone oil, AP 150 silicone oil, AP 200 silicone oil, CR 200 Silicone oil, DC 200 silicone oil, DC702 silicone oil, DC 710 silicone oil, octanol, decanol, acetophenone, perfluoro-oils, perfluorononane, perfluorodecane, perfluorodimethylcylcohexane, perfluoro-1-butanesulfonyl fluoride, perfluoro-1-octanesulfonyl fluoride, perfluoro-1-octanesulfonyl fluoride, nonafluoro-1- butanesulfonyl chloride, nonafluoro-tert-butyl alcohol, perfluorodecanol, perfluorohexane, perfluorooctanol, perfluorodecene, perfluorohexene, perfluorooctene, fuel oil, halocarbon oil 28, halocarbon oil 700, hydrocarbon oil, glycerol, 3M Fluoriner™ fluids (FC- 40, FC-43, FC-70, FC-72, FC-77, FC-84. FC-87, FC-3283), oils comprising trifluoroacetic acid, oils comprising hexafluoroisopropanol, Krytox oils (e.g., oils comprising hexafluoropropylene epoxide and / or polymers thereof), oil comprising polyhexafluoropropylene oxide and / or polymers thereof, Krytox GPL oils, oils comprising perfluoropolyether, oils comprising perfluoroalkylether, oils comprising perfluoropolyalkylether, Solvay Galden oils, oils comprising hydrofluoroethers (e.g., HFE- 7500, HFE-7100, HFE-7200, HFE-7600), oils comprising perfluoroalkylamines (e.g., Fluorinert FC-3283 and Fluorinert FC-40), soybean oil, castor oil, coconut oil, cedar oil, clove bud oil, fir oil, linseed oil, safflower oil, sunflower oil, almond seed oil, anise oil, clove oil, cottonseed oil, corn oil, croton oil, olive oil, palm oil, peanut oil, bay oil, borage oil, bergamot oil, cod liver oil, macadamia nut oil, camada oil, chamomile oil, citronella oil, eucalyptus oil, fennel oil, lavender oil, lemon oil, nutmeg oil orange oil, petitgrain oil, 18 IPTS / 128953967.1Docket Number: SBT-004WO rose oil, tarragon oil, tung oil, basil oil, birch oil, black pepper oil, birch tar oil, carrot seed oil, cardamom oil, cassia oil, sage oil, cognac oil, copaiba balsam oil, cypress oil, eucalyptus oil, dillweed oil, grape fruit oil, ginger oil, juniper oil, lavender oil, lovage oil, majoram oil, mandarin oil, myrrh oil, neroli oil, olibanum oil, onion oil, paraffin oil, origanum oil, parsley oil, peppermint oil, pimenta leaf oil, sage oil, rosemary oil, rose oil, sandalwood oil, sassafras oil, spearmint oil, thyme oil, transformer oil, verbena oil, and rapeseed oil.

[0072] Generally, after generating single droplets that include a single cell and a bead, the droplets are collected. For example, a population of droplets, a fraction of which contains a single cell and a bead, can be collected such that one or more reactions useful for single-cell sequencing can be performed. Returning to FIG.1A, the droplets containing a single cell and a bead continue to flow down the microchannel 135 towards a collection well 140. In various embodiments, after the

[0073] Reference is now made to FIG.2, which depicts a flow diagram for ordering and encapsulating a cell and a bead into a single droplet, in accordance with an embodiment. As shown in FIG.2, step 210 involves flowing a first aqueous phase comprising an ordered stream of cells towards a junction in a first microchannel. Step 220 involves flowing a second aqueous phase comprising an ordered stream of beads towards a junction in a second microchannel. Step 230 involves flowing an oil phase in a third microchannel towards the junction. Step 240 involves generating a single droplet from the first aqueous phase, the second aqueous phase, and the oil phase, wherein the single droplet comprises a cell from the ordered stream of cells and a bead from the ordered stream of beads. Ordering Cells or Beads in a Stream

[0074] Embodiments described herein involve generating ordered streams of cells or beads within microfluidic channels. In various embodiments, methods and apparati of the present disclosure involve generating two or more ordered streams e.g., an ordered stream of cells and an ordered stream of beads, within two or more microfluidic channels. For example, embodiments may involve generating exactly an ordered stream of cells and an ordered stream of beads within two microfluidic channels. In other scenarios, embodiments may involve generating three ordered streams of cells and / or beads within three microfluidic channels, four ordered streams of cells and / or beads within four microfluidic channels, five ordered streams of cells and / or beads within five microfluidic channels, six ordered streams of cells and / or beads within six microfluidic channels, seven ordered streams of cells and / or 19 IPTS / 128953967.1Docket Number: SBT-004WO beads within seven microfluidic channels, eight ordered streams of cells and / or beads within eight microfluidic channels, nine ordered streams of cells and / or beads within nine microfluidic channels, or ten ordered streams of cells and / or beads within ten microfluidic channels. As will be understood by a person of ordinary skill in the art, this description expressly contemplates numeric combinations of cells and beads based on the numbers of microfluidic channels beyond those explicitly described, e.g., generating two ordered streams of cells and one ordered stream of beads within three microchannels, etc.

[0075] Although the subsequent description is in reference to the ordering of cells and / or beads within a single microchannel, the description can be similarly applied to the ordering of cells and / or beads within multiple microchannels. Generally, cells or beads in a microchannel are aligned into an ordered stream through a process known as inertial focusing caused by Dean forces. Inertial focusing push cells in a tangential direction to the direction of flow, until cells or beads reach an equilibrium position. In various embodiments, the equilibrium position may be along a central axis of the microchannel. Thus, in such embodiments, cells and / or beads of an ordered stream are aligned along the central axis of the microchannel. In various embodiments, the equilibrium position may not be along the central axis of the microchannel, and instead may be along a side or edge of the microchannel due to laminar fluid flow.

[0076] Generally, the inertial focusing due to secondary forces (e.g., Dean forces) arises due to the curvature of a microchannel (e.g., due to curved region 110A or curved region 110B shown in FIG.1A). For example, Dean flow arises due to velocity differences in a microchannel cross section, such as in parabolic flow where the fluid in the center of a channel moves faster than fluid near the walls as described, e.g., by Poiseuille’s law. The additional momentum carried by the faster-moving fluid in the center of a channel carries it toward the outer wall of the channel curvature as it enters a curve. Owing to conservation laws, this generates a recirculation of fluid toward the center of the channel curvature along top and bottom surfaces of the channel. Altogether, the implementation of a curved region within a microchannel imparts inertial focusing forces on flowing cells or beads, thereby aligning the flowing cells or beads to generate an ordered stream of cells or beads within the microchannel.

[0077] In various embodiments, the curved region of a microfluidic channel includes at least an undulating portion in which the directional flow vector of cells or beads changes over the length of the undulating portion. The change in the directional flow vector causes the 20 IPTS / 128953967.1Docket Number: SBT-004WO imparting of inertial focusing forces on the flowing cells or beads. In various embodiments, the curved region comprises at least one undulating portion comprising at least a 45 degree change in a flow vector across a length of the undulating portion. In various embodiments, the curved region comprises at least one undulating portion comprising at least a 60 degree change, at least a 90 degree change, at least a 120 degree change, at least a 150 degree change, or at least a 180 degree change in a flow vector across a length of the undulating portion.

[0078] Reference is now made to FIG.3A which depicts an example curved region of a serpentine microfluidic channel for ordering cells or beads, in accordance with an embodiment. For example, the curved region 115 shown in FIG.3A may refer to curved region 115A or curved region 115B shown in FIG.1A. FIG.3A shows a serpentine microfluidic channel with multiple asymmetric curves. In particular, the flow of cells or beads enters from the left side labeled as “Cell Inlet.” The cells or beads flow through multiple undulating portions (e.g., undulating portions 310A, 310B, 310C, 310D, and 310E). Following the flow through the undulating portions, which impart inertial focusing forces, the flowing cells or beads exit to the right as an ordered stream.

[0079] FIG.3A also shows the directional flow vector of cells or beads as they flow through the various undulating portions 310. Specifically, referring to the directional flow vector corresponding to undulating portion 310A, the flow vector begins at an upward 90odirection (assuming that a 0odirection is horizontally to the right). As the cells or beads continue to flow through undulating portion 310A, the flow vector changes. For example, proceeding from the upward 90odirection, the flow vector decreases to 45o, then to 0o, then to -45o, and then to -90oat the end of undulating portion 310A. Referring to the directional flow vector corresponding to undulating portion 310B, the flow vector may begin at a downward - 90odirection and then rapidly reverse to an upward 90odirection. The rapid directional flow change across the length of undulating portion 310B may further assist in the ordering of the stream of cells or beads. As shown in FIG.3A, the cells or beads can further flow through undulating portions 310C and 310D, which may be duplicative of undulating portions 310A and 310B, respectively. Finally, the cells or beads can further flow through undulating portion 310E, which may be duplicative of undulating portion 310A and / or undulating portion 310C.

[0080] Although FIG.3A depicts five undulating portions in the asymmetrically curved microchannel, in various embodiments, there may be additional or fewer undulating portions 21 IPTS / 128953967.1Docket Number: SBT-004WO in the curved region 115 of the microchannel. In various embodiments, the curved region 115 includes between 30 and 180 undulating portions. In various embodiments, the curved region 115 includes between 35 and 170 undulating portions, between 40 and 160 undulating portions, between 45 and 150 undulating portions, between 50 and 140 undulating portions, between 55 and 130 undulating portions, between 60 and 120 undulating portions, between 65 and 110 undulating portions, between 70 and 100 undulating portions, or between 75 and 90 undulating portions. In particular embodiments, the curved region 115 includes between 60 and 120 undulating portions.

[0081] Furthermore, FIG.3A depicts two different undulating portions (e.g., undulating portion 310A and undulating portion 310B) that are then duplicated over the length of the curved region 115. Here, undulating portion 310A and undulating portion 310B may differ in that they have different radii of curvature. Specifically, undulating portion 310A may have a first radius of curvature that is larger than the radius of curvature of undulating portion 310B. Thus, as cells or beads flow through the curved region 115, the cells or beads experience different inertial focusing forces due to the first radius of curvature of the undulating portion 310A and the second radius of curvature of the undulating portion 310B. In various embodiments, undulating portion 310A and undulating portion 310B (as well as the duplicative undulating portions) have the same radius of curvature. Thus, in such embodiments, the radius of curvature of the curved region 115 of the microchannel may be constant across the full length of the curved region 115.

[0082] Reference is now made to FIG.3B, which depicts an example curved region of a serpentine microfluidic channel for ordering cells or beads, in accordance with a second embodiment. Here, the curved region 115 shown in FIG.3B may include a unit 340A which includes the undulating portions 310 (e.g., 310A, 310B, 310C, 310D, and 310E) shown in FIG.3A. Furthermore, curved region 115 shown in FIG.3B may further include an additional unit 340B including additional undulating portions. Here, additional unit 340B may be a reflection of the undulating portions of the unit 340A. Thus, cells or beads flow in from the top left, labeled as “inlet” through the undulating portions of the unit 340A and then continue to flow through the undulating portions of the unit 340B to the outlet, labeled as an “ordered stream.” Generally, the curved region 115 shown in FIG.3B includes additional undulating portions in comparison to the curved region 115 shown in FIG.3A, which means that cells or beads flowing through the curved region 115 in FIG.3B experience inertial focusing forces along the longer length of the curved portion 115 in FIG.3B. The longer 22 IPTS / 128953967.1Docket Number: SBT-004WO length of the curved region assists in consistent ordering of cells or beads within the microchannel.

[0083] Reference is now made to FIG.3C, which depicts an example curved region of a spiral microfluidic channel for ordering cells or beads, in accordance with an embodiment. Generally, in a spiral microfluidic channel, inertial focusing forces increase as the radius of curvature in the microchannel decreases (e.g., a tighter curve of a microchannel creates a larger imbalance between the outward and inward forces, which preferentially pushes the cells or beads towards the inside wall of the curve). As shown in FIG.3C, the cell inlet can feed cells into the curved region 115. The radius of curvature of the curved region 115 increases with every loop, so inertial focusing becomes less efficient and flow resistance increases, which lowers overall flow velocity and further decreases inertial focusing. The equilibrium position for inertial focusing can be along the inner wall of the microchannel.

[0084] FIG.3C depicts a spiral microfluidic channel with two loops (e.g., one interior loop and one exterior loop leading to the outlet labeled as “ordered stream”). In various embodiments, the spiral microfluidic channel may include additional loops. For example, the spiral microfluidic channel may include three loops, four loops, five loops, six loops, seven loops, eight loops, nine loops, or ten loops before leading to the outlet. FIG.3C further shows the directional flow vector of cells or beads over a length of half of a loop. For example, beginning at the bottom portion of the loop, the directional flow vector is to the left (e.g., 180o). As the cells or beads travel along the length of the channel, the flow vector continuously decreases from 180oto 135o, then to 90oat the halfway point, then to 45oand then to 0obefore exiting through the outlet. Thus, over a half-length of a loop, the flow vector changes a full 180o. Furthermore, over a full length of a loop, the flow vector changes a full 360o.

[0085] In various embodiments, an ordered stream of cells includes 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more 18 or more 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, 95 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, 150 or more, 160 or more, 170 or more, 180 or more, 190 or more, 200 or more, 250 or more, 300 or more, 350 or more, 400 or more, 450 or more, 500 or more, 600 or more, 700 or more, 800 or more, 900 or more, 1000 or more, 1200 or more, 23 IPTS / 128953967.1Docket Number: SBT-004WO 1500 or more, 1800 or more, 2000 or more, 2500 or more, 3000 or more, 4000 or more, 5000 or more, 10,000 or more, 15,000 or more, 20,000 or more, 25,000 or more, 30,000 or more, 40,000 or more, 50,000 or more, 100,000 or more, 200,000 or more, 300,000 or more, 400,000 or more, 500,000 or more, or 1 million or more cells. In particular embodiments, an ordered stream of cells include between 10 and 1000 cells, between 20 and 900 cells, between 30 and 800 cells, between 40 and 700 cells, between 50 and 600 cells, between 60 and 500 cells, between 70 and 400 cells, between 80 and 300 cells, between 90 and 200 cells, or between 100 and 150 cells.

[0086] As described herein, the inter-cell spacing refers to the distance between any pair of cells (e.g., center of a first cell and a center of a second cell) in the ordered stream. In particular embodiments, the inter-cell spacing refers to the distance between two successive cells (e.g., no other cell is present between the two successive cells) in the ordered stream. The inter-cell spacing may be described in relation to a cell diameter, such as an average cell diameter of cells in the ordered stream. In various embodiments, the inter-cell spacing between any pair of successive cells is between 0.5 times an average cell diameter and 5.5 times an average cell diameter. In particular embodiments, the inter-cell spacing between any pair of successive cells is between 1 times an average cell diameter and 5 times an average cell diameter, between 1.2 times an average cell diameter and 4 times an average cell diameter, between 1.5 times an average cell diameter and 3.5 times an average cell diameter, between 2 times an average cell diameter and 3 times an average cell diameter. In particular embodiments, the inter-cell spacing between any pair of successive cells is about 1 cell diameter, about 2 cell diameters, about 3 cell diameters, about 4 cell diameters, or about 5 cell diameters. In various embodiments, the cell diameter (e.g., average cell diameter) of cells is from about 5 µm to about 25 µm. Further example cell diameters are disclosed herein.

[0087] In various embodiments, for an ordered stream of cells, the inter-cell spacing for at least 80% of cells in the ordered stream is between 1 times an average cell diameter and 3.5 times an average cell diameter. In various embodiments, for an ordered stream of cells, the inter-cell spacing for at least 60% of cells in the ordered stream is between 1.5 times an average cell diameter and 3 times an average cell diameter. In various embodiments, for an ordered stream of cells, a standard deviation of inter-cell spacing between pairs of successive cells is less than 10 µm when measured over 10 pairs of adjacent cells in the first ordered stream of cells. In various embodiments, for an ordered stream of cells, a standard deviation of inter-cell spacing between pairs of successive cells is less than 10 µm when measured over 24 IPTS / 128953967.1Docket Number: SBT-004WO 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent cells in the first ordered stream of cells. In various embodiments, for an ordered stream of cells, a standard deviation of inter-cell spacing between pairs of successive cells is less than 9 µm, less than 8 µm, or less than 7 µm when measured over 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent cells in the first ordered stream of cells.

[0088] In various embodiments, an ordered stream of beads includes 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, 15 or more, 16 or more, 17 or more 18 or more 19 or more, 20 or more, 21 or more, 22 or more, 23 or more, 24 or more, 25 or more, 30 or more, 35 or more, 40 or more, 45 or more, 50 or more, 55 or more, 60 or more, 65 or more, 70 or more, 75 or more, 80 or more, 85 or more, 90 or more, 95 or more, 100 or more, 110 or more, 120 or more, 130 or more, 140 or more, 150 or more, 160 or more, 170 or more, 180 or more, 190 or more, 200 or more, 250 or more, 300 or more, 350 or more, 400 or more, 450 or more, 500 or more, 600 or more, 700 or more, 800 or more, 900 or more, 1000 or more, 1200 or more, 1500 or more, 1800 or more, 2000 or more, 2500 or more, 3000 or more, 4000 or more, 5000 or more, 10,000 or more, 15,000 or more, 20,000 or more, 25,000 or more, 30,000 or more, 40,000 or more, 50,000 or more, 100,000 or more, 200,000 or more, 300,000 or more, 400,000 or more, 500,000 or more, or 1 million or more beads. In particular embodiments, an ordered stream of beads include between 10 and 1000 beads, between 20 and 900 beads, between 30 and 800 beads, between 40 and 700 beads, between 50 and 600 beads, between 60 and 500 beads, between 70 and 400 beads, between 80 and 300 beads, between 90 and 200 beads, or between 100 and 150 beads.

[0089] As described herein, the inter-bead spacing refers to the distance between any pair of beads (e.g., center of a first bead and a center of a second bead) in the ordered stream. In particular embodiments, the inter-bead spacing refers to the distance between two successive beads (e.g., no other bead is present between the two successive beads) in the ordered stream. The inter-bead spacing may be described in relation to a bead diameter, such as an average bead diameter of beads in the ordered stream. In various embodiments, the inter-bead spacing between any pair of successive beads is between 0.5 times an average bead diameter and 5.5 times an average bead diameter. In particular embodiments, the inter-bead spacing between any pair of successive beads is between 1 times an average bead diameter and 5 times an average bead diameter, between 1.2 times an average bead diameter and 4 times an average bead diameter, between 1.5 times an average bead diameter and 3.5 times an average 25 IPTS / 128953967.1Docket Number: SBT-004WO bead diameter, between 2 times an average bead diameter and 3 times an average bead diameter. In particular embodiments, the inter-bead spacing between any pair of successive beads is about 1 bead diameter, about 2 bead diameters, about 3 bead diameters, about 4 bead diameters, or about 5 bead diameters. In various embodiments, the bead diameter (e.g., average bead diameter) is from about 5 µm to about 25 µm. Further example bead diameters are disclosed herein.

[0090] In various embodiments, for an ordered stream of beads, the inter-bead spacing for at least 80% of beads in the ordered stream is between 1 times an average bead diameter and 3.5 times an average bead diameter. In various embodiments, for an ordered stream of beads, the inter-bead spacing for at least 60% of beads in the ordered stream is between 1.5 times an average bead diameter and 3 times an average bead diameter. In various embodiments, for an ordered stream of beads, a standard deviation of inter-bead spacing between pairs of successive beads is less than 10 µm when measured over 10 pairs of adjacent beads in the first ordered stream of beads. In various embodiments, for an ordered stream of beads, a standard deviation of inter-bead spacing between pairs of successive beads is less than 10 µm when measured over 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent beads in the first ordered stream of beads. In various embodiments, for an ordered stream of beads, a standard deviation of inter-bead spacing between pairs of successive beads is less than 9 µm, less than 8 µm, or less than 7 µm when measured over 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent beads in the first ordered stream of beads. Parameters for Ordering Cells or Beads

[0091] As described herein, tunable parameters are set to achieve ordering of cells or beads and successful co-encapsulation of single cells and single beads in single droplets. Example tunable parameters include: concentration of cells or beads in aqueous fluid, flow rate of aqueous phase including cells or beads, flow rate of oil phase, microchannel width, inter-cell spacing, and inter-bead spacing within an ordered stream. Disclosed herein are example sets of parameters that are conducive for ordering streams of cells and / or beads and co-encapsulating single cells and single beads in single droplets. Microfluidic Channel Dimensions and Cell Diameter

[0092] Generally, the successful ordering of cells or beads into a stream can be dependent on the microfluidic channel width as well as the concentration of the cells or beads. For 26 IPTS / 128953967.1Docket Number: SBT-004WO example, as the microchannel width is widened, the maximum concentration of cells or beads that can be processed decreases. Conversely, if the microchannel width is decreased, flow resistance increases, thereby limiting the volume of solution that can be processed per unit time. Therefore, microchannel width should be optimized to allow for maximum volume throughput and maximum cell or bead concentration.

[0093] The description below refers to a single microchannel; however, one skilled in the art would understand that the description can refer to either or both of the microchannels (e.g., first microchannel 115A and / or second microchannel 115B) as described in FIG.1A. In various embodiments, the appropriate width of a curved region of a microchannel (e.g., first microchannel and / or second microchannel) for ordering a stream of cells or beads is dependent on the diameter of the cells or beads. The diameter of the cells or beads can refer to an average cell diameter of cells or beads. In various embodiments, the width of a microchannel (e.g., a curved region of a microchannel) for ordering a stream of cells or beads is from about 1 times the cell or bead diameter to about 20 times the cell or bead diameter. Put another way, a ratio between a width of the microchannel and an average diameter of cells in an ordered stream of cells or beads is between 1 and 20. In various embodiments, the width of a microchannel (e.g., a curved region of a microchannel) for ordering a stream of cells or beads is from about 2 times the diameter (e.g., of cells or beads) to about 8 times the diameter, from about 3 times the diameter to about 7 times the diameter, or from about 4 times the diameter to about 6 times the diameter. In various embodiments, the width of microchannel (e.g., a curved region of a microchannel) for ordering a stream of cells or beads is about 1 times, about 1.5 times, about 2 times, about 2.5 times, about 3 times about 3.5 times, about 4 times, about 4.5 times, about 5 times, about 5.5 times, about 6 times, about 6.5 times, about 7 times, about 7.5 times, about 8 times, about 8.5 times, about 9 times, about 9.5 times, about 10 times, about 11.5 times, about 12 times, about 12.5 times, about 13 times, about 13.5 times, about 14 times, about 14.5 times, about 15 times, about 15.5 times, about 16 times, about 16.5 times, about 17 times, about 17.5 times, about 18 times, about 18.5 times, about 19 times, about 19.5 times, or about 20 times the diameter (e.g., of cells or beads). In particular embodiments, a ratio between a width of the microchannel and an average diameter in an ordered stream of cells is between 1.5 and 7.5. In particular embodiments, a ratio between a width of the microchannel and an average diameter in an ordered stream of cells or beads is between 2.5 and 5.0. In particular embodiments, a ratio between a width of the microchannel and an average diameter of cells or beads in an ordered 27 IPTS / 128953967.1Docket Number: SBT-004WO stream of cells or beads is between 10.0 and 20.0, such as between 11.0 and 19.0, between 12.0 and 18.0, between 13.0 and 17.0, or between 14.0 and 16.0.

[0094] In various embodiments, the cell diameter (e.g., average cell diameter of a population of cells that undergo ordering) of cells is from about 5 µm to about 25 µm. In various embodiments, the cell diameter (e.g., average cell diameter of a population of cells that undergo ordering) of cells is from about 6 µm to about 24 µm, from about 7 µm to about 23 µm, from about 8 µm to about 22 µm, from about 9 µm to about 21 µm, from about 10 µm to about 20 µm, from about 11 µm to about 19 µm, from about 12 µm to about 18 µm, from about 13 µm to about 17 µm, or from about 14 µm to about 16 µm. In various embodiments, the cell diameter (e.g., average cell diameter of a population of cells that undergo ordering) of cells is about 5 µm, about 6 µm, about 7 µm, about 8 µm, about 9 µm, about 10 µm, about 11 µm, about 12 µm, about 13 µm, about 14 µm, about 15 µm, about 16 µm, about 17 µm, about 18 µm, about 19 µm, about 20 µm, about 21 µm, about 22 µm, about 23 µm, about 24 µm, or about 25 µm.

[0095] In various embodiments, beads may be of uniform size or heterogeneous size. In some embodiments, the diameter of a bead may be about 1 μm, 5 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 250 μm, 500 μm, or 1 mm. In some cases, a bead may have a diameter of at least about 1 μm, 5 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 250 μm, 500 μm, 1 mm, or more. In some cases, a bead may have a diameter of less than about 1 μm, 5 μm, 10 μm, 20 μm, 30 μm, 40 μm, 50 μm, 60 μm, 70 μm, 80 μm, 90 μm, 100 μm, 250 μm, 500 μm, or 1 mm. In some embodiments, a bead may have a diameter in the range of about 40-75 μm, 30-75 μm, 20-75 μm, 40-85 μm, 40-95 μm, 20-100 μm, 10-100 μm, 1-100 μm, 20-250 μm, or 20-500 μm.

[0096] In various embodiments, the width of a microchannel (e.g., first microchannel and / or second microchannel) is between from about 5 µm to about 200 µm. In various embodiments, the width of a microchannel is between from about 10 µm to about 100 µm, between from about 15 µm to about 95 µm, between from about 20 µm to about 90 µm, between from about 25 µm to about 85 µm, between from about 30 µm to about 80 µm, between from about 35 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of a microchannel is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 28 IPTS / 128953967.1Docket Number: SBT-004WO µm). In various embodiments, the width of a microchannel is between from about 50 µm to about 75 µm.

[0097] Another tunable parameter includes the microchannel length. Specifically, the length of the curved region of a microchannel (e.g., first microchannel and / or second microchannel) can be tuned to allow more time for the Dean forces to inertially focus the cells or beads. However, increasing the length of the curved region of a microchannel (e.g., first microchannel and / or second microchannel) will also increase flow resistance, and decreases flow velocity.

[0098] In various embodiments, the length of a curved region of a microchannel (e.g., first microchannel and / or second microchannel) is between from about 10 mm to about 500 mm. In various embodiments, the length of a curved region of a microchannel (e.g., first microchannel and / or second microchannel) is between from about 125 mm to about 400 mm, between from about 150 mm to about 300 mm, or between from about 175 mm to about 200 mm. In various embodiments, the length of a curved region of a microchannel (e.g., first microchannel and / or second microchannel) is between from about 100 mm to about 300 mm, between from about 125 mm to about 275 mm, between from about 150 mm to about 250 mm, between from about 175 mm to about 225 mm, between from about 180 mm to about 220 mm, between from about 185 mm to about 215 mm, between from about 190 mm to about 210 mm, or between from about 195 mm to about 205 mm. In various embodiments, the length of a curved region of a microchannel (e.g., first microchannel and / or second microchannel) is between from about 30 mm to about 400 mm, between from about 40 mm to about 350 mm, or between from about 50 mm to about 300 mm. In various embodiments, the length of a curved region of a microchannel (e.g., first microchannel and / or second microchannel) is between from about 40 mm to about 200 mm, between from about 50 mm to about 150 mm, between from about 60 mm to about 140 mm, between from about 70 mm to about 130 mm, between from about 80 mm to about 120 mm, between from about 85 mm to about 115 mm, between from about 90 mm to about 110 mm, or between from about 95 mm to about 105 mm. In various embodiments, the length of a curved region of a microchannel (e.g., first microchannel and / or second microchannel) is about 100 mm. Concentration of cells or beads

[0099] Generally, the concentration of cells and / or beads are tunable parameters for influencing the ordering of a stream of cells or beads. For example, providing too low of a concentration can result in too low or slow of a throughput analysis. On the contrary, using 29 IPTS / 128953967.1Docket Number: SBT-004WO too high of a concentration will cause aggregation and disruptive flow, thereby resulting in encapsulation of more than the desired numbers of cells and beads in a droplet, e.g., more than one cell or more than one bead into a droplet from an ordered stream.

[0100] In various embodiments, the concentration of cells or beads can be dependent on values of other tunable parameters. For example, the appropriate concentration can be determined based on any of 1) microchannel diameter, 2) inter-cell or inter-bead spacing, 3) microchannel width, and / or 4) microchannel height. In particular embodiments, the appropriate concentration is dependent on 1) microchannel diameter, 2) inter-cell or inter- bead spacing, 3) microchannel width, and / or 4) microchannel height.

[0101] In various embodiments, the concentration of cells or beads ^^^in an ordered stream is defined according to Equation (1): ^^^^^^^^^^ ^^^^ ^^^^^^^^^^ 1 ^^^^^^^^^^^ ^^^^ ^^^^^^^^^^^ଷି^^^ ^^^ ^ ൨ ൌ^ ^^ ^ ^ ∗ 10 ^^ ^^^^^^^ ^ ^^^ ^^ ∗ ^^^ ^^^ ∗ ^^^^^^^^^^^ where ^^^^^^spacing between pairs of cells or beads of the ordered stream, ^^^widthof first microchannel, and ^^^represents height of first microchannel. Similarly, the concentration of cells or beads ^^ଶin the second ordered stream can be defined according to Equation (2): ^^^^^^^^^^ ^^^^ ^^^^^^^^^^ 1 ^^^^^^^^^^^ ^^^^ ^^^^^^^^^^^ଷି ^^ ^^ൌ ^ଶ^൨ ∗ 10 ^^ ^^^^^^^ ^ ^^ ^^^^^ ^ ^^^^ ^^^^^^^^ where ^^ଶstream, ^^ଶrepresents spacing between pairs of cells or beads of the second ordered stream, ^^ଶrepresents width of the second microchannel, and ^^ଶrepresents height of the second microchannel.

[0102] In various embodiments, Equation (1) and Equation (2) described above refer to the maximum concentration of cells or beads ^^^and maximum concentration of cells or beads ^^ଶ, respectively, in their respective microchannels. In various embodiments, Equation (1) and Equation (2) described above refer to the maximum concentration of cells or beads ^^^and maximum concentration of cells or beads ^^ଶ, respectively, that are added to theirrespective wells (e.g., aqueous wells). Thus, remaining below the maximum concentration ^^^and maximum concentration ^^ଶcan ensure ordering of both the stream of cells and the stream of beads. 30 IPTS / 128953967.1Docket Number: SBT-004WO

[0103] In various embodiments, the concentration of cells or beads defined in Equation (1) and Equation (2) can be adjusted according to a desired droplet diameter and volume. For example, the denominator of either Equation (1) or Equation (2) can be equal to half the volume of the desired droplet volume. Inter-cell spacing

[0104] Generally, the inter-cell spacing of cells within an ordered stream influences the number of cells that are encapsulated into a single droplet. As used herein, the inter-cell spacing refers to the distance between a pair of successive cells (e.g., no other cell between the pair of cells) within an ordered stream. In various embodiments, the desired inter-cell spacing of cells in an ordered stream is dependent on the volume of droplets that are formed at the junction of a microfluidic center. In various embodiments, the desired inter-cell distance between two cells is a distance that, when multiplied by the cross-sectional area of the microchannel, is between from about ^ ସ∗ ^^^^^^^^^^^^^^ ^^^^^^^^^^^^ to about 1 ∗ ^^^^^^^^^^^^^^ ^^^^^^^^^^^^.In various embodiments, the desired inter-cell distance between two cells is a distance that, when multiplied by the cross-sectional area of the microchannel, is between from about ^ ଶ ∗^^^^^^^^^^^^^^ ^^^^^^^^^^^^ to about 1 ∗ ^^^^^^^^^^^^^^ ^^^^^^^^^^^^. For a square or rectangular microchannel,the cross-sectional area of the microchannel is the product of the height and width of the microchannel. For a circular microchannel, the cross-sectional area of the microchannel is the product of ^^ and the square of the radius of the microchannel. By controlling the inter- cell spacing in this fashion, individual cells in an ordered stream of cells will be successfully encapsulated into separate, single droplets. If the inter-cell spacing is smaller than desired, then more than one cell from the ordered stream will be encapsulated in a droplet. Conversely, if the inter-cell spacing is larger than desired, many droplets will be formed that do not contain a single cell.

[0105] In various embodiments, cells in an ordered stream may have a distribution of inter-cell spacings. In other words, a first pair of cells in the ordered stream may have an inter-cell spacing that differs from the inter-cell spacing of a second pair of cells. In various embodiments, an average inter-cell distance of pairs of cells in an ordered stream is between from about 0.5 times the average cell diameter to about 6 times the average cell diameter. In various embodiments, pairs of successive cells in an ordered stream can independently have an inter-cell distance between from about 0.6 times the average cell diameter to about 5.5 times the average cell diameter, between from about 0.7 times the average cell diameter to about 5 times the average cell diameter, between from about 0.8 times the average cell 31 IPTS / 128953967.1Docket Number: SBT-004WO diameter to about 4.5 times the average cell diameter, between from about 1 times the average cell diameter to about 4 times the average cell diameter, between from about 1.5 times the average cell diameter to about 3.5 times the average cell diameter, between from about 2 times the average cell diameter to about 3 times the average cell diameter, or between from about 2.25 times the average cell diameter to about 2.75 times the average cell diameter.

[0106] In various embodiments, an average inter-cell distance of pairs of cells in an ordered stream is between from about 5 µm to about 100 µm. In various embodiments, pairs of successive cells in an ordered stream can independently have an inter-cell distance between from about 6 µm to about 90 µm, between from about 7 µm to about 80 µm, between from about 8 µm to about 70 µm, between from about 9 µm to about 60 µm, between from about 10 µm to about 50 µm, between from about 11 µm to about 40 µm, between from about 12 µm to about 30 µm, or between from about 15 µm to about 20 µm. Inter-bead spacing

[0107] Generally, the inter-bead spacing of beads within an ordered stream influences the number of beads that are encapsulated into a single droplet. As used herein, the inter-bead spacing refers to the distance between a pair of successive beads (e.g., no other bead between the pair of beads) within an ordered stream. In various embodiments, the desired inter-bead spacing of beads in an ordered stream is dependent on the volume of droplets that are formed at the junction of a microfluidic center. In various embodiments, the desired inter-bead distance between two beads is a distance that, when multiplied by the cross-sectional area of the microchannel, is between from about ^ ସ∗ ^^^^^^^^^^^^^^ ^^^^^^^^^^^^ to about 1 ∗ ^^^^^^^^^^^^^^ ^^^^^^^^^^^^.In various embodiments, the desired inter-bead distance between two beads is a distance that, when multiplied by the cross-sectional area of the microchannel, is between from about ^ ଶ ∗^^^^^^^^^^^^^^ ^^^^^^^^^^^^ to about 1 ∗ ^^^^^^^^^^^^^^ ^^^^^^^^^^^^. For a square or rectangular microchannel,the cross-sectional area of the microchannel is the product of the height and width of the microchannel. For a circular microchannel, the cross-sectional area of the microchannel is the product of ^^ and the square of the radius of the microchannel. By controlling the inter- bead spacing in this fashion, individual beads in an ordered stream of beads will be successfully encapsulated into separate, single droplets. If the inter-bead spacing is smaller than desired, then more than one bead from the ordered stream will be encapsulated in a droplet. Conversely, if the inter-bead spacing is larger than desired, many droplets will be formed that do not contain a single bead. 32 IPTS / 128953967.1Docket Number: SBT-004WO

[0108] In various embodiments, beads in an ordered stream may have a distribution of inter-bead spacing. In other words, a first pair of beads in the ordered stream may have an inter-bead spacing that differs from the inter-bead spacing of a second pair of beads. In various embodiments, an average inter-bead distance of pairs of beads in an ordered stream is between from about 0.5 times the average bead diameter to about 6 times the average bead diameter. In various embodiments, pairs of successive beads in an ordered stream can independently have an inter-bead distance between from about 0.6 times the average bead diameter to about 5.5 times the average bead diameter, between from about 0.7 times the average bead diameter to about 5 times the average bead diameter, between from about 0.8 times the average bead diameter to about 4.5 times the average bead diameter, between from about 1 times the average bead diameter to about 4 times the average bead diameter, between from about 1.5 times the average bead diameter to about 3.5 times the average bead diameter, between from about 2 times the average bead diameter to about 3 times the average bead diameter, or between from about 2.25 times the average bead diameter to about 2.75 times the average bead diameter.

[0109] In various embodiments, an average inter-bead distance of pairs of beads in an ordered stream is between from about 5 µm to about 100 µm. In various embodiments, pairs of successive beads in an ordered stream can independently have an inter-bead distance between from about 6 µm to about 90 µm, between from about 7 µm to about 80 µm, between from about 8 µm to about 70 µm, between from about 9 µm to about 60 µm, between from about 10 µm to about 50 µm, between from about 11 µm to about 40 µm, between from about 12 µm to about 30 µm, or between from about 15 µm to about 20 µm. Flow rate

[0110] The flow rates of the aqueous phases and / or the oil phase are tunable to ensure successful ordering of cell and / or bead streams and co-encapsulation of single cells and single beads in single droplets. As referred to herein, the first aqueous phase refers to the aqueous fluid that flows through a first microchannel carrying cells. The second aqueous phase refers to the aqueous fluid that flows through a second microchannel carrying beads. The oil phase refers to an immiscible fluid that flows through two or more microchannels to meet the first and second aqueous phase at a junction (e.g., to form single droplets).

[0111] In various embodiments, the first aqueous phase is flowed through the first microchannel at a rate between from about 5 µL / min to 100 µL / min. In various embodiments, the first aqueous phase is flowed through the first microchannel at a rate between from about 33 IPTS / 128953967.1Docket Number: SBT-004WO 10 µL / min to 75 µL / min, between from about 15 µL / min to 50 µL / min, between from about 20 µL / min to 40 µL / min, or between from about 25 µL / min to 35 µL / min. In various embodiments, the first aqueous phase is flowed through the first microchannel at a rate between from about 10 µL / min to 40 µL / min, between from about 15 µL / min to 35 µL / min, between from about 20 µL / min to 30 µL / min, or between from about 22.5 µL / min to 27.5 µL / min. In various embodiments, the first aqueous phase is flowed through the first microchannel at a rate between from about 8 µL / min to 80 µL / min, between from about 10 µL / min to 60 µL / min, between from about 15 µL / min to 50 µL / min, between from about 20 µL / min to 40 µL / min, between from about 25 µL / min to 35 µL / min, or between from about 27.5 µL / min to 32.5 µL / min. In various embodiments, the first aqueous phase is flowed through the first microchannel at a rate of about 60 µL / min. In various embodiments, the first aqueous phase is flowed through the first microchannel at a rate of about 45 µL / min. In various embodiments, the first aqueous phase is flowed through the first microchannel at a rate of about 30 µL / min.

[0112] In various embodiments, the second aqueous phase is flowed through the second microchannel at a rate between from about 5 µL / min to 100 µL / min. In various embodiments, the second aqueous phase is flowed through the second microchannel at a rate between from about 10 µL / min to 75 µL / min, between from about 15 µL / min to 50 µL / min, between from about 20 µL / min to 40 µL / min, or between from about 25 µL / min to 35 µL / min. In various embodiments, the second aqueous phase is flowed through the second microchannel at a rate between from about 10 µL / min to 40 µL / min, between from about 15 µL / min to 35 µL / min, between from about 20 µL / min to 30 µL / min, or between from about 22.5 µL / min to 27.5 µL / min. In various embodiments, the second aqueous phase is flowed through the second microchannel at a rate between from about 8 µL / min to 80 µL / min, between from about 10 µL / min to 60 µL / min, between from about 15 µL / min to 50 µL / min, between from about 20 µL / min to 40 µL / min, between from about 25 µL / min to 35 µL / min, or between from about 27.5 µL / min to 32.5 µL / min. In various embodiments, the second aqueous phase is flowed through the second microchannel at a rate of about 60 µL / min. In various embodiments, the second aqueous phase is flowed through the second microchannel at a rate of about 45 µL / min. In various embodiments, the second aqueous phase is flowed through the second microchannel at a rate of about 30 µL / min.

[0113] In various embodiments, the first aqueous phase and the second aqueous phase are flowed through their respective microchannels at the same flow rate. In various embodiments, 34 IPTS / 128953967.1Docket Number: SBT-004WO the first aqueous phase and the second aqueous phase are flowed through their respective microchannels at different flow rates. For example, the second aqueous phase can be flowed at a second rate that is slower than a first rate of the first aqueous phase. By flowing the first aqueous phase faster, then more cells that are carried by the first aqueous phase may be encapsulated in a single droplet. For example, a single droplet comprises only a single bead from the ordered stream of beads (flowed at a second flow rate) and two or more cells from the ordered stream of cells (flowed at a first, faster flow rate).

[0114] In various embodiments, the oil phase is flowed through an oil microchannel at a rate between from about 5 µL / min to 100 µL / min. In various embodiments, the oil phase is flowed through the oil microchannel at a rate between from about 10 µL / min to 75 µL / min, between from about 15 µL / min to 50 µL / min, between from about 20 µL / min to 40 µL / min, or between from about 25 µL / min to 35 µL / min. In various embodiments, the oil phase is flowed through the oil microchannel at a rate between from about 10 µL / min to 40 µL / min, between from about 15 µL / min to 35 µL / min, between from about 20 µL / min to 30 µL / min, or between from about 22.5 µL / min to 27.5 µL / min. In various embodiments, the oil phase is flowed through the oil microchannel at a rate between from about 8 µL / min to 80 µL / min, between from about 10 µL / min to 60 µL / min, between from about 15 µL / min to 50 µL / min, between from about 20 µL / min to 40 µL / min, between from about 25 µL / min to 35 µL / min, or between from about 27.5 µL / min to 32.5 µL / min. In various embodiments, the oil phase is flowed through the oil microchannel at a rate of about 60 µL / min. In various embodiments, the oil phase is flowed through the oil microchannel at a rate of about 45 µL / min. In various embodiments, the oil phase is flowed through the oil microchannel at a rate of about 30 µL / min. Ordering Cells or Beads using Pillars

[0115] In various embodiments, microfluidic devices include additional features, such as one or more pillars, that aid in the ordering of cells or beads into a stream. Generally, one or more pillars of a microfluidic device are useful for manipulating movement of single cells or beads in the microfluidic device. For example, pillars can manipulate movement of single cells or beads to ensure that the cells or beads do not aggregate and lead to clogging of the microchannels. As another example, pillars can manipulate movement of single cells or beads to assist in achieving a particular inter-cell or inter-bead spacing. This can further aid in the ordering of a stream of cells or beads. 35 IPTS / 128953967.1Docket Number: SBT-004WO

[0116] In various embodiments, the one or more pillars are situated at an entrance to a microchannel of the microfluidic device. For example, referring to FIG.1A, the one or more pillars can be situated in aqueous well 105A at the entrance to the first microchannel 115A. As another example, the one or more pillars can be situated in aqueous well 105B at the entrance to the second microchannel 115B. In particular embodiments, aqueous well 105A and aqueous well 105B include one or more pillars situated at the entrance to the first microchannel 115A and second microchannel 115B, respectively. Thus, as cells or beads in the aqueous wells 105 flow into their respective microchannels 115, the one or more pillars disrupt the flow of the cells or beads to avoid aggregation and clumping within the microchannels 115. In particular, the one or more pillars disrupt the flow of the cells or beads to achieve a particular inter-cell or inter-bead spacing within the microchannels 115.

[0117] In various embodiments, one or more pillars at an entrance of a microchannel are arranged in rows. A row of pillars may be arranged substantially perpendicular or perpendicular to the flow of the cells or beads. In various embodiments, a set of pillars includes at least 2 rows of pillars. In various embodiments, a set of pillars includes at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 rows of pillars.

[0118] In various embodiments, a set of pillars at an entrance of a microchannel comprises gaps between pairs of pillars. For example, a pair of pillars in the same row may have a particular gap. Generally, the gaps between pillars in rows are small enough to force cells or beads to pass through the center of the gap, and due to laminar flow, the cells or beads will flow into the center of the gap of the next row of pillars, and so on. In various embodiments, the gaps between a pair of pillars in a row are uniform in distance. In various embodiments, the set of pillars comprise 2 to 80 µm gaps, 3 to 60 µm gaps, 4 to 50 µm gaps, 5 to 40 µm gaps, 6 to 30 µm gaps, or 8 to 20 µm gaps between pillars. In particular embodiments, the set of pillars comprise 5 to 40 µm gaps. In various embodiments, the gaps between pairs of pillars in successive rows become successively smaller. For example, in successive rows, the gaps between pairs of pillars is between about 5% to 50% smaller than the gaps between pairs of pillars in the immediately preceding row. In some scenarios, in successive rows, the gaps between pairs of pillars is between about 10% to 40% smaller, between about 15% to about 35% smaller, between about 20% to about 30% smaller, or between about 22.5% to about 27.5% smaller than the gaps between pairs of pillars in the immediately preceding row. 36 IPTS / 128953967.1Docket Number: SBT-004WO

[0119] In various embodiments, a row of pillars is shifted (e.g., offset) in relation to an adjacent row of pillars. Thus, through successive rows of pillars in which a row is shifted in relation to a prior row of pillars, the cells or beads flowing through the pillars are guided in the direction of the shift towards a common point. In various embodiments, a row of pillars is shifted a proportion of the distance of a gap between a pair of pillars in the same row. For example, assuming a gap distance of X between a pair of pillars in the same row (e.g., a firstrow), then a second row of pillars adjacent to the first row can be shifted by a value of ^^ ∗ ^^,where ^^ represents a proportion and is less than 1. In various embodiments, ^^ is 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95.

[0120] Reference is now made to FIG.4, which shows example flow paths using pillars which separate cells or beads into ordered streams, in accordance with an embodiment. Specifically, FIG.4 shows vertically oriented rows of pillars, in which a row of pillars is shifted relative to a prior row of pillars. Here, the flow paths of the cells or beads show that due to laminar flow, the cells or beads are flowed through the gaps of rows of pillars to a central axis before entering into the microchannel on the right. Encapsulating Cells and Beads of Ordered Streams into Single Droplets

[0121] Disclosed herein are methods for co-encapsulating single cells and single beads from two or more ordered streams into single droplets at a junction of microfluidic device. An ordered stream of cells flows in an aqueous phase in a first microchannel to a junction, an ordered stream of beads flows in an aqueous phase in a second microchannel to the junction, and an oil phase flows through a third microchannel to the junction. The meeting of the aqueous phases and oil phase at the junction causes the formation of single droplets.

[0122] In various embodiments, methods for co-encapsulating single cells and single beads into a single droplet involves meeting the two or more aqueous phases and the oil phase at the junction substantially simultaneously (e.g., the various phases encounter each other simultaneously or within 100 milliseconds (ms), within 10 ms, or within 1 ms). In various embodiments, methods for co-encapsulating single cells and single beads involves first contacting the two or more aqueous phases with one another. For example, methods may involve contacting the flowing first aqueous phase with the second aqueous phase, wherein the contacting creates a single aqueous phase comprising the ordered stream of cells from the first aqueous phase and the ordered stream of beads from the second aqueous phase. In various embodiments, the contacting of the flowing first aqueous phase and the second aqueous phase to create the single aqueous phase occurs at a location at or prior to the 37 IPTS / 128953967.1Docket Number: SBT-004WO junction. As an example, reference is made to FIG.1B, which depicts the example junction 130. Here, the ordered stream of cells flows in a first aqueous phase in the first microchannel 115A and the ordered stream of beads flows in a second aqueous phase in the second microchannel 115B. The aqueous phases of the first microchannel 115A and the second microchannel 115B meet at a location prior to the junction 130 to form a single aqueous phase.

[0123] In various embodiments, the aqueous phases merge prior to encountering the oil phases flowing in microchannels 125A and 125B. In such embodiments, methods for co- encapsulating single cells and single beads further comprises contacting the flowing oil phase with the single aqueous phase to form a cone configuration within the junction. Here, the cone configuration is formed due to the immiscible oil phases interacting with the aqueous phase. Thus, single droplets are generated at the tip of the cone configuration.

[0124] In various embodiments, the oil phase is flowed to the junction at a rate between from about 5 µL / min to 100 µL / min. In various embodiments, the oil phase is flowed at a rate between from about 10 µL / min to 75 µL / min, between from about 15 µL / min to 50 µL / min, between from about 20 µL / min to 40 µL / min, or between from about 25 µL / min to 35 µL / min. In various embodiments, the oil phase is flowed at a rate between from about 10 µL / min to 40 µL / min, between from about 15 µL / min to 35 µL / min, between from about 20 µL / min to 30 µL / min, or between from about 22.5 µL / min to 27.5 µL / min.

[0125] In various embodiments, methods disclosed herein are useful for generating a population of single droplets. In various embodiments, methods involve generating at least 5, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 300, at least 400, at least 500, at least 1000, at least 5000, at least 10,000, at least 50,000, at least 100,000, at least 500,000, at least 1 million, at least 10 million, at least 50 million, or at least 100 million single droplets. In various embodiments, methods involve generating between 10 and 10,000 single droplets. In various embodiments, methods involve generating between 50 and 5,000, between 100 and 1,000, between 200 and 900, between 300 and 800, between 400 and 700, or between 500 and 600 single droplets.

[0126] Generally, the population of single droplets is characterized by a fraction of the single droplets that comprise a single cell from an ordered stream and a single bead from an ordered stream. The fraction of single droplets that include a single cell from a first ordered stream and a single bead from a second ordered stream exceeds a predicted fraction of single 38 IPTS / 128953967.1Docket Number: SBT-004WO droplets comprising a single cell from a first ordered stream and a single bead from a second ordered stream predicted using a Poisson distribution. For example, based on Poisson’s law, about 10% of single droplets would contain a cell from a first stream and a bead from a second stream. The Poisson prediction is calculated by using the Poisson distribution where k is the number of occurrences (in this case, numberdroplet), and ^^ is the expected value of cells or beads in droplets. The expected value of cells or beads in droplets is the concentration of cells or beads divided by the volume of a droplet. As an example, given a droplet of diameter 60 µm, with 4 million cells / mL of T-cells, the Poisson formula calculates ~28% of droplets having 1 T-cell. For the same droplet diameter and 9 million beads / mL, the Poisson formula calculates ~36% of droplets having 1 bead. As these two events are independent, the number of droplets that contain a T-cell and a bead is 28% * 36% = ~10%.

[0127] In various embodiments, methods and apparati disclosed herein generate a population of single droplets characterized by a fraction of single droplets including a single cell from an ordered stream and a single bead from an ordered stream, wherein the fraction exceeds the predicted fraction predicted using a Poisson distribution by at least 1.5-fold. In various embodiments, the fraction exceeds the predicted fraction predicted using a Poisson distribution by at least 1.6-fold, by at least 1.7-fold, by at least 1.8-fold, by at least 1.9-fold, by at least 2.0-fold, by at least 2.1-fold, by at least 2.2-fold, by at least 2.3-fold, by at least 2.4-fold, by at least 2.5-fold, by at least 2.6-fold, by at least 2.7-fold, by at least 2.8-fold, by at least 2.9-fold, by at least 3.0-fold, by at least 3.1-fold, by at least 3.2-fold, by at least 3.3- fold, by at least 3.4-fold, by at least 3.5-fold, by at least 3.6-fold, by at least 3.7-fold, by at least 3.8-fold, by at least 3.9-fold, by at least 4.0-fold, by at least 4.1-fold, by at least 4.2-fold, by at least 4.3-fold, by at least 4.4-fold, by at least 4.5-fold, by at least 4.6-fold, by at least 4.7-fold, by at least 4.8-fold, by at least 4.9-fold, or by at least 5.0-fold.

[0128] In various embodiments, the fraction exceeds the predicted fraction predicted using a Poisson distribution by a factor ranging from 1.3-fold to 10.0-fold. In various embodiments, the fraction exceeds the predicted fraction predicted using a Poisson distribution by a factor ranging from 1.4-fold to 9.0-fold, by a factor ranging from 1.5-fold to 8.0-fold, by a factor ranging from 1.6-fold to 7.0-fold, by a factor ranging from 1.7-fold to 6.0-fold, by a factor ranging from 1.8-fold to 5.0-fold, by a factor ranging from 1.9-fold to 39 IPTS / 128953967.1Docket Number: SBT-004WO 4.0-fold, or by a factor ranging from 2.0-fold to 3.0-fold. In various embodiments, two or more cells and / or beads may become encapsulated within a single droplet. Single-Cell Sequencing

[0129] Embodiments disclosed herein involve performing single-cell sequencing on a population of single droplets that include a fraction of single droplets that a single cell and a single barcoded bead. Here, as described herein, methods achieve a fraction of single droplets comprising a single cell and a single barcoded bead that exceed a predicted fraction of single droplets that comprise a single cell and a single barcoded bead predicted using a Poisson distribution. Thus, by beating Poisson statistics, this eliminates the need for high concentrations of beads and further avoids scenarios where large proportions of droplets lack one or both a single cell and a bead (e.g., droplets that only include a bead, droplets that only include a cell, or droplets that do not include either a bead or a cell).

[0130] In various embodiments, performing single-cell sequencing involves incorporating barcode sequences of barcoded beads into nucleic acids of cells within the single droplets. Then, methods may involve performing sequencing e.g., sequencing at least the incorporated barcode sequences to determine which cell the sequence originates from. In various embodiments, performing sequencing involves sequencing the incorporated barcode sequences as well as a sequence derived from nucleic acids of the cells. As one example, by sequencing the sequence derived from a nucleic acid of the cell, this enables counting or quantifying copies of the particular nucleic acid in the cell. As another example, by sequencing the sequence derived from a nucleic acid of the cell, this enables determination of presence of absence of one or more mutations (e.g., insertions, deletions, polymorphisms, copy number variations, and gene fusions) in the cell. Further description of methods for performing single-cell sequencing are described in US20210130892, US20210277471, or WO2021030447, each of which is incorporated by reference in its entirety.

[0131] In one set of embodiments, as a non-limiting example, a droplet can be formed containing a T-cell (or other effector cell), and a cancer cell (or other target cell). In some cases, the droplet may contain a first signaling entity and a second signaling entity distinguishable from the first signaling entity. The cells may be allowed to interact. The droplet may then be analyzed to determine its fluorescence. For example, the first signaling entity may be determined to determine the viability of the target cell, and the second signaling entity may be determined to determine the presence of cytokines, antibodies, or 40 IPTS / 128953967.1Docket Number: SBT-004WO other substances. Based on these determinations, the droplets may be sorted, e.g., such that droplets containing effector cells able to interact with the target cells (positively or negatively) are selected or sorted over droplets containing cells that poorly interact, or do not interact at all. The sorted effector cells may then be analyzed using any suitable technique. For example, the effector cells may be sequenced using techniques known to those of ordinary skill in the art, for example to identify receptors that allowed the cells to recognize the target cells, to identify cytokine sequences that may be present, or the like.

[0132] In one set of embodiments, as a non-limiting example, a droplet can be formed containing a T-cell (or other effector cell), and a cancer cell (or other target cell). In some cases, the droplet may contain a first signaling entity and a second signaling entity distinguishable from the first signaling entity. The cells may be allowed to interact. The droplet may then be analyzed to determine its fluorescence. For example, the first signaling entity may be determined to determine the viability of the target cell, and the second signaling entity may be determined to determine the presence of cytokines, antibodies, or other substances. Based on these determinations, the droplets may be sorted, e.g., such that droplets containing effector cells able to interact with the target cells (positively or negatively) are selected or sorted over droplets containing cells that poorly interact, or do not interact at all. The sorted effector cells may then be analyzed using any suitable technique. For example, the effector cells may be sequenced using techniques known to those of ordinary skill in the art, for example to identify receptors that allowed the cells to recognize the target cells, to identify cytokine sequences that may be present, or the like.

[0133] In one set of embodiments, cells sorted for a desired characteristic (e.g., ability to interact with a target cell) may be analyzed to determine various characteristics of the cells. For example, receptors on the cells may be determined or sequenced, e.g., to determine receptors able to interact with the target cells. As other examples, sequences encoding antibodies that are able to interact with the target cells, and / or sequences encoding substances that are secreted to interact with the target cells, may be analyzed. In some cases, all, or a portion of, the DNA or the genome of the effector cells may be sequenced or otherwise determined. The cells may also be grown or expanded (e.g., in number) before such determination, in some embodiments, e.g., using cell culture techniques known to those of ordinary skill in the art. In some cases, the cells that are sorted may be purified and cultured, e.g., for applications as discussed herein, for subsequent study, or for other applications or uses. 41 IPTS / 128953967.1Docket Number: SBT-004WO

[0134] The DNA from the cell may be sequenced using any suitable technique known to those of ordinary skill in the art. Examples of DNA sequencing techniques include, but are not limited to, PCR (polymerase chain reaction), “sequencing by synthesis” techniques (e.g., using DNA synthesis by DNA polymerase to identify the bases present in the complementary DNA molecule), “sequencing by ligation” (e.g., using DNA ligases), “sequencing by hybridization” (e.g., using DNA microarrays), nanopore sequencing techniques, or the like. Optionally, the extracted nucleic acid sequence may be amplified, duplicated, or expanded by PCR, rolling circle replication, or other techniques known to those of ordinary skill in the art.

[0135] In some embodiments, assays may be used to assess target recognition and / or killing activity of one or several or many effector cells. As discussed herein, droplets can be created, analyzed, and sorted at high rates (hundreds to thousands per second). Multiple assays (e.g., cytokine secretion, cell killing, identification of activation marker, etc.) can also be performed with the same droplet, which minimize noise or isolation of cells that happen to be dying or releasing cytokines at the time of encapsulation before any cell-cell interaction can happen, or other false-positive events. In some cases, after the droplets of interest are sorted, the effector cells may still be viable and, for example, can be released to expand cell number.

[0136] In some embodiments, the droplets can be sorted and then genes or transcripts of the encapsulated cells can be sequenced. For example, upregulation of apoptosis-related genes, may be used to determine, confirm, or study killing of the target cell. In some cases, the sequences of cell receptors from the effector cells can also be identified. Nucleic acid analysis of sorted droplets may also reveal, in some cases, certain features of the target cell, for example type, behavior, physiology, condition, etc.

[0137] As mentioned, the sequencing can be performed by any suitable technique. For example, droplets of interest can be dispensed into wells and then sequenced by Sanger methods, and the effector and target cell information will remain paired in the well. As another example, droplet-based barcoding can be used, which will maintain droplet-pairing of effector and target cells during next-generation sequencing. For example, droplets may be broken (e.g., using mechanical disruption, ultrasound, chemical agents, or surfactants, for example, 1H,1H,2H,2H-perfluorooctanol) and their contents merged together for sequencing or other purposes.

[0138] In some embodiments, the nucleic acids may be sequenced using a variety of techniques and instruments, many of which are readily available commercially. Examples of 42 IPTS / 128953967.1Docket Number: SBT-004WO such techniques include, but are not limited to, chain-termination sequencing, sequencing-by- hybridization, Maxam-Gilbert sequencing, dye-terminator sequencing, chain-termination methods, Massively Parallel Signature Sequencing (Lynx Therapeutics), polony sequencing, pyrosequencing, sequencing by ligation, ion semiconductor sequencing, DNA nanoball sequencing, single-molecule real-time sequencing, nanopore sequencing, microfluidic Sanger sequencing, digital RNA sequencing (“digital RNA-seq”), etc.

[0139] In some cases, the assay may determine cell cytokine secretion at a single cell level. In some cases, picoliter or microfluidic droplets may be helpful since the concentration of cytokines in droplets with single-cell secretion can easily reach a few nanomolar after one or two hours of incubation. In contrast, cytokines secreted from single cells in bulk solutions are not easily detectable with current methods.

[0140] In addition, in some embodiments, two or more cell signals or functions may be determined. In some cases, a bead-based assay can be used to determine effector cell response to a target cell, and can be used in conjunction with other assays, e.g., methods to indicate cell vitality, cell death, etc. A combination of assays outputs can reduce false- positives significantly.

[0141] In addition, in certain embodiments, rapid selection of effector cells may be performed at high accuracy, and may significantly improve activity and efficacy of cells isolated for adoptive cell therapy or other applications. For example, in some cases, effector cells from a subject may be assayed and sorted based on interactions with target cells as discussed above, then the sorted effector cells may be expanded and re-introduced into the subject (or to another subject), e.g., for therapeutic purposes.

[0142] In some embodiments, effectors cells may be identified and sorted without any tagging on the cell surface, e.g., resulting in a population of tag-free effector cells, which may improve the efficacy of cells for adoptive cell therapy or other applications. For example, in some cases, effectors T cells are assayed by a secretion capturing bead and the death of a cancer cell, instead of through fluorescent tagging of activation markers on the T-cell surface, which may incur cytotoxicity.

[0143] In some aspects, relatively large numbers of droplets may be created that contain the same type and / or numbers of cells therein. For example, a population of at least 10, at least 30, at least 50, at least 100, at least 300, at least 500, at least 1,000, at least 3,000, at least 5,000, at least 10,000, at least 30,000, at least 50,000, at least 100,000 droplets, at least 300,000 droplets, at least 500,000 droplets, at least 1,000,000 droplets, at least 3,000,000 43 IPTS / 128953967.1Docket Number: SBT-004WO droplets, at least 5,000,000 droplets, at least 10,000,000 droplets, etc., containing cells (e.g., one or more effector cells and / or one or more target cells) may be created. In some cases, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% of the droplets that are created may contain the same number of cells (e.g., 2 cells), and / or the same number of types of cells (e.g., a particular effector cell and a particular target cell). For example, the droplets may each contain at least one immune cell and at least one target cell (e.g., a cancer cell or an infected cell) for the immune cell.

[0144] In some embodiments, sequencing may be performed with at least one cellular derived nucleic acid. Cellular derived nucleic acids may be, but are not limited to, genomic DNA, mitochondrial DNA, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), micro RNA (miRNA), small interfering RNA (siRNA), long non-coding RNA (lncRNA), complementary DNA (cDNA), circular RNA (circRNA), or other nucleic acids. In some embodiments, a cellular derived nucleic acid may encode a cytokine, an antibody or a T-cell receptor (TCR) sequence.

[0145] Reference is now made to FIG.8, which shows a flow diagram including steps for performing single cell sequencing, in accordance with an embodiment. Step 810 involves incorporating barcode sequences of the barcoded bead into nucleic acids of a cell. As shown in FIG.8, step 810 further includes step 820, 830, and 840.

[0146] Step 820 involves lysing a cell within a single droplet. Here, lysing reagents may be introduced (or were previously introduced) to contact the cell within the single droplet, thereby causing the cell to lyse. In various embodiments, lysing a cell within a single droplet can involve employing other methods such as electroporation, thermal, acoustic or mechanical cellular disruption. Lysing the cell within the single droplet involves releasing the nucleic acids of the cell, including e.g., genomic nucleic acids and ribonucleic acids (RNA).

[0147] In various embodiments, step 820 involves capturing the released nucleic acids on the barcoded bead. In various embodiments, the barcoded bead may include copies of barcode sequences including at terminal sequence that is capable of capturing released nucleic acids. For example, the released nucleic acids may include messenger RNA (mRNA) including poly-A tail sequences. Thus, the barcoded bead may include barcode sequences 44 IPTS / 128953967.1Docket Number: SBT-004WO including a terminal poly-T sequence that is capable of hybridizing with the poly-A tail sequences of the released mRNA.

[0148] In various embodiments, the barcode sequences of the barcoded bead may be released from the bead prior to capturing the released nucleic acids. In such embodiments, the terminal sequence of barcode sequences may hybridize with the released nucleic acids within solution (without being attached to the bead).

[0149] Step 830 involves reverse transcribing the nucleic acids (e.g., mRNA) to generate cDNA. In various embodiments, reverse transcription occurs while the released nucleic acids are captured (e.g., attached) to the barcoded bead via the barcode sequences. In various embodiments, reverse transcription occurs while the released nucleic acids are hybridized to the terminal sequence of barcode sequences (which thereby serves as a priming sequence) while in solution (e.g., without being attached to the bead).

[0150] Step 840 involves amplifying the cDNA to generate amplicons comprising the barcode sequences. In various embodiments, amplifying the cDNA involves performing a nucleic acid amplification reaction using one or more reagents. As discussed herein, reagents may be introduced (or previously introduced prior to co-encapsulation). For example, performing nucleic acid amplification can involve enzymes such as DNA polymerase, thermostable polymerases for thermal cycled amplification, or polymerases for multiple- displacement amplification for isothermal amplification. As another example, performing nucleic acid amplification can involve one or more primers, for the amplification of a target sequence in the cDNA. The primers may include a forward primer and a reverse primer that are complementary to a target sequence, or complement thereof. Thus, the primers can initiate the nucleic acid amplification reaction, thereby generating amplicons that include the barcode sequences.

[0151] Step 850 involves sequencing at least the barcode sequences of the amplicons. In various embodiments, the amplicons comprising barcode sequences may be pooled. In various embodiments, the pooled amplicons may undergo one or more processing steps such as a library preparation and / or sample preparation step. For example, additional primers comprising a P5 sequence and / or primers comprising a P7 sequence can be provided. Here, the P5 and P7 sequences are used for attachment to a sequencing flow cell for Illumina sequencing.

[0152] In various embodiments, sequencing can be achieved with commercially available next generation sequencing (NGS) platforms, including platforms that perform any of 45 IPTS / 128953967.1Docket Number: SBT-004WO sequencing by synthesis, sequencing by ligation, pyrosequencing, using reversible terminator chemistry, using phospholinked fluorescent nucleotides, or real-time sequencing. As an example, amplified nucleic acids may be sequenced on an Illumina MiSeq platform. Once sequenced, the sequence reads can be aggregated and aligned e.g., to a reference library. The sequence reads can be attributed to individual cells according to the sequenced barcode reads.

[0153] Altogether, in comparison to conventional methodologies, the methods disclosed herein achieve higher co-encapsulation efficiencies of single cells and single beads within single droplets. By doing so, the methods disclosed herein enable the performance of single- cell sequencing while wasting significantly less consumables and resources. As referred to herein, “waste” can be measured by the number of droplets that fail to include a single cell and a single bead. In various embodiments, the methods of single-cell sequencing disclosed herein wastes less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% of the beads that would be wasted in a single-cell sequencing methodology that co-encapsulates single cells and beads in accordance with Poisson statistics. In particular embodiments, the methods of single-cell sequencing disclosed herein wastes less than 50%, less than 49%, less than 48%, less than 47%, less than 46%, less than 45%, less than 44%, less than 43%, less than 42%, less than 41%, less than 40%, less than 39%, less than 38%, less than 37%, less than 36%, less than 35%, less than 34%, less than 33%, less than 32%, less than 31%, less than 30%, less than 29%, less than 28%, less than 27%, less than 26%, or less than 25% of the beads that would be wasted in a single-cell sequencing methodology that co-encapsulates single cells and beads in accordance with Poisson statistics.

[0154] In various embodiments, the methods of single-cell sequencing disclosed herein wastes less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, or less than 5% of the cells that would be wasted in a single-cell sequencing methodology that co-encapsulates single cells and beads in accordance with Poisson statistics. In particular embodiments, the methods of single-cell sequencing disclosed herein waste less than 50%, less than 49%, less than 48%, less than 47%, less than 46%, less than 45%, less than 44%, less than 43%, less than 42%, less than 41%, less than 40%, less than 46 IPTS / 128953967.1Docket Number: SBT-004WO 39%, less than 38%, less than 37%, less than 36%, less than 35%, less than 34%, less than 33%, less than 32%, less than 31%, less than 30%, less than 29%, less than 28%, less than 27%, less than 26%, or less than 25% of the cells that would be wasted in a single-cell sequencing methodology that co-encapsulates single cells and beads in accordance with Poisson statistics. Example Microfluidic Devices for Encapsulating Cells and Beads of Ordered Streams into Single Droplets

[0155] Microfluidic devices, such as microfluidic devices disclosed herein, are designed and used in accordance with a range of parameters (e.g., concentration of cells or beads in aqueous fluid, flow rate of aqueous phase including cells or beads, flow rate of oil phase, microchannel width, inter-cell spacing within an ordered stream of cells, and inter-bead spacing within an ordered stream of bead) to successfully achieve, in certain embodiments, co-encapsulation of single cells and single beads in single droplets. In particular, microfluidic devices are used to find a range of flow velocities that are both fast enough for inertial focusing (e.g., to achieve ordered streams of cells), but also slow enough to achieve droplet generation. Furthermore, microfluidic devices are also designed to process cells in a high throughput manner, thereby ensuring cell viability during the process.

[0156] Tunable parameters of microfluidic devices include the width of the microfluidic channels. In particular, decreasing the width of a microchannel increases the rate of inertial focusing by decreasing the distance that cells travel to reach the equilibrium position within the microchannel. However, decreasing the microchannel width comes with the tradeoff of decreasing flow velocity by increasing the flow resistance, thereby reducing processing throughput. Another tunable parameter includes the microchannel length. Specifically, the length of the channel can be tuned to allow more time for the Dean forces to inertially focus the cells. However, increasing the microchannel length also increases flow resistance, and so decreases flow velocity at a fixed operating pressure.

[0157] Disclosed herein are, in certain embodiments, microfluidic devices for encapsulating single cells and single beads in single droplets, the microfluidic device comprising: a first microchannel, a second microchannel, and a third microchannel, wherein the first microchannel, second microchannel and third microchannel are fluidically connected to one another through a junction. 47 IPTS / 128953967.1Docket Number: SBT-004WO Example Junction of Microfluidic Devices

[0158] Reference is made to FIG.5, which depicts an example junction of a microfluidic device, such as an example microfluidic device including serpentine channels (as described below in reference to FIG.6) or an example microfluidic device including spiral channels (as described below in reference to FIGs.7A and 7B). Here, FIG.5 depicts a first microchannel 580A (e.g., for carrying an ordered stream of cells), a second microchannel 580B (e.g., for carrying an ordered stream of beads), an oil channel 590 (for carrying an immiscible phase), a junction 585, a nozzle region 588 after the junction 585, and a post-nozzle region 592 for collecting droplets. Generally, the operation of the microfluidic device shown in FIG.5 involves flowing solutions from the right (e.g., through first microchannel 580A and second microchannel 580B) towards the left (e.g., to the post-nozzle region 592). Additionally, FIG. 5 includes designations of the dimensions. For example, “AA” refers to the width of the oil channel 590. “BB” refers to the width of the junction 585. “CC” refers to the width of the nozzle region 588. “DD” refers to the length of the nozzle region 588. “EE” refers to the width of the post-nozzle region 592.

[0159] As shown in FIG.5, the first microchannel 580A and second microchannel 580B may meet at the junction 585 or at a region immediately prior to the junction 585. This region then leads to the junction 585 for forming droplets. The nozzle region 588 leads away from the junction 585 to the post-nozzle region 592, which collects the formed droplets.

[0160] Referring first to the first microchannel 580A, in various embodiments, the width of the first microchannel 580A is between from about 5 µm to about 200 µm. In various embodiments, the width of the first microchannel 580A is between from about 10 µm to about 100 µm, between from about 15 µm to about 95 µm, between from about 20 µm to about 90 µm, between from about 25 µm to about 85 µm, between from about 30 µm to about 80 µm, between from about 35 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the first microchannel 580A is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the first microchannel 580A is between from about 50 µm to about 75 µm. 48 IPTS / 128953967.1Docket Number: SBT-004WO

[0161] In various embodiments, the width of the first microchannel 580A tapers down when approaching the junction 585. For example, the first microchannel 580A may have a first width that is located distal to the junction 585 in relation to a second width of the first microchannel 580A that is located more proximal to the junction 585. The first width of the first microchannel 580A may be greater than the second width of the first microchannel 580A. In various embodiments, the first width of the first microchannel 580A (e.g., located distal to the junction 585) is between from about 40 µm to about 100 µm, between from about 45 µm to about 80 µm, or between from about 50 µm to about 60 µm. In particular embodiments, the first width of the first microchannel 580A (e.g., located distal to the junction 585) is about 50 µm. In various embodiments, the second width of the first microchannel 580A (e.g., located proximal to the junction 585) is between from about 10 µm to about 40 µm, between from about 20 µm to about 35 µm, or between from about 25 µm to about 32 µm. In particular embodiments, the second width of the first microchannel 580A (e.g., located proximal to the junction 585) is about 30 µm. In particular embodiments, the second width of the first microchannel 580A (e.g., located proximal to the junction 585) is about 25 µm.

[0162] In various embodiments, the width of the second microchannel 580B is between from about 5 µm to about 200 µm. In various embodiments, the width of the second microchannel 580B is between from about 10 µm to about 100 µm, between from about 15 µm to about 95 µm, between from about 20 µm to about 90 µm, between from about 25 µm to about 85 µm, between from about 30 µm to about 80 µm, between from about 35 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the second microchannel 580B is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the second microchannel 580B is between from about 50 µm to about 75 µm.

[0163] In various embodiments, the width of the second microchannel 580B tapers down when approaching the junction 585. For example, the second microchannel 580B may have a first width that is located distal to the junction 585 in relation to a second width of the second microchannel 580B that is located more proximal to the junction 585. The first width of the second microchannel 580B may be greater than the second width of the second microchannel 49 IPTS / 128953967.1Docket Number: SBT-004WO 580B. In various embodiments, the first width of the second microchannel 580B (e.g., located distal to the junction 585) is between from about 40 µm to about 100 µm, between from about 45 µm to about 80 µm, or between from about 50 µm to about 60 µm. In particular embodiments, the first width of the second microchannel 580B (e.g., located distal to the junction 585) is about 50 µm. In various embodiments, the second width of the second microchannel 580B (e.g., located proximal to the junction 585) is between from about 10 µm to about 40 µm, between from about 20 µm to about 35 µm, or between from about 25 µm to about 32 µm. In particular embodiments, the second width of the second microchannel 580B (e.g., located proximal to the junction 585) is about 30 µm. In particular embodiments, the second width of the second microchannel 580B (e.g., located proximal to the junction 585) is about 25 µm.

[0164] In various embodiments, the width of the oil microchannel 590 (denoted as “AA” in FIG.5) is between from about 5 µm to about 200 µm. In various embodiments, the width of the oil microchannel 590 is between from about 10 µm to about 150 µm, between from about 20 µm to about 140 µm, between from about 30 µm to about 130 µm, between from about 40 µm to about 125 µm, between from about 50 µm to about 120 µm, between from about 60 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the oil microchannel 590 is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the oil microchannel 590 is between from about 50 µm to about 75 µm. In particular embodiments, the width of the oil microchannel 590 is about 50 µm. In particular embodiments, the width of the oil microchannel 590 is about 60 µm. In particular embodiments, the width of the oil microchannel 590 is about 75 µm.

[0165] Referring next to the junction 585, in various embodiments, the width of the junction 585 (denoted as “BB” in FIG.5) is between from about 5 µm to about 200 µm. In various embodiments, the width of the junction 585 is between from about 10 µm to about 150 µm, between from about 20 µm to about 140 µm, between from about 30 µm to about 130 µm, between from about 40 µm to about 125 µm, between from about 50 µm to about 120 µm, between from about 60 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the junction 585 is between from about 50 µm to about 50 IPTS / 128953967.1Docket Number: SBT-004WO 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the junction 585 is between from about 50 µm to about 75 µm. In particular embodiments, the width of the junction 585 is about 50 µm. In particular embodiments, the width of the junction 585 is about 60 µm. In particular embodiments, the width of the junction 585 is about 75 µm.

[0166] In various embodiments, a ratio between the width of the oil channel 590 (denoted as “AA” in FIG.5) and the width of the junction 585 (denoted as “BB” in FIG.5) is between from about 1 to about 5. In various embodiments, the ratio between the width of the oil channel 590 (denoted as “AA” in FIG.5) and the width of the junction 585 (denoted as “BB” in FIG.5) is between from about 1 to about 4, between from about 1 to about 3, from about 1 to about 2, between from about 2 to about 4, or between from about 2 to about 3. In particular embodiments, the ratio between the width of the oil channel 590 (denoted as “AA” in FIG.5) and the width of the junction 585 (denoted as “BB” in FIG.5) is about 100 µm / 60 µm (e.g., about 1.6).

[0167] Referring next to the width of the nozzle 588, the width (denoted as “CC” in FIG.5) can be designed to control the size of resulting droplets. In various embodiments, the width of the nozzle 588 controls the size of the resulting droplets by about ±20 µm, centered around the nozzle width. For example, given a width of a nozzle of 50 µm, the resulting droplets are sized between 30-70 µm (e.g., depending on the pressure applied to the aqueous channels and their corresponding flow rates). In various embodiments, the width of the nozzle 588 is between from about 5 µm to about 200 µm. In various embodiments, the width of the nozzle 588 is between from about 10 µm to about 150 µm, between from about 20 µm to about 140 µm, between from about 30 µm to about 130 µm, between from about 40 µm to about 125 µm, between from about 50 µm to about 120 µm, between from about 60 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the nozzle 588 is between from about 50 µm to about 75 µm. In particular embodiments, the width of the nozzle 588 is about 50 µm. In particular embodiments, the width of the nozzle 588 is about 75 µm. In particular embodiments, the width of the nozzle 588 is about 100 µm.

[0168] In particular embodiments, the width of the nozzle 588 (denoted as “CC” in FIG.5) is less than the width of the junction 585 (denoted as “BB” in FIG.5). In various embodiments, the width of the nozzle 588 is at least 1% less than the width of the junction 51 IPTS / 128953967.1Docket Number: SBT-004WO 585. In various embodiments, the width of the nozzle 588 is at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, or at least 20% less than the width of the junction 585. In some embodiments, the width of the nozzle 558 is between from about 40 µm to about 55 µm and the width of the junction 585 is between from about 55 µm to about 75 µm. In some embodiments, the width of the nozzle 558 is between from about 45 µm to about 52 µm and the width of the junction 585 is between from about 58 µm to about 65 µm. In some embodiments, the width of the nozzle 558 is about 50 µm and the width of the junction 585 is about 60 µm.

[0169] Referring next to the length of the nozzle 588, the length of the nozzle 588 (denoted as “DD” in FIG.5) can be designed to ensure droplet formation at higher flow rates of aqueous and / or oil phases. For example, higher flow velocities or flow rates may result in an aqueous / oil interface that is in a co-flow or jetting regime, which prevents the formation of single droplets. Therefore, increasing the length of the nozzle 588 can enable the increase of flow rates to higher values while still allowing droplet formation to occur. In various embodiments, the length of the nozzle 588 is between from about 20 µm to about 500 µm. In various embodiments, the length of the nozzle 588 is between from about 30 µm to about 450 µm, is between from about 40 µm to about 400 µm, is between from about 50 µm to about 350 µm, is between from about 75 µm to about 300 µm, is between from about 100 µm to about 250 µm, or is between from about 150 µm to about 225 µm.

[0170] Referring next to post-nozzle region 592, the width of the post-nozzle region 592 (denoted as “EE” in FIG.5) can be designed to ensure that droplets have sufficient space to form without merging into each other. In various embodiments, the width of the post-nozzle region 592 is between from about 50 µm to about 1000 µm. In various embodiments, the width of the post-nozzle region 592 is between from about 100 µm to about 900 µm, between from about 150 µm to about 850 µm, between from about 200 µm to about 800 µm, between from about 250 µm to about 750 µm, between from about 300 µm to about 700 µm, between from about 350 µm to about 650 µm, between from about 400 µm to about 600 µm, between from about 450 µm to about 550 µm, or between from about 475 µm to about 525 µm.

[0171] In various embodiments, the width of the junction 585 (denoted as “BB” in FIG.5) is greater than the width of nozzle 588 (denoted as “CC” in FIG.5). In various embodiments, a ratio between the width of the junction 585 (denoted as “BB” in FIG.5) and the width of nozzle 588 (denoted as “CC” in FIG.5) is between from about 1 to about 5. In various 52 IPTS / 128953967.1Docket Number: SBT-004WO embodiments, the ratio between the width of the junction 585 and the width of nozzle 588 is between from about 1 to about 4, between from about 1 to about 3, from about 1 to about 2, between from about 2 to about 4, or between from about 2 to about 3. In particular embodiments, the ratio between the width of the junction 585 and the width of nozzle 588 is about 60 µm / 50 µm (e.g., about 1.2).

[0172] In various embodiments, the width of the post-nozzle region 592 (denoted as “EE” in FIG.5) is greater than the width of the nozzle 588 (denoted as “CC” in FIG.5). In various embodiments, a ratio of the width of the post-nozzle region 592 (denoted as “EE” in FIG.5) to the width of the nozzle 588 (denoted as “CC” in FIG.5) is between from about 1 to about 15. In various embodiments, a ratio of the width of the post-nozzle region 592 (denoted as “EE” in FIG.5) to the width of the nozzle 588 (denoted as “CC” in FIG.5) is between from about 2 to about 14.5, between from about 3 to about 14, between from about 4 to about 13.5, between from about 5 to about 13, between from about 6 to about 12.5, between from about 7 to about 12, between from about 8 to about 11.5, or between about 9 to about 11. Serpentine Microchannel Microfluidic Device

[0173] FIG.6 depicts the example microfluidic device with serpentine microchannels. For purposes of introduction, the microfluidic device includes two aqueous wells 610A and 610B. Here, cells can be introduced in aqueous fluid into aqueous well 610A and beads can be introduced in aqueous fluid into aqueous well 610B.

[0174] As shown in FIG.6, the aqueous well 610A is fluidically connected to a curved region 615A of a first serpentine microchannel. Similarly, the aqueous well 610B is fluidically connected to a curved region 615B of a second serpentine microchannel. Thus, cells provided through aqueous well 610A flow back and forth through the curved region 615A of the serpentine microchannel to the junction 640. The curved region 615A imparts inertial focusing forces to order the stream of cells before they arrive at the junction 640, as is shown in FIG.1B. Similarly, beads provided through aqueous well 610B flow back and forth through the curved region 615B of the serpentine microchannel to the junction 640. The curved region 615B imparts inertial focusing forces to order the stream of beads before they arrive at the junction 640, as is shown in FIG.1B. In various embodiments, the curved region 615A and / or 615B includes multiple undulating portions which impart the inertial focusing forces on the cells and / or beads. In various embodiments, there may be even further undulations in which the cells and / or beads further flow e.g., from left to right and / or from right to left, such that the inertial focusing forces imparted on the cells and / or beads through 53 IPTS / 128953967.1Docket Number: SBT-004WO these even further undulations further order the cells and / or beads within the microchannel. In the particular example microfluidic device shown in FIG.6, cells in aqueous well 610A flowed from right to left through a first set of undulating portions, then flowed from left to right through a second set of undulating portions, then flowed from right to left through a third set of undulating portions, then flowed from left to right through a fourth set of undulating portions, and then flowed from right to left through a fifth (and final) set of undulating portions to the junction 640. Similarly, beads in aqueous well 610B flowed from right to left through a first set of undulating portions, then flowed from left to right through a second set of undulating portions, then flowed from right to left through a third set of undulating portions, then flowed from left to right through a fourth set of undulating portions, and then flowed from right to left through a fifth (and final) set of undulating portions to the junction 640.

[0175] Additionally shown in FIG.6 is an oil well 625 in which an oil phase is introduced to the microfluidic device. The oil phase flows from the oil well 625 through microchannel 630 to the junction 640. At the junction 640, the ordered stream of cells originating from well 610A, the ordered stream of beads originating from well 610B, and the oil phase from oil well 625 combine to form single droplets that encapsulate a single cell and a single bead. Spiral Microchannel Microfluidic Device

[0176] FIG.7A depicts an example microfluidic device with spiral microchannels. For purposes of introduction, the microfluidic device includes two aqueous wells 710A and 710B. Here, cells can be introduced in aqueous fluid into aqueous well 710A and beads can be introduced in aqueous fluid into aqueous well 710B. Generally, the operation of the microfluidic device shown in FIG.7A involves flowing solutions from the left (e.g., from wells 710A, 710B and 725) towards the right (e.g., to the junction 740 and towards the collection well 745).

[0177] As shown in FIG.7A, the aqueous well 710A is fluidically connected to a curved region 715A of a first spiral microchannel. Similarly, the aqueous well 710B is fluidically connected to a curved region 715B of a second spiral microchannel. Thus, cells provided through aqueous well 710A flow through the curved region 715A of the spiral microchannel to the junction 740. The curved region 715A imparts inertial focusing forces to order the stream of cells before they arrive at the junction 740. Similarly, beads provided through aqueous well 710B flow through the curved region 715B of the spiral microchannel to the 54 IPTS / 128953967.1Docket Number: SBT-004WO junction 740. The curved region 715B imparts inertial focusing forces to order the stream of beads before they arrive at the junction 740.

[0178] Reference is now made to FIG.7B depicts an example curved region of a spiral microchannel of the example microfluidic device shown in FIG.7A at a higher magnification. Specifically, FIG.7B shows the inset 750 shown in FIG.7A at a higher magnification. Here, the inset 750 shows the spiral microchannel as it loops around with continuously increasing radius of curvature. In this particular example, the radius of curvature of the microchannel closer to the aqueous well 710A is smaller than the radius of curvature of the microchannel closer to the outlet shown in FIG.7B. Thus, as the cells or beads flow through the spiral microchannel, the inertial focusing forces imparted on the cells or beads causes the organization of the cells or beads into an ordered stream of cells or beads.

[0179] Additionally shown in FIG.7A is an oil well 725 in which an oil phase is introduced to the microfluidic device. The oil phase flows from the oil well 725 through microchannel 730 to the junction 740. At the junction 740, the ordered stream of cells originating from well 710A, the ordered stream of beads originating from well 710B, and the oil phase from oil well 725 were combined to form single droplets that encapsulate single cells and single beads. Additional Features of Microfluidic Devices for Encapsulating Cells and Beads of Ordered Streams into Single Droplets

[0180] In various embodiments, microfluidic devices disclosed herein, such as microfluidic devices shown in FIG.6 and / or FIG.7A can include additional features for improving the ordering of streams of cells and / or co-encapsulation of two or more cells and / or beads in single droplets.

[0181] In various embodiments, an additional feature includes one or more or pillars. The pillars can be useful for guiding the flow of cells from the aqueous well 115A and / or aqueous well 115B into the respective microchannels. For example, a set of pillars can be helpful for establishing the inter-cell or inter-bead distance in the ordered stream of cells or beads. Thus, given appropriate inter-cell or inter-bead distance in the two ordered streams, single cells and single beads are successfully co-encapsulated into single droplets at the junction.

[0182] In various embodiments, a set of pillars is located at an entrance to a microchannel. For example, referring again to FIG.1A, the set of pillar may be located at the entrance of microchannel 115A or microchannel 115B. In particular embodiments, the set of 55 IPTS / 128953967.1Docket Number: SBT-004WO pillars may be located at the end of the aqueous channel 105A or 105B immediately prior to the entrance to the microchannel 115A and microchannel 115B. In various embodiments, the set of pillars comprise 5 to 40 µm gaps between pillars. The example flow of cells or beads around a set of pillars is shown in FIG.4. Beads and Barcodes

[0183] Disclosed herein are methods for performing single-cell sequencing by co- encapsulating single cells and single beads in single droplets. Example beads include solid beads (e.g., silica beads), polymeric beads, or hydrogel beads (e.g., polyacrylamide, agarose, or alginate beads). Beads can be synthesized using a variety of techniques. For example, using a mix-split technique, beads with many copies of the same, random barcode sequence can be synthesized.

[0184] In various embodiments, the beads comprise barcoded beads. In various embodiments, the barcodes of a barcoded bead enabling the subsequent determination that sequenced reads derived originated from a particular cell within the single droplet. In other words, the barcodes are indicative of the single droplet (and the encapsulated cell within the single droplet).

[0185] In various embodiments, each barcoded bead includes at least 102, at least 103, at least 104, at least 105, at least 105, at least 106, at least 107, or at least 108barcodes. In various embodiments, each of the barcodes of a barcoded bead have the same barcode sequence. For example, multiple copies of the same barcode sequence are attached (e.g., releasably attached) to a barcoded bead, thereby enabling identification of the cell from which various sequence reads originate from. In various embodiments, the barcode sequences of a barcoded bead are different. For example, each barcode sequence of a barcoded bead may comprise a ‘unique identification sequence’ (UMI). A UMI is a nucleic acid having a sequence which can be used to identify and / or distinguish one or more first nucleic acids to which the UMI is conjugated from one or more second nucleic acids to which a distinct UMI, having a different sequence, is conjugated. Therefore, UMIs enable the differentiation of different nucleic acids, thereby enabling various applications such as counting or quantifying particular nucleic acids that are present in a cell. In various embodiments, a UMI is between 5 to 20 bases in length. UMIs may be single or double stranded. In some embodiments, both a barcode sequence and a UMI are incorporated into a barcode sequence. Generally, a UMI is used to distinguish between molecules of a similar type within a population or group, whereas a barcode 56 IPTS / 128953967.1Docket Number: SBT-004WO sequence is used to distinguish between populations or groups of molecules that are derived from different cells. In some embodiments, where both a UMI and a barcode sequence are utilized, the UMI is shorter in sequence length than the barcode sequence. The use of barcodes is further described in US Patent Application No.15 / 940,850, which is hereby incorporated by reference in its entirety.

[0186] In some embodiments, the barcodes are single-stranded barcodes. Single-stranded barcodes can be generated using a number of techniques. For example, they can be generated by obtaining a plurality of DNA barcode molecules in which the sequences of the different molecules are at least partially different. These molecules can then be amplified so as to produce single stranded copies using, for instance, asymmetric PCR. Alternatively, the barcode molecules can be circularized and then subjected to rolling circle amplification. This will yield a product molecule in which the original DNA barcoded is concatenated numerous times as a single long molecule. In some embodiments, circular barcode DNA containing a barcode sequence flanked by any number of constant sequences can be obtained by circularizing linear DNA. Primers that anneal to any constant sequence can initiate rolling circle amplification by the use of a strand displacing polymerase (such as Phi29 polymerase), generating long linear concatemers of barcode DNA. Example Cells

[0187] Embodiments described herein involve performing single-cell sequencing on nucleic acids derived from single cells encapsulated in droplets. As described herein, single cells can be encapsulated in droplets by flowing an ordered stream of the cells through a microfluidic channel and co-encapsulating with a barcoded bead.

[0188] In various embodiments, the cell is a human cell. In various embodiments, the cell is a human cancer cell. In various embodiments, the cell is a non-human cell (e.g., a mouse cell). In various embodiments, the cell is a non-human cancer cell (e.g., a mouse cancer cell).

[0189] In various embodiments, the cell is an effector cell. An example of an effector cell is an immune cell, such as a B-cell, a T-cell, a natural killer cell, a lymphocyte, a macrophage, a neutrophil, a basophil, or a mast cell. In particular embodiments, the cell is a B-cell. In particular embodiments, the cell is a T-cell. For example, the T-cell may be a cytotoxic CD8+ T-cell. As another example, the T-cell may be a CD4+ T-cell. In various embodiments, the effector cell may be genetically modified or engineered. For example, the 57 IPTS / 128953967.1Docket Number: SBT-004WO effector cell may be a T cell having a genetically-modified T cell receptor. For instance, in some cases, a T-cell may be taken from a subject (e.g., healthy or diseased), and modified to include a chimeric antigen receptor. The T-cells may be expanded, then assayed as discussed herein to determine target cells that the modified T-cells react to. In various embodiments, the cell is an antigen presenting cell (APC). Example APCs include macrophages, microglia, dendritic cells, B cells (e.g., memory B cells), tumor cells or any native or modified cells.

[0190] In various embodiments, the cell is a cancer cell. Thus, methods disclosed herein for performing single cell sequencing may be useful to identify one or more mutations (e.g., insertions, deletions, polymorphisms, copy number variations, and gene fusions) present in the cell. Examples of cancer cells include cells of hematologic malignancies or solid tumors. Examples of hematologic malignancies include, but are not limited to, acute lymphoblastic leukemia, acute myeloid leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, classic Hodgkin’s Lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, multiple myeloma, myelodysplastic syndromes, myeloid, myeloproliferative neoplasms, or T-cell lymphoma. Examples of solid tumors include, but are not limited to, breast invasive carcinoma, colon adenocarcinoma, glioblastoma multiforme, kidney renal clear cell carcinoma, liver hepatocellular carcinoma, lung adenocarcinoma, lung squamous cell carcinoma, ovarian cancer, pancreatic adenocarcinoma, prostate adenocarcinoma, or skin cutaneous melanoma. Example System Embodiments for Encapsulating Cells and Beads of Ordered Streams into Single Droplets

[0191] Additionally described herein are systems and devices for performing the assays in droplets comprising two cells. An example system can include a microfluidic device, such as an example microfluidic device described herein. In various embodiments, the system may also include one or more of: (a) one or more pumps or control modules for controlling the flow of aqueous fluids and / or oil phase in the microfluidic device, (b) a temperature control module for controlling the temperature of one or more portions of the subject devices and / or droplets therein and which is operably connected to the microfluidic device(s), and / or (c) a detection module, i.e., a detector, e.g., an optical or fluorescent imager, operably connected to the microfluidic device(s). The one or more detection modules i.e., a detector, e.g., an optical or fluorescent imager, are configured for detecting the presence of signal (e.g., signal from reagents indicative of a cell-cell interaction) within one or more droplets. In some 58 IPTS / 128953967.1Docket Number: SBT-004WO embodiments, detector modules are configured to recognize one or more components of one or more droplets, in one or more flow channels. Ordering and Co-Encapsulating Two or More Cells in Single Droplets

[0192] Disclosed herein is a method of ordering cells or beads into an ordered stream. In various embodiments, methods disclosed herein include flowing an aqueous phase comprising cells or beads in a non-rectangular microchannel of a microfluidic device. In various embodiments, the non-rectangular microchannel of the microfluidic device comprises at least a curved region that imparts inertial focusing forces on the flowing cells and / or beads in the microchannel, thereby ordering the cells and / or beads. In some scenarios, the combination of the curved region that imparts inertial focusing forces and the non-rectangular shape of the microchannel enables more effective ordering of cells and / or beads. For example, in some scenarios, the combination of the curved region and the non-rectangular shape of the microchannel avoids cell or bead crowding and enables ordering of higher concentrations of cells and / or beads in the microchannel. By being able to order higher concentrations of cells and / or beads, this enables higher throughput generation of single droplets that co-encapsulate a single cell or bead from a first microchannel and a single cell or bead from a second microchannel. Furthermore, this avoids generation of droplets that include undesirable quantities of cells and / or beads (e.g., too many cells and / or beads in a single droplet) that arise due to crowding effects that occur at higher concentrations of cells and / or beads. Such droplets that have undesirable quantities of cells and / or beads would be otherwise wasted, and therefore, methods disclosed herein avoid wasting these droplets (including undesirable numbers of cells and / or beads). Overview of Co-encapsulating two or more cells in single droplets

[0193] Described herein are methods for ordering and co-encapsulating two or more cells in single droplets in a high-throughput and efficient manner. Methods can further involve studying interactions between the co-encapsulated two or more cells within the single droplets. Further disclosed herein are microfluidic systems for ordering streams of cells and co-encapsulating two or more cells in single droplets to study the interactions of the two or more cells. When the analyses are conducted in a high-throughput manner, such microfluidic systems can identify cells of interest while maintaining the integrity of these cells. 59 IPTS / 128953967.1Docket Number: SBT-004WO

[0194] In various embodiments, methods for co-encapsulating two or more cells in single droplets in a high-throughput and efficient manner generally involve the following steps: 1. Ordering two streams of cells through curved regions of non-rectangular microchannels where the cells experience inertial focusing forces that result in the ordering of the cells (e.g., in an equilibrium of substantially equally distanced cells lined up in a single line in the microchannel). By incorporating non-rectangular microchannels (e.g., microchannels with non-rectangular cross-sections), this avoids cell crowding issues and enables cells to more efficiently order even at higher cell concentrations. 2. Providing the two ordered streams of cells to a junction where they further encounter an oil phase. By tuning the speed of the oil phase, the oil phase cuts each of the cell streams by one cell distance, thereby resulting in co-encapsulation of a pair of cells, where one cell from a first ordered stream and a least one cell from a second ordered stream are in a single droplet.

[0195] Disclosed herein are methods for performing an assay in a single droplet comprising two cells, the method comprising: flowing a first aqueous phase comprising a first ordered stream of cells in a first microchannel towards a junction; flowing a second aqueous phase comprising a second ordered stream of cells in a second microchannel towards the junction; flowing an oil phase in a third microchannel towards the junction; and at the junction, generating the single droplet formed from the first aqueous phase, the second aqueous phase, and the oil phase, the single droplet comprising a cell from the first ordered stream of cells and a cell from the second ordered stream of cells. Additionally disclosed herein are methods for encapsulating pairs of cells in a plurality of droplets, the method comprising: flowing a first aqueous phase comprising a first ordered stream of cells in a first microchannel; flowing a second aqueous phase comprising a second ordered stream of cells in a second microchannel; flowing an oil phase in a third microchannel; and flowing together the first aqueous phase, the second aqueous phase, and the oil phase to generate the plurality of droplets. In various embodiments, the disclosed methods achieve a high co-encapsulation efficiency, wherein at least 15% of droplets in the plurality of droplets include a single cell from the first ordered stream of cells and a single cell from the second ordered stream of cells. In various embodiments, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% of droplets in the 60 IPTS / 128953967.1Docket Number: SBT-004WO plurality of droplets include a single cell from the first ordered stream of cells and a single cell from the second ordered stream of cells.

[0196] As described in further detail herein, a cell-cell interaction assay is performed on single droplets comprising two or more cells. For example, methods disclosed herein involve further encapsulating in the single droplets, during or after co-encapsulation, reagents for performing a cell-cell interaction assay. In a droplet where the two or more cells interact, the reagents report on the activation markers of the two or more cells and / or the secreted molecules in the environment. In various embodiments, methods disclosed herein further involve identifying or sorting cells of interest based on detection of the reagents. Example Methods for Encapsulating Two Cells in a Single Droplet

[0197] Generally, methods for encapsulating two cells (or more cells, e.g. three or more cells) in a single droplet involve at least two steps of 1) ordering two (or more) streams of cells in two separate non-rectangular microchannels, and 2) at a junction at which the two (or more) separate microchannels meet, generating the single droplet comprising a cell from the first ordered stream of cells and a cell from the second ordered stream of cells (etc.). Also the description in this section explicitly describes the ordering of a first stream of cells, ordering a second stream of cells, and co-encapsulating two cells in a single droplet, the description can be further applicable to co-encapsulating a single cell and a single bead in a single droplet. For example, methods can involve ordering a stream of cells in a first non- rectangular microchannel, ordering a stream of beads in a second non-rectangular microchannel, and co-encapsulating a single cell and a single bead in a single droplet.

[0198] As described herein, the parameters (e.g., concentration of cells in aqueous fluid, flow rate of aqueous phase including cells, flow rate of oil phase, microchannel width, and inter-cell spacing within an ordered stream of cells.) that are conducive for ordering cells into ordered streams may not be conducive for co-encapsulation of two or more cells into single droplets. Thus, the parameters are to be tuned to achieve a fluid flow regime that achieves both ordering of cell streams and co-encapsulation of two or more cells into a single droplet.

[0199] Generally, within a microfluidic device, the ordering of cells occurs within a curved region of a microchannel of the microfluidic device. Generally, the ordering of cells within a curved region of a microchannel is due to inertial focusing forces arising from the curvature of the curved region of the microchannel. These secondary forces cause secondary flow, also referred to as Dean flow. For example, under sufficient Dean flow, the equilibrium 61 IPTS / 128953967.1Docket Number: SBT-004WO positions within a microchannel become unstable owing to the impingement of the secondary flow on particles. This can leave a single lateral equilibrium position within the microchannel e.g., at the inside wall of the curve, thereby causing cells to align in an ordered stream. Further details of cell ordering and Dean flow is described in Martel JM, et al. Inertial focusing in microfluidics. Annu Rev Biomed Eng.2014 Jul 11;16:371-96, which is hereby incorporated by reference in its entirety.

[0200] The co-encapsulation of two or more cells into single droplets occurs at a junction of the microfluidic device. Generally, the junction represents the meeting of two or more microchannels, where a first microchannel and a second microchannel each carrying an ordered stream of cells (e.g., ordered as described above due to inertial focusing forces arising from curved regions of microchannels). Furthermore, at least one microchannel carrying an immiscible oil phase (immiscible relative to the aqueous fluid carrying the ordered stream of cells) flows to the junction. Thus, the meeting of the two or more microchannels carrying ordered streams of cells and the one or more microchannels carrying an immiscible oil phase results in the generation of single droplets that include two or more cells (e.g., one cell from a first ordered stream of cells and at least one cell from a second ordered stream of cells). Notably, the flow of the aqueous fluids carrying the ordered stream of cells and the flow of the immiscible oil phase are carefully controlled to avoid the entering into “jetting” or “co-flow” regimes in which droplet formation fails to occur. Reference is now made to Figure (FIG.) 9A, which shows an example schematic of a microfluidic device for encapsulating two or more cells in a single droplet, in accordance with an embodiment. FIG.9A is shown for purposes of introducing a first aqueous well 905A, a second aqueous well 905B, a first microchannel 915A, a curved region 910A of the first microchannel 915A, a second microchannel 915B, a curved region 910B of the second microchannel 915B, a first oil phase well 920A, a third microchannel 925A fluidically connected to the first oil phase well 920A, a second oil phase well 920B, a fourth microchannel 925B fluidically connected to the second oil phase well 920B, a junction 930, a collection well 940, and a sixth microfluidic channel 935 fluidically connecting the junction 930 to the collection well 940. Generally, the operation of the microfluidic device shown in FIG.9A involves flow solutions from the left (e.g., from wells 905A and 905B) towards the right (e.g., to the collection well 940).

[0201] FIG.9A shows one example embodiment of a microfluidic device for encapsulating two or more cells in a single droplet. In some embodiments, the device may be 62 IPTS / 128953967.1Docket Number: SBT-004WO differently configured. As one example, the microfluidic device need not include two separate oil phase wells 920A and 920B and instead, includes a single oil phase well that is fluidically connected to provide the oil phase to the junction 930.

[0202] FIG.9A shows two sets of an aqueous well 905, microchannel 915, and curved region 910 of microchannel 915 leading to the junction 930. In various embodiments, a microfluidic device may include additional sets of an aqueous well 905 connected to an additional microchannel 915 with a curved region 910. For example, a microfluidic device may include three sets, four sets, five sets, six sets, seven sets, eight sets, nine sets, or ten sets of an aqueous well 905 connected to an additional microchannel 915 with a curved region 910. This enables the co-encapsulation of various types of cells and / or reagents that are provided through the various aqueous wells that lead to the junction 930. For example, in various embodiments, a microfluidic device can enable co-encapsulation of two cells, three cells, four cells, five cells, six cells, seven cells, eight cells, nine cells, or ten or more cells within a single droplet.

[0203] Generally, cells of a first cell type are provided to the first aqueous well 905A. Cells of a second cell type are provided to the second aqueous well 905B. Under microfluidic control, the cells of the first cell type are driven from the first aqueous well 905A through at least the curved region 910A of the first microchannel 915A. Here, the curved region 910A of the first microchannel 915A imparts inertial focusing forces on the cells of the first cell type to generate a first ordered stream of cells upon entering into the junction 930. Similarly, under microfluidic control, the cells of the second cell type are driven from the second aqueous well 905B through at least the curved region 910B of the second microchannel 915B. Here, the curved region 910B of the second microchannel 915B imparts inertial focusing forces on the cells of the second cell type to generate a second ordered stream of cells upon entering into the junction 930. For simple diagrammatic purposes, curved regions 910A and 910B are shown as serpentine portions of the first microchannel 915A and second microchannel 915B.

[0204] Furthermore, as shown in FIG.9A, the first channel 915A may include a non- curved region 918A leading up to the junction 930. Thus, the non-curved region 918A is located proximal to the junction 930 in comparison to the curved region 910A of the first microchannel 915A. Similarly, the second microchannel 915B may include a non-curved region 918B leading up to the junction 930. Thus, the non-curved region 918B is located proximal to the junction 930 in comparison to the curved region 910B of the second 63 IPTS / 128953967.1Docket Number: SBT-004WO microchannel 915B. Here, the non-curved region 918A and 918B leading up the junction 930 enable the respective ordered stream of cells to approach the junction 930 while experiencing reduced, limited, or no inertial focusing forces.

[0205] An immiscible oil phase is provided to the oil phase well 920. Exemplary immiscible oils useful for the oil phase are described above. Here, under microfluidic control, the oil phase flows through the third microchannel 925A and / or the fourth microchannel 925B to meet at the junction 930. Reference is now made to FIG.9B, which shows a zoomed in view of the junction 930. In particular, FIG.9B shows a first ordered stream of cells 950A entering the junction 930 through the first microchannel 915A, a second ordered stream of cells 950B entering the junction 930 through the second microchannel 915B, and the immiscible oil phases entering the junction 930 through the third microchannel 925A and the fourth microchannel 925B. The flowing aqueous fluids including the two ordered streams of cells are pinched by the flowing oil phases, thereby causing droplet formation downstream of the junction 930. Specifically, as shown in FIG.9B, a single droplet 955 includes two or more cells 960, where one cell originates from the first ordered stream of cells 950A and another cell originates from the second ordered stream of cells 950B.

[0206] Returning to FIG.9A, the droplets containing two or more cells continue to flow down the microchannel 935 towards a collection well 940. In various embodiments, while flowing through microchannel 935, the droplet can undergo an assay, such as a cell-cell interaction assay to interrogate whether the two or more cells interacted with each other. As described in further detail herein, the cell-cell interaction assay can involve capturing a signal (e.g., a fluorescent signal) emitted in a single droplet once a cell-cell interaction has occurred. Thus, in such embodiments, a detection module, i.e., a detector, e.g., an optical or fluorescent imager, can be configured to capture the signal emitted in single droplets. For example, the detection module can be situated to capture the signal emitted in single droplets while the droplets are flowing through microchannel 935 towards the collection well 940. Non-rectangular Microchannels

[0207] As described herein, various embodiments involve implementation of non- rectangular microchannels, which enables the ordering of higher concentrations of cells within the non-rectangular microchannels. Generally, in a setting of higher concentrations of cells, the cells will encounter cell crowding effects. Thus, the cell crowding can prevent cells from reaching an equilibrium state, such as an equilibrium state where the cells are lined up 64 IPTS / 128953967.1Docket Number: SBT-004WO in an ordered stream. The implementation of non-rectangular microchannels lessens the impact of the cell crowding, thereby enabling the ordering of cells even at higher concentrations.

[0208] Specifically, by implementing non-rectangular microchannels, asymmetry in the flow velocity profile of the non-rectangular microchannel is introduced so that the focused line of cells will be offset from the center of the channel in the Z direction (height dimension). As an example, assuming the non-rectangular microchannel is a triangular microchannel, the triangular shape will shift the stream of cells upwards towards the apex of the triangular shape. This upward shift means that cells that are trying to enter the ordered stream will be moving much faster or slower than the cells that are already in the ordered stream. Additionally, cells on adjacent sides of the ordered stream will be moving at different velocities. These differences in velocities allow the cells to separate from each other in the longitudinal direction, allowing the cells to settle into their equilibrium positions at unoccupied slots within the ordered stream of cells.

[0209] In various embodiments, the implementation of non-rectangular microchannels enables ordering of higher concentrations of cells that exceed a threshold concentration. In various embodiments, the threshold concentration is expressed as follows: ^^^^^^^^^^ ^^^^ ^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^ ^൨ ^^^^ ^rectangular microchannel, wherein width refers to a width of the non- rectangular microchannel, and wherein height refers to a height of the non- rectangular microchannel.

[0210] In various embodiments, the total cross sectional area of a non-rectangular microchannel is between about 500 µm2and about 20,000 µm2, between about 600 µm2to about 19,000 µm2, between about 700 µm2to about 18,000 µm2, between about 800 µm2to about 17,000 µm2, and any ranges within the prior listed ranges. In various embodiments, the total cross sectional area of a non-rectangular microchannel is about 500 µm2, about 550 µm2, about 600 µm2, about, about 700 µm², about 850 µm², about 1,000 µm², about 1,150 µm², about 1,300 µm², about 1,450 µm², about 1,600 µm², about 1,750 µm², about 1,900 µm², about 2,050 µm², about 2,200 µm², about 2,350 µm², about 2,500 µm², about 2,650 µm², about 2,800 µm², about 2,950 µm², about 3,100 µm², about 3,250 µm², about 3,400 µm², 65 IPTS / 128953967.1Docket Number: SBT-004WO about 3,550 µm², about 3,700 µm², about 3,850 µm², about 4,000 µm², about 4,150 µm², about 4,300 µm², about 4,450 µm², about 4,600 µm², about 4,750 µm², about 4,900 µm², about 5,050 µm², about 5,200 µm², about 5,350 µm², about 5,500 µm², about 5,650 µm², about 5,800 µm², about 5,950 µm², about 6,100 µm², about 6,250 µm², about 6,400 µm², about 6,550 µm², about 6,700 µm², about 6,850 µm², about 7,000 µm², about 7,150 µm², about 7,300 µm², about 7,450 µm², about 7,600 µm², about 7,750 µm², about 7,900 µm², about 8,050 µm², about 8,200 µm², about 8,350 µm², about 8,500 µm², about 8,650 µm², about 8,800 µm², about 8,950 µm², about 9,100 µm², about 9,250 µm², about 9,400 µm², about 9,550 µm², about 9,700 µm², about 9,850 µm², about 10,000 µm², about 10,150 µm², about 10,300 µm², about 10,450 µm², about 10,600 µm², about 10,750 µm², about 10,900 µm², about 11,050 µm², about 11,200 µm², about 11,350 µm², about 11,500 µm², about 11,650 µm², about 11,800 µm², about 11,950 µm², about 12,100 µm², about 12,250 µm², about 12,400 µm², about 12,550 µm², about 12,700 µm², about 12,850 µm², about 13,000 µm², about 13,150 µm², about 13,300 µm², about 13,450 µm², about 13,600 µm², about 13,750 µm², about 13,900 µm², about 14,050 µm², about 14,200 µm², about 14,350 µm², about 14,500 µm², about 14,650 µm², about 14,800 µm², about 14,950 µm², about 15,100 µm², about 15,250 µm², about 15,400 µm², about 15,550 µm², about 15,700 µm², about 15,850 µm², about 16,000 µm², about 16,150 µm², about 16,300 µm², about 16,450 µm², about 16,600 µm², about 16,750 µm², about 16,900 µm², about 17,050 µm², about 17,200 µm², about 17,350 µm², about 17,500 µm², about 17,650 µm², about 17,800 µm², about 17,950 µm², about 18,100 µm², about 18,250 µm², about 18,400 µm², about 18,550 µm², about 18,700 µm², about 18,850 µm², about 19,000 µm², about 19,150 µm², about 19,300 µm², about 19,450 µm², about 19,600 µm², about 19,750 µm², about 19,900 µm², about 20,050 µm².

[0211] Referring now to FIG.9C, an example diagram of parabolic fluid flow velocity in a rectangular microchannel is shown. Pressure, defined as force divided by unit area, pushes the fluid forward. A cylindrical flow of fluid moves from left to right, away from the source of pressure. Within the parabolic flow, velocity of the fluid is highest in the center with fluid flow slowing down on the sides (indicated by the length of the arrows). An end view of parabolic flow is also shown. There are concentric fluid layers within the parabolic flow, each layer faster than a previous layer from outside in, with a center of the parabolic flow having a highest velocity. 66 IPTS / 128953967.1Docket Number: SBT-004WO

[0212] Referring now to FIG.9D, an illustration of focused streams within a rectangular microchannel is shown. Here, at higher cell concentrations, FIG.9D shows cell crowding effects where cells block each other from effectively lining up into an ordered stream. As illustrated, in a rectangular microchannel, unoccupied slots in a focused stream may appear (shown as dotted circles). As explained above with reference to FIG.9C, flow near the sides in a parabolic flow stream is slower. This may cause particles, such as beads or cells, to crowd each other. In a parabolic flow, if a particle enters a free slot, a second particle may be partially or completely blocked from entering another free slot since particles on the same distance away from a center of the parabolic flow have the same velocity. The second particle has to wait for a next available unoccupied slot.

[0213] Referring now to FIG.9E, an illustration of a time lapse of cells in a parabolic flow is presented. The parabolic flow may include cells 1-5, each aligned with a flow velocity with respect to a maximum flow velocity in a center of the parabolic flow where cell 3 is represented. The dotted circles represent empty slots in which a cell may be positioned in and the dashed lines represent channel walls. A flow velocity may be slower for cells more distal to a center of a flow. For instance, cells 1 and 5 may experience a slowest flow velocity, cells 2 and 4 may experience a greater flow velocity than cells 1 and 5, and cell 3 may experience a greatest flow velocity. In some embodiments, cells 2 and 4 may block each other from entering a free slot in the cell stream. Cells 1 and 5 may similarly block one another from entering the cell stream. As shown in FIG.9E, as time progress, cells 1-5 crowd one another instead of flowing in a single file line.

[0214] Referring now to FIG.9F, a parabolic flow in an asymmetric channel is presented. Similar to the flow in FIG.9E, cells 1-5 may experience various flow velocities with respect to a maximum flow velocity of cell 4. Cell 1 may travel slower than cell 2 and may enter an unoccupied slot of behind cell 2. Cell 3 may flow faster than cell 2 and may find an unoccupied slot ahead of cell 2. Cells 4 and 5 may further separate in preparation for entering an ordered stream.

[0215] Referring now to FIGs.9H-M, illustrations of various non-rectangular microchannels are presented. In some embodiments, the first and / or second microchannels 915A-B may be non-rectangular. Non-rectangular microchannels may prevent cell crowding as depicted above.

[0216] Referring specifically now to FIG.9H, a rectangular microchannel is presented. For FIGs.9H-N, arrows indicate a path that cells may travel to arrive at an equilibrium 67 IPTS / 128953967.1Docket Number: SBT-004WO position (e.g., within an inertially focused ordered cell stream). Dotted lines indicate axes of symmetry. When an axis of symmetry is present, a flow velocity profile and its effect on inertial focusing may follow that as shown in FIG.9H. Rectangular channels may have 2 axes of symmetry which may cause both a top and side view to follow as illustrated in FIG. 9H, which may lead to cell crowding at high cell concentrations.

[0217] Referring to FIG.9I, an isosceles-triangular shaped microchannel is presented. In planes with asymmetry, a flow velocity profile and its effect on inertial focusing may be as shown in FIG.9I. For instance triangular and / or U-shaped channel may have one plane of symmetry so that the flow of cells from a top view follows the flow shown in FIG.9E and the flow of cells from a side view follows the flow shown in FIG.9F. In various embodiments, the triangular channel may be a serpentine channel that has a triangular cross-sectional shape. Therefore, the serpentine channel may impart inertial focusing forces that focus an ordered stream of cells into a middle of the channel while the triangular cross-sectional shape may focus the ordered stream of cells upwards towards its apex, as is shown in FIG.9L. At an apex of the triangular cross-sectional shape, flow velocity of the ordered stream may be slower because the apex is closer to two channel walls of the microchannel. This difference in velocity may allow one or more cells in an ordered stream to slip past one or more other cells in the ordered stream. As a non-limiting example, if cell A encounters a cell B that is already in an equilibrium position, cell A can slip past cell B to find an unoccupied slot in the ordered stream, whereas in a rectangular channel the flow velocity does not change drastically which would cause cell B to crowd cell A.

[0218] Referring now to FIG.9J, a scalene-triangular shaped microchannel is presented. The scalene-triangular shaped microchannel, an irregular trapezoidal, and / or non-symmetric U-shaped channel, may have no axes of symmetry, which may cause the flow of cells from both a top and side view of the scalene-triangular shaped microchannel to follow that of FIG. 9F.

[0219] Referring now to FIG.9K, a trapezoidal microchannel is presented. A non- rectangular channel may include a trapezoidal channel. For instance, instead of a rectangular or triangular cross-sectional channel design, trapezoidal channels may be designed to raise a concentration limit of cells. Trapezoidal channels may accommodate larger cells having a greater diameter and may allow these cells to order at a shorter side of the trapezoidal channel’s parallel sides. The bottom, longer side of the trapezoid shown in FIG.9K may allow more fluid to flow past without touching the channel walls of the microchannel. The 68 IPTS / 128953967.1Docket Number: SBT-004WO top, shorter side of the trapezoid may force fluids to contact more walls and may have a slower flow velocity. A shear gradient may force the cells upwards into the trapezoids apex.

[0220] Referring now to FIG.9L, a U-shaped microchannel is presented. A non- rectangular channel may include a U-shaped channel, which may allow higher concentrations of cells to be inertially focused. In a U-shaped channel, a flow velocity of a center of the channel may be much slower than neighboring flow streams. A serpentine channel may focus cells into a center of the channel where a majority of passing fluid may contact stationary channel walls, drastically slowing the flow velocity. Cells entering the central equilibrium point may slip past a cell that may already be there and enter an empty slot easily.

[0221] Referring now to FIG.9M, a non-symmetric U-shaped channel is presented. The non-symmetric U-shaped channel may no axes of symmetry, which may cause the flow profile of cells from both a top and side view of the scalene-triangular shaped microchannel to follow that of FIG.9F.

[0222] In some embodiments, non-rectangular microchannels may have two or more centers of maximum flow velocity. A non-rectangular microchannel may have a height that may change along a length of the non-rectangular microchannel. A changing height of a non- rectangular microchannel along a length of the non-rectangular microchannel may occur in an undulating matter. A changing height of a non-rectangular microchannel may impart Dean forces as an undulating channel but in a Z-direction relative to a three dimensional cartesian coordinate system (e.g., X-axis, Y-axis, Z-axis). Imparting Dean forces in an undulating channel but in a Z-direction may offset an equilibrium point of a non-rectangular microchannel from a center of max velocity of the non-rectangular microchannel but may not be completely at an apex of the non-rectangular microchannel, such as, without limitation, in the case of a triangular microchannel.

[0223] Referring back to FIG.9A, any of the above described non-rectangular designs may be used for either or both of the first microchannel 915A and / or second microchannel 915B. A non-rectangular microchannel 915 may allow for an ordering of cells or beads to generate an ordered stream of cells or beads. A non-rectangular microchannel 915 may apply a pressure to an ordered stream of cells or beads of about 500 millibar to about 1500 millibar . A non-rectangular microchannel 915, may cause a cell or bead located proximal to a center of the non-rectangular microchannel 915 to experience a faster flow velocity relative to a slower flow velocity of a cell or bead located more distally to a center of the non-rectangular microchannel 915. A non-rectangular microchannel 915 may prevent a crowding of a 69 IPTS / 128953967.1Docket Number: SBT-004WO plurality of cells or beads, such as with any of the above-described shaped channels. In some embodiments, a non-rectangular microchannel 915 may focus a majority of an aqueous phase towards a bottom side of the non-rectangular microchannel 915 without touching one or more channel walls of the non-rectangular microchannel 915. A non-rectangular microchannel 915 may be triangular, trapezoidal, U-shaped, and / or any other shape or combination of shapes, without limitation. A non-rectangular first microchannel 915A and a non-rectangular second microchannel 915B may allow for single droplet formation generation with a population characterized by a fraction of single droplets comprising one cell or bead from the first ordered stream and one cell or bead from the second ordered stream, that exceeds a predicted fraction of single droplets comprising one cell or bead from the first ordered stream and one cell or bead from the second ordered stream using a Poisson distribution.

[0224] Reference is now made to FIG.10, which depicts a flow diagram for ordering cells or beads into an ordered stream, in accordance with an embodiment. As shown in FIG. 10, step 1010 involves flowing an aqueous phase comprising cells or beads in a non- rectangular microchannel of a microfluidic device. Step 1020 involves ordering the cells or beads in the non-rectangular microchannel to generate an ordered stream of cells or beads. Concentration of Cells or Beads in Non-Rectangular Microchannels

[0225] Generally, the concentration of cells or beads is a tunable parameter for influencing the ordering of a stream of cells or beads. For example, providing too low of a concentration can result in too low or slow of a throughput analysis. On the contrary, using too high of a concentration will cause aggregation and disruptive flow, thereby resulting in encapsulation of more than one cell or more than one bead into a droplet from an ordered stream.

[0226] In various embodiments, the concentration of cells or beads can be dependent on values of other tunable parameters. For example, the appropriate concentration can be determined based on any of 1) diameter, 2) inter-cell or inter-bead spacing, 3) microchannel width, and / or 4) microchannel height. In particular embodiments, the appropriate concentration is dependent on 1) diameter, 2) inter-cell or inter-bead spacing, 3) microchannel width, and / or 4) microchannel height.

[0227] In various embodiments, the concentration of cells or beads ^^^in an ordered stream is defined according to Equation (1): 70 IPTS / 128953967.1Docket Number: SBT-004WO ^^^^^^^^^^ ^^^^ ^^^^^^^^^^ 1 ^^^^^^^^^^^ ^^^^ ^^^^^^^^^^^ଷି ^^ ^^^^൨ ൌ^ ^^ ^ ∗ 10 ^^^ ^^^^^^^ ^ ^^^ ^^ ∗ ^^^^^^^ ∗ ^^^^^^^^^^^ where ^^^^^^represents or width and ^^ represents height of first mi^ crochannel. the concentration of cells or beads ^^ଶin the second ordered stream can be defined according to Equation (2): ^^^^^^^^^^ ^^^^ ^^^^^^^^^^1^^^^^^^^^^^ ^^^^ ^^^^^^^^^^^^^ଷ^^ଶ^ ^^^^൨ ൌ^^^ ^ ^^ ^ ^ ^ ^ ^ ∗ 10ି^^^ ଶ^^ଶ ^^ ∗ ^^ଶ ^^ ∗ ^^ଶ ^^^^^^ where ^^ଶstream, ^^ଶrepresents spacing between pairs of cells or beads of the second ordered stream, ^^ଶrepresents width of the second microchannel, and ^^ଶrepresents height of the second microchannel.

[0228] In various embodiments, Equation (1) and Equation (2) described above refer to the maximum concentration of cells or beads ^^^and maximum concentration of cells or beads ^^ଶ, respectively, in their respective microchannels. In various embodiments, Equation (1) and Equation (2) described above refer to the maximum concentration of cells or beads ^^^and maximum concentration of cells or beads ^^ଶ, respectively, that are added to their respective wells (e.g., aqueous wells). Thus, remaining below the maximum concentration ^^^and maximum concentration ^^ଶcan ensure ordering of both the stream of cells and the stream of beads.

[0229] In various embodiments, the concentration of cells or beads defined in Equation (1) and Equation (2) can be adjusted according to a desired droplet diameter and volume. For example, the denominator of either Equation (1) or Equation (2) can be equal to half the volume of the desired droplet volume.

[0230] In various embodiments, the concentration of cells or beads defined in Equation (1) and Equation (2) are maximum concentrations of cells or beads for generating ordered streams of cells or beads in microchannels. The implementation of non-rectangular microchannels may enable the use of concentrations of cells or beads that exceed Equation (1) and Equation (2). In various embodiments, by implementing a non-rectangular microchannel, the concentration of cells or beads in the non-rectangular microchannel can exceed the concentration of cells or beads in Equation (1) or Equation (2) by at least 10%. In various embodiments, by implementing a non-rectangular microchannel, the concentration of 71 IPTS / 128953967.1Docket Number: SBT-004WO cells or beads in the non-rectangular microchannel can exceed the concentration of cells or beads in Equation (1) or Equation (2) by at least 15%, by at least 20%, by at least 25%, by at least 30%, by at least 35%, by at least 40%, by at least 45%, by at least 50%, by at least 55%, by at least 60%, by at least 65%, by at least 70%, by at least 75%, by at least 80%, by at least 85%, by at least 90%, by at least 95%, or by at least 100%.

[0231] For instance, for non-rectangular microchannels, the concentration of cells or beads in a first ordered stream is defined according to Equation (3): ^^^^^^^^^^ ^^^^ ^^^^^^^^^^ 1 ^^^^^^^^^^^ ^^^^ ^^^^^^^^^^^ଷି^^^ ^^ଷ^൨ ൌ^ ଷ ଷ^^ ^ ^ ^^^^^^^^ െ ^^^^^^^^^^^^^^^^^^ ^^^^^^^^ ^^ଶ ∗ 10 ^^ ^^^^^^ ^ ^^ ^^ ∗ ^^ ^^ ^^^^^sectional area represents the cross-sectional area of the non-rectangular microchannel. Equation (3) can be used for a first ordered stream of a non-rectangular microchannel, a second ordered stream of a non-rectangular microchannel, or additional ordered streams of non-rectangular microchannels.

[0232] In various embodiments, Equation (3) described above refers to the maximum concentration of cells or beads ^^ଷin a non-rectangular microchannel. In various embodiments, Equation (3) described above refers to the maximum concentration of cells or beads ^^ଷthat are added to a respective well (e.g., aqueous well). Thus, remaining below the maximum concentration ^^ଷcan ensure ordering of the stream of cells or beads.

[0233] In various embodiments, the concentration of cells or beads defined in Equation (3) can be adjusted according to a desired droplet diameter and volume. For example, the denominator of Equation (3) can be equal to half the volume of the desired droplet volume.

[0234] In various embodiments, the concentration of cells or beads defined in Equation (3) is a maximum concentrations of cells or beads for generating ordered streams of cells or beads in non-rectangular microchannels. Co-Encapsulating Three or More Cells or Beads of Different Species in a Single Droplet

[0235] Generating droplets that contain multiple cells or beads of different species at a reproducible and consistent ratio at high throughput is currently difficult. Microfluidic devices can encapsulate single cells into droplets and thereby compartmentalize the cells in high throughput. Generally, these devices produce droplets containing one or more cells in accordance with a Poisson distribution. 72 IPTS / 128953967.1Docket Number: SBT-004WO

[0236] Disclosed herein are methods for co-encapsulating three or more cells or beads in a single droplet. In various embodiments, co-encapsulating three or more cells or beads involves inertially focusing cells or beads within microchannels of a microfluidic device. Inertially focusing cells or beads inside a microfluidic device requires the cells or beads to be travelling at high velocity and flow rate. However, when the aqueous fluid that contains the cells or beads is flowing at too high a rate and velocity, they cannot form droplets. Instead, a co-flow regime between the aqueous and the encapsulating oil phase forms with no droplet generation. Thus, device parameters such as channel geometry, length, and width must be optimized and carefully designed to allow droplet formation at these high flow rates. Attempting to generate droplets with contributions from more than one ordered stream results in a co-flow regime since the total flow rate across all the streams is too large to allow droplet formation.

[0237] The method includes flowing a first aqueous phase comprising a first ordered stream of cells or beads in a first microchannel towards a junction. The method includes flowing a second aqueous phase comprising a second ordered stream of cells or beads in a second microchannel towards the junction. The method includes flowing a third aqueous phase comprising a third ordered stream of cells or beads in a third microchannel towards the junction. The method includes flowing an oil phase in a fourth microchannel towards the junction. The method includes, at the junction, generating the single droplet formed from the first aqueous phase, the second aqueous phase, the third aqueous phase, and the oil phase, the single droplet comprising one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream.

[0238] In an aspect, a system for generation of a single droplet having three or more cells or beads is presented. The system includes a first microchannel configured to flow a first aqueous phase comprising a first ordered stream of cells or beads. The system includes a second microchannel configured to flow a second aqueous phase comprising a second ordered stream of cells or beads. The system includes a third microchannel configured to flow a third aqueous phase comprising a third ordered stream of cells or beads. The system includes a fourth microchannel configured to flow an oil phase. The system includes a junction connected to the first, second, third, and fourth microchannels. The first, second, third, and fourth microchannels flow towards the junction. The junction has a nozzle end configured to generate a single droplet formed from the first, second, and third aqueous 73 IPTS / 128953967.1Docket Number: SBT-004WO phases. The single droplet includes one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream.

[0239] Reference is now made to Figure (FIG.) 11A, which shows an example schematic of a microfluidic device for encapsulating two or more cells in a single droplet, in accordance with an embodiment. FIG.11A is shown for purposes of introducing a first aqueous well 1105A, a second aqueous well 1105B, a third aqueous well 1105C, a first microchannel 1115A, a curved region 1110A of the first microchannel 1115A, a second microchannel 1115B, a curved region 1110B of the second microchannel 1115B, a third microchannel 1115C, a curved region 1110C of the third microchannel 1115C, a first oil phase well 1120A, a fourth microchannel 1125A fluidically connected to the first oil phase well 1120A, a second oil phase well 1120B, a fifth microchannel 1125B fluidically connected to the second oil phase well 1120B, a junction 1130, a collection well 1140, and a sixth microfluidic channel 1135 fluidically connecting the junction 1130 to the collection well 1140. Generally, the operation of the microfluidic device shown in FIG.11A involves flow solutions from the left (e.g., from wells 1105A, 1105B, and 1105C) towards the right (e.g., to the collection well 1140).

[0240] FIG.11A shows one example embodiment of a microfluidic device for encapsulating three or more cells or beads (or various combinations, e.g., two cells and one bead) in a single droplet. In some embodiments, the device may be differently configured. As one example, the microfluidic device need not include two separate oil phase wells 1120A and 1120B, and instead, includes a single oil phase well that is fluidically connected to provide the oil phase to the junction 1130.

[0241] FIG.11A shows three sets of an aqueous well 1105, microchannel 1115, and curved region 1110 of microchannel 1115 leading to the junction 1130. In various embodiments, a microfluidic device may include additional sets of an aqueous well 1105 connected to an additional microchannel 1115 with a curved region 1110. For example, a microfluidic device may include four sets, five sets, six sets, seven sets, eight sets, nine sets, or ten sets of an aqueous well 1105 connected to an additional microchannel 1115 with a curved region 1110. This enables the co-encapsulation of various types of cells and / or reagents that are provided through the various aqueous wells that lead to the junction 1130. For example, in various embodiments, a microfluidic device can enable co-encapsulation of three cells, four cells, five cells, six cells, seven cells, eight cells, nine cells, or ten or more cells within a single droplet. 74 IPTS / 128953967.1Docket Number: SBT-004WO

[0242] Although FIG.11A shows that the three microchannels 1115A, 1115B, and 1115C each meet at junction 1130, in some embodiments, one or more of the microchannels 1115 may meet before arriving at the junction 1130 while other one or more of the microchannels 1115 meet at the junction 1130. For example, in a scenario where there are four microchannels 1115 (each carrying an aqueous phase with an ordered stream of cells or beads), two of the microchannels may first merge to form a first intermediate microchannel before merging with the third and fourth microchannels e.g., at a junction. As another example, in a scenario where there are four microchannels 1115 (each carrying an aqueous phase with an ordered stream of cells or beads), two of the microchannels may merge to form a first intermediate microchannel, the other two of the microchannels may merge to form a second intermediate microchannel, and the first and second intermediate microchannels can meet at junction 1130.

[0243] Generally, cells or beads of a first cell or bead type are provided to the first aqueous well 1105A. Cells or beads of a second cell or bead type are provided to the second aqueous well 1105B. Cells or beads of a third cell or bead type are provided to the third aqueous well 1105C. Under microfluidic control, the cells of the first cell type or beads of a first bead type are driven from the first aqueous well 1105A through at least the curved region 1110A of the first microchannel 1115A. Here, the curved region 1110A of the first microchannel 1115A imparts inertial focusing forces on the cells of the first cell type to generate a first ordered stream of cells or beads which enters into the junction 1130. Similarly, under microfluidic control, the cells of the second cell type or beads of a second bead type are driven from the second aqueous well 1105B through at least the curved region 1110B of the second microchannel 1115B. Here, the curved region 1110B of the second microchannel 1115B imparts inertial focusing forces on the cells of the second cell type to generate a second ordered stream of cells or beads which enters into the junction 1130. Similarly, under microfluidic control, the cells or beads of the third cell or bead type are driven from the third aqueous well 1105C through at least the curved region 1110C of the third microchannel 1115C. Here, the curved region 1110C of the third microchannel 1115C imparts inertial focusing forces on the cells or beads of the third cell or bead type to generate a third ordered stream of cells or beads which enters into the junction 1130. For simple diagrammatic purposes, curved regions 1110A, 1110B and 1110C are shown as serpentine portions of the first microchannel 1115A, second microchannel 1115B, and third microchannel 1115C. However, in various embodiments, the curved regions 1110A, 1110B, 75 IPTS / 128953967.1Docket Number: SBT-004WO and 1110C, can be, in various embodiments, significantly more complicated. In some embodiments, the first, second, and third microchannels 1115A-C all are serpentine structured. In other embodiments, the first, second, and third microchannels 1115A-C may all have different structures. Any combination of structures of the first, second, and third microchannels 1115A-C may be employed, without limitation.

[0244] In various embodiments, reagents may be further provided to one or more of the aqueous wells 1105 shown in FIG.11, such that upon co-encapsulation of the single cell and single bead at the junction 1130, the reagents, or portions thereof, are similarly encapsulated in the single droplet. In various embodiments, reagents may be useful for performing cell sequencing. In various embodiments, the reagents are provided to aqueous well 1105A, 1105B, and / or 1105C with the barcoded beads. In various embodiments, the reagents are provided to aqueous well 1105A, 1105B, and / or 1105C with the cells. Exemplary reagents include lysis reagents, chemical stimuli, a proteinase (e.g., proteinase K), chelators, nucleic acid extension reagents, replication, transcription or amplification reagents such as polymerases, reverse transcriptases, transposases which can be used for transposon based methods, nucleoside triphosphates or NTP analogues, primer sequences and additional cofactors such as divalent metal ions used in such reactions, ligation reaction reagents, such as ligase enzymes and ligation sequences, dyes, labels, or other tagging reagents. In various embodiments, certain reagents are provided to aqueous well 1105B and / or 1105C such that they do not prematurely interact with the cell in aqueous well 1105A. For example, lysis reagents may be provided to aqueous well 1105B and / or 1105C with the barcoded beads such that the lysis reagents contact the cells upon co-encapsulation at the junction 1130 (and not prior to co-encapsulation). Exemplary lysis reagents include surfactant based lysis solutions such as non-ionic surfactants (e.g., TritonX-100 and Tween 20) or ionic surfactants (e.g., sarcosyl and sodium dodecyl sulfate (SDS)).

[0245] Furthermore, as shown in FIG.11A, the first channel 1115A may include a non- curved region 1118A leading up to the junction 1130. Thus, the non-curved region 1118A is located proximal to the junction 1130 in comparison to the curved region 1110A of the first microchannel 1115A. Similarly, the second microchannel 1115B may include a non-curved region 1118B leading up to the junction 1130. Similarly, the third microchannel 1115C may include a non-curved region 1118C leading up to the junction 1130. Thus, the non-curved region 1118C is located proximal to the junction 1130 in comparison to the curved region 1110C of the third microchannel 1115C. Here, the non-curved region 1118A, 1118B, and 76 IPTS / 128953967.1Docket Number: SBT-004WO 1118C leading up the junction 1130 enable the respective ordered stream of cells or beads to approach the junction 1130 while experiencing reduced, limited, or no inertial focusing forces. An immiscible oil phase is provided to the oil phase well 1120. Here, under microfluidic control, the oil phase flows through the fourth microchannel 1125A and / or the fifth microchannel 1125B to meet at the junction 1130.

[0246] The first microchannel may have a width of about 50 microns to about 200 microns. The second microchannel may have a same or different width than that of the first microchannel. For instance and without limitation, the second microchannel may have a smaller or greater width than the first microchannel. Similarly, the third microchannel may have a width greater or less than that of either of both of the first and second microchannels. The first, second, and / or third microchannels may have any width of a microchannel described throughout this disclosure, without limitation. In some embodiments, all three microchannels 1115A-C have the same width. In some embodiments, the first microchannel may meet the junction 1130 at an angle. For instance, and without limitation, the first microchannel 1115A may meet the junction 1130 at angle of about 45 degrees to about 70 degrees, less than about 45 degrees, or greater than about 70 degrees. Angles between microchannels 1115 may be anywhere in a range of about 1 degree to about 180 degrees, without limitation. Similarly, the second and third microchannels 1115B-C may meet the junction 1130 at various angles. The second microchannel 1115B may meet at the junction 1130 at an angle greater than or less than the first microchannel 1115A. The third microchannel 1115C may meet at the junction 1130 at an angle greater or less than either or both of the first and second microchannels 1115B-C. In some embodiments, the second microchannel 1115B may meet the junction 1130 at an angle substantially smaller than that of the first or third microchannels 1115A,C. The second microchannel 1115B may be positioned between the first and third microchannels 1115A,C, which may limit an angle that the second microchannel 1115B can meet the junction 1130 at. In some embodiments, to account for spacing of the first and third microchannels 1115A,C, the second microchannel 1115B may comprise an elongated end that may be flat and provide a connection between the second microchannel 1115B and the junction 1130. An elongated end of the second microchannel 1115B may be non-curved and may connect the junction 1130 with the non- curved region 1118B of the second microchannel 1115B. A length of an elongated end of the second microchannel 1115B may be no more than about 1%, about 2%, about 3%, about 4%, about 5%, about 10%, about 15%, or about 20% an entire length of the second microchannel 77 IPTS / 128953967.1Docket Number: SBT-004WO 1115B. A length of an elongated end of the second microchannel 1115B may be in a range of about 0.1% to about 10% of a total length of the second microchannel 1115B. A width of an elongated end of the second microchannel 1115B may be about 20 μm to about 75 μm, less than about 10 μm, or greater than about 20 μm. For instance, a width of an elongated end of the second microchannel 1115B may be about 20 μm to about 200 μm. In some embodiments, an elongated end of the second microchannel 1115B may be tapered from the non-curved region 1118B of the second microchannel 1115B to the junction 1130. For instance, an elongated end of the second microchannel 1115B may taper down from a width of about 50 μm to a width of about 30 μm.

[0247] The first microchannel 1115A may form an angle between itself and the second microchannel 1115B at the junction 1130. Angles between the first microchannel 1115A and the second microchannel 1115B may include, but are not limited to, 10 degrees, 15 degrees, 20 degrees, 30 degrees, 35 degrees, 40 degrees, 45 degrees, greater than 45 degrees, and any range of angles in between 1 degree to 180 degrees. Likewise, the second microchannel 1115B may form an angle between itself and the third microchannel 1115C. Angles between the second microchannel 1115B and the third microchannel 1115C may include, but are not limited to, 10 degrees, 15 degrees, 20 degrees, 30 degrees, 35 degrees, 40 degrees, 45 degrees, greater than 45 degrees, and any range of angles in between 1 degree to 180 degrees.

[0248] Still referring to FIG.11A, in some embodiments, the first, second, and / or third ordered streams may have a flow rate. For instance and without limitations, flow rates may range from about 10 µl / minute to about 100 µl / minute. Flow rates may include any flow rate as described throughout this application, without limitation. Each of the first, second, and third ordered streams may have the same flow rate. In some embodiments, each of the first, second, and third ordered streams may have a different flow rate. A pump or other fluid moving device may be configured to increase a flow rate of any one or more of the first, second, and third ordered streams. A flow rate of any of the first, second, and third ordered streams may be adjusted to synchronize a timing of cells or beads from any of the first, second, or third ordered streams to meet at the junction 1130. A pump may be connected to a controller which may adjust flow rates of any of the first, second, and / or third ordered streams. In some embodiments, the controller may alternate between adjusting a flow rate of the first, second, or third ordered streams. In some embodiments, all three of the first, second, and third ordered streams flow simultaneously towards the junction 1130. In other embodiments, a selection of two ordered streams from the first, second, and third ordered 78 IPTS / 128953967.1Docket Number: SBT-004WO streams may be chosen to flow simultaneously while preventing an ordered stream not part of the set from flowing. In some embodiments, the first and second ordered streams include cells while the third ordered stream includes a bead. In other embodiments, the first ordered stream includes a cell while the second and third ordered streams include beads. Any combination of cells and beads of the first, second, and third ordered streams may be employed, without limitation. As described in greater detail below, any of the ordered streams may be aligned through inertial focusing while flowing through the curved region 1110 of their respective microchannels 1115. In some embodiments, the first, second, and / or third ordered streams may be aligned along a central axis or edge of their respective microchannels 1115.

[0249] The junction 1130 may allow for generation of single droplets or populations of single droplets. Populations of single droplets generated by the junction 1130 may be characterized by a fraction of single droplets comprising one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream. The fraction may exceed a prediction fraction of single droplets comprising one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream predicted using a Poisson distribution, which is explained in greater detail below. In some embodiments, the junction 1130 may generating a jet-like formation of single droplets through a nozzle and may break a portion of the jet-like formation into the single droplet. In some embodiments, the junction 1130 may be triangular, circular, ovular, or other shapes, without limitation. The junction 1130 may be sized to accommodate a combination of up to 6 cells or beads, greater than 6 cells or beads, or less than 6 cells or beads. The junction 1130 and nozzle of the junction 1130 may be described in further detail below with reference to FIG.13.

[0250] Reference is now made to FIG.11B, which shows a zoomed in view of the junction 1130. In particular, FIG.11B shows a first ordered stream of cells 1150A entering the junction 1130 through the first microchannel 1115A, a second ordered stream of cells 1150B entering the junction 1130 through the second microchannel 1115B, a third ordered stream of cells or beads 1150C entering the junction 1130 through the third microchannel 1115C, and the immiscible oil phases entering the junction 1130 through the fourth microchannel 1125A and the fifth microchannel 1125B. The flowing aqueous fluids including the two ordered streams of cells are pinched by the flowing oil phases, thereby causing droplet formation downstream of the junction 1130. Specifically, as shown in FIG. 79 IPTS / 128953967.1Docket Number: SBT-004WO 11B, a single droplet 1155 includes three or more cells or beads, where one cell or bead originates from the first ordered stream of cells 1150A, a second cell or bead originates from the second ordered stream of cells or beads 1150B, and a third cell or bead originates from the third ordered stream of cells or beads 1150C.

[0251] Example oil of an emulsion that is used as an immiscible oil phase can be selected based upon chemical properties e.g., molecular structure, content, solvating strength, viscosity, boiling point, thermal expansion coefficient, oil-in-water solubility, water-in- oil solubility, dielectric constant, polarity, water-in-oil surface tension, and / or oil-in-water surface tension and are described above.

[0252] Returning to FIG.11A, the droplets containing three or more cells continue to flow down the microchannel 1135 towards a collection well 1140. In various embodiments, while flowing through microchannel 1135, the droplet can undergo an assay, such as a cell- cell interaction assay to interrogate whether the two or more cells interacted with each other. As described in further detail herein, the cell-cell interaction assay can involve capturing a signal (e.g., a fluorescent signal) emitted in a single droplet once a cell-cell interaction has occurred. In various embodiments, a co-encapsulated bead captures a nucleic acid or a cytokine that is indicative of the cell-cell interaction. For example, the co-encapsulated bead may be decorated with binders specific for the nucleic acid or the cytokine that is indicative of the cell-cell interaction. Thus, in such embodiments, a detection module, i.e., a detector, e.g., an optical or fluorescent imager, can be configured to capture the signal emitted in single droplets. For example, the detection module can be situated to capture the signal emitted in single droplets while the droplets are flowing through microchannel 1135 towards the collection well 1140.

[0253] Reference is now made to FIG.12, which depicts a flow diagram for ordering and encapsulating three cells or beads (or various numeric combinations of cells and beads totaling 3) into a single droplet, in accordance with an embodiment. As shown in FIG.12, step 1210 involves flowing a first aqueous phase comprising a first ordered stream of cells or beads towards a junction in a first microchannel. Step 1220 involves flowing a second aqueous phase comprising a second ordered stream of cells or beads towards a junction in a second microchannel. Step 1230 involves flowing a third aqueous phase comprising a third ordered stream of cells or beads towards a junction in a third microchannel. Step 1240 involves flowing an oil phase in a fourth microchannel towards the junction. Step 1245 involves generating a single droplet from the first aqueous phase, the second aqueous phase, 80 IPTS / 128953967.1Docket Number: SBT-004WO the third aqueous phase, and the oil phase, wherein the single droplet comprises a cell or bead from the first ordered stream, a cell or bead from the second ordered stream, and a cell or bead from the third ordered stream. Additional Example Junction of Microfluidic Devices

[0254] Reference is made to FIG.13, which depicts an example junction of a microfluidic device, such as an example microfluidic device including serpentine channels or an example microfluidic device including spiral channels. Here, FIG.13 depicts a first microchannel 1380A (e.g., for carrying an ordered stream of cells or beads), a second microchannel 1380B (e.g., for carrying an ordered stream of cells or beads), a third microchannel 1380C (e.g., for carry an ordered stream of cells or beads), an oil channel 1390 (for carrying an immiscible phase), a junction 1385, a nozzle region 1388 after the junction 1385, and a post-nozzle region 1392 for collecting droplets. Generally, the operation of the microfluidic device shown in FIG.13 involves flowing solutions from the right (e.g., through first microchannel 1380A, second microchannel 1380B, and third microchannel 1380C) towards the left (e.g., to the post-nozzle region 1392). Although not explicitly shown in FIG.13, embodiments of the microfluidic device may further include an additional microchannel that flows solutions from the right to the junction 1385 (similar to microchannels 1380A-C). The additional microchannel can flow cells or beads in an ordered stream for co-encapsulation of cells and beads (e.g., at least two cells and a bead) in a single droplet.

[0255] Additionally, FIG.13 includes designations of the dimensions. For example, “AA” refers to the width of the oil channel 1390. “BB” refers to the width of the junction 1385. “CC” refers to the width of the nozzle region 1388. “DD” refers to the length of the nozzle region 1388. “EE” refers to the width of the post-nozzle region 1392.

[0256] As shown in FIG.13, the first microchannel 1380A, second microchannel 1380B, and third microchannel 1380C may meet at the junction 1385 or at a region immediately prior to the junction 1385. This region then leads to the junction 1385 for forming droplets. The nozzle region 1388 leads away from the junction 1385 to the post-nozzle region 1392, which collects the formed droplets.

[0257] Referring first to the first microchannel 1380A, in various embodiments, the width of the first microchannel 1380A is between from about 5 µm to about 200 µm. In various embodiments, the width of the first microchannel 1380A is between from about 10 µm to about 100 µm, between from about 15 µm to about 95 µm, between from about 20 µm to 81 IPTS / 128953967.1Docket Number: SBT-004WO about 90 µm, between from about 25 µm to about 85 µm, between from about 30 µm to about 80 µm, between from about 35 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the first microchannel 1380A is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the first microchannel 1380A is between from about 50 µm to about 75 µm.

[0258] In various embodiments, the width of the first microchannel 1380A tapers down when approaching the junction 1385. For example, the first microchannel 1380A may have a first width that is located distal to the junction 1385 in relation to a second width of the first microchannel 1380A that is located more proximal to the junction 1385. The first width of the first microchannel 1380A may be greater than the second width of the first microchannel 1380A. In various embodiments, the first width of the first microchannel 1380A (e.g., located distal to the junction 1385) is between from about 40 µm to about 100 µm, between from about 45 µm to about 80 µm, or between from about 50 µm to about 60 µm. In particular embodiments, the first width of the first microchannel 1380A (e.g., located distal to the junction 1385) is about 50 µm. In various embodiments, the second width of the first microchannel 1380A (e.g., located proximal to the junction 1385) is between from about 10 µm to about 40 µm, between from about 20 µm to about 35 µm, or between from about 25 µm to about 32 µm. In particular embodiments, the second width of the first microchannel 1380A (e.g., located proximal to the junction 1385) is about 30 µm. In particular embodiments, the second width of the first microchannel 1380A (e.g., located proximal to the junction 1385) is about 25 µm. In particular embodiments, the width of the first microchannel 1380A tapers down from a first width of 50 µm to a second width of 30 µm at the junction 1385.

[0259] In various embodiments, the width of the second microchannel 1380B is between from about 5 µm to about 200 µm. In various embodiments, the width of the second microchannel 1380B is between from about 10 µm to about 100 µm, between from about 15 µm to about 95 µm, between from about 20 µm to about 90 µm, between from about 25 µm to about 85 µm, between from about 30 µm to about 80 µm, between from about 35 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width 82 IPTS / 128953967.1Docket Number: SBT-004WO of the second microchannel 1380B is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the second microchannel 1380B is between from about 50 µm to about 75 µm.

[0260] In various embodiments, the width of the second microchannel 1380B tapers down when approaching the junction 1385. For example, the second microchannel 1380B may have a first width that is located distal to the junction 1385 in relation to a second width of the second microchannel 1380B that is located more proximal to the junction 1385. The first width of the second microchannel 1380B may be greater than the second width of the second microchannel 1380B. In various embodiments, the first width of the second microchannel 1380B (e.g., located distal to the junction 1385) is between from about 40 µm to about 100 µm, between from about 45 µm to about 80 µm, or between from about 50 µm to about 60 µm. In particular embodiments, the first width of the second microchannel 1380B (e.g., located distal to the junction 1385) is about 50 µm. In various embodiments, the second width of the second microchannel 1380B (e.g., located proximal to the junction 1385) is between from about 10 µm to about 40 µm, between from about 20 µm to about 35 µm, or between from about 25 µm to about 32 µm. In particular embodiments, the second width of the second microchannel 1380B (e.g., located proximal to the junction 1385) is about 30 µm. In particular embodiments, the second width of the second microchannel 1380B (e.g., located proximal to the junction 1385) is about 25 µm. In particular embodiments, the width of the second microchannel 1380B tapers down from a first width of 50 µm to a second width of 30 µm at the junction 1385.

[0261] In various embodiments, the width of the third microchannel 1380C is between from about 5 µm to about 200 µm. In various embodiments, the width of the third microchannel 1380C is between from about 10 µm to about 100 µm, between from about 15 µm to about 95 µm, between from about 20 µm to about 90 µm, between from about 25 µm to about 85 µm, between from about 30 µm to about 80 µm, between from about 35 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the third microchannel 1380C is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various 83 IPTS / 128953967.1Docket Number: SBT-004WO embodiments, the width of the third microchannel 1380C is between from about 50 µm to about 75 µm.

[0262] In various embodiments, the width of the third microchannel 1380C tapers down when approaching the junction 1385. For example, the third microchannel 1380C may have a first width that is located distal to the junction 1385 in relation to a second width of the third microchannel 1380C that is located more proximal to the junction 1385. The first width of the third microchannel 1380C may be greater than the second width of the third microchannel 1380C. In various embodiments, the first width of the third microchannel 1380C (e.g., located distal to the junction 1385) is between from about 40 µm to about 100 µm, between from about 45 µm to about 80 µm, or between from about 50 µm to about 60 µm. In particular embodiments, the first width of the third microchannel 1380C (e.g., located distal to the junction 1385) is about 50 µm. In various embodiments, the second width of the third microchannel 1380C (e.g., located proximal to the junction 1385) is between from about 10 µm to about 40 µm, between from about 20 µm to about 35 µm, or between from about 25 µm to about 32 µm. In particular embodiments, the second width of the third microchannel 1380C (e.g., located proximal to the junction 1385) is about 30 µm. In particular embodiments, the second width of the third microchannel 1380C (e.g., located proximal to the junction 1385) is about 25 µm. In particular embodiments, the width of the third microchannel 1380C tapers down from a first width of 50 µm to a second width of 30 µm at the junction 1385.

[0263] In various embodiments, the microfluidic device includes an additional microchannel that flows cells or beads in an ordered stream to the junction 1385. The width of the additional microchannel may be between from about 5 µm to about 200 µm. In various embodiments, the width of the additional microchannel is between from about 10 µm to about 100 µm, between from about 15 µm to about 95 µm, between from about 20 µm to about 90 µm, between from about 25 µm to about 85 µm, between from about 30 µm to about 80 µm, between from about 35 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the additional microchannel is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the additional microchannel is between from about 50 µm to about 75 µm. 84 IPTS / 128953967.1Docket Number: SBT-004WO

[0264] In various embodiments, the width of the additional microchannel tapers down when approaching the junction 1385. For example, the additional microchannel may have a first width that is located distal to the junction 1385 in relation to a second width of the additional microchannel that is located more proximal to the junction 1385. The first width of the additional microchannel may be greater than the second width of the additional microchannel. In various embodiments, the first width of the additional microchannel (e.g., located distal to the junction 1385) is between from about 40 µm to about 100 µm, between from about 45 µm to about 80 µm, or between from about 50 µm to about 60 µm. In particular embodiments, the first width of the additional microchannel (e.g., located distal to the junction 1385) is about 50 µm. In various embodiments, the second width of the additional microchannel (e.g., located proximal to the junction 1385) is between from about 10 µm to about 40 µm, between from about 20 µm to about 35 µm, or between from about 25 µm to about 32 µm. In particular embodiments, the second width of the additional microchannel (e.g., located proximal to the junction 1385) is about 30 µm. In particular embodiments, the second width of the additional microchannel (e.g., located proximal to the junction 1385) is about 25 µm. In particular embodiments, the width of the additional microchannel tapers down from a first width of 50 µm to a second width of 30 µm at the junction 1385.

[0265] In various embodiments, the width of the oil microchannel 1390 (denoted as “AA” in FIG.13) is between from about 5 µm to about 200 µm. In various embodiments, the width of the oil microchannel 1390 is between from about 10 µm to about 150 µm, between from about 20 µm to about 140 µm, between from about 30 µm to about 130 µm, between from about 40 µm to about 125 µm, between from about 50 µm to about 120 µm, between from about 60 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the oil microchannel 1390 is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the oil microchannel 590 is between from about 50 µm to about 75 µm. In particular embodiments, the width of the oil microchannel 590 is about 50 µm. In particular embodiments, the width of the oil microchannel 590 is about 60 µm. In particular embodiments, the width of the oil microchannel 590 is about 75 µm. 85 IPTS / 128953967.1Docket Number: SBT-004WO

[0266] Referring next to the junction 1385, in various embodiments, the width of the junction 1385 (denoted as “BB” in FIG.13) is between from about 5 µm to about 200 µm. In various embodiments, the width of the junction 1385 is between from about 10 µm to about 150 µm, between from about 20 µm to about 140 µm, between from about 30 µm to about 130 µm, between from about 40 µm to about 125 µm, between from about 50 µm to about 120 µm, between from about 60 µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the junction 1385 is between from about 50 µm to about 100 µm (e.g., between from about 55 µm to about 95 µm, between from about 60 µm to about 90 µm, between from about 65 µm to about 85 µm, or between from about 70 µm to about 80 µm). In various embodiments, the width of the junction 1385 is between from about 50 µm to about 75 µm. In particular embodiments, the width of the junction 1385 is about 50 µm. In particular embodiments, the width of the junction 1385 is about 60 µm. In particular embodiments, the width of the junction 1385 is about 75 µm.

[0267] In various embodiments, a ratio between the width of the oil channel 1390 (denoted as “AA” in FIG.13) and the width of the junction 1385 (denoted as “BB” in FIG.13) is between from about 1 to about 5. In various embodiments, the ratio between the width of the oil channel 1390 (denoted as “AA” in FIG.13) and the width of the junction 1385 (denoted as “BB” in FIG.13) is between from about 1 to about 4, between from about 1 to about 3, from about 1 to about 2, between from about 2 to about 4, or between from about 2 to about 3. In particular embodiments, the ratio between the width of the oil channel 1390 (denoted as “AA” in FIG.13) and the width of the junction 1385 (denoted as “BB” in FIG.13) is about 100 µm / 60 µm (e.g., about 1.6).

[0268] Referring next to the width of the nozzle 1388, the width (denoted as “CC” in FIG. 13) can be designed to control the size of resulting droplets. In various embodiments, the width of the nozzle 1388 controls the size of the resulting droplets by about ±20 µm, centered around the nozzle width. For example, given a width of a nozzle of 50 µm, the resulting droplets are sized between 30-70 µm (e.g., depending on the pressure applied to the aqueous channels and their corresponding flow rates). In various embodiments, the width of the nozzle 1388 is between from about 5 µm to about 200 µm. In various embodiments, the width of the nozzle 1388 is between from about 10 µm to about 150 µm, between from about 20 µm to about 140 µm, between from about 30 µm to about 130 µm, between from about 40 µm to about 125 µm, between from about 50 µm to about 120 µm, between from about 60 86 IPTS / 128953967.1Docket Number: SBT-004WO µm to about 75 µm, between from about 40 µm to about 70 µm, between from about 45 µm to about 65 µm, between from about 50 µm to about 60 µm. In various embodiments, the width of the nozzle 1388 is between from about 50 µm to about 75 µm. In particular embodiments, the width of the nozzle 1388 is between from about 20 µm to about 100 µm. In particular embodiments, the width of the nozzle 1388 is about 50 µm. In particular embodiments, the width of the nozzle 1388. In particular embodiments, the width of the nozzle 1388 is about 75 µm. In particular embodiments, the width of the nozzle 1388 is about 100 µm.

[0269] In particular embodiments, the width of the nozzle 1388 (denoted as “CC” in FIG. 13) is less than the width of the junction 1385 (denoted as “BB” in FIG.13). In various embodiments, the width of the nozzle 1388 is at least 1% less than the width of the junction 1385. In various embodiments, the width of the nozzle 1388 is at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, at least 10%, at least 11%, at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, or at least 20% less than the width of the junction 1385. In some embodiments, the width of the nozzle 1358 is between from about 40 µm to about 55 µm and the width of the junction 1385 is between from about 55 µm to about 75 µm. In some embodiments, the width of the nozzle 1358 is between from about 45 µm to about 52 µm and the width of the junction 1385 is between from about 58 µm to about 65 µm. In some embodiments, the width of the nozzle 1358 is about 50 µm and the width of the junction 1385 is about 60 µm. In various embodiments, the width of the nozzle 1358 tapers along the length of the nozzle 1358. For example, the width of the nozzle 1358 may be larger at a location more proximal to the junction 1385 in comparison to a location more proximal to the post- nozzle region 1392.

[0270] Referring next to the length of the nozzle 1388, the length of the nozzle 1388 (denoted as “DD” in FIG.13) can be designed to ensure droplet formation at higher flow rates of aqueous and / or oil phases. For example, higher flow velocities or flow rates may result in an aqueous / oil interface that is in a co-flow or jetting regime, which prevents the formation of single droplets. Therefore, increasing the length of the nozzle 1388 can enable the increase of flow rates to higher values while still allowing droplet formation to occur. In various embodiments, the length of the nozzle 1388 is between from about 20 µm to about 500 µm. In various embodiments, the length of the nozzle 1388 is between from about 30 µm to about 450 µm, is between from about 40 µm to about 400 µm, is between from about 87 IPTS / 128953967.1Docket Number: SBT-004WO 50 µm to about 350 µm, is between from about 75 µm to about 300 µm, is between from about 100 µm to about 250 µm, or is between from about 150 µm to about 225 µm.

[0271] Altogether, the dimensions of the nozzle may be valuable for generating single droplets containing cells and / or beads. For example, the length of the nozzle can be chosen to ensure that a sufficient length of the nozzle is present for the jetting aqueous fluid to break up into discrete droplets before it enters the post-nozzle zone. If a jetting aqueous fluid enters the post-nozzle zone without breaking up, it may never form droplets and may jet all the way to the outlet. Therefore, increasing the length of the nozzle will increase the flow rate ceiling for droplet generation. This will additionally increase the number of allowable microchannels (e.g., three, four, five, six, seven, eight, nine, or ten or more microchannels each carrying an aqueous phase containing an ordered stream e.g., of cells or beads) in the microfluidic device. As another example, tapering the width of the nozzle may assist in guiding the shape of the jet into a sharper point which may help destabilize the jetting aqueous fluid into discrete droplets. Tapering the nozzle may also allow the jet to break up evenly, as sometimes when a jet destabilizes into discrete droplets, the contents of the droplets are not equally sourced from the upstream microchannels.

[0272] In various embodiments, an increase of the length of the nozzle enables a corresponding increase in total flow rate capacity (e.g., total flow rate from the three microchannels carrying aqueous phases). In various embodiments, an increase of 1 µm in the length of the nozzle enables a corresponding increase of between 1 µL / min to 10 µL / min of total flow rate capacity. In various embodiments, an increase of 1 µm in the length of the nozzle enables a corresponding increase of 1 µL / min, 2 µL / min, 3 µL / min, 4 µL / min, 5 µL / min, 6 µL / min, 7 µL / min, 8 µL / min, 9 µL / min, or 10 µL / min of total flow rate capacity.

[0273] Referring next to post-nozzle region 1392, the width of the post-nozzle region 1392 (denoted as “EE” in FIG.13) can be designed to ensure that droplets have sufficient space to form without merging into each other. Nozzle 1388 may extend into post-nozzle region 1932. In some embodiments, nozzle 1388 may terminate at post-nozzle region 1932. In various embodiments, the width of the post-nozzle region 1392 is between from about 50 µm to about 1000 µm. In various embodiments, the width of the post-nozzle region 1392 is between from about 100 µm to about 900 µm, between from about 150 µm to about 850 µm, between from about 200 µm to about 800 µm, between from about 250 µm to about 750 µm, between from about 300 µm to about 700 µm, between from about 350 µm to about 650 µm, between from about 400 µm to about 600 µm, between from about 450 µm to about 550 µm, 88 IPTS / 128953967.1Docket Number: SBT-004WO or between from about 475 µm to about 525 µm. In particular embodiments, the width of the post-nozzle region 1392 is about 500 µm.

[0274] In various embodiments, the width of the junction 1385 (denoted as “BB” in FIG. 13) is greater than the width of nozzle 1388 (denoted as “CC” in FIG.13). In various embodiments, a ratio between the width of the junction 1385 (denoted as “BB” in FIG.13) and the width of nozzle 1388 (denoted as “CC” in FIG.13) is between from about 1 to about 5. In various embodiments, the ratio between the width of the junction 1385 and the width of nozzle 1388 is between from about 1 to about 4, between from about 1 to about 3, from about 1 to about 2, between from about 2 to about 4, or between from about 2 to about 3. In particular embodiments, the ratio between the width of the junction 1385 and the width of nozzle 1388 is about 60 µm / 50 µm (e.g., about 1.2).

[0275] In various embodiments, the width of the post-nozzle region 1392 (denoted as “EE” in FIG.13) is greater than the width of the nozzle 1388 (denoted as “CC” in FIG.13). In various embodiments, a ratio of the width of the post-nozzle region 1392 (denoted as “EE” in FIG.13) to the width of the nozzle 1388 (denoted as “CC” in FIG.13) is between from about 1 to about 15. In various embodiments, a ratio of the width of the post-nozzle region 1392 (denoted as “EE” in FIG.13) to the width of the nozzle 1388 (denoted as “CC” in FIG.13) is between from about 2 to about 14.5, between from about 3 to about 14, between from about 4 to about 13.5, between from about 5 to about 13, between from about 6 to about 12.5, between from about 7 to about 12, between from about 8 to about 11.5, or between about 9 to about 11. In particular embodiments, a ratio of the width of the post-nozzle region 1392 to the width of the nozzle 1388 is about 10. Air Blade with Junction

[0276] Referring now to FIG.14, an air blade in use with a junction of two or more microchannels is presented. Air channel 1404 may be formed from an air channeling device, such as an air pump, compressor, or other device, Air channel 1404 may have a velocity of about 1 micron / second to about 10,000 microns / second. In some embodiments, air channel 1404 may have a velocity of less than 1 micron / second or greater than 10,000 microns / second, without limitation. In some embodiments, air channel 1404 may have a width of about 20 microns to about 200 microns. Air channel 1404 may intersect junction 1400 from a top or bottom side of junction 1400. Air channel 1404 may intersect a combination of ordered streams that may combine at junction 1400. Air channel 1404 may 89 IPTS / 128953967.1Docket Number: SBT-004WO introduce one or more air bubbles 1408. Air bubbles 1408 may have a diameter similar to that of one or more singular droplets as described above. In some embodiments, there may be one air bubble 1408 per single droplet 1412. Air bubbles 1408 may collide with and destabilize a jet formed at the junction 1400, which may allow the jet to break up into droplets faster and easier than without air channel 1404. Air bubbles 1408 may merge and self-separate from oil and / or droplets 1412. Use of air channel 1404 may remove a limit on a number of inertially focused microchannels that may be combined at junction 1400. Rather than cutting a jet formed at junction 1400, air channel 1404 bounces off of the jet, which may cause air bubbles 1408 and single droplets 1412 to form. Single Cell Sequencing of Droplets Generated from Variations of Devices and Methods Described Herein

[0277] Single cell sequencing may be performed on droplets generated with any combination of microchannels of any microfluidic devices described herein. For instance, microfluidic devices may have three or more microchannels, with at least one microchannel being non-rectangular. A microfluidic device may have a first microchannel and a second microchannel connected at a junction. A first microchannel may be non-rectangular. In some embodiments, a second microchannel may be non-rectangular. In some embodiments, both a first and second microchannel may be non-rectangular. A microfluidic device may have three or more microchannel connected to a junction. A third microchannel of a microfluidic device may be rectangular or non-rectangular. For instance, a microfluidic device may have three non-rectangular microchannels. In some embodiments, a microfluidic device may have three microchannels with at least one of the three microchannels being non-rectangular. In some embodiments, a first microchannel may be rectangular or non-rectangular and may flow a first aqueous phase comprising an order stream of cells or barcoded beads. A second microchannel may be rectangular or non-rectangular and may flow a second aqueous phase comprising an ordered steam of cells or barcoded beads. A third microchannel may be rectangular or non-rectangular and may flow a third aqueous phase comprising an ordered stream of cells or barcoded beads. In some embodiments, microfluidic devices may include four or more microchannels that may include at least one non-rectangular microchannel. Three or more microchannels of a microfluidic device may connect at a junction and may generate a single droplet comprising one of a single bead and a single cell, two or more beads 90 IPTS / 128953967.1Docket Number: SBT-004WO and a single cell, two or more beads and two or more cells, or a single bead and two or more cells.

[0278] In some embodiments, microfluidic devices with a first non-rectangular microchannel and a second non-rectangular or rectangular microchannel may generate a single droplet from a first aqueous phase, a second aqueous phase, and an oil phase, wherein a fraction of single droplets comprising a cell and a bead excess a predicted fraction of single droplets of a cell and a bead using Poisson distribution. In some embodiments, microfluidic devices with three or more microchannels may generate a single droplet from a first aqueous phase, a second aqueous phase, a third aqueous phase, and an oil phase, comprising a cell and a bead wherein a fraction of single droplets comprising a cell and a bead exceeds a prediction fraction of single droplets of a cell and a bead using Poisson distribution. In some embodiments, microfluidic devices with three or more microchannels, with at least one of the three or more microchannels being non-rectangular, may generate single droplets comprising a cell and a bead wherein a fraction of single droplets comprising a cell and a bead exceeds a prediction fraction of single droplets of a cell and a bead using Poisson distribution. I. Single Cell Sequencing With Three or More Microchannels

[0279] In some embodiments a microfluidic device may have three or more microchannels. For instance, a microfluidic device may have a first microchannel, a second microchannel, and a third microchannel. A first microchannel may flow a first aqueous phase comprising order cells or beads towards a junction, a second microchannel may flow a second aqueous phase comprising ordered cells or beads towards a junction, and a third microchannel may flow a third aqueous phase comprising ordered cells or beads towards a junction. In some embodiments, at least two aqueous phases may comprise a stream of ordered cells. In some embodiments, at least two aqueous phases may comprise a stream of ordered beads. For instance, a three-channeled microfluidic device may be as described herein with reference to FIGs.11A-B, without limitation.

[0280] At a junction of a three-channeled microfluidic device, a single droplet may be generated. A single droplet may comprise a bead and a cell, two beads and a cell, two cells and a bead, or other combinations of cells and beads. In some embodiments, single droplets generated by a three-channeled microfluidic device may be higher than a predicted fraction of beads and cells of the single droplets using Poisson statistics. For instance, a single droplet comprising a cell and two beads, a bead and two cells, or other combinations, may be higher than a predicted fraction of single droplets generated having any of the previously described 91 IPTS / 128953967.1Docket Number: SBT-004WO ratios of beads to cells using Poisson statics. Sequencing of cells and beads of single droplets formed by a three-channeled microfluidic device may be performed at a higher throughput than devices that generate single droplets with ratios of cells and beads that are within a predicted occurrence using Poisson statistic. In some embodiments, four or more microchannels of a microfluidic device may join at a junction. A fourth microchannel may have a fourth aqueous phase which may be an ordered stream of beads or cells. II. Single Cell Sequencing with at least One Non-Rectangular Microchannel

[0281] In some embodiments, single cell sequencing may be performed on single droplets generated by non-rectangular microchannels of a microfluidic device. For instance, a microfluidic device may have one or more non-rectangular microchannels. Non-rectangular microchannels may be as described herein with reference to FIGs.9A-M. In some embodiments, a microfluidic device may have a first microchannel that may flow a first aqueous phase comprising an ordered stream of cells or beads at a junction and a second microchannel that may flow a second aqueous phase comprising an ordered steam of cells or beads at a junction. A first microchannel and / or a second microchannel may be non- rectangular. Non-rectangular shapes may include, but are not limited to, U-shapes, triangular shapes, trapezoidal shapes, or other non-rectangular shapes. Single droplets generated by a microfluidic device with one or more non-rectangular microchannels may comprise one cell and one bead. In some embodiments, single droplet generation of one cell and one bead using non-rectangular devices described herein may occur at a higher rate than predicted using Poisson statistics. Single cell sequencing may be performed at a higher volume than with devices without non-rectangular microchannels due to the increased occurrence of a bead to cell ratio of single droplets generated with non-rectangular microchannels. III. Single Cell Sequencing with Three or More Microchannels with At Least One Non- Rectangular Microchannel

[0282] In some embodiments, single cell sequencing may be performed on single droplets generate by a microfluidic device with three or more microchannels, with at least one of the three or more microchannels being a non-rectangular microchannel. For instance, and without limitation, a three-channeled device may be as described herein with reference to FIGs.11A- B. At least one microchannel of an at least three-channeled microfluidic device may be non- rectangular. Non-rectangular microchannels may be as described herein with reference to FIGS.9A-M, without limitation. In some embodiments, at least two microchannels may be non-rectangular. In some embodiments, all three microchannels of a three-channeled 92 IPTS / 128953967.1Docket Number: SBT-004WO microfluidic device may be non-rectangular. A first microchannel may flow a first aqueous phase of an ordered stream of cells or beads, a second microchannel may flow a second aqueous phase of an ordered stream of cells or beads, and a third microchannel may flow a third aqueous phase of an ordered stream of cells or beads. In some embodiments, at least two microchannels flow an aqueous phase of an ordered stream of cells. In some embodiments, at least two microchannels flow an aqueous phase of an ordered stream of beads. Single droplet generation using three or more microchannels with at least one non-rectangular microchannel may comprise a cell and two beads, two cells and a bead, or other combination of cells and beads. In some embodiments, single droplet generation using a microfluidic device with three or more microchannel with at least one non-rectangular microchannel may have an occurrence of a ratio of beads to cells that is higher than a predicted occurrence using Poisson statistics. Sequencing of single droplets generated by a microfluidic device with three or more microchannel with at least one non-rectangular microchannel may be performed at a higher volume than conventional microfluidic devices. VI. Co-encapsulation with Three or More Microchannels with At Least One Non-Rectangular Microchannel

[0283] In some embodiments, co-encapsulation of two or more beads or cells in single droplets may be generate by a microfluidic device with three or more microchannels, with at least one of the three or more microchannels being a non-rectangular microchannel. For instance, and without limitation, a three-channeled device may be as described herein with reference to FIGs.11A-B. At least one microchannel of an at least three-channeled microfluidic device may be non-rectangular. Non-rectangular microchannels may be as described herein with reference to FIGS.9A-M, without limitation. In some embodiments, at least two microchannels may be non-rectangular. In some embodiments, all three microchannels of a three-channeled microfluidic device may be non-rectangular. A first microchannel may flow a first aqueous phase of an ordered stream of cells or beads, a second microchannel may flow a second aqueous phase of an ordered stream of cells or beads, and a third microchannel may flow a third aqueous phase of an ordered stream of cells or beads. In some embodiments, at least two microchannels flow an aqueous phase of an ordered stream of cells. In some embodiments, at least two microchannels flow an aqueous phase of an ordered stream of beads. Single droplet generation using three or more microchannels with at least one non-rectangular microchannel may comprise a cell and two beads, two cells and a bead, or other combination of cells and beads. In some embodiments, single droplet 93 IPTS / 128953967.1Docket Number: SBT-004WO generation using a microfluidic device with three or more microchannel with at least one non- rectangular microchannel may have an occurrence of a ratio of beads to cells that is higher than a predicted occurrence using Poisson statistics.

[0284] Single cell sequencing may be performed on droplets generated with any combination of microchannels of any microfluidic devices described herein. For instance, microfluidic devices may have three or more microchannels, with at least one microchannel being non-rectangular. A microfluidic device may have a first microchannel and a second microchannel connected at a junction. A first microchannel may be non-rectangular. In some embodiments, a second microchannel may be non-rectangular. In some embodiments, both a first and second microchannel may be non-rectangular. A microfluidic device may have three or more microchannel connected to a junction. A third microchannel of a microfluidic device may be rectangular or non-rectangular. For instance, a microfluidic device may have three non-rectangular microchannels. In some embodiments, a microfluidic device may have three microchannels with at least one of the three microchannels being non-rectangular. In some embodiments, a first microchannel may be rectangular or non-rectangular and may flow a first aqueous phase comprising an order stream of cells or barcoded beads. A second microchannel may be rectangular or non-rectangular and may flow a second aqueous phase comprising an ordered steam of cells or barcoded beads. A third microchannel may be rectangular or non-rectangular and may flow a third aqueous phase comprising an ordered stream of cells or barcoded beads. In some embodiments, microfluidic devices may include four or more microchannels that may include at least one non-rectangular microchannel. Three or more microchannels of a microfluidic device may connect at a junction and may generate a single droplet comprising one of a single bead and a single cell, two or more beads and a single cell, two or more beads and two or more cells, or a single bead and two or more cells.

[0285] In some embodiments, microfluidic devices with a first non-rectangular microchannel and a second non-rectangular or rectangular microchannel may generate a single droplet from a first aqueous phase, a second aqueous phase, and an oil phase, wherein a fraction of single droplets comprising a cell and a bead excess a predicted fraction of single droplets of a cell and a bead using Poisson distribution. In some embodiments, microfluidic devices with three or more microchannels may generate a single droplet from a first aqueous phase, a second aqueous phase, a third aqueous phase, and an oil phase, comprising a cell and a bead wherein a fraction of single droplets comprising a cell and a bead exceeds a prediction 94 IPTS / 128953967.1Docket Number: SBT-004WO fraction of single droplets of a cell and a bead using Poisson distribution. In some embodiments, microfluidic devices with three or more microchannels, with at least one of the three or more microchannels being non-rectangular, may generate single droplets comprising a cell and a bead wherein a fraction of single droplets comprising a cell and a bead exceeds a prediction fraction of single droplets of a cell and a bead using Poisson distribution. Additional Embodiments

[0286] In some embodiments an improved method for performing single cell sequencing is disclosed. An improved method may include flowing a first aqueous phase comprising a plurality of cells in a first microchannel towards a junction, flowing a second aqueous phase comprising a plurality of barcoded beads in a second microchannel towards the junction, flowing an oil phase in a third microchannel towards the junction, at the junction, generating a population of single droplets formed from the first aqueous phase, the second aqueous phase, and the oil phase, wherein a fraction of the population of single droplets comprises a cell from the first ordered stream of cells and a barcoded bead from the second ordered stream of cells, for each of one or more single droplets within the fraction of the population of single droplets, incorporating barcode sequences of the barcoded bead into nucleic acids of the cell, and sequencing at least the incorporated barcode sequences to perform single cell sequencing. An improvement of an improved method may include flowing the first aqueous phase comprising cells of the plurality of cells in the first microchannel through flowing the cells in an ordered stream in the first microchannel, wherein flowing the second aqueous phase comprising the plurality of barcoded beads in the second microchannel comprises flowing the barcoded beads in an ordered stream in the second microchannel, wherein the fraction exceeds a predicted fraction of single droplets comprising a cell from the first ordered stream and a barcoded bead from the second ordered stream predicted using a Poisson distribution.

[0287] In some embodiments, a fraction of single droplets comprising a cell from the first ordered stream and a barcoded bead from the second ordered stream exceeds a predicted fraction of single droplets comprising a cell from the first ordered stream and a barcoded bead from the second ordered stream predicted using a Poisson distribution.

[0288] In some embodiments, the fraction exceeds the predicted fraction by a factor ranging from 2-3. In some embodiments, the fraction of the population of single droplets are generated at a rate of at least 1 million single cells per hour. In some embodiments, the fraction of the population of single droplets are generated at a rate of at least 1 million single 95 IPTS / 128953967.1Docket Number: SBT-004WO cells per hour. In some embodiments, incorporating barcode sequences of the barcoded bead into nucleic acids of the cell comprises performing nucleic acid amplification. In some embodiments, performing nucleic acid amplification comprises performing polymerase chain reaction. In some embodiments, the nucleic acids of the cell comprise one or more of genomic DNA, RNA, or cDNA.

[0289] In some embodiments, the method comprises prior to incorporating barcode sequences of the barcoded bead into nucleic acids of the cell, reverse transcribing RNA of the cell to produce cDNA. In some embodiments, sequencing at least the incorporated barcode sequences to perform single cell sequencing further comprises assigning sequence reads to cells of the plurality of cells according to presence of incorporated barcode sequences. In some embodiments, cells of the ordered stream of cells are aligned along a central axis or edge of the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned along a central axis or edge of the second microchannel. In some embodiments, cells of the ordered stream of cells are aligned through inertial focusing while flowing through the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned through inertial focusing while flowing through the second microchannel. In some embodiments, the inertial focusing of the cells is generated by flowing the first aqueous phase through a curved region of the first microchannel and the inertial focusing of the barcoded beads is generated by flowing the second aqueous phase through a curved region of the second microchannel. In some embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 45 degree change in a flow vector across a length of the undulating portion. In some embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 60 degree change, at least a 90 degree change, at least a 120 degree change, at least a 150 degree change, or at least a 180 degree change in a flow vector across a length of the undulating portion. In some embodiments, the curved region of the first microchannel or the curved region of the second microchannel comprises between 60-120 undulating portions.

[0290] In some embodiments, an inter-cell spacing for at least 80% of cells in the ordered stream of cells is between 1 times an average cell diameter and 3.5 times an average cell diameter. In some embodiments, an inter-cell spacing for at least 60% of cells in the ordered stream of cells is between 1.5 times an average cell diameter and 3 times an average cell 96 IPTS / 128953967.1Docket Number: SBT-004WO diameter. In some embodiments, a standard deviation of inter-cell spacing between pairs of successive cells is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent cells in the ordered stream of cells. In some embodiments, an inter-cell spacing for at least 80% of barcoded beads in the ordered stream of barcoded beads is between 1 times an average bead diameter and 3.5 times an average bead diameter.

[0291] In some embodiments, an inter-cell spacing for at least 60% of barcoded beads in the ordered stream of barcoded beads is between 1.5 times an average bead diameter and 3 times an average bead diameter. In some embodiments, a standard deviation of inter-cell spacing between pairs of successive beads is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent beads in the ordered stream of barcoded beads.

[0292] A method for ordering cells or beads into an ordered stream is disclosed, the method comprising flowing an aqueous phase comprising cells or beads in a non-rectangular microchannel of a microfluidic device and ordering the cells or beads in the non-rectangular microchannel to generate an ordered stream of cells or beads.

[0293] In some embodiments, the cells or beads are present in the aqueous phase at a concentration that is about over 30% of a maximum concentration of cells or beads defined by: ^^^^^^^^^^ ^^^^ ^^^^^^^^^^ ^^^^^^^^^^^^^^^^^^^^^^^^^^ ^൨ ^^^^non- rectangular microchannel and wherein cross-sectional area refers to a cross-sectional area of the non-rectangular microchannel.

[0295] In some embodiments, the non-rectangular microchannel is one of a triangular microchannel, trapezoidal microchannel, or a U-shaped microchannel. In some embodiments, the ordered stream of cells or beads has a flow rate of about 10uL / min to about 60 uL / min. In some embodiments, a center of the microchannel has a maximum velocity of about 25 mm / s to about 250mm / s. In some embodiments, the method further comprises focusing the cells or beads into an apex of the non-rectangular microchannel, wherein a cell or bead located proximal to the apex experiences a slower flow velocity relative to a faster flow velocity of a cell or bead located distally to the apex. In some embodiments, the non-rectangular 97 IPTS / 128953967.1Docket Number: SBT-004WO microchannel prevents cell crowding of a plurality of cells or beads. In some embodiments, the method further comprises focusing a majority of the aqueous phase towards a bottom side of the non-rectangular microchannel without touching one or more channel walls of the non- rectangular microchannel. In some embodiments, the method further comprises focusing the aqueous phase to flow slower at a top side of the non-rectangular microchannel. In some embodiments, the non-rectangular microchannel is an asymmetrical microchannel. In some embodiments, the non-rectangular microchannel has a maximum cross-sectional area of about 20,000 square microns.

[0296] In some embodiments, the non-rectangular microchannel has a channel width of about 50 microns. In some embodiments, a cell or bead located proximal to a center of the non-rectangular microfluidic channel experiences a faster flow velocity relative to a slower flow velocity of a cell or bead located more distally to the center of the non-rectangular microfluidic channel.

[0297] A system for order cells or beads into an ordered stream is disclosed, comprising a non-rectangular microchannel, wherein the non-rectangular microchannel is configured to receive an aqueous phase comprising cells or beads and order the cells or beads to generate an ordered stream of cells or beads.

[0298] In some embodiments, the non-rectangular microchannel is one of a triangular microchannel, isosceles triangular microchannel, scalene triangular microchannel, trapezoidal microchannel, irregular trapezoidal microchannel, U-shaped microchannel, or asymmetric U- shaped microchannel. In some embodiments, the ordered stream of cells or beads has a flow rate of about 10uL / min to about 60 uL / min. In some embodiments, a center of the microchannel has a maximum velocity of about 20 mm / sm / s to about 250 mm / s. In some embodiments, the non-rectangular microchannel is further configured to focus the cells or beads into an apex of the non-rectangular microchannel, wherein a cell or bead located proximal to the apex experiences a slower flow velocity relative to a faster flow velocity of a cell or bead located distally to the apex. In some embodiments, the non-rectangular microchannel prevents cell crowding of a plurality of cells or beads. In some embodiments, the non-rectangular microchannel is configured to focus a majority of the aqueous phase towards a bottom side of the non-rectangular microchannel without touching one or more channel walls of the non-rectangular microchannel. In some embodiments, the non- rectangular microchannel is further configured to focus the aqueous phase to flow slower at a top side of the non-rectangular microchannel. In some embodiments, the non-rectangular 98 IPTS / 128953967.1Docket Number: SBT-004WO microchannel has at least one side that is asymmetrical to at least one other side. In some embodiments, the non-rectangular microchannel has a maximum cross-sectional area of about 20,000 square microns. In some embodiments, the non-rectangular microchannel has a channel width of about 50 microns. In some embodiments, a cell or bead located proximal to a center of the non-rectangular microchannel channel experiences a faster flow velocity relative to a slower flow velocity of a cell or bead located more distally to the center of the non-rectangular microchannel. In some embodiments, the non-rectangular microchannel has two or more centers of maximum flow velocity. In some embodiments, a cross-sectional area of the non-rectangular microchannel is non-rectangular.

[0299] A method for ordering cells or beads into an ordered stream is disclosed, the method comprising flowing a first aqueous phase comprising a first ordered stream of cells or beads in a first non-rectangular microchannel of a microfluidic device towards a junction, flowing a second aqueous phase comprising a second ordered stream of cells or beads in a second non-rectangular microchannel of the microfluidic device towards the junction, flowing an oil phase in a third microchannel of the microfluidic device towards the junction, and at the junction, generating a single droplet formed from the first aqueous phase, the second aqueous phase, and the oil phase, the single droplet comprising one cell or bead from the first ordered stream and one cell or bead from the second ordered stream.

[0300] In some embodiments, the method further comprises at the junction, further generating single droplets to generate a population of single droplets, wherein the population is characterized by a fraction of single droplets comprising one cell or bead from the first ordered stream and one cell or bead from the second ordered stream, and wherein the fraction exceeds a predicted fraction of single droplets comprising one cell or bead from the first ordered stream and one cell or bead from the second ordered stream, predicted using a Poisson distribution.

[0301] A method for co-encapsulating three or more cells or beads in a single droplet is disclosed, the method comprising flowing a first aqueous phase comprising a first ordered stream of cells or beads in a first microchannel towards a junction, flowing a second aqueous phase comprising a second ordered stream of cells or beads in a second microchannel towards the junction, flowing a third aqueous phase comprising a third ordered stream of cells or beads in a third microchannel towards the junction, flowing an oil phase in a fourth microchannel towards the junction and at the junction, generating the single droplet formed from the first aqueous phase, the second aqueous phase, the third aqueous phase, and the oil 99 IPTS / 128953967.1Docket Number: SBT-004WO phase, the single droplet comprising one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream.

[0302] In some embodiments, the method further comprises at the junction, further generating single droplets to generate a population of single droplets, wherein the population is characterized by a fraction of single droplets comprising one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream, and wherein the fraction exceeds a predicted fraction of single droplets comprising one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream predicted using a Poisson distribution.

[0303] In some embodiments, generating the single droplet at the junction comprises extending a jet-like formation from the junction through a nozzle; and breaking a portion of the jet-like formation into the single droplet. In some embodiments, the nozzle comprises a length between about 50 micrometers to about 500 micrometers. In some embodiments, the first microchannel has a width of about 50 micrometers to about 100 micrometers, the second microchannel has a width of about 50 micrometers to about 100 micrometers, and the third microchannel has a width of about 50 micrometers to about 100 micrometers. In some embodiments, the first microchannel has an angle between the junction and the second microchannel of about 45 degrees to about 65 degrees and the third microchannel has an angle between the junction and the second microchannel of about 45 degrees to about 65 degrees. In some embodiments, the junction comprises a triangular portion, a circular portion, or an ovular portion.

[0304] In some embodiments, the method further comprises adjusting a flow rate of the first, second, or third ordered stream of cells or beads to synchronize a time of entering the junction among the first, second, or third ordered stream of cells or beads. In some embodiments, the method further comprises producing single droplets from the nozzle at a rate of about 5,000 single droplets per second. In some embodiments, cells or beads of the first ordered stream are aligned along a central axis or edge of the first microchannel. In some embodiments, cells or beads of the first ordered stream are aligned through inertial focusing while flowing through a curved region of the first microchannel. In some embodiments, cells or beads of the second ordered stream are aligned along a central axis or edge of the second microchannel. In some embodiments, cells or beads of the second ordered stream are aligned through inertial focusing while flowing through a curved region of the second microchannel. 100 IPTS / 128953967.1Docket Number: SBT-004WO In some embodiments, cells or beads of the third ordered stream are aligned along a central axis or edge of the third microchannel. In some embodiments, cells or beads of the third ordered stream are aligned through inertial focusing while flowing through a curved region of the third microchannel. In some embodiments, an inter-cell spacing for at least 80% of cells or beads in the first ordered stream, cells or beads in the second ordered stream, or cells or beads in the third ordered stream is between 1 times an average cell or bead diameter and 3.5 times an average cell or bead diameter.

[0305] In some embodiments, an inter-cell spacing for at least 60% of cells or beads in the first ordered stream, cells or beads in the second ordered stream, or cells or beads in the third ordered stream is between 1.5 times an average cell or bead diameter and 3 times an average cell or bead diameter. In some embodiments, a standard deviation of the inter-cell spacing between pairs of successive cells or beads in the first, second, or third ordered stream is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent cells or beads in the ordered stream.

[0306] A system for generation of a single droplet having three or more cells is disclosed, comprising a first microchannel configured to flow a first aqueous phase comprising a first ordered stream of cells or beads, a second microchannel configured to flow a second aqueous phase comprising a second ordered stream of cells or beads, a third microchannel configured to flow a third aqueous phase comprising a third ordered stream of cells or beads, a fourth microchannel configured to flow an oil phase and a junction connected to the first, second, third, and fourth microchannels, wherein the first, second, third, and fourth microchannels flow towards the junction, wherein the junction has a nozzle end configured to generate a single droplet form from the first, second, and third aqueous phases, the single droplet comprising one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream. In some embodiments, the junction generates the single droplet in a jet-like formation through a nozzle.

[0307] In some embodiments, the nozzle comprises a length between about 50 micrometers to about 500 micrometers. In some embodiments, the first microchannel has a width of about 50 micrometers to about 200 micrometers, the second microchannel has a width of about 50 microns to about 200 microns, and the third microchannel has a width of about 50 microns to about 200 microns. In some embodiments, the first microchannel has an angle between the junction and the second microchannel of about 45 degrees to about 65 degrees and the third microchannel has an angle between the junction and the second 101 IPTS / 128953967.1Docket Number: SBT-004WO microchannel of about 45 degrees to about 65 degrees. In some embodiments, the junction comprises a triangular portion, a circular portion, or an ovular portion. In some embodiments, the junction is configured to produce single droplets at a rate of about 5,000 single droplets per second. In some embodiments, the junction is sized to accommodate a combination of up to 6 cells or beads.

[0308] In some embodiments, a sum of the flow rates of each of the first, second, and third microchannels is about 20ul / min to about 150ul / min. In some embodiments, the nozzle end is tapered.

[0309] In some embodiments, the system, further comprises an air channeling device that directs a channel of air towards the nozzle end to break up a jet-like formation emitted from the nozzle end. In some embodiments, a flow rate of the first microchannel is different than a flow rate of either or both of the second and third microchannels. In some embodiments, a flow rate of the first microchannel is the same as that of a flow rate of either or both of the second and third microchannels.

[0310] In some embodiments, the system further comprises one or more additional microchannels that each flows an additional aqueous phase towards the junction in an ordered stream of cells or beads. In some embodiments, the single droplet comprises aqueous fluid, wherein 50% of the aqueous fluid of the single droplet is contributed from the first microchannel, wherein 25% of the aqueous fluid of the single droplet is contributed from the second microchannel, and wherein 25% of the aqueous fluid of the single droplet is contributed from the third microchannel. EXAMPLES Example 1: Ordered Streams Achieves Improved Co-encapsulation of Single Bead and Cells for Single-Cell Sequencing

[0311] Droplets were generated inside a microfluidic device. Inside the device, there were two aqueous channels that join together at a junction, where a third channel containing an oil phase also joins them. All liquids flowed through a narrow nozzle region which generated droplets, and the droplets were conveyed through a post-nozzle region and into an outlet that led to a collection tube. A solution comprising cells of a 1:1 mixture of human HEK293T cells and mouse NIH3T3 cells suspended in a buffer (Phosphate-buffered saline, with 0.01% w / v of Bovine Serum Albumin) was flowed through a first aqueous channel. The cells were at a concentration of 1-5 million cells per milliliter. A second solution comprising 102 IPTS / 128953967.1Docket Number: SBT-004WO barcoded beads comprised of polystyrene-divinylbenzene was suspended in a second buffer, and flowed through the second aqueous channel. This second buffer is referred to as drop-seq lysis buffer and contained 200mM Tris pH7.5, 6% v / v Ficoll PM-400, 0.2% v / v Sarkosyl, 20mM EDTA, as well as 50mM DTT.

[0312] These two solutions were flowed through their respective aqueous channels, which are both designed to orient the beads and / or cells into a single-file orientation. This ensures that when both channels join into a junction with the oil channel to generate droplets, only one cell and one bead enter into the same droplet. Referring now to FIG.15, an illustration of cell and bead co-encapsulation using a microfluidic device 1500 is presented. Microfluidic device 1500 has first microchannel 1504A and second microchannel 1504B. First microchannel 1504A allowed for a flow cells 1520. The flow of cells 1520 was ordered in a single line.

[0313] Second microchannel 1504B had a flow of one or more beads 1524. The flow of beads 1524 in second microchannel 1504B was ordered in a single line. First and second microchannels joined at junction 1508. At an angle of about 45 degrees. Beads 1524 and cells 1520 became co-encapsulated into droplets 1516 at junction 1508 and flowed through outlet 1512. An occurrence of 1:1 pairing of cells 1520 and beads 1524 into droplets 1516 occurred about 90% to about 99% of the time, which was a greater percentage than if cells 1520 and beads 1524 were randomly packaged.

[0314] Upon droplet generation, cells from the first channel came into contact with the drop-seq lysis buffer of the second channel. This buffer lysed the cells, which released the cellular nucleic acids / mRNA into the droplet, where they subsequently bound to the barcoded beads.

[0315] The surface of the barcoded beads were previously modified with nucleic acids that bear a sequence that binds to the cellular nucleic acids through the Watson-Crick base pairing scheme. For mRNA capture, the beads were 10µm diameter beads surface-modified with a single-strand DNA sequence that has a 25nt constant region, a 12nt long barcode (unique to a single bead; different beads have different barcodes), 8nt long UMI (unique molecular identifier; different for every DNA strand on the surface of the same bead), followed by a 30nt long dT tail. This sequence captures random mRNA sequences from the cell for use in applications such as whole exome sequencing. For capturing other specific nucleic acid sequences of interest, the 30nt long dT tail can be replaced with a 30nt sequence that is complementary to a constant region at the 3’ end of the nucleic acid of interest. 103 IPTS / 128953967.1Docket Number: SBT-004WO

[0316] Following droplet generation, droplets were broken to extract the barcoded beads. These beads have the nucleic acid of interest bound to their surfaces, via Watson-Crick base pairing. The oil phase of the droplet sample was removed and 30mL of 6X SSC buffer (900mM Sodium chloride, 90mM Citric Acid Trisodium salt), and 1mL of Perfluoro-1- octanol was added. Droplets were shaken by hand for 20s, and centrifuged at 1000 x g for 1 minute. After centrifugation, beads settled at the bottom of the tube. The liquid above them (the supernatant) was removed until 5mL remain. Bead pellets were resuspended by adding 30mL of 6X SSC, then the resuspended beads were moved to a separate tube and centrifuged again. The beads were transferred to 1.5mL microcentrifuge tubes and washed twice (defined as a bead resuspension and subsequent centrifugation cycle) with 1mL 6X SSC and once with 300µL of 5X Maxima HRT Buffer.

[0317] A reverse transcription and PCR amplification step was carried out on the nucleic acids bound to the beads to produce and amplify cDNA (complementary DNA) using the barcode-nucleic acid complex on the surface of the bead.200µL of Reverse Transcription Mixture (1X Maxima RT buffer, 4% v / v Ficoll PM-400, 1mM dNTPs, 1U / µL RNAse Inhibitor, 2.5µM Template_Switch_Oligo, 10U / µL Maxima H-RT) was added to a pellet of 90,000 beads. The beads were incubated at 42°C for 90 minutes, and were washed once with 1mL 1 x TE (10mM Tris-HCl (pH8.0) with 0.1mM EDTA) +0.5% Sodium Dodecyl Sulfate then washed twice with 1mL of TE / TW buffer (TE buffer with 0.01% Tween20) and finally washed once with 1mL of 10mM Tris pH 7.5.

[0318] Exonuclease 1 treatment was carried out to remove excess single-stranded DNA. To do this, the bead pellet was resuspended in 200µL of exonuclease 1 mix (consisting of 1X Exonuclease 1 Buffer, 1U / µL Exonuclease 1) and incubated at 37°C for 45 minutes. The beads were then washed once with 1mL TE / SDS (TE Buffer with 0.5% Sodium Dodecyl Sulfate), washed twice with 1 mL TE / TW buffer and finally washed once with 1mL ultrapure water (18mΩ resistance).

[0319] Nucleic acids were then amplified using PCR Amplification. This was done by adding 50µL of PCR reaction mix (1x Hifi HotStart Readymix, 0.8µM TSO_PCR primer) per 1000 beads. The PCR thermocycler was programed as follows: hold at 95°C for 3 minutes, then 4 cycles of 98°C for 20 seconds -> 65°C for 45 seconds -> 72°C for 3 minutes, then 8 cycles of 98°C for 20 seconds -> 67°C for 20 seconds -> 72°C for 3 minutes, then hold at 72°C for 5 minutes. After PCR, supernatant from each PCR reaction mix was purified using 0.6X of Agencourt AMPure XP beads. These are magnetic beads that reversibly bind to 104 IPTS / 128953967.1Docket Number: SBT-004WO nucleic acids in the sample. The beads were immobilized against the side of the tube by holding a bar magnet to the tube wall. Excess liquid was removed, then the AMpure beads were resuspended in 10uL of ultrapure water to recover the PCR product off the beads. A portion of the sample (cDNA dissolved in ultrapure water) was taken and analyzed using the BioAnalyzer High Sensitivity Chip to check for successful nucleic acid capture, barcode incorporation, and amplification. Following the manufacturer’s protocol, this yielded a trace similar to that shown in FIG.17.

[0320] Recovered cDNA was used to generate a sequencing library, using a standard Nextera XT tagmentation kit by following the protocol of the Nextera XT tagmentation kit, using custom primers P5-TSO_Hybrid and P7-TSO_Hybrid, and Nextera_N701 oligos listed in the chart below (Table 1). Nextera_N702 or Nextera_N703 can be used in place of Nextera_N701. Using these alternative oligos allows cDNA from separate experiments and samples to be discerned from one another if multiple cDNA libraries must be pooled together for sequencing. The tagmented cDNA was amplified as follows: hold at 95°C for 30 seconds, then 12 cycles of 95°C for 10 seconds -> 55°C for 30 seconds -> 72°C for 30 seconds, then hold at 72°C for 5 minutes. The amplified Tagmented cDNA was purified with 0.6X Agencourt AMPure XP beads following the procedure described previously. For 8pM of sample on a Illumina MiSeq instrument, the cDNA was sequenced with 0.5µM of Read1CustSeqB for priming of read 1. For read lengths, read 1 was 20 base pairs and read 2 (paired end) was 50 base pairs. Table 1: Name SEQ Sequence N A JJ105 IPTS / 128953967.1Docket Number: SBT-004WO Barcoded 3 5’-Bead-Linker- Bead SeqB TTTTTTTAAGCAGTGGTATCAACGCAGAGTACJJJJJJJJJJJJJJJ G G G G C * T

[0321] In table 1, “r” stands for ribose, “n” indicates any nucleotide, “b” indicates any nucleotide except Adenine, “JJJ” regions indicated barcode nucleotides, “NNN” regions 106 IPTS / 128953967.1Docket Number: SBT-004WO indicate UMI nucleotides, and asterisks indicate that a preceding base is phosphorylated to prevent it from being attacked by nucleases. Barcoded bead SeqB, the Template_Switch_Oligo, TSO_PCR, all Nextera sequences, Read1CustomSeqB, as well as both the P5 and P7 adaptor primers were used. Single cell sequencing may be as described in “Macosko EZ, Basu A, Satija R, et al. Highly Parallel Genome-wide Expression Profiling of Individual Cells Using Nanoliter Droplets. Cell.2015;161(5):1202-1214. doi:10.1016 / j.cell.2015.05.002”, which is incorporated by reference herein in its entirety. Continued Examples of Co-Encapsulation

[0322] Referring now to FIG.16, a distribution of droplets with beads and cells is presented. Using devices, systems, and methods described herein, a 95% occurrence of a single cell in a single droplet is achieved, which outperforms a Poisson-predicated rate of about 60%. Using devices systems, and methods described herein, a 73% occurrence of cells co-encapsulated in a droplet with a single bead is achieved, which outperforms a Poisson- predicted rate of about 23%.

[0323] Referring now to FIG.17, a graph showing an average concentration of DNA produced from a sample of 5,000 beads is presented. After the cells were lysed inside the droplet, their mRNA was captured on the barcoded bead that was in the same droplet. The droplets were merged and reverse transcription was performed on the beads and extracted to produce cDNA using the captured mRNA as a template. After an exonuclease treatment, the DNA was amplified via PCR, then analyzed on a bioanalyzer.

[0324] The graph is data from a Bioanalyzer, showing the presence of DNA produced from a sample of 5000 beads with an average concentration of 375pg / uL. The presence of DNA confirms that mRNA was successfully captured when the cells were lysed inside the droplet, in the presence of the barcoded beads.

[0325] Referring now to FIG.18, a graph showing experiment results of single-cell sequencing of mouse and human cells is presented. The cells used in the experiment were NIH-3T3 (mouse) cells, and HEK293T (human) cells. To verify the ability to perform single- cell sequencing with devices and methods described herein, both cell types were first mixed at a 1:1 ratio prior to droplet generation. During droplet generation, the cells would be individually packaged inside of their own droplet, along with a single barcoded bead. Due to the platform pairing a single cell with a single bead, it’s possible to distinguish sequences of human origin distinctly from sequences of mouse origins, using the barcoded beads. This is a way of quantifying the rate of cross-contamination or the efficiency of the sequencing 107 IPTS / 128953967.1Docket Number: SBT-004WO platform. Cross-contamination would yield UMIs that contain sequences from both species. The data here shows human UMIs on the Y-axis, and mouse UMIs on the X-axis. In the experiment, UMIs with primarily human sequences were successfully distinguished from UMIs with primarily mouse sequences, demonstrating that the platform can be used for single-cells sequencing. Example 2: Example multichannel microfluidic devices successfully encapsulate three or more cells and beads

[0326] Referring to FIG.19, an example of a three-channeled microfluidic device 1900 that generated single droplets is presented. The three-channeled microfluidic device included first microchannel 1904A, second microchannel 1904B, and third microchannel 1904C. First ordered stream of cells 1924A entered the junction 1908 through the first microchannel 1904A. Second ordered stream of cells 1924B entered the junction 1908 through the second microchannel 1904B. Third ordered stream of cells 1924C entered the junction 1908 through the third microchannel 1904C. Immiscible oil phases entered the junction 1908 through the fourth microchannel 1916A and the fifth microchannel 1916B. A single droplet 1920 generated by the three-channeled microfluidic device at nozzle 1912 comprised three cells, where one cell originated from the first ordered stream of cells 1904A, a second cell originated from the second ordered stream of cells 1904B, and a third cell originated from the third ordered stream of cells 1904C. Example 3: Example Non-rectangular microfluidic channels

[0327] Referring to FIG.20A, an illustration of a non-rectangular microchannel 2000 is presented. Non-rectangular microchannel 2000. Non-rectangular microchannel 2000 has first wall 2004 and second wall 2008. First wall 2004 is concave, while second wall 2008 is convex. First wall 2004 and second wall 2008 form a non-rectangular channel, in this case a serpentine channel, of which an ordered stream of beads and cells can flow.

[0328] Referring to FIG.20B, an image of an oblique cut of a microfluidic device having a non-rectangular microchannel is presented. The microfluidic device has a triangular cross- section 2012 of microfluidic channels. Loops and curves of non-rectangular microchannels terminate in triangular cross-section 2012. 108 IPTS / 128953967.1

Claims

Docket Number: SBT-004WO CLAIMS What is claimed is:

1. A method for performing single cell sequencing for a plurality of cells, the method comprising: flowing a first aqueous phase comprising an ordered stream of cells of the plurality of cells in a first microchannel towards a junction; flowing a second aqueous phase comprising an ordered stream of barcoded beads in a second microchannel towards the junction; flowing an oil phase in a third microchannel towards the junction; and at the junction, generating a population of single droplets formed from the first aqueous phase, the second aqueous phase, and the oil phase, wherein a fraction of the population of single droplets comprises a cell from the ordered stream of cells and a barcoded bead from the ordered stream of barcoded beads, wherein the fraction of single droplets comprising a cell from the ordered stream of cells and a barcoded bead from the ordered stream of barcoded beads exceeds a predicted fraction of single droplets comprising a cell from the ordered stream of cells and a barcoded bead from the ordered stream of barcoded beads predicted using a Poisson distribution; for each of one or more single droplets within the fraction of the population of single droplets, incorporating barcode sequences of the barcoded bead into nucleic acids of the cell; and sequencing at least the incorporated barcode sequences and a cellular derived nucleic acid to perform single cell sequencing.

2. The method of claim 1, wherein the cellular derived nucleic acid is RNA, cDNA, or genomic DNA.

3. The method of claim 1, wherein the cellular derived nucleic acid encodes a cytokine or TCR sequence 4. The method of any one of claims 1-3, wherein the fraction exceeds the predicted fraction by a factor ranging from 2-3.

5. The method of any one of claims 1-4, wherein the fraction of the population of single droplets are generated at a rate of at least 1 million single cells per hour. 109 IPTS / 128953967.1Docket Number: SBT-004WO 6. The method of any one of claims 1-5, wherein the fraction of the population of single droplets are generated at a rate of at least 8 million single cells per hour.

7. The method of any one of claims 1-6, wherein incorporating barcode sequences of the barcoded bead into nucleic acids of the cell comprises performing nucleic acid amplification.

8. The method of claim 7, wherein performing nucleic acid amplification comprises performing polymerase chain reaction.

9. The method of any one of claims 1-8, wherein the nucleic acids of the cell comprise one or more of genomic DNA, RNA, or cDNA.

10. The method of any one of claims 1-8, further comprising: prior to incorporating barcode sequences of the barcoded bead into nucleic acids of the cell, reverse transcribing RNA of the cell to produce cDNA.

11. The method of any one of claims 1-10, wherein sequencing at least the incorporated barcode sequences to perform single cell sequencing further comprises assigning sequence reads to cells of the plurality of cells according to presence of incorporated barcode sequences.

12. The method of any one of claims 1-11, wherein cells of the ordered stream of cells are aligned along a central axis or edge of the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned along a central axis or edge of the second microchannel.

13. The method of any one of claims 1-12, wherein cells of the ordered stream of cells are aligned through inertial focusing while flowing through the first microchannel and the barcoded beads of the ordered stream of barcoded beads are aligned through inertial focusing while flowing through the second microchannel.

14. The method of claim 13, wherein the inertial focusing of the cells is generated by flowing the first aqueous phase through a curved region of the first microchannel and the inertial focusing of the barcoded beads is generated by flowing the second aqueous phase through a curved region of the second microchannel.

15. The method of claim 14, wherein the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 45 degree change in a flow vector across a length of the undulating portion. 110 IPTS / 128953967.1Docket Number: SBT-004WO 16. The method of claim 14 or 15, wherein the curved region of the first microchannel or the curved region of the second microchannel comprises at least one undulating portion comprising at least a 60 degree change, at least a 90 degree change, at least a 120 degree change, at least a 150 degree change, or at least a 180 degree change in a flow vector across a length of the undulating portion.

17. The method of any one of claims 14-16, wherein the curved region of the first microchannel or the curved region of the second microchannel comprises between 60-120 undulating portions.

18. The method of any one of claims 1-17, wherein an inter-cell spacing for at least 80% of cells in the ordered stream of cells is between 1 times an average cell diameter and 3.5 times an average cell diameter.

19. The method of any one of claims 1-17, wherein an inter-cell spacing for at least 60% of cells in the ordered stream of cells is between 1.5 times an average cell diameter and 3 times an average cell diameter.

20. The method of any one of claims 1-17, wherein a standard deviation of inter-cell spacing between pairs of successive cells is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent cells in the ordered stream of cells.

21. The method of any one of claims 1-17, wherein an inter-bead spacing for at least 80% of barcoded beads in the ordered stream of barcoded beads is between 1 times an average bead diameter and 3.5 times an average bead diameter.

22. The method of any one of claims 1-17, wherein an inter-bead spacing for at least 60% of barcoded beads in the ordered stream of barcoded beads is between 1.5 times an average bead diameter and 3 times an average bead diameter.

23. The method of any one of claims 1-17, wherein a standard deviation of inter-bead spacing between pairs of successive beads is less than 10 µm when measured over 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 pairs of adjacent beads in the ordered stream of barcoded beads.

24. The method of any one of claims 1-17, wherein the first microchannel is non-rectangular.

25. The method of any one of claims 1-17, wherein the second microchannel is non- rectangular.

26. The method of any one of claims 24-25, wherein either or both of the non-rectangular microchannel of the first microchannel and second microchannel is one of a triangular microchannel, isosceles triangular microchannel, scalene triangular microchannel, 111 IPTS / 128953967.1Docket Number: SBT-004WO trapezoidal microchannel, irregular trapezoidal microchannel, U-shaped microchannel, or asymmetric U-shaped microchannel.

27. The method of any one of claims 24-26, wherein the ordered stream of cells of the first aqueous phase or the ordered stream of beads of the second aqueous phase, or both, has a flow rate of about 10uL / min to about 60 uL / min.

28. The method of any one of claims 24-27, wherein a center of either or both of the first microchannel and the second microchannel has a maximum velocity of about 25 mm / s to about 250 mm / s.

29. The method of any one of claims 24-28 further comprising focusing the cells of the ordered stream of cells in the non-rectangular microchannel of the first microchannel into an apex of the non-rectangular microchannel, wherein a cell located proximal to the apex experiences a slower flow velocity relative to a faster flow velocity of a cell or bead located distally to the apex.

30. The method of any one of claims 25-29, further comprising focusing the beads of the ordered stream of beads of the nonrectangular microchannel of the second microchannel into an apex of the non-rectangular microchannel, wherein a bead located proximal to the apex experiences a slower flow velocity relative to a faster flow velocity of a bead located distally to the apex.

31. The method of any one of claims 24-30, wherein the non-rectangular microchannel of the first microchannel prevents cell crowding of a plurality of cells.

32. The method of any one of claims 25-31, wherein the non-rectangular microchannel of the second microchannel prevents bead crowding of a plurality of beads.

33. The method of any one of claims 24-32, further comprising focusing a majority of the first aqueous phase towards a bottom side of the non-rectangular microchannel of the first microchannel without touching one or more channel walls of the non-rectangular microchannel.

34. The method of claim 33, further comprising focusing the first aqueous phase to flow slower at a top side of the non-rectangular microchannel.

35. The method of any one of claims 25-34, further comprising focusing a majority of the second aqueous phase towards a bottom side of the non-rectangular microchannel of the second microchannel without touching one or more channel walls of the non-rectangular microchannel. 112 IPTS / 128953967.1Docket Number: SBT-004WO 36. The method of claim 35, further comprising focusing the second aqueous phase to flow slower at a top side of the non-rectangular microchannel.

37. The method of any one of claims 24-36, wherein the non-rectangular microchannel of the first microchannel is asymmetrical.

38. The method of any one of claims 24-37, wherein the non-rectangular microchannel of the second microchannel is asymmetrical.

39. The method of any one of claims 24-38, wherein the non-rectangular microchannel of the first microchannel, the second microchannel, or both, has a maximum cross-sectional area of about 20,000 square microns.

40. The method of any one of claims 24-39, wherein the non-rectangular microchannel of the first microchannel, the second microchannel, or both, has a channel width of about 50 microns.

41. The method of any one of claims 24-40, wherein a cell located proximal to a center of the non-rectangular microfluidic channel of the first microfluidic channel experiences a faster flow velocity relative to a slower flow velocity of a cell located more distally to the center of the non-rectangular microfluidic channel.

42. The method of any one of claims 24-41, further comprising flowing a fourth aqueous phase comprising an ordered steam of cells or beads in a fourth microchannel towards the junction.

43. The method of claim 42, wherein the fourth microchannel is non-rectangular.

44. The method of claim 43, wherein the non-rectangular fourth microchannel is one of a triangular microchannel, isosceles triangular microchannel, scalene triangular microchannel, trapezoidal microchannel, irregular trapezoidal microchannel, U-shaped microchannel, or asymmetric U-shaped microchannel 45. The method of claim 44, further comprising generating a single droplet formed from the first aqueous phase, the second aqueous phase, the third aqueous phase, and the oil phase.

46. The method of claim 45, wherein the single droplet comprises one cell or bead from the first ordered stream, one cell or bead from the second ordered stream, and one cell or bead from the third ordered stream.

47. The method of any one of claims 43-46, wherein generating the single droplet at the junction comprises extending a jet-like formation from the junction through a nozzle and breaking a portion of the jet-like formation into the single droplet. 113 IPTS / 128953967.1Docket Number: SBT-004WO 48. The method of claim 47, wherein the nozzle comprises a length between about 50 micrometers to about 500 micrometers.

49. The method of any one of claims 42-48, wherein the first microchannel has a width of about 50 micrometers to about 100 micrometers, the second microchannel has a width of about 50 micrometers to about 100 micrometers, and the fourth microchannel has a width of about 50 micrometers to about 100 micrometers.

50. The method of any one of claims 42-49, wherein the first microchannel has an angle between the junction and the second microchannel of about 45 degrees to about 65 degrees and the fourth microchannel has an angle between the junction and the second microchannel of about 45 degrees to about 65 degrees.

51. The method of any one of claims 1-50, wherein the junction comprises a triangular portion, a circular portion, or an ovular portion.

52. The method of any one of claims 42-51, further comprising adjusting a flow rate of the first, second, or third ordered stream of cells or beads to synchronize a time of entering the junction among the first, second, or third ordered stream of cells or beads.

53. The method of any one of claims 1-52, further comprising producing single droplets from the nozzle at a rate of about 5,000 single droplets per second.

54. The method of any one of claims 42-53, wherein the single droplet comprises three or more cells.

55. The method of any one of claims 42-54, wherein a flow rate of the first microchannel is different than a flow rate of either or both of the second and fourth microchannels.

56. The method of any one of claims 42-55, wherein a flow rate of the first microchannel is the same as that of a flow rate of either or both of the second and fourth microchannels.

57. The method of any one of claims 42-56, further comprising one or more additional microchannels that each flows an additional aqueous phase towards the junction in an ordered stream of cells or beads.

58. The method of any one of claims 43-57, wherein the single droplet comprises aqueous fluid, wherein 50% of the aqueous fluid of the single droplet is contributed from the first microchannel, wherein 25% of the aqueous fluid of the single droplet is contributed from the second microchannel, and wherein 25% of the aqueous fluid of the single droplet is contributed from the fourth microchannel.

59. The method of any one of claims 1-58, further comprising providing an air channel at the junction to generate the single droplet. 114 IPTS / 128953967.1

Images