Chimeric antigen receptor targeting nectin4

Abstract

The present disclosure generally relates to, inter alia, novel chimeric polypeptides and chimeric antigen receptors (CARs) that include a hinge domain from CD28 and optionally a costimulatory domain not from CD28. The disclosure also provides compositions and methods useful for producing such molecules, as well as methods for the detection and treatment of diseases, such as cancer.

Description

CHIMERIC ANTIGEN RECEPTOR TARGETING NECTIN4RELATED APPLICATION

[0001] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 648,502, filed May 16, 2024, which is incorporated herein by reference in its entirety for all purposes.STATEMENT REGARDING FEDERALLY SPONSORED R&D

[0002] This invention was made with government support under grant no. K08 CA273514 awarded by the National Cancer Institutes of the National Institutes of Health. The government has certain rights in the invention.INCORPORATION OF THE SEQUENCE LISTING|0003] This application contains a Sequence Listing, which is incorporated herein by reference in its entirety. The accompanying Sequence Listing XML file, named “2025-05-14 Sequence_Listing_ST26 048536-798001WO.XML” was created on May 14, 2025 and is 124,646 bytes.FIELD

[0004] The present disclosure relates generally to the fields of oncology and immunotherapeutics, and particularly relates to novel polypeptides, e.g., chimeric antigen receptors (CARs) that bind a nectin cell adhesion molecule 4 (NECTIN4) antigen. The disclosure also provides compositions and methods useful for producing such compositions, as well as methods for the prevention and / or treatment of health conditions, such as diseases (e.g., cancer), associated with NECTIN4 antigen expression.BACKGROUND

[0005] In recent years, chimeric antigen receptors (CARs) have emerged as a promising approach for immunotherapy and made headlines in clinical trials conducted by a number of pharmaceutical and biotechnology companies. For example, in cancer immunotherapy, the development of agents that activate T cells of the host's immune system to prevent the proliferation of or kill cancer cells, has emerged as a promising therapeutic approach to complement existing standards of care. Adoptive transfer of T cells, especially CAR- engineered T cells, has emerged as another promising approach in cancer immunotherapy.Unlike naturally occurring T cell receptors, CARs can directly recognize their target antigens without restrictions imposed by major histocompatibility complex (MHC) molecules and can potentially mediate high levels of cancer cell-killing activity. One common method is to genetically engineer T cells ex vivo to express engineered CARs which can recognize target antigens without the need for MHC presentation. These engineered CAR-T cells have the potential to generate high levels of anti-tumor activity towards cells expressing the target antigen.

[0006] However, it has been reported that CAR potency is often limited, particularly in solid tumors. This is often due to low target antigen density, immune suppressive factors in the microenvironment, and CAR T cell exhaustion.

[0007] Therefore, there remains an urgent need for the development of novel immunotherapies and more potent CARs to overcome these obstacles to extend the reach of these therapeutics to more diseases and to treat more patients. Described in various aspects and embodiments of the present disclosure are immuno-reagents, including chimeric polypeptides and CAR T-cell receptors that bind NECTIN4 antigen, as well as compositions and methods for the prevention and / or treatment of health conditions associated with expression of NECTIN4 in a subject in need thereof.SUMMARY

[0008] The present disclosure relates generally to the development of immuno-therapeutics, including enhanced polypeptides and chimeric antigen receptors (CARs), as well as recombinant cells and pharmaceutical compositions comprising the same for use in treating various health conditions, such as diseases (e.g, cancer). As described in greater detail below, some aspects and embodiments of the present disclosure relate to the development of immuno-reagents, including chimeric polypeptides and CARs that selectively target a NECTIN4 antigen (which is referred to hereafter as "NECTIN4-targeting CAR") for use in detecting and treating cancers that express NECTIN4. Nucleic acid molecules encoding these NECTIN4-targeting CARs are also provided. The disclosure also provides compositions and methods useful for production of recombinant cells expressing NECTIN4-targeting CARs, as well as methods for the prevention and / or treatment of health conditions associated with elevated expression of NECTIN4 as a cell surface protein.

[0009] In one aspect, provided herein are various chimeric polypeptides including: (a) an extracellular domain (ECD) including an antigen-binding moiety that has a binding affinity for nectin cell adhesion molecule 4 (NECTIN4); (b) a transmembrane domain (TMD) derivedfrom CD28; and (c) an intracellular signaling domain (ICD) including (i) a costimulatory domain derived from CD28; and (ii) a CD3^ domain.

[0010] Non-limiting exemplary embodiments of the chimeric polypeptides of the disclosure include one or more of the following features. In some embodiments, the chimeric polypeptide is a chimeric antigen receptor (CAR). In some embodiments, the antigen-binding moiety is selected from the group consisting of an antibody, a fragment antigen binding (Fab), a monovalent fragment (Fab’), bivalent fragment (F(ab’)2), a fragment variable (Fv), a single-chain antibody variable fragment (scFv), a biparatopic scFv, a disulfide-stabilized variable fragment (dsFv), a minibody, a diabody, a tandem diabody, atriabody, a nanobody, a tandem scFv (taFv), a variable domain of heavy-chain antibody (VHH), a variable domain of new antigen receptor (VNAR), a bispecific T-cell engager (BiTE®), a BiTE®-like fragment, a dual-affinity re-targeting antibody fragment (DART®), and an alphabody®.|0011] In some embodiments, the antigen-binding moiety includes an anti-NECTIN4 single-chain variable fragment (scFv). In some embodiments, the antigen-binding moiety includes: (a) heavy chain complementary determining regions (HCDRs) from the heavy chain variable (VH) domain selected from the group consisting of SEQ ID NOS: 1-6; and / or (b) light chain CDRs (LCDRs) from the light chain variable (VL) domain selected from the group consisting of SEQ ID NOS: 7-12. In some embodiments, the antigen-binding moiety includes (a) a VH domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a VH domain selected from the group consisting of SEQ ID NOS: 1-6, (b) and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a VL domain selected from the group consisting of SEQ ID NOS: 7-12. In some embodiments, the antigenbinding moiety includes (a) a VH domain having an amino acid sequence selected from the group consisting of SEQ ID NOS: 1-6 and (b) a VL domain having an ammo acid sequence selected from the group consisting of SEQ ID NOS: 7-12, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different ammo acid.

[0012] In some embodiments, the antigen-binding moiety includes: (a) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively; (b) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 2 and SEQ ID NO: 8, respectively; (c) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively; (d) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively; (e) a VH domain and a VL domain having the VH and VL sequences of SEQ IDNO: 5 and SEQ ID NO: 11 , respectively; or (f) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively; and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.10013] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 2 and SEQ ID NO: 8, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 5 and SEQ ID NO: 11, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively.

[0014] In some embodiments of the disclosure, the antigen-binding moiety includes an anti-NECTIN4 single-chain variable fragment (scFv) wherein the VH domain is operably linked upstream to the VL domain. In some embodiments, the anti-NECTIN4 scFv includes a VH domain and a VL domain, wherein the VH domain is operably linked downstream to the VL domain.

[0015] In some embodiments disclosed herein, the chimeric polypeptides of the disclosure further include a linker that is operably inserted between the VH domain and the VL domain. In some embodiments, the linker includes a peptide linker.

[0016] In some embodiments, the chimeric polypeptides disclosed herein further include an extracellular spacer sequence inserted between the ECD and the TMD. In some embodiments, the spacer sequence includes an extracellular IgG4 (EQ) spacer. In some embodiments, the chimeric polypeptides disclosed herein further include a reporter polypeptide domain. In some embodiments, the reporter polypeptide domain includes a sequence for a reporter protein. In some embodiments, the reporter protein is selected from the group consisting of green fluorescent protein (GFP) gene, blue fluorescent protein (BFP) gene, yellow fluorescent protein (YFP) gene, luciferase gene, and mCherry gene. In some embodiments, the reporter protein includes an eGFP polypeptide.

[0017] In some embodiments, the chimeric polypeptide disclosed herein further include one or more autoproteolytic cleavage sequences. In some embodiments, the one or more autoproteolytic cleavage sequences are derived from Thosea asigna virus 2A (T2A), calciumdependent senne endoprotease (furin), porcine teschovirus-1 2A (P2A), foot-and-mouth disease vims (FMDV) 2A (F2A), Equine Rhinitis A Vims (ERAV) 2A (E2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), and / or Flacherie Vims 2A (BmIFV2A). In some embodiments, the chimeric polypeptides of the disclosure include a T2A autoproteolytic cleavage sequence inserted between the reporter polypeptide domain and the CD3^ ICD.

[0018] In some embodiments, the chimeric polypeptides of the disclosure include, in N- terminal to C-terminal direction, (a) an anti-NECTIN4 scFv domain; (b) an IgG4 (EQ) spacer; (c) a CD28 TMD; and (d) an ICD including a costimulatory domain derived from CD28 and a CD3^ domain.|0019] In some embodiments, the chimeric polypeptides of the disclosure include an amino acid sequence having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the sequence of SEQ ID NO: 4.

[0020] In another aspect, provided herein are various recombinant nucleic acid molecules including nucleic acid sequences encoding a chimeric polypeptide (e.g., CAR) as disclosed herein. Non-limiting exemplary embodiments of the recombinant nucleic acid molecules include one or more of the following features. In some embodiments, the nucleic acid sequence encodes a chimeric polypeptide as disclosed herein. In some embodiments, the chimeric polypeptide is a CAR as disclosed herein. In some embodiments, the recombinant nucleic acid molecule is operably linked to a heterologous nucleic acid sequence. In some embodiments, the recombinant nucleic acid molecule is incorporated into an expression cassette or a vector. In some embodiments, the vector is a lentiviral vector, an adeno vims vector, an adeno-associated virus vector, or a retroviral vector. In some embodiments, the vector is a lentiviral vector.

[0021] In another aspect, some embodiments of the disclosure relate to a recombinant cell including: (a) a chimeric polypeptide as described herein; and / or a nucleic acid molecule as described herein. In some embodiments, the recombinant cell is a prokaryotic cell or a eukary otic cell. In some embodiments, the recombinant cell is a eukaryotic cell. In some embodiments, the recombinant cell is an immune system cell. In some embodiments, the immune system cell is a B cell, a monocyte, a NK cell, a natural killer T (NKT) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (TH), a cytotoxic T cell (TCTL), a memory T cell, a gamma delta (y5) T cell,another T cell, a hematopoietic stem cell, or a hematopoietic stem cell progenitor. In some embodiments, the immune system cell is a T lymphocyte.

[0022] In another aspect, some embodiments disclosed herein relate to methods for making a recombinant cell, wherein the method includes (a) providing a host cell capable of protein expression; and (b) transducing the provided host cell with a recombinant nucleic acid of the disclosure to produce a recombinant cell. Accordingly, in a related aspect, also provided herein are recombinant cells produced by the methods of the disclosure. In a further related aspect, some embodiments of the disclosure provide cell cultures that include at least one recombinant cell of the disclosure and a culture medium.

[0023] In another aspect, some embodiments of the disclosure relate to a pharmaceutical composition including a pharmaceutically acceptable carrier and one or more of the following: (a) a chimeric polypeptide of the disclosure; (b) a nucleic acid molecule of the disclosure; and (c) a recombinant cell of the disclosure. In some embodiments, the composition includes a recombinant nucleic acid of the disclosure and a pharmaceutically acceptable carrier. In some embodiments, the recombinant nucleic acid is encapsulated in a viral capsid or a lipid nanoparticle. In some embodiments, the composition includes a recombinant cell of the disclosure and a pharmaceutically acceptable carrier.

[0024] In yet another aspect, some embodiments of the disclosure relate to methods for preventing and / or treating a condition in a subject in need thereof, wherein the methods include administering to the subject a composition including one or more of the following: (a) a chimeric polypeptide of the disclosure, (b) a recombinant nucleic acid of the disclosure, (c) a recombinant cell of the disclosure, and (d) a pharmaceutical composition of the disclosure. Non-limiting exemplary' embodiments of the disclosed methods include one or more of the following features. In some embodiments, the condition is a proliferative disease. In some embodiments, the proliferative disease is a cancer. In some embodiments, the cancer expresses or overexpresses the NECTIN4 antigen (NECTIN4-positive cancer). In some embodiments, the NECTIN4-positive cancer is breast cancer, bladder cancer, gastric cancer, pancreatic cancer, lung cancer, penile cancer, head and neck cancers, cholangiocar cinoma, skin cancer, liver cancer, or ovarian cancer. In some embodiments, the NECTIN4-positive cancer is breast cancer or bladder cancer. In some embodiments, the bladder cancer is a cancer with acquired resistance to enfortumab vedotin (VE).

[0025] In some embodiments, the NECTIN4-positive cancer is a solid tumor cancer. In some embodiments, the solid tumor cell is lung cancer, liver cancer, pancreatic cancer, stomach cancer, colon cancer, kidney cancer, brain cancer, head and neck cancer, breastcancer, skin cancer, rectal cancer, uterine cancer, cervical cancer, ovarian cancer, testicular cancer, skin cancer, or esophageal cancer. In some embodiments, the cancer includes a sarcoma cell, a rhabdoid cancer cell, a neuroblastoma cell, retinoblastoma cell, or a medulloblastoma cell, lung cancer, liver cancer, pancreatic cancer, stomach cancer, colon cancer, kidney cancer, brain cancer, head and neck cancer, breast cancer, skin cancer, rectal cancer, uterine cancer, cervical cancer, ovarian cancer, testicular cancer, skin cancer, or esophageal cancer. In some embodiments, the administered composition inhibits tumor growth or metastasis of the NECTIN4-positive cancer in the subject. In some embodiments, the NECTIN4-positive cancer includes a metastatic cancer cell, a multiply drug resistant cancer cell, or a recurrent cancer cell. In some embodiments, the cancer has elevated expression of NECTIN4.

[0026] In some embodiments, the composition is administered to the subject as a sole therapy or as a first therapy in combination with a second therapy. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy , and surgery. In some embodiments, the first therapy and the second therapy are administered concomitantly. In some embodiments, the first therapy is administered at the same time as the second therapy. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy is administered after the second therapy. In some embodiments, the first therapy is administered before and / or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in rotation. In some embodiments, the first therapy and the second therapy are administered together in a single formulation.

[0027] In some embodiments, the second therapy includes an anti-diabetic drug. In some embodiments, the anti-diabetic drug includes thiazolidinedione and / or rosiglitazone. In some embodiments, the second therapy includes an agonist of peroxisome proliferator-activated receptor gamma (PPARY agonist). In some embodiments, the PPARy agonist includes rosiglitazone.

[0028] In another aspect, some embodiments of the disclosure provide various kits for the practice of the methods disclosed herein. Some embodiments relate to kits for methods of the prevention and / or treatment of a health condition in a subject in need thereof, wherein the kits include one or more of: a chimeric polypeptide of the disclosure; a recombinant nucleic acidof the disclosure; a recombinant cell of the disclosure, and a pharmaceutical composition of the disclosure, as well as written instructions for making and using the same.

[0029] The foregoing summary is illustrative only and is not intended to be in any way limiting. In addition to the illustrative embodiments and features described herein, further aspects, embodiments, objects and features of the disclosure will become fully apparent from the drawings and the detailed description and the claims.

[0030] Each of the aspects and embodiments described herein are capable of being used together, unless excluded either explicitly or clearly from the context of the embodiment or aspect.

[0031] Throughout this specification, various patents, patent applications and other types of publications (e.g., journal articles, electronic database entries, etc.) are referenced. The disclosure of all patents, patent applications, and other publications cited herein are hereby incorporated by reference in their entirety for all purposes.BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIGS. 1A-1G schematically summarize the development of an exemplary 2ndgeneration CAR construct against NECTIN4 (N4-CAR).

[0033] FIG. 1A depicts the schematic of the lentiviral NECTIN4-CAR construct, including signal peptide, Myc tag, scFv targeting NECTIN4, CAR T backbone construct containing an IgG4Fc (EQ) spacer, the CD28 transmembrane domain and the CD28 costimulatory domain with CD3 intracellular signaling domain, 2A self-cleavage peptide, GFP transduction marker. Also shown are scFv single-chain variable fragment, VL variable light chain, VH variable heavy' chain, tm transmembrane, and GFP green fluorescent protein.

[0034] FIG. IB depicts a Western blot analysis ofNECTIN4 expression in whole cell lysates of RT112 parental cells and two NECTIN4 knockout (KO) clones, generated from two unique sgRNA guide sequences.

[0035] FIG. 1C depicts a surface protein staining for NECTIN4 protein in RT112 parental cells and NECTIN4 KO cell line 1 (KOI).

[0036] FIGS. ID depicts growth curves of RT112 target cells with fluorescently labeled nuclei (NucLightRed, NLR) co-cultured with (left) NECTIN4-CAR T cells or (right) nontransduced (NTD) T cells at indicated effector-to-target (E:T) cell ratios.

[0037] FIGS. 1D-1E depict growth curves of NECTIN4 KO target cells with fluorescently labeled nuclei (NucLightRed, NLR) co-cultured with (left) NECTIN4-CAR T cells or (right) non-transduced (NTD) T cells at indicated effector-to-target (E:T) cell ratios.

[0038] FIG. IF illustrates that the kill index [1 / area under the curve (AUC)] was calculated as a time-dependent measure of killing efficacy against the indicated tumor target cells at an E:T ratio of 1:2.

[0039] FIG. 1G illustrates that IFN-y quantification by ELISA from co-cultures of NECTIN4-CAR or NTD T cells, an indicator if CAR T cell activation and cytotoxicity, with the indicated RT112 cell lines, including NECTIN4 KOs at a 1 :2 ratio at 24 h.

[0040] FIGS. 2A-2C graphically summarize the results of experiments performed to demonstrate that N4-CAR activity is correlated with NECTIN4 expression.

[0041] FIG. 2A depicts Western blots demonstrating NECTIN4 protein expression across luminal and basal human urothelial carcinoma cell lines. GAPDH was used as a protein loading control.

[0042] FIG. 2B depicts growth curves of indicated cell lines co-cultured with NECTIN4- CAR T cells at an E:T ratio of 1 : 1. n = 3 biological replicates per conditions were used and error bars represent mean with SEM.

[0043] FIG. 2C depicts a scatter plot showing the kill index of NECTIN4-CAR T cells against target cell lines described in FIGS. 2A-2B versus respective expression of NECTIN4. Pearson's correlation is shown for NECTIN4 expression versus kill index (r = 0.96, P=Q.010).

[0044] FIGS. 3A-3C summarize the results of experiments demonstrating that NECTIN4 expression is sufficient to trigger N4-CAR T kill.

[0045] FIG. 3A depicts a Western blot showing NECTIN4 expression in NECTIN4NEGUMUC-3 parental cells and NECTIN4 overexpressing (OE) cells, where NECTIN4 is expressed using a lentivirus containing a CMV promoter driving expression of the NECTIN4 gene. GAPDH was used as a protein loading control.

[0046] FIG. 3B depicts growth curves of UMUC-3 parental with fluorescently labeled nuclei co-cultured with (left) NECTIN4-CAR or (right) nontransduced (NTD) control T cells at indicated E:T ratios.

[0047] FIG. 3C depicts growth curves of UMUC-3 NECTIN4 OE target cells with fluorescently labeled nuclei co-cultured with (left) NECTIN4-CAR or (right) NTD control T cells at the indicated E:T ratios.

[0048] FIGS. 4A-4B summarize the results of experiments illustrating that NECTIN4 is heterogeneously expressed in bladder cancer.

[0049] FIG. 4A depicts immunohistochemical staining for NECTIN4 in a variety of bladder cancer samples from a tissue microarray, which represent low / negative (left), medium (middle) and high (right) expression of NECTIN4.

[0050] FIG. 4B depicts the quantification of the H-score (summation of percentage of cells expression 0, 1+, 2+ and 3+ from the immunohistochemical stain) of NECTIN4 across the different molecular subtypes of bladder cancer.

[0051] FIG. 5A summaries the association of NECTIN4 mRNA expression with GATA3 in bladder cancer samples. The red box (bottom) indicates that PPARG, which is the gene that encodes for PPARy, a nuclear hormone receptor that can be agonized and antagonized using small molecules. The Pearson correlation coefficient and p value are indicated within each graph.

[0052] FIG. 5B summaries the association of NECTIN4 mRNA expression with FOXA1 in bladder cancer samples. The red box (bottom) indicates that PPARG. which is the gene that encodes for PPARy. a nuclear hormone receptor that can be agonized and antagonized using small molecules. The Pearson correlation coefficient and p value are indicated within each graph.

[0053] FIG. 5C summaries the association of NECTIN4 mRNA expression with PPARG in bladder cancer samples. The red box (bottom) indicates that PPARG, which is the gene that encodes for PP ARv. a nuclear hormone receptor that can be agonized and antagonized using small molecules. The Pearson correlation coefficient and p value are indicated within each graph.

[0054] FIGS. 6A-6D summarize the results of experiments demonstrating that PPARy agonists increase NECTIN4 expression.

[0055] FIG. 6A depicts a Western blot for NECTIN4 and HPGD in RT112 cells treated with rosiglitazone for 72h across a dose series (starting at luM on the right lane with serial 2- fold dilutions).

[0056] FIG. 6B depicts a dose response curve of NECTIN4 and HPGD expression after treating RT112 with the indicated doses of rosiglitazone after 72h.

[0057] FIG. 6C depicts surface NECTIN4 protein staining in RT112 cells treated with rosiglitazone for 72h.

[0058] FIG. 6D depicts an increase across a dose series of rosiglitazone to a maximum treated dose of IpM.

[0059] FIG. 7 pictorially summarizes the results of experiments demonstrating that PPARy inhibition decreases NECTIN4 expression. This is a Western blot showing NECTIN4, PPARy, and FABP4 in RT112 cells expressing sgRNAs against GAL4 (control), NECTIN4, and two unique PPARG guides to knockdown expression of NECTIN4 or PPARG.

[0060] FIGS. 8A-8H graphically summarize the results of experiments performed to demonstrate that PPARy agonists improve N4-CAR mediated kill.

[0061] FIG. 8A illustrates representative growth curves of RT112 cells pretreated for 72 hours with DMSO vehicle or 1 pM rosiglitazone and co-cultured with either NECTIN4-CAR T cells (left) or NTD T cells (right) at the indicated E:T cell ratios, n = 3 biological replicates per condition were used, and error bars represent the mean with SEM.10062] FIG. 8B illustrates the kill indices for NECTIN4-CAR and NTD T cells against RT112 cells pretreated for 72 hours with DMSO vehicle or 1 pM rosiglitazone across vanous E:T ratios, n = 3 biological replicates per condition were used, error bars represent the mean with SEM, and two-way ANOVA with Sidak’s multiple comparison test was performed.

[0063] FIG. 8C illustrates representative growth curves of UMUC-1 cells pretreated for 72 hours with DMSO vehicle or 1 pM rosiglitazone and co-cultured with either NECTIN4-CAR T cells (left) or NTD T cells (right) at the indicated E:T cell ratios, n = 3 biological replicates per condition were used, and error bars represent the mean with SEM.|0064] FIG. 8D illustrates the kill indices for NECTIN4-CAR and NTD T cells against UMUC-1 cells pretreated for 72 hours with DMSO vehicle or 1 pM rosiglitazone across various E:T ratios, n = 3 biological replicates per condition were used, error bars represent the mean with SEM, and two-way ANOVA with Sidak’s multiple comparison test was performed.

[0065] FIG. 8E illustrates representative growth curves of HT1197 cells pretreated for 72 hours with DMSO vehicle or 1 pM rosiglitazone and co-cultured with either NECTIN4-CAR T cells (left) or NTD T cells (right) at the indicated E:T cell ratios, n = 3 biological replicates per condition were used, and error bars represent the mean with SEM.

[0066] FIG. 8F illustrates the kill indices for NECTIN4-CAR and NTD T cells against HT1197 cells pretreated for 72 hours with DMSO vehicle or 1 pM rosiglitazone across various E:T ratios, n = 3 biological replicates per condition were used, error bars represent the mean with SEM, and two-way ANOVA with Sidak’s multiple comparison test was performed.

[0067] FIG. 8G illustrates IFN-y quantification by ELISA from co-cultures of NECTIN4- CAR or NTD T cells with RT112 cells pretreated for 72 hours with DMSO control or 1 pM rosiglitazone at an E:T ratio of 1 : 1 at 24 hours. Error bars represent the mean with SEM.

[0068] FIG. 8H illustrates IFN-y quantification by ELISA from co-cultures of NECTIN4- CAR or NTD T cells with UMUC-1 cells pretreated for 72 hours with DMSO control or1 pM rosiglitazone at an E:T ratio of 1 : 1 at 24 hours. Error bars represent the mean with SEM.

[0069] FIG. 9 pictorially summarizes the results of experiments demonstrating that the PPARy agonist Rosiglitazone enhances N4-CAR kill. In these studies, the nuclei are labeled in red, and the timelapse microscopy images are taken over 3 days.|0070] FIGS. 10A-10K summarize the experimental procedure performed to demonstrate that the PPARy agonist Rosiglitazone primes NECTIN4 expression and enhances N4-CAR kill.|0071] FIG. 10A illustrates a schematic of in vivo studies investigating the combination of rosiglitazone and NECTIN4-CAR T cell therapy (created with BioRender.com). Xenograft models were established by subcutaneous injection of the indicated UC cells into NOD / scid / gamma (NSG) mice. When tumors reached approximately 50-100 mm3, mice were randomized to receive daily treatment with rosiglitazone (20 mg / kg) or vehicle for 5 days, followed by a single injection of 2.5-5 x io6NECTIN4-CAR or NTD T cells. Some tumors were collected immediately following rosiglitazone or vehicle administration for analysis.

[0072] FIG. 10B illustrates a representative western blot analysis of NECTIN4 and HPGD expression in RT112 tumor xenografts from mice treated with either rosiglitazone or vehicle for 5 days. Vinculin was used as a protein loading control.

[0073] FIG. 10C illustrates quantification of NECTIN4 and HPGD protein expression from the western blot shown in FIG. 10B.

[0074] FIG. 10D illustrates a scatterplot showing NECTIN4 versus HPGD expression from the western blot analysis of tumors in FIG. 10B. Pearson's correlation coefficient (r = 0.58, P = 0.01) is shown. Data are from n = 2 independent cohorts of n = 4-5 mice each.

[0075] FIG. 10E illustrates tumor growth curves of RT112 subcutaneous xenografts in NSG mice treated for 5 days with either vehicle or rosiglitazone, followed by an IV injection of NECTIN4-CAR or NTD T cells, n = 5 mice in each NTD T cell-treated group and n = 7 mice in each NECTIN4-CAR T cell-treated group, p < 0.001 at days 25, 28, and 31, and p < 0.0001 at day 34 for Vehicle + NECTIN4-CAR T versus Rosi + NECTIN4-CAR T. Bars represent mean with SEM. A mixed effects model with Sidak’s multiple comparison test was used.

[0076] FIG. 1OF illustrates body weights of each group of mice from FIG. 10E over time. Bars represent mean with SEM. A mixed effects model with Sidak’s multiple comparison test was used.

[0077] FIG. 10G illustrates a representative western blot for NECTIN4 and HPGD expression in HT1197 tumor xenografts from mice treated with either rosiglitazone or vehicle for 5 days. Vinculin was used as a protein loading control.

[0078] FIG. 10H illustrates quantification of NECTIN4 protein expression from the western blot shown in FIG. 10G.

[0079] FIG. 101 illustrates a scatterplot showing NECTIN4 versus HPGD expression from the western blot analysis of tumors in FIG. 10G. Pearson's correlation coefficient (r = 0.50, P = 0.04) is shown. Data are from n = 2 independent cohorts of n = 4-5 mice each.

[0080] FIG. 10J illustrates tumor growth curves of HT1197 subcutaneous xenografts in NSG mice treated with either vehicle or rosiglitazone, followed by a single IV injection of NECTIN4-CAR T cells or NTD T cells. The number of mice in each group is indicated in parentheses, p < 0.001 at day 82 for Vehicle + NTD versus Rosi + NTD and p < 0.01 at day 82 for Vehicle + NECTIN4-CAR T versus Rosi + NECTIN4-CAR T. Bars represent mean with SEM. A mixed effects model with Sidak’s multiple comparison test was used.

[0081] FIGS. 11A-11C schematically summarize the results of experiments suggesting that NECTIN4 is retained in EV-resistant cells. FIG. 11A: Schematic of parental RT112 cells undergoing cycles of treatment with enfortumab vedotin (EV) at escalating doses to yield a generation of cells (“RT112-EV Res.”) surviving after treatment with 25 ug / ml of EV. Created with BioRender.com. FIG. 11B: EV dose-response curves for survival of RT112- Parental and RT112-EV Res. following 9 days of treatment with EV. p < 0.0001 for IC50 of EV against RT112-parental (2.4 ug / ml) vs IC50 of EV against RT112-EV Res. (25.1 ug / ml). FIG. 11C: Tumor growth curves of RT112-parental and RT112-EVRes. subcutaneous tumor xenografts in NSG mice treated with a single IV injection of EV (4mg / kg) or vehicle. RT112- parental tumors treated with vehicle (n=10 mice, black), RT112-EV Res. tumors treated with vehicle (n=10 mice, pink), RT112-parental xenografts treated with EV (n=4 mice, purple), RT112-EV Res. xenografts treated with EV (n=5 mice, teal), p < 0.0001 at day 28 and p < 0.001 at day 34 for tumor volume of RT112-parental xenografts treated with vehicle (black) vs EV (purple).

[0082] FIGS. 12A-12B graphically summarizes the results of experiments suggesting that NECTIN4 levels are retained in post-EV biopsies and N4-CAR remain active.

[0083] FIG. 12A illustrates H-scores for surface NECTIN4 IHC staining on matched biopsy samples taken from a cohort of n=17 UC patients treated with EV who underwent pre- EV and post-EV biopsies. Bars represent mean with SEM.

[0084] FIG. 12B illustrates H-scores for surface NECTIN4 IHC staining on matched biopsy samples taken from a cohort of n=17 UC patients treated with EV, with lines linking the same patient who was biopsied pre-EV and post-EV.

[0085] FIGS. 13A-13B graphically summarize the results of experiments performed to illustrate that NECTIN4 is broadly expressed in breast cancer cells across the traditional molecular subtypes.

[0086] FIG. 13A illustrates surface NECTIN4 protein expression across a panel of nine breast cancer cells representing hormone receptor (HR) positive, HER2 positive and triplenegative breast cancer (TNBC) cell lines.|0087] FIG. 13B illustrates the median fluorescence intensity (MFI) of NECTIN4 staining is plotted for each indicated cell line. The triple-negative breast cancer cell lines include MDA-MB-468, HCC1937 and MDA-MB-231.

[0088] FIGS. 14A-14C graphically summarize the cell lines utilized in the study, which include HER2+ and HER2 negative expressing cell lines.

[0089] FIG. 14A is Western blot showing HER2 levels in breast cancer cell lines. Vinculin is shown as a loading control.

[0090] FIG. 14B is Scatter plot showing expression of ERBB2 (the gene encoding HER2) versus NECTIN4 across a panel of 30 breast cancer cell lines.

[0091] FIG. 14C is Scatter plot showing HER2 protein versus NECTIN4 protein expression in BT474 (HER2+), MDA-MB-361 (HER2 medium) and T47D (HER2 low) cell lines.

[0092] FIGS. 15A-15F graphically summarize results demonstrating that NECTIN4-CAR T cells exhibit activity across multiple breast cancer subtypes and effectively kill different breast cancer cell lines.

[0093] FIG. 15A illustrates NECTIN4-CAR T cell-mediated killing of ZR75-1 (hormone receptor-positive, HR+) breast cancer cells.

[0094] FIG. 15B illustrates NECTIN4-CAR T cell-mediated killing of T47D (hormone receptor-positive, HR+) breast cancer cells.

[0095] FIG. 15C illustrates NECTIN4-CAR T cell-mediated killing of BT474+ (HER2- positive) breast cancer cells.

[0096] FIG. 15D illustrates NECTIN4-CAR T cell-mediated killing of MDA-MB-468 (triple-negative breast cancer, TNBC) cells.

[0097] FIG. 15E illustrates surface NECTIN4 protein staining of a patient-derived organoid (PDO) model of TNBC, showing high NECTIN4 expression. An unstained negative control is also shown.

[0098] FIG. 15F illustrates NECTIN4-CAR T cell-mediated killing of a PDO model of TNBC. Phase-contrast microscopy images were taken on Day 0 (at the time of NECTIN4- CAR T cell addition) and on Day 11 (after evidence of killing was observed). HR = hormone receptor; TNBC = triple-negative breast cancer.

[0099] FIGS. 16A-16C graphically summarize the results of experiments performed to determine which of the NECTIN4 binders would function in the CAR backbone and exhibit anti -tumor killing activity against NECTIN4-expressing (RT112) but not NECTIN4-negative (UMUC3) bladder cancer cells.

[0100] FIG. 16A is Western blot showing NECTIN4 levels in RT112 and UMUC3 (negative control) bladder cancer cells.

[0101] FIG. 16B illustrates T cells expressing NECTIN4 CAR1, CAR2, CAR3, CAR5. CAR7, and CAR8 co-cultured with RT112 cells labeled with NucLightRed and monitored over 90 hours. In this experiment, CAR3 and CAR8 did not exhibit any anti-tumor activity.

[0102] FIG. 16C illustrates T cells expressing NECTIN4 CAR1, CAR2, CAR3, CAR5, CAR7, and CAR8 co-cultured with UMUC3 cells labeled with NucLightRed and monitored over 90 hours. In this experiment, none of the CARs exhibited anti-tumor activity, consistent with UMUC3 being aNECTIN4-negative cell line.DETAILED DESCRIPTION OF THE DISCLOSURE

[0103] The present disclosure generally relates to, inter alia, compositions and methods for the treatment of a health condition associated with expression of nectin cell adhesion molecule 4 (NECTIN4) in a subject in need thereof. In some embodiments, the NECTIN4 antigen is expressed on the cell surface. NECTIN4 has been considered a promising immunotherapeutic target. It is present on the cell surface of numerous malignancies and demonstrates high differential expression between tumor and normal tissues. In particular, NECTIN4 has been identified as a cell surface protein on several cancer types, including breast cancer and bladder cancer. This presents an opportunity for the development of new targeted immunotherapies.

[0104] As will be discussed more thoroughly herein, various aspects and embodiments of the disclosure relate to the development of NECTIN4-CAR T cells targeting bladder cancer and the ability of thiazolidinedione, a class of anti-diabetic drugs, to specifically upregulate NECTIN4 expression and expand the therapeutic window of NECTIN4-CAR T cells. As described in greater detail below, the efficacy of NECTIN4-CAR T cell therapy against a model of bladder cancer with acquired resistance to enfortumab vedotin has been assessed.

[0105] As described in greater detail in the Examples below, an exemplary NECTIN4- targeting CAR T cell therapy has been demonstrated to be highly antigen-specific and possesses antitumor activity against multiple bladder cancer models, including EV resistant cells. It was observed that modulating the PPARy pathway increases NECTIN4 expression, which was subsequently leveraged by repurposing an FDA-approved anti-diabetes drug rosiglitazone to increase targeting and anti-tumor efficacy of NECTIN4-CAR T cells. Taken together, these preclinical results lay the groundwork for CAR T therapy development in bladder cancer, and suggest rational drug combinations that can expand the therapeutic window of NECTIN4-targeting therapies.

[0106] Some embodiments of the disclosure relate to the engineering of NECTIN4-targeted CAR T-cells and the optimization of several CAR modules to render CAR T-cells highly efficacious against tumors expressing NECTIN4. In some embodiments, the disclosure provides novel CARs that have been designed to selectively bind NECTIN4 antigen and can be useful in methods for detecting, preventing, and / or treating a health condition associated with NECTIN4 expression. As described in greater detail below, novel CARs targeting NECTIN4 have been engineered and improved to demonstrate that they are highly efficacious against NECTIN4 -expressing malignancies in vitro and in vivo in mammals, as exemplified by murine xenograft models. In particular, NECTIN4-targeting CAR T-cells as described herein can prove efficacious in the treatment of a broad spectrum of malignancies (e.g, cancers) facing an otherwise poor prognosis.

[0107] As described in greater detail below (e.g., in Examples 1-11 of the present disclosure), exemplary NECTIN4-targeting CAR constructs were designed and cloned into a second-generation EQ-28^ CAR backbone construct. Human primary T cells were transduced with lentiviral NECTIN4-CAR constructs and co-cultured with a panel of bladder cancer cell lines with a range of NECTIN4 expression and against NECTIN4 knockout cells to assess specificity. Tumor cell count over time was monitored in vitro using an IncuCyte S3. Several bladder cancer cell lines (e.g., RT112, UMUC-1, HT1197) were treated with PPARy agonists (e.g., rosiglitazone) and antagonists (e.g., T0070907), and total and surface NECTIN4 proteinlevels were assessed. Anti-tumor effects of the NECTIN4-CAR T were evaluated in vitro and in vivo, either with or without rosiglitazone pre-treatment. Furthermore, RT112 bladder cancer cells were exposed to “cycles” of escalating doses of EV to generate EV resistant cell line models, and anti-tumor efficacy against EV-resistant lines was also evaluated.|0108] As demonstrated herein, NECTIN4-targeting CAR T cells was found to display potent and NECTIN4-specific cytotoxic activity against bladder cancer cell lines. The efficacy of NECTIN4-CAR T cells was strongly correlated with NECTIN4 expression. Treatment with PPARy agonists and antagonists was shown to upregulate and downregulate NECTIN4 expression, respectively. Treatment with the PPARy agonist rosiglitazone induced NECTIN4 expression in a PPARy-dependent and dose responsive manner. NECTIN4 expression was increased in bladder cancer xenografts established in immunodeficient NSG mice that were treated with systemic rosiglitazone. It was further observed that priming with rosiglitazone enhanced sensitivity' to NECTIN4-CAR T cells in vitro, and the combination of rosiglitazone pre-treatment and NECTIN4-CAR T cell therapy showed enhanced tumor control in bladder cancer xenograft models. In RT112 cells that exhibited resistance to EV in vitro and in vivo, NECTIN4 expression was retained. Interestingly, EV-resistant RT112 cells were found to remain sensitive to NECTIN4-CAR T cell therapy both in vitro and in vivo.

[0109] Furthermore, the results described in the Examples demonstrate that not all NECTIN4 binders can be substituted from an antibody format and transferred in a CAR T backbone to elicit anti -tumor activity. The data described herein suggest that optimization and evaluation of the VH and VL sequences, the linker length, and the specific order that the VH and VL are linked together (i.e., VH-linker-VL versus VL-linker-VH) has important implications to obtain anti-tumor activity.I. DEFINITIONS[OHO] Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this disclosure pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.

[0111] The singular form “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. For example, the term “a cell” includes one or more cells, including mixtures thereof. “A and / or B” is used herein to include all of the following alternatives: “A,” “B,” “A or B,” and “A and B.”|0112] The terms “cell,” “cell culture,” “cell line” refer not only to the particular subject cell, cell culture, or cell line but also to the progeny or potential progeny of such a cell, cell culture, or cell line, without regard to the number of transfers or passages in culture. It should be understood that not all progeny are exactly identical to the parental cell. This is because certain modifications can occur in succeeding generations due to either mutation (e.g., deliberate or inadvertent mutations) or environmental influences (e.g. , methylation or other epigenetic modifications), such that progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein, so long as the progeny retain the same functionality as that of the originally cell, cell culture, or cell line.

[0113] As used herein, the term “chimeric antigen receptor” (CAR) refers to a polypeptide construct comprising at least an extracellular antigen-binding domain, a TMD and a cytoplasmic signaling domain (also referred to as “an intracellular signaling domain” or ICD). In some cases, the cytoplasmic signaling domain includes a functional signaling domain derived from a stimulatory molecule. In some embodiments, the stimulatory molecule is the zeta chain associated with the T cell receptor complex. Optionally, the ICD can further include one or more functional signaling domains derived from at least one costimulatory molecule.

[0114] Generally, the CARs of the disclosure include an ectodomain and an endodomain each as defined by the host cell wall. In this regard, the terms “ectodomain” or “extracellular domain” generally refer to the portion of the CAR polypeptide outside of the cell or extenor to the membranous lipid bilayer, which can include one or more antigen recognition binding domains, an optional hinge domain, and any spacer domains exterior to the amino acid residues physically spanning the membrane. In some embodiments, the ectodomain of the CARs provided herein further include a signal peptide. Conversely, the terms “endodomain” or “intracellular domain” generally refer to the portion of the CAR polypeptide inside the cell or interior to the membranous lipid bilayer, which can also include any spacer domains interior to the amino acid residues physically spanning the membrane, as well as the ICD, which comprises one or more costimulatory signaling domains e. , ITAM-containing sequences, costimulatory domains, etc. ).

[0115] The terms “nucleic acid molecule” and “polynucleotide” are used interchangeably herein, and refer to both RNA and DNA molecules, including nucleic acid molecules comprising cDNA, genomic DNA, synthetic DNA, and DNA or RNA molecules containing nucleic acid analogs. A nucleic acid molecule can be double-stranded or single-stranded (e.g., a sense strand or an antisense strand). A nucleic acid molecule can contain unconventional or modified nucleotides. The terms "polynucleotide sequence" and "nucleic acid sequence" as used herein interchangeably refer to the sequence of a polynucleotide molecule.

[0116] The term “operably linked,” as used herein, denotes a physical or functional linkage between two or more elements, e.g, polypeptide sequences or polynucleotide sequences, which permits them to operate in their intended fashion. For example, an operably linkage between a polynucleotide of interest and a regulatory sequence (for example, a promoter) is functional link that allows for expression of the polynucleotide of interest. In this sense, the term "operably linked" refers to the positioning of a regulatory region and a coding sequence to be transcribed so that the regulatory region is effective for regulating transcription or translation of the coding sequence of interest. In some embodiments disclosed herein, the term "operably linked” denotes a configuration in which a regulatory sequence is placed at an appropriate position relative to a sequence that encodes a polypeptide or functional RNA such that the control sequence directs or regulates the expression or cellular localization of the mRNA encoding the polypeptide, the polypeptide, and / or the functional RNA. Thus, a promoter is in operable linkage with a nucleic acid sequence if it can mediate transcription of the nucleic acid sequence. Operably linked elements can be contiguous or non-contiguous. In the context of a polypeptide, e.g. CAR, “operably linked” refers to a physical linkage (e.g. , directly or indirectly linked) between amino acid sequences (e.g., different domains) to provide for a described activity of the polypeptide. In the present disclosure, various domains of the polypeptides of the disclosure can be operably linked to retain proper folding, processing, targeting, expression, binding, and other functional properties of the polypeptides in the cell. Operably linked domains of the polypeptides of the disclosure can be contiguous or non-contiguous (e.g, linked to one another through a linker).

[0117] The term “percent identity” as used herein in the context of two or more nucleic acids or proteins, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acids that are the same (e.g., about 60% sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measuredusing a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection. See e.g., the NCBI web site at ncbi.nlm.nih.gov / BLAST. Such sequences are then said to be “substantially identical.” This definition also refers to, or can be applied to, the complement of a sequence. This definition also includes sequences that have deletions and / or additions, as well as those that have substitutions. Such modifications can occur naturally or synthetically. In some embodiments, sequence identity can be calculated over a region that is at least about 20 amino acids or nucleotides in length, or over a region that is 10-100 amino acids or nucleotides in length, or over the entire length of a given sequence. Sequence identity can be calculated using published techniques and widely available computer programs, such as the GCS program package (Devereux et al, Nucleic Acids Res. 12:387, 1984), BLASTP, BLASTN, FASTA (Atschul et al., J Mol Biol 215:403, 1990). In some embodiments, sequence identity can be measured using sequence analysis software such as the Sequence Analysis Software Package of the Genetics Computer Group at the University of Wisconsin Biotechnology Center (1710 University Avenue, Madison, Wis. 53705), with the default parameters thereof. Additional methodologies that can suitably be utilized to determine structural similarity or identity amino acid sequences include those relying on positionspecific structure-scoring matrix (P3SM) that incorporates structure-prediction scores from Rosetta, as well as those based on a length-normalized edit distance as described previously in, e.g., Setcliff etal., Cell Host & Microbe 23(6), May 2018.

[0118] The term “recombinant” nucleic acid molecule, polypeptide, and cell as used herein, refers to a nucleic acid molecule, polypeptide, and cell that has been altered through human intervention. As non-limiting examples, a recombinant nucleic acid molecule can be one which: (1) has been synthesized or modified in vitro, for example, using chemical or enzymatic techniques (for example, by use of chemical nucleic acid synthesis, or by use of enzymes for the replication, polymerization, exonucleolytic digestion, endonucleolytic digestion, ligation, reverse transcription, transcription, base modification (including, e.g., methylation), or recombination (including homologous and site-specific recombination) of nucleic acid molecules; (2) includes conjoined nucleotide sequences that are not conjoined in nature; (3) has been engineered using molecular cloning techniques such that it lacks one or more nucleotides with respect to the naturally occurring nucleic acid molecule sequence; and / or (4) has been manipulated using molecular cloning techniques such that it has one or more sequence changes or rearrangements with respect to the naturally occurring nucleic acidsequence. A non-limiting example of a recombinant protein is a chimeric antigen receptor provided herein.

[0119] As used herein, a “subject” or an “individual” includes animals, such as human (e.g., human subjects) and non-human animals. In some embodiments, a “subject” or “individual” is a patient under the care of a physician. Thus, the subject can be a human patient or an individual who has, is at risk of having, or is suspected of having a disease of interest (e.g, cancer) and / or one or more symptoms of the disease. The subject can also be an individual who is diagnosed with a risk of the condition of interest at the time of diagnosis or later. The term "non-human animals" includes all vertebrates, e.g, mammals, e.g, rodents, e.g, mice, and non- mammals, such as non-human primates, e.g., sheep, dogs, cows, chickens, amphibians, reptiles, etc.

[0120] The term "vector" is used herein to refer to a nucleic acid molecule or sequence capable of transferring or transporting another nucleic acid molecule. For example, a vector can be used as a gene delivery vehicle to transfer a gene into a cell. The transferred nucleic acid molecule is generally linked to, e.g., inserted into, the vector nucleic acid molecule. Generally, a vector is capable of replication when associated with the proper control elements. The term "vector" includes cloning vectors and expression vectors, as well as viral vectors and integrating vectors. An "expression vector" is a vector that includes a regulator}' region, thereby capable of expressing DNA sequences and fragments in vitro and / or in vivo. A vector can include sequences that direct autonomous replication in a cell, or can include sequences sufficient to allow integration into host cell DNA. Useful vectors include, for example, plasmids (e.g, DNA plasmids or RNA plasmids), transposons, cosmids, bacterial artificial chromosomes, and viral vectors. Useful viral vectors include, e.g., replication defective retroviruses and lentiviruses. In some embodiments, a vector is a gene delivery vector.|0121] It is understood that aspects and embodiments of the disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments. As used herein, “comprising” is synonymous with “including,” “containing,” or “characterized by,” and is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. As used herein, “consisting of’ excludes any elements, steps, or ingredients not specified in the claimed composition or method. As used herein, “consisting essentially of’ does not exclude materials or steps that do not materially affect the basic and novel characteristics of the claimed composition or method. Any recitation herein of the term “comprising,” particularly in a description of components of a composition or in a descriptionof steps of a method, is understood to encompass those compositions and methods consisting essentially of and consisting of the recited components or steps.

[0122] Headings, e.g., I, II, III etc. , are presented merely for ease of reading the specification and claims. The use of headings in the specification or claims does not require the steps or elements to be performed in alphabetical or numerical order or the order in which they are presented.

[0123] As will be understood by one having ordinary skill in the art, for any and all purposes, such as in terms of providing a written description, all ranges disclosed herein also encompass any and all possible sub-ranges and combinations of sub-ranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a nonlimiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like include the number recited and refer to ranges which can be subsequently broken down into sub-ranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 articles refers to groups having 1, 2, or 3 articles. Similarly, a group having 1-5 articles refers to groups having 1, 2, 3, 4, or 5 articles, and so forth.

[0124] Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number can be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. If the degree of approximation is not otherwise clear from the context, “about” means either within plus or minus 10% of the provided value, or rounded to the nearest significant figure, in all cases inclusive of the provided value. In some embodiments, the term “about” indicates the designated value ± up to 10%, up to ± 5%, or up to ± 1%.

[0125] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to the disclosureare specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed. In addition, all subcombinations of the various embodiments and elements thereof are also specifically embraced by the present disclosure and are disclosed herein just as if each and every such sub- combination was individually and explicitly disclosed herein.IL GENERAL EXPERIMENTAL PROCEDURES

[0126] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, cell biology, biochemistry, nucleic acid chemistry, and immunology, which are well known to those skilled in the art. Such techniques are explained fully in the literature, such as Sambrook, J., & Russell, D. W. (2012). Molecular Cloning: A Laboratory Manual (4th ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory and Sambrook, J., & Russel, D. W. (2001). Molecular Cloning: A Laboratory Manual (3rd ed.). Cold Spring Harbor, NY: Cold Spring Harbor Laboratory (jointly referred to herein as “Sambrook”); Ausubel, F. M. (1987). Current Protocols in Molecular Biology. New York, NY: Wiley (including supplements through 2014); Bollag, D. M. et al. (1996). Protein Methods. New York, NY: Wiley-Liss; Huang, L. et al. (2005). Nonviral Vectors for Gene Therapy. San Diego: Academic Press; Kaplitt, M. G. et al. (1995). Viral Vectors: Gene Therapy and Neuroscience Applications. San Diego, CA: Academic Press; Lefkovits, I. (1997). The Immunology Methods Manual: The ComprehensiveSourcebook of Techniques. San Diego, CA: Academic Press; Doyle, A. etal. (1998). Cell and Tissue Culture: Laboratory Procedures in Biotechnology. New York, NY: Wiley; Mullis, K. B., Ferre, F. & Gibbs, R. (1994). PCR: The Polymerase Chain Reaction. Boston: Birkhauser Publisher; Greenfield, E. A. (2014). Antibodies: A Laboratory Manual (2nd ed.). New? York, NY: Cold Spring Harbor Laboratory Press; Beaucage, S. L. et al. (2000). Current Protocols in Nucleic Acid Chemistry. New York, NY: Wiley, (including supplements through 2014); and Makrides, S. C. (2003). Gene Transfer and Expression in Mammalian Cells. Amsterdam, NL: Elsevier Sciences B.V., the disclosures of which are incorporated herein by reference. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and / or parameters unless otherwise noted.III. COMPOSITIONS OF THE DISCLOSURE

[0127] As described in greater detail below', one aspect of the present disclosure relates to novel chimeric polypeptides and CARs capable of binding a NECTIN4 antigen. In someembodiments, also provided are (i) recombinant nucleic acids encoding such CARs and / or chimeric polypeptides, (ii) recombinant cells that have been engineered to express a chimeric polypeptide or a CAR as disclosed herein, and are directed against a cell of interest, e.g, a cancer cell.A. Nectin Cell Adhesion Molecule 4 (NECTIN4)|0128] Nectin-4, also known as poliovirus receptor-related protein 4 (PVRL4), is a single pass type I transmembrane protein of about 52 kDa in size that belongs to the Nectin family of cellular adhesion molecules. Nectin-4 is a Ca2+ independent immunoglobulin-like protein. Along with other Nectins (Nectin-1, -2 and -3), it is primarily involved in cell-cell adhesion. In contrast to other Nectins, Nectin-4 is specifically enriched in the embryonic and placental tissues but its expression significantly declines in adult life. In recent years, it has been found that Nectin-4 is especially overexpressed and served as a tumor associated inducer in various malignant tumors including breast, lung, colorectal, pancreatic, ovarian cancers, etc. Overexpression of Nectin-4 is associated with various aspects of tumor progression like proliferation, angiogenesis, epithelial to mesenchymal transition, metastasis, DNA repair, tumor relapse, poor prognosis in several types of cancer.

[0129] Nectins mediate Ca2+-independent cell-cell adhesion at adherens junctions via both homophilic interaction where one Nectin-4 interacts with another Nectin-4, and heterophilic interactions where Nectin-4 interacts with another Nectin family protein such Nectin- 1, Nectin-2, orNectin-3. The extracellular domain of Nectin-4 has three Ig-like subdomains designated V, CI and C2. It has been shown that the CI domain in Nectin-2 is responsible for homophilic interactions, while V domains of most Nectin molecules contribute to heterophilic interactions and cell-cell adhesion. Nectins are expressed in various tissues, including, for example, hematopoietic, neuronal, endothelial, and epithelial cells.

[0130] Besides mediating cell-cell adhesions by homophilic interactions or heterophilic interactions with other Nectin family proteins, Nectins can recruit other cell adhesion molecules such as cadherins, or other cell surface receptors such as the prolactin receptor. By recruiting other cell surface receptors, Nectins can also serve as a stimulatory co-receptor and thus have a signaling function. For example, in the mouse mammary gland, Nectin-4 interacts with the prolactin receptor through its extracellular and transmembrane domain and binds to and sequesters suppressor-of-cytokinesignaling-1 (SOCS-1), which normally inhibits the kinase activity of the Janus Kinase-2 (JAK2), thereby enhancing prolactin induced JAK2activation and signaling. Nectins can also cooperate with cadhenns to induce and then rapidly suppress Rael activity during initial cell-cell adhesion.B. Chimeric Polypeptides and Chimeric Antigen Receptors (CARs) Targeting NECTIN4|0131] In one aspect, some embodiments disclosed herein relate to novel chimeric polypeptides and CAR) which targets NECTIN4. CAR T-cells utilize synthetic biology to equip T-cells with a receptor that recognizes cell-surface proteins on cancer. The chimeric polypeptides and CARs of the disclosure generally include an antigen-binding moiety capable of binding to aNECTIN4 polypeptide operably linked (e.g. , fused) to a TMD and an ICD. In some embodiments, the NECTIN4-targeting CAR of the disclosure, when expressed on the surface of an immune cell, e.g, T cells, can mediate binding of the target, activate the immune cell (e.g., T cells), and induce target cell killing.10132] Non-limiting examples ofNECTIN4 antigen-binding moieties suitable for the compositions and methods disclosed herein include an anti-NECTIN4 antibody, an anti- NECTIN4-Fab, an anti-NECTIN4-Fab’, an anti-NECTIN4-F(ab’)2, an anti-NECTIN4-Fv, an anti-NECTIN4-scFv, a biparatopic anti-NECTIN4-scFv, an anti-NECTIN4-dsFv, an anti- NECTIN4-minibody, an anti-NECTIN4-diabody, an anti-NECTIN4-tandem diabody, an anti- NECTIN4-triabody, an anti-NECTIN4-nanobody, an anti-NECTIN4-taFv, an anti- NECTIN4-VHH), an anti-NECTIN4-VNAR, an anti-NECTIN4-BiTE®, an anti-NECTIN4- BiTE®-like fragment, an anti-NECTIN4-DART®, and an anti-NECTIN4-alphabody®. In some embodiments, the antigen-binding moiety includes a heavy chain variable (VH) region and a light chain variable (VL) region. In some embodiments, the antigen-binding moiety includes an anti-NECTIN4 single-chain variable fragment (scFv).

[0133] The antigen-binding moiety can include naturally-occurring amino acid sequences or can be engineered, designed, or modified so as to provide desired and / or improved properties, e.g., binding affinity. Generally, binding affinity can be used as a measure of the strength of a non-covalent interaction between two molecules, e.g., an antigen-binding moiety and an antigen (e.g., NECTIN4 antigen). In some cases, binding affinity can be used to describe monovalent interactions (intrinsic activity)- Binding affinity between two molecules can be quantified by determination of the equilibrium dissociation constant (KD). In turn, KD can be determined by measurement of the kinetics of complex formation and dissociation using, e.g., the surface plasmon resonance (SPR) method (Biacore, Carterra, ForteBio). The rate constants corresponding to the association and the dissociation of amonovalent complex are referred to as the association rate constants ka(or kon) and dissociation rate constant ka (or koff), respectively. KD is related to kaand ka through the equation KD = ka / ka. The value of the dissociation constant can be determined directly by various methods, and can be computed even for complex mixtures by methods such as those set forth in Caceci et al. (1984, Byte 9: 340-362). For example, the KD can be established using a double-fdter nitrocellulose fdter binding assay such as that disclosed by Wong & Lohman (1993, Proc. Natl. Acad. Sci. USA 90: 5428- 5432).

[0134] Other assays to evaluate the binding ability (e.g., binding affinity and / or specificity) of the antigen-binding moiety of the present disclosure towards target antigens include, for example, ELISAs, Western blots, RIAs, and flow cytometry analysis. The binding kinetics and binding affinity of the antigen-binding moiety also can be assessed by standard assays known in the art, such as Surface Plasmon Resonance (SPR), e.g. by using a Biacore™ system, or KinExA. In some embodiments, the binding affinity of an antigen-binding moiety for a target antigen (e.g., NECTIN4 antigen) can be calculated by the Scatchard method described by Frankel etal.,Mol. Immunol, 16: 101-106, 1979. It will be understood that the binding affinity of an antigen-binding moiety for a target antigen is the strength of interaction between the antigen-binding moiety for a target antigen relates to the affinity to the target antigen relative to other antigens. It will also be understood that an antigen-binding moiety that “specifically binds” a target antigen (such as NECTIN4 antigen) is an antigen-binding fragment that binds the target antigen but does not significantly bind non-target antigens. In some embodiments, the antigen-binding moiety “specifically binds” a target antigen if it does not significantly bind other antigens (e.g., non-target antigens) but binds the target antigen with high affinity, e.g., with an equilibrium dissociation constant (KD) of 100 nM or less, such as 60 nM or less, for example, 30 nM or less, such as, 15 nM or less, or 10 nM or less, or 5 nM or less, or 1 nM or less, or 500 pM or less, or 400 pM or less, or 300 pM or less, or 200 pM or less, or 100 pM or less.

[0135] Implementations of embodiments of the NECTIN4-targeting CAR of the disclosure can include one or more of the following features. In some embodiments, the antigen-binding moiety with binding affinity for NECTIN4 includes: (a) heavy chain complementary determining regions (HCDRs) from the heavy chain variable (VH) domain selected from the group consisting of SEQ ID NOS: 1-6; and / or (b) light chain CDRs (LCDRs) from the light chain variable (VL) domain selected from the group consisting of SEQ ID NOS: 7-12.|0136] In some embodiments, the antigen-binding moiety with binding affinity for NECTIN4 includes: (a) HCDRs from the VH domain as set forth in SEQ ID NO: 1; and (b)LCDRs from the VL domain as set forth in SEQ ID NO: 7. In some embodiments, the antigen-binding moiety with binding affinity for NECTIN4 includes: (a) HCDRs from the VH domain as set forth in SEQ ID NO: 2; and (b) LCDRs from the VL domain as set forth in SEQ ID NO: 8. In some embodiments, the antigen-binding moiety with binding affinity for NECTIN4 includes: (a) HCDRs from the VH domain as set forth in SEQ ID NO: 3; and (b) all CDRs from the VL domain as set forth in SEQ ID NO: 9. In some embodiments, the antigen-binding moiety with binding affinity for NECTIN4 includes: (a) HCDRs from the VH domain as set forth in SEQ ID NO: 4; and (b) all CDRs from the VL domain as set forth in SEQ ID NO: 10. In some embodiments, the antigen-binding moiety with binding affinity for NECTIN4 includes: (a) HCDRs from the VH domain as set forth in SEQ ID NO: 5; and (b) all CDRs from the VL domain as set forth in SEQ ID NO: 11. In some embodiments, the antigen-binding moiety with binding affinity for NECTIN4 includes: (a) HCDRs from the VH domain as set forth in SEQ ID NO: 6; and (b) all CDRs from the VL domain as set forth in SEQ ID NO: 12.

[0137] In some embodiments, one amino acid residue in any one of the CDRs is optionally substituted by a different amino acid residue. In some embodiments, two amino acid residues in any one of the CDRs are optionally substituted by different amino acid residues. In some embodiments, three amino acid residues in any one of the CDRs are optionally substituted by different amino acid residues. In some embodiments, four amino acid residues in any one of the CDRs are optionally substituted by different amino acid residues. In some embodiments, five amino acid residues in any one of the CDRs are optionally substituted by different amino acid residues. In some embodiments, the amino acid substitution(s) can be a conservative amino acid substitution, for example at a non-essential ammo acid residue in the CDR sequence(s). A conservative amino acid substitution is understood to be one in which the original amino acid residue is substituted with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains are known in the art. These families include amino acids with basic side chains (e.g, lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g, glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), non-polar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), betabranched side chains (e.g. , threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).|0138] In some embodiments, the antigen-binding moiety includes (a) a VH domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identify to a VH domain selectedfrom the group consisting of SEQ ID NOS: 1-6, (b) and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a VL domain selected from the group consisting of SEQ ID NOS: 7-12. In some embodiments, the antigen-binding moiety comprises a VH domain and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively. In some embodiments, the antigen-binding moiety comprises a VH domain and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VH and VL sequences of SEQ ID NO: 2 and SEQ ID NO: 8, respectively. In some embodiments, the antigen-binding moiety comprises a VH domain and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively. In some embodiments, the antigen-binding moiety comprises a VH domain and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively. In some embodiments, the antigen-binding moiety comprises a VH domain and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VH and VL sequences of SEQ ID NO: 5 and SEQ ID NO: 11, respectively. In some embodiments, the antigen-binding moiety comprises a VH domain and a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively.

[0139] In some embodiments, the antigen-binding moiety includes (a) a VH domain having an ammo acid sequence selected from the group consisting of SEQ ID NOS: 1-6 and (b) a VL domain having an amino acid sequence selected from the group consisting of SEQ ID NOS: 7-12, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 2 and SEQ ID NO: 8, respectively, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively, and further wherein one, two,three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 5 and SEQ ID NO: 11, respectively, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.

[0140] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively, wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.

[0141] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 2 and SEQ ID NO: 8, respectively, wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid

[0142] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively, wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid|0143] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively, wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.

[0144] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 5 and SEQ ID NO: 11, respectively, wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.

[0145] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively, wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.|0146] In some embodiments, one amino acid residue in the VH domain and / or the VL domain is optionally substituted by a different amino acid residue. In some embodiments, two amino acid residues in the VH domain and / or the VL domain are optionally substituted by different amino acid residues. In some embodiments, three amino acid in the VH domain and / or the VL domain are optionally substituted by different amino acid residues. In some embodiments, four amino acid residues in the VH domain and / or the VL domain are optionally substituted by different amino acid residues. In some embodiments, five amino acid in the VH domain and / or the VL domain are optionally substituted by different amino acid residues. In some embodiments, the amino acid substitution(s) can be a conservative amino acid substitution, for example at a non-essential amino acid residue in the CDR sequence(s).

[0147] In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 2 and SEQ ID NO: 8, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 5 and SEQ ID NO: 11, respectively. In some embodiments, the antigen-binding moiety includes a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively.

[0148] In some embodiments, the antigen-binding moiety includes an anti-NECTIN4 single-chain variable fragment (scFv) wherein the VH domain is operably linked upstream to the VL domain (i.e. , C-terminus of the VH domain is linked to the N-terminus of the VL domain). In some embodiments, the anti-NECTIN4 scFv includes a VH domain and a VL domain, wherein the VH domain is operably linked downstream to the VL domain (i.e., N- terminus of the VH domain is linked to the C-terminus of the VL domain). As used herein, the term “upstream” in reference to an amino acid sequence refers to a location that is distalfrom a point of reference in an N-terminus to C-terminus direction of the amino acid sequence. Similarly, the term “downstream” refers to a location that is distal from a point of reference in a C-terminus to N-terminus direction of an amino acid sequence.

[0149] In some embodiments disclosed herein, the chimeric polypeptides of the disclosure further include a linker that is operably inserted between the VH domain and the VL domain. There is no particular limitations on the linkers that can be used in the chimeric polypeptides and CARs described herein. In some embodiments, the linker is a synthetic compound linker such as, for example, a chemical cross-linking agent. Non-limiting examples of suitable cross-linking agents that are commercially available include N- hydroxysuccinimide (NHS), disuccinimidylsuberate (DSS), bis(sulfosuccinimidyl)suberate (BS3), dithiobis(succinimidylpropi onate) (DSP), dithiobis(sulfosuccinimidylpropi onate) (DTSSP), ethyleneglycol bis(succinimidylsuccinate) (EGS), ethyleneglycol bis(sulfosuccinimidylsuccinate) (sulfo-EGS), disuccinimidyl tartrate (DST), disulfosuccinimidyl tartrate (sulfo-DST), bis[2-(succinimidooxy carbonyloxy )ethyl] sulfone (BSOCOES), and bis[2- (sulfosuccimmidooxycarbonyloxy)ethyl]sulfone (sulfo-BSOCOES). Other examples of alterative structures and linkages suitable for the chimeric polypeptides and CARs of the disclosure include those described in Spiess et al., Mol. Immunol. 67:95- 106, 2015.

[0150] In some embodiments, the linker includes a polypeptide linker (peptidal linkage). In some embodiments, the polypeptide linker comprising a single-chain polypeptide sequence comprising about one to 100 amino acid residues (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc. amino acid residues) can be used as a polypeptide linker. In some embodiments, the linker polypeptide sequence includes about 5 to 50, about 10 to 60, about 20 to 70, about 30 to 80, about 40 to 90, about 50 to 100, about 60 to 80, about 70 to 100, about 30 to 60, about 20 to 80, about 30 to 90 amino acid residues. In some embodiments, the linker polypeptide sequence includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25, about 20 to 40, about 30 to 50, about 40 to 60, about 50 to 70 amino acid residues. In some embodiments, the linker polypeptide sequence includes about 40 to 70, about 50 to 80, about 60 to 80, about 70 to 90, or about 80 to 100 amino acid residues. In some embodiments, the linker polypeptide sequence includes about 1 to 10, about 5 to 15, about 10 to 20, about 15 to 25 amino acid residues.

[0151] In some embodiments, the length and amino acid composition of the linker polypeptide sequence can be optimized to vary the orientation and / or proximity of the VH domain and the VL domain relative to one another to achieve a desired activity of thechimeric polypeptide or CAR. In some embodiments, the orientation and / or proximity' of the VH domain and the VL domain relative to one another can be varied as a “tuning” tool to achieve a tuning effect that would enhance or reduce the chimeric polypeptide functionality or CAR functionality. In certain embodiments, the linker contains only glycine and / or serine residues (e.g., glycine-serine linker). Examples of such polypeptide linkers include: Gly, Ser; Gly Ser; Gly Gly Ser; Ser Gly Gly; Gly Gly Gly Ser; Ser Gly Gly Gly; Gly Gly Gly Gly Ser; Ser Gly Gly Gly Gly; Gly Gly Gly Gly Gly Ser; Ser Gly Gly Gly Gly Gly; Gly Gly Gly Gly Gly Gly Ser; Ser Gly Gly Gly Gly Gly Gly; (Gly Gly Gly Gly Ser)n, wherein n is an integer of one or more; and (Ser Gly Gly Gly Gly)n, wherein n is an integer of one or more. In some embodiments, the polypeptide linkers are modified such that the amino acid sequence Gly Ser Gly (GSG) (that occurs at the junction of traditional Gly / Ser linker polypeptide repeats) is not present. For example, in some embodiments, the polypeptide linker includes an amino acid sequence selected from the group consisting of (GGGXX)nGGGGS and GGGGS(XGGGS)n, where X is any amino acid that can be inserted into the sequence and not result in a polypeptide comprising the sequence GSG, and n is 0 to 4. In some embodiments, the sequence of a polypeptide linker is (GGGXlX2)nGGGGS and XI is P and X2 is S and n is 0 to 4. In some embodiments, the sequence of a polypeptide linker is (GGGXlX2)nGGGGS and XI is G and X2 is Q and n is 0 to 4. In some other embodiments, the sequence of a polypeptide linker is (GGGXlX2)nGGGGS and XI is G and X2 is A and n is 0 to 4. In some embodiments, the sequence of a polypeptide linker isGGGGS(XGGGS)n, and X is P and n is 0 to 4. In some embodiments, a linker polypeptide of the disclosure comprises or consists of the amino acid sequence (GGGGA)2GGGGS. In some embodiments, a polypeptide linker comprises or consists of the amino acid sequence (GGGGQ)2GGGGS. In some embodiments, a polypeptide linker comprises or consists of the amino acid sequence (GGGPS)2GGGGS. In some embodiments, a polypeptide linker comprises or consists of the amino acid sequence GGGGS(PGGGS)2. In some embodiments, a polypeptide linker comprises or consists of the amino acid sequence (GGGS)? (SEQ ID NO: 13).

[0152] In some embodiments, the chimeric polypeptides disclosed herein further include an extracellular spacer region, which includes one or more intervening amino acid residues that are positioned between the ECD and the TMD. The term “spacer” generally refers to a flexible polypeptide connector region inserted between the targeting moiety and the TMD. These sequences are generally derived from CD3, CD4, CD8, CD28 and domains of IgG subclasses (such as IgGl and IgG4), or IgD domains. In some embodiments, the spacerprovides structural flexibility to flanking polypeptide regions. The spacer can consist of natural or synthetic polypeptides. It will be appreciated by those skilled in the art that spacers can improve the function of the CAR by promoting optimal positioning of the antigenbinding moiety in relationship to the portion of the antigen recognized by the same. It will be appreciated that, in some embodiments, the spacer may not be required for optimal CAR activity. In some embodiments, a beneficial spacer comprising a short sequence of amino acids promotes CAR activity by facilitating antigen-binding by, e.g., relieving any steric constraints that can otherwise alter binding kinetics. The sequence encoding the spacer can be positioned between the antigen recognition moiety and the TMD. In some embodiments, the spacer is operably linked downstream of the antigen-binding moiety and upstream of the TMD.

[0153] In some embodiments, the spacer includes an extracellular IgG4Fc (EQ) spacer, which is an IgG4-Fc spacer with 2-point mutations (L235E; N297Q) in the CH2 domain (EQ). In some embodiments, the spacer includes an amino acid sequence having at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence of SEQ ID NO: 14. In some embodiments, the spacer includes an amino acid sequence having 100% sequence identity to the amino acid sequence of SEQ ID NO: 14.

[0154] In some embodiments, the chimeric polypeptides disclosed herein further include a reporter polypeptide domain. In some embodiments, the reporter polypeptide domain includes a sequence for a reporter protein. In some embodiments, the reporter protein is selected from the group consisting of green fluorescent protein (GFP) gene, blue fluorescent protein (BFP) gene, yellow fluorescent protein (YFP) gene, luciferase gene, and mCherry gene. In some embodiments, the reporter protein includes an eGFP polypeptide.

[0155] In some embodiments, the chimeric polypeptide disclosed herein further include one or more autoproteolytic cleavage sequences. In some embodiments, the one or more autoproteolytic cleavage sequences are derived from Thosea asigna virus 2A (T2A), calciumdependent senne endoprotease (furin), porcine teschovirus-1 2A (P2A), foot-and-mouth disease vims (FMDV) 2A (F2A), Equine Rhinitis A Vims (ERAV) 2A (E2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), and / or Flacherie Vims 2A (BmIFV2A). In some embodiments, the chimeric polypeptides of the disclosure include a T2A autoproteolytic cleavage sequence operably positioned between the reporter polypeptide domain and the CD3UCD.|0156] In some embodiments, the ICD of the NECTIN4-targeting CAR disclosed herein includes a CD3^ ICD. In some embodiments of the disclosure, the NECTIN4-targeting CARincludes, in N-terminal to C-terminal direction, (a) an anti-NECTIN4 scFv domain; (b) an IgG4 (EQ) spacer; (c) a CD28 TMD; and (d) an ICD comprising a costimulatory domain derived from CD28 and a CD3^ domain.

[0157] In some embodiments, the chimeric polypeptides or NECTIN4-targeting CARs disclosed herein include one or more peptide tags for downstream capture and detection applications. In some embodiments, the one or more peptide tags includes Myc-tag, His-tag, FLAG-tag, HA tag, Strep tag or V5 tag, or a combination of any thereof. In some embodiments, the one or more peptide tags comprises or consists of a Myc-tag derived from the c-Myc protein.TABLE 1; This table provides a brief description for the exemplary 2ndgeneration CAR constructs described in the present disclosure, their corresponding components, as well as corresponding sequence identifiers. VH: heavy chain variable region; VL: light chain variable region; HCDR1, HCDR2, HCDR3: variable heavy chain CDR 1, 2 and 3; LCDR1, LCDR2, LCDR3: variable light chain CDR 1, 2 and 3; AA: amino acid sequence; DNA: nucleic acid sequence.

[0158] One skilled in the art will appreciate that the complete amino acid sequence of a chimeric polypeptide or CAR of the disclosure can be used to construct a back-translated gene. For example, a DNA oligomer containing a nucleotide sequence coding for a given chimeric polypeptide or CAR can be synthesized. For example, several small oligonucleotides coding for portions of the desired chimeric polypeptide or CAR can be synthesized and then ligated. The individual oligonucleotides typically contain 5' or 3' overhangs for complementary assembly.

[0159] In addition to generating desired chimeric polypeptides or CARs via expression of nucleic acid molecules that have been engineered by recombinant molecular biological techniques, a subject chimeric polypeptide or CAR in accordance with the present disclosure can be chemically synthesized. Chemically synthesized polypeptides are routinely generated by those of skill in the art.

[0160] Once assembled (by synthesis, recombinant methodologies, site-directed mutagenesis or other suitable techniques), the DNA sequences encoding a chimeric polypeptide or CAR as disclosed herein can be inserted into an expression vector and operably linked to an expression control sequence appropriate for expression of the chimeric polypeptide or CAR in the desired transformed host. Proper assembly can be confirmed by nucleotide sequencing, restriction mapping, and expression of a biologically active polypeptide in a suitable host. As is known in the art, in order to obtain high expression levels of a transfected gene in a host, take should be taken to ensure that the gene is operably linkedto transcriptional and translational expression control sequences that are functional in the chosen expression host.C. Nucleic Acid Molecules

[0161] In discussed above, a chimeric polypeptide or CAR described herein can be obtained by expression of a nucleic acid molecule. Accordingly, one aspect of the disclosure relates to a recombinant nucleic acid molecule including a nucleic acid sequence that encodes a chimeric polypeptide of the disclosure or a NECTIN4-targeting CAR as disclosed herein.

[0162] In some embodiments, the recombinant nucleic acids of the disclosure can be configured as expression cassettes or vectors containing these nucleic acid molecules operably linked to heterologous nucleic acid sequences such as, for example, regulatory sequences which allow in vivo expression of the receptor in a host cell.

[0163] Nucleic acid molecules of the present disclosure can be nucleic acid molecules of any length, including nucleic acid molecules that are generally between about 5 Kb and about 50 Kb, for example between about 5 Kb and about 40 Kb, between about 5 Kb and about 30 Kb, between about 5 Kb and about 20 Kb, or between about 10 Kb and about 50 Kb, for example between about 15 Kb to 30 Kb, between about 20 Kb and about 50 Kb, between about 20 Kb and about 40 Kb, about 5 Kb and about 25 Kb, or about 30 Kb and about 50 Kb.

[0164] In some embodiments, the recombinant nucleic acid molecule is operably linked to a heterologous nucleic acid sequence, such as, for example a regulatory sequence (e.g, promoter sequence) or a sequence encoding signal peptide. In some embodiments, the recombinant nucleic acid molecule is further configured as (e.g., incorporated into) an expression cassette or a vector. In some embodiments, the vector is a lentiviral vector, an adeno virus vector, an adeno-associated virus vector, a baculovirus, or a retroviral vector. In some embodiments, the vector is a lentiviral vector.

[0165] Some embodiments disclosed herein relate to vectors or expression cassettes including a recombinant nucleic acid molecule as disclosed herein. As used herein, the term “expression cassette” refers to a construct of genetic material that contains coding sequences and enough regulatory information to direct proper transcription and / or translation of the coding sequences in a recipient cell, in vivo and / or ex vivo. The expression cassette can be inserted into a vector for targeting to a desired host cell and / or into a subject. As such, the term expression cassette can be used to refer to an expression construct.

[0166] Also provided herein are vectors, plasmids or viruses containing one or more of the nucleic acid molecules encoding any of the chimeric polypeptides or NECTIN4-targetingCARs disclosed herein. The nucleic acid molecules described above can be contained within a vector that is capable of directing their expression in, for example, a cell that has been transformed / transduced with the vector. Suitable vectors for use in eukaryotic and prokaryotic cells are known in the art and are commercially available, or readily prepared by a skilled artisan. Additional vectors can also be found in, for example, Ausubel, F. M., et al. (2014, supra) and Sambrook et al. (2012, supra).

[0167] It should be understood that not all vectors and expression control sequences will function equally well to express the DNA sequences described herein. Neither will all hosts function equally well with the same expression system. However, one of skill in the art can make a selection among these vectors, expression control sequences and hosts without undue experimentation. For example, in selecting a vector, the host must be considered because the vector must replicate in it. The vector's copy number, the ability to control that copy number, and the expression of any other proteins encoded by the vector, such as antibiotic markers, should also be considered. For example, vectors that can be used include those that allow the DNA encoding the chimeric polypeptides or NECTIN4-targeting CARs of the present disclosure to be amplified in copy number. Such amplifiable vectors are known in the art.

[0168] Accordingly, in some embodiments, the chimeric polypeptides or NECTIN4- targeting CARs of the present disclosure can be expressed from vectors, generally expression vectors. The vectors are useful for autonomous replication in a host cell or can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome (e.g., non-episomal mammalian vectors). Expression vectors are capable of directing the expression of coding sequences to which they are operably linked. In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids (vectors). However, other forms of expression vectors, such as viral vectors (e.g, replication defective retroviruses, adenoviruses, and adeno-associated viruses) are also included.

[0169] Exemplary' recombinant expression vectors can include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, operably linked to the nucleic acid sequence to be expressed.

[0170] DNA vector can be introduced into prokaryotic or eukary otic cells via conventional transformation or transfection techniques. Suitable methods for transforming or transfecting host cells can be found in, for example, Sambrook et al. (2012) Molecular Cloning: A Laboratory Manual (2nd ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.) and other standard molecular biology laboratory manuals.

[0171] The nucleic acid sequences encoding the chimeric polypeptides or NECTIN4- targeting CARs of the present disclosure can be optimized for expression in the host cell of interest. For example, the G-C content of the sequence can be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. Methods for codon optimization are known in the art. Codon usages within the coding sequence of the chimeric polypeptides or NECTIN4-targeting CARs disclosed herein can be optimized to enhance expression in the host cell, such that about 1%, about 5%, about 10%, about 25%, about 50%, about 75%, or up to 100% of the codons within the coding sequence have been optimized for expression in a particular host cell.

[0172] Vectors suitable for use include T7-based vectors for use in bacteria, the pMSXND expression vector for use in mammalian cells, and baculovirus-derived vectors for use in insect cells. In some embodiments nucleic acid inserts, which encode the subject chimeric polypeptide or NECTIN4-targeting CAR in such vectors, can be operably linked to a promoter, which is selected based on, for example, the cell type in which expression is sought.

[0173] In selecting an expression control sequence, a variety of factors should also be considered. These include, for example, the relative strength of the sequence, its controllability, and its compatibility with the actual DNA sequence encoding the subject chimeric polypeptide or NECTIN4-targeting CAR, particularly as regards potential secondary' structures. Hosts should be selected by consideration of their compatibility with the chosen vector, the toxicity of the product coded for by the DNA sequences of this disclosure, their secretion characteristics, their ability to fold the polypeptides correctly, their fermentation or culture requirements, and the ease of purification of the products coded for by the DNA sequences.

[0174] Within these parameters one of skill in the art can select various vector / expression control sequence / host combinations that will express the desired DNA sequences on fermentation or in large scale animal cell culture, for example, using CHO cells or COS 7 cells.

[0175] The choice of expression control sequence and expression vector, in some embodiments, will depend upon the choice of host. A wide variety of expression host / vector combinations can be employed. Non-limiting examples of useful expression vectors for eukaryotic hosts, include, for example, vectors with expression control sequences from SV40, bovine papilloma virus, adenovirus and cytomegalovirus. Non-limiting examples of useful expression vectors for bacterial hosts include known bacterial plasmids, such as plasmidsfrom E. coli, including col El, pCRI, pER32z, pMB9 and their derivatives, wider host range plasmids, such as RP4, phage DNAs, e.g., the numerous derivatives of phage lambda, e.g, NM989, and other DNA phages, such as Ml 3 and filamentous single stranded DNA phages. Non-limiting examples of useful expression vectors for yeast cells include the 2p plasmid and derivatives thereof. Non-limiting examples of useful vectors for insect cells include pVL 941 and pFastBac™ 1.

[0176] A T7 promoter can be used in bacteria, a polyhedrin promoter can be used in insect cells, and a cytomegalovirus or metallothionein promoter can be used in mammalian cells. Also, in the case of higher eukaryotes, tissue-specific and cell type-specific promoters are widely available. These promoters are so named for their ability to direct expression of a nucleic acid molecule in a given tissue or cell type within the body. Skilled artisans will readily appreciate numerous promoters and other regulatory elements which can be used to direct expression of nucleic acids.

[0177] In addition to sequences that facilitate transcription of the inserted nucleic acid molecule, vectors can contain origins of replication, and other genes that encode a selectable marker. For example, the neomycin-resistance (neoR) gene imparts G418 resistance to cells in which it is expressed, and thus permits phenotypic selection of the transfected cells. Those of skill in the art can readily determine whether a given regulatory element or selectable marker is suitable for use in a particular experimental context.

[0178] Viral vectors that can be used in the disclosure include, for example, retroviral, adenoviral, and adeno-associated vectors, herpes virus, simian virus 40 (SV40), lentivirus, and bovine papilloma virus vectors (see, for example, Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, N.Y.).

[0179] Prokaryotic or eukaryotic cells that contain and express a nucleic acid molecule that encodes a subject CAR disclosed herein are also features of the disclosure. A cell of the disclosure is a transfected cell, e.g., a cell into which a nucleic acid molecule, for example a nucleic acid molecule encoding a chimeric polypeptide or NECTIN4-targeting CAR, has been introduced by means of recombinant DNA techniques. The progeny of such a cell are also considered within the scope of the disclosure.

[0180] Viral vectors that can be used in the disclosure include, for example, retrovirus vectors, adenovirus vectors, and adeno-associated virus vectors, lentivirus vectors, herpes virus, simian virus 40 (SV40), and bovine papilloma virus vectors (see, for example, Gluzman (Ed.), Eukaryotic Viral Vectors, CSH Laboratory Press, Cold Spring Harbor, N.Y.). For example, a chimeric polypeptide or NECTIN4-targeting CAR as disclosed herein can beproduced in a prokaryotic host, such as the bacterium E. colt, or in a eukaryotic host, such as an insect cell (e.g, an Sf21 cell), or mammalian cells (e.g, COS cells, NIH 3T3 cells, or HeLa cells). These cells are available from many sources, including the American Type Culture Collection (Manassas, Va.). In selecting an expression system, care should be taken to ensure that the components are compatible with one another. Artisans or ordinary skill are able to make such a determination. Furthermore, if guidance is required in selecting an expression system, skilled artisans can consult Ausubel et al. (Current Protocols in Molecular Biology, John Wiley and Sons, New York, N.Y., 1993) and Pouwels et al. (Cloning Vectors: A Laboratory Manual, 1985 Suppl. 1987).

[0181] The expressed chimeric polypeptides (e.g, CARs) can be purified from the expression system using routine biochemical procedures, and can be used, e g, as therapeutic agents, as described herein.|0182] In some embodiments, chimeric polypeptides or NECTIN4-targeting CARs obtained will be glycosylated or unglycosylated depending on the host organism used to produce the chimeric polypeptides or NECTIN4-targeting CARs. If bacteria are chosen as the host then the chimeric polypeptides or NECTIN4-targeting CARs produced will be unglycosylated. Eukaryotic cells, on the other hand, will glycosylate the chimeric polypeptides or NECTIN4-targeting CARs, although perhaps not in the same way as native polypeptides is glycosylated. The chimeric polypeptides or NECTIN4-targeting CARs produced by the transformed host can be purified according to any suitable methods known in the art. Produced chimeric polypeptides or NECTIN4-targeting CARs can be isolated from inclusion bodies generated in bacteria such as E. colt, or from conditioned medium from either mammalian or yeast cultures producing a given chimeric polypeptide or NECTIN4- targeting CAR using cation exchange, gel filtration, and or reverse phase liquid chromatography.|0183] In addition or alternatively, another exemplary method of constructing a DNA sequence encoding the chimeric polypeptides or NECTIN4-targeting CARs of the disclosure is by chemical synthesis. This includes direct synthesis of a peptide by chemical means of the protein sequence encoding for a chimeric polypeptide or NECTIN4-targeting CAR exhibiting the properties described. This method can incorporate both natural and unnatural amino acids at positions that affect the binding affinity of the chimeric polypeptide or NECTIN4-targeting CAR with the target protein (e.g, NECTIN4 polypeptide). Alternatively, a gene which encodes the desired chimeric polypeptide or NECTIN4-targeting CAR can be synthesized by chemical means using an oligonucleotide synthesizer. Such oligonucleotides are designedbased on the amino acid sequence of the desired chimeric polypeptide or NECTIN4-targeting CAR, and suitably selecting those codons that are favored in the host cell in which the recombinant chimeric polypeptides or NECTIN4-targeting CAR will be produced. In this regard, it is well recognized in the art that the genetic code is degenerate such that an amino acid can be coded for by more than one codon. Accordingly, it will be appreciated by those skilled in the art that for a given DNA sequence encoding a particular chimeric polypeptide or NECTIN4-targeting CAR, there will be many DNA degenerate sequences that will code for that chimeric polypeptide or NECTIN4-targeting CAR. For example, it will be appreciated that in addition to the DNA sequences for chimeric polypeptides and NECTIN4- targeting CARs provided in the specification, there will be many degenerate DNA sequences that code for the chimeric polypeptides and NECTIN4-targeting CARs disclosed herein. These degenerate DNA sequences are considered within the scope of this disclosure. Therefore, “degenerate variants thereof’ in the context of this disclosure means all DNA sequences that code for and thereby enable expression of a particular chimeric polypeptide or NECTIN4-targeting CAR.

[0184] The DNA sequence encoding the subject chimeric polypeptide or NECTIN4- targeting CAR, whether prepared by site directed mutagenesis, chemical synthesis or other methods, can also include DNA sequences that encode a signal sequence. Such signal sequence, if present, should be one recognized by the cell chosen for expression of the chimeric polypeptide or NECTIN4-targeting CAR. It can be prokaryotic, eukaryotic or a combination of the two. In general, the inclusion of a signal sequence depends on whether it is desired to secrete the chimeric polypeptide or NECTIN4-targeting CAR as disclosed herein from the recombinant cells in which it is made. If the chosen cells are prokaryotic, it generally is preferred that the DNA sequence not encode a signal sequence. If the chosen cells are eukaryotic, it generally is preferred that a signal sequence be included.|0185] The nucleic acid molecules provided can contain naturally occurring sequences, or sequences that differ from those that occur naturally, but, due to the degeneracy of the genetic code, encode the same polypeptide. These nucleic acid molecules can consist of RNA or DNA (for example, genomic DNA, cDNA, or synthetic DNA, such as that produced by phosphoramidite-based synthesis), or combinations or modifications of the nucleotides within these types of nucleic acids. In addition, the nucleic acid molecules can be double-stranded or single-stranded (e.g, either a sense or an antisense strand).|0186] The nucleic acid molecules are not limited to sequences that encode polypeptides; some or all of the non-coding sequences that he upstream or downstream from a codingsequence (e.g., the coding sequence of a chimeric polypeptide or CAR) can also be included. Those of ordinary skill in the art of molecular biology are familiar with routine procedures for isolating nucleic acid molecules. They can, for example, be generated by treatment of genomic DNA with restriction endonucleases, or by performance of the polymerase chain reaction (PCR). In the event the nucleic acid molecule is a ribonucleic acid (RNA), molecules can be produced, for example, by in vitro transcription.

[0187] Exemplary' isolated nucleic acid molecules of the present disclosure can include fragments not found as such in the natural state. Thus, this disclosure encompasses recombinant molecules, such as those in which a nucleic acid sequence (for example, a sequence chimeric polypeptide or CAR) is incorporated into a vector (e.g. , a plasmid or viral vector) or into the genome of a heterologous cell (or the genome of a homologous cell, at a position other than the natural chromosomal location).IV. RECOMBINANT CELLS AND CELL CULTURES

[0188] The nucleic acid molecule of the present disclosure can be introduced into a host cell, such as a human T cell or cancer cell, to produce a recombinant cell containing the nucleic acid molecule. Accordingly, some embodiments of the disclosure relate to methods for making a recombinant cell, including (a) providing a host cell capable of protein expression; and transducing the provided host cell with a recombinant nucleic acid of the disclosure to produce a recombinant cell. Introduction of the nucleic acid molecules of the disclosure into cells can be achieved by methods known to those skilled in the art such as, for example, viral infection, transfection, conjugation, protoplast fusion, hpofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI)- mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.

[0189] Accordingly, in some embodiments, the nucleic acid molecules can be introduced into a host cell by viral or non-viral delivery vehicles known in the art to produce a recombinant cell. For example, the nucleic acid molecule can be stably integrated in the host genome, or can be episomally replicating, or present in the recombinant host cell as a minicircle expression vector for a stable or transient expression. Accordingly, in some embodiments disclosed herein, the nucleic acid molecule is maintained and replicated in the recombinant host cell as an episomal unit. In some embodiments, the nucleic acid molecule is stably integrated into the genome of the recombinant cell. Stable integration can becompleted using classical random genomic recombination techniques or with more precise genome editing techniques such as using zine-finger proteins (ZNF), guide RNA directed CRISPR / Cas9, DNA-guided endonuclease genome editing NgAgo (Natronobacterium gregoryi Argonaute), or TALEN genome editing (transcription activator-hke effector nucleases).

[0190] The nucleic acid molecules can be encapsulated in a viral capsid or a lipid nanoparticle, or can be delivered by viral or non-viral delivery means and methods known in the art, such as electroporation. For example, introduction of nucleic acids into cells can be achieved by viral transduction. In anon-limiting example, baculoviral virus or adeno- associated virus (AAV) can be engineered to deliver nucleic acids to target cells via viral transduction. Several AAV serotypes have been described, and all of the known serotypes can infect cells from multiple diverse tissue types. AAV is capable of transducing a wide range of species and tissues in vivo with no evidence of toxicity, and it generates relatively mild innate and adaptive immune responses.

[0191] Lentiviral-derived vector systems are also useful for nucleic acid delivery and gene therapy via viral transduction. Lentiviral vectors offer several attractive properties as genedelivery vehicles, including: (i) sustained gene delivery through stable vector integration into host genome; (ii) the capability of infecting both dividing and non-dividing cells; (iii) broad tissue tropisms, including important gene- and cell-therapy-target cell types; (iv) no expression of viral proteins after vector transduction; (v) the ability to deliver complex genetic elements, such as polycistronic or intron-containing sequences; (vi) a potentially safer integration site profile; and (vii) a relatively easy system for vector manipulation and production.

[0192] In some embodiments, host cells can be genetically engineered (e.g., transduced or transformed or transfected) with, for example, a vector construct of the present application that can be, for example, a viral vector or a vector for homologous recombination that includes nucleic acid sequences homologous to a portion of the genome of the host cell, or can be an expression vector for the expression of the polypeptides of interest. Host cells can be either untransformed cells or cells that have already been transfected with at least one nucleic acid molecule.

[0193] In some embodiments, the recombinant cell is a prokaryotic cell or a eukaryotic cell. In some embodiments, the cell is in vivo. In some embodiments, the cell is ex vivo. In some embodiments, the cell is in vitro. In some embodiments, the recombinant cell is an animal cell. In some embodiments, the animal cell is a mammalian cell. In some embodiments, theanimal cell is a mouse cell. In some embodiments, the animal cell is a human cell. In some embodiments, the cell is a non-human primate cell. In some embodiments, the recombinant cell is an immune system cell, e.g., a B cell, a monocyte, aNK cell, a natural killer T (NKT) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (TH), a cytotoxic T cell (TCTL), a memory T cell, a gamma delta (yS) T cell, another T cell, a hematopoietic stem cell, or a hematopoietic stem cell progenitor.

[0194] In some embodiments, the immune system cell is a lymphocyte. In some embodiments, the lymphocyte is a T lymphocyte. In some embodiments, the lymphocyte is a T lymphocyte progenitor. In some embodiments, the T lymphocyte is a CD4+ T cell or a CD8+ T cell. In some embodiments, the T lymphocyte is a CD8+ T cytotoxic lymphocyte cell. Non-limiting examples of CD8+ T cytotoxic lymphocyte cell suitable for the compositions and methods disclosed herein include naive CD8+ T cells, central memory CD8+ T cells, effector memory CD8+ T cells, effector CD8+ T cells, CD8+ stem memory T cells, and bulk CD8+ T cells. In some embodiments, the T lymphocyte is a CD4+ T helper lymphocyte cell. Suitable CD4+ T helper lymphocyte cells include, but are not limited to, naive CD4+ T cells, central memory CD4+ T cells, effector memory CD4+ T cells, effector CD4+ T cells, CD4+ stem memory T cells, and bulk CD4+ T cells.

[0195] As outlined above, some embodiments of the disclosure relate to various methods for making a recombinant cell, including (a) providing a host cell capable of protein expression; and transducing the provided host cell with a recombinant nucleic acid of the disclosure to produce a recombinant cell. Non-limiting exemplary embodiments of the disclosed methods for making a recombinant cell can further include one or more of the following features. In some embodiments, the host cell is obtained by leukapheresis performed on a sample obtained from a subject, and the cell is transduced ex vivo. In some embodiments, the recombinant nucleic acid is encapsulated in a viral capsid or a lipid nanoparticle. In some embodiments, the methods further include isolating and / or purifying the produced cells. Accordingly, the recombinant cells produced by the methods disclosed herein are also within the scope of the disclosure.

[0196] Techniques for transforming a wide variety of the above-mentioned host cells and species are known in the art and described in the technical and scientific literature. For example, DNA vectors can be introduced into eukary otic cells via conventional transformation or transfection techniques. Suitable methods for transforming or transfecting cells can be found in Sambrook et al. (2012, supra) and other standard molecular biology laboratory manuals, such as, calcium phosphate transfection, DEAE-dextran mediatedtransfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction, nucleoporation, hydrodynamic shock, and infection. In some embodiments, the nucleic acid molecule is introduced into a host cell by a transduction procedure, electroporation procedure, or a biolistic procedure. Accordingly, cell cultures including at least one recombinant cell as disclosed herein are also within the scope of this application. Methods and systems suitable for generating and maintaining cell cultures are known in the art.

[0197] In one aspect, some embodiments of the disclosure relate to a recombinant cell including: (a) a CAR as described herein; and / or a nucleic acid molecule according as described herein.

[0198] In a related aspect, some embodiments of the disclosure relate to a cell culture including at least one recombinant cell as disclosed herein, and a culture medium. Generally, the culture medium can be any one of suitable culture media for the cell cultures described herein. In some embodiments, the recombinant cell expresses a chimeric polypeptide or NECTIN4-targeting CAR as described herein. Accordingly, cell cultures including at least one recombinant cell as disclosed herein are also within the scope of this application. Methods and systems suitable for generating and maintaining cell cultures are known in the art.V. PHARMACEUTICAL COMPOSITIONS

[0199] The chimeric polypeptides, CARs, nucleic acids, recombinant cells, and / or cell cultures of the disclosure can be incorporated into compositions, including pharmaceutical compositions. Such compositions generally include the chimeric polypeptides, CARs, nucleic acids, recombinant cells, and / or cell cultures as described herein and a pharmaceutically acceptable carrier. Accordingly, in one aspect, some embodiments of the disclosure relate to pharmaceutical compositions for treating, preventing, ameliorating, reducing or delaying the onset of health condition, for example a proliferative disease (e.g., cancer). In some embodiments, the pharmaceutical composition includes at least one chimeric polypeptide, CAR, nucleic acid, recombinant cell, and / or cell culture as disclosed herein, in an admixture with a pharmaceutically acceptable carrier, some embodiments of the disclosure relate to a pharmaceutical composition including a pharmaceutically acceptable carrier and one or more of the following: (a) a chimeric polypeptide of the disclosure; (b) a nucleic acid molecule of the disclosure; and (c) a recombinant cell of the disclosure. In some embodiments, the composition includes a recombinant nucleic acid of the disclosure and a pharmaceuticallyacceptable carrier. In some embodiments, the recombinant nucleic acid is encapsulated in a viral capsid or a lipid nanoparticle. In some embodiments, the composition includes a recombinant cell of the disclosure and a pharmaceutically acceptable carrier.

[0200] In certain embodiments, the pharmaceutical compositions in accordance with some embodiments disclosed herein include cell cultures that can be washed, treated, combined, supplemented, or otherwise altered prior to administration to an individual in need thereof. Furthermore, administration can be at varied doses, time intervals or in multiple administrations.

[0201] The pharmaceutical compositions provided herein can be in any form that allows for the composition to be administered to an individual. In some specific embodiments, the pharmaceutical compositions are suitable for human administration. As used herein, the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The carrier can be a diluent, adjuvant, excipient, or vehicle with which the pharmaceutical composition is administered. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, including injectable solutions. Suitable excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E.W. Martin. In some embodiments, the pharmaceutical composition is sterilely formulated for administration into an individual. In some embodiments, the individual is a human. One of ordinary skilled in the art will appreciate that the formulation should suit the mode of administration.

[0202] In some embodiments, the pharmaceutical compositions of the present disclosure are formulated to be suitable for the intended route of administration to an individual. For example, the pharmaceutical composition can be formulated to be suitable for one or more of the following administration routes: intranasal administration, transdermal administration, intrathecal administration, intraperitoneal administration, intramuscular administration, intratracheal administration, intranodal administration, intratumoral administration, intraarticular administration, intravenous administration, subcutaneous administration, intravaginal administration, intraocular administration, rectal administration, and oral administration. In some particular embodiments of the disclosure, the composition is formulated intramuscular administration.VI. METHODS OF THE DISCLOSURE

[0203] Administration of any one of the therapeutic compositions described herein, e.g, chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions, can be used in the treatment of relevant conditions, such as health disorders and proliferative diseases (e.g, cancer). In some embodiments, the chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions as described herein can be incorporated into therapeutic agents for use in methods of treating an individual who has, who is suspected of having, or who can be at high risk for developing one or more health conditions associated with NECTIN4, such as health disorders and proliferative diseases (e.g, cancers). In some embodiments, the individual is a patient under the care of a physician. In some embodiments, the proliferative is a cancer. In some embodiments, the cancer is a pediatric cancer. In some embodiments, the cancer is an adult malignancy.

[0204] In some embodiments, therapeutic agents described herein, e.g , chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions, can be used in methods of treating individual who have, who are suspected of having, or who can be at high risk for developing a cancer expressing the NECTIN4 antigen (e.g., aNECTIN4 -positive cancer). In some embodiments, the cancer overexpresses the NECTIN4 antigen. In some embodiments, the NECTIN4-positive cancer is breast cancer, bladder cancer, gastric cancer, pancreatic cancer, lung cancer, or ovarian cancer. In some embodiments, the NECTIN4 -positive cancer is a breast cancer. In some embodiments, the NECTIN4 -positive cancer is a bladder cancer. In some embodiments, the bladder cancer is a cancer with acquired resistance to enfortumab veduta (VE).

[0205] In some embodiments, the therapeutic agents described herein, e.g., chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions, can be used in methods of treating individual who have, who are suspected of having, or who can be at high risk for developing a NECTIN4-positive cancer which is a solid tumor cancer. In some embodiments, the solid tumor cell is lung cancer, liver cancer, pancreatic cancer, stomach cancer, colon cancer, kidney cancer, brain cancer, head and neck cancer, breast cancer, skin cancer, rectal cancer, uterine cancer, cervical cancer, ovarian cancer, testicular cancer, skin cancer, or esophageal cancer. In some embodiments, the cancer includes a sarcoma cell, a rhabdoid cancer cell, a neuroblastoma cell, retinoblastoma cell, or a medulloblastoma cell, lung cancer, liver cancer, pancreatic cancer, stomach cancer, colon cancer, kidney cancer, brain cancer, head and neck cancer, breast cancer, skin cancer, rectalcancer, uterine cancer, cervical cancer, ovarian cancer, testicular cancer, skin cancer, or esophageal cancer. In some embodiments, the administered composition inhibits tumor growth or metastasis of the NECTIN4 -positive cancer in the subject. In some embodiments, the NECTIN4-positive cancer includes a metastatic cancer cell, a multiply drug resistant cancer cell, or a recurrent cancer cell. In some embodiments, the cancer has elevated expression of NECTIN4.

[0206] Administration of therapeutic agents described herein, e.g., chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions, can be used in the stimulation of an immune response. In some embodiments, chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions as described herein are administered to an individual after induction of remission of cancer with chemotherapy, or after autologous or allogeneic hematopoietic stem cell transplantation.

[0207] An effective amount of the therapeutic agents described herein, e.g., chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions, is determined based on the intended goal, for example tumor regression. For example, where existing cancer is being treated, the amount of a therapeutic agent disclosed herein to be administered can be greater than where administration of the therapeutic agent is for prevention of cancer. One of ordinary skill in the art would be able to determine the amount of a therapeutic agent to be administered and the frequency of administration in view of this disclosure. The quantity to be administered, both according to number of treatments and dose, also depends on the individual to be treated, the state of the individual, and the protection desired. Precise amounts of the therapeutic agent also depend on the judgment of the practitioner and are peculiar to each individual. Frequency of administration could range from 1-2 days, to 2-6 hours, to 6-10 hours, to 1-2 weeks or longer depending on the judgment of the practitioner.

[0208] Longer intervals between administration and lower amounts of therapeutic agents can be employed where the goal is prevention. For instance, amounts of therapeutic agents administered per dose can be 50% of the dose administered in treatment of active disease, and administration can be at weekly intervals. One of ordinary skill in the art, in light of this disclosure, would be able to determine an effective amount of therapeutic agents and frequency of administration. This determination would, in part, be dependent on the particular clinical circumstances that are present e.g., type of cancer, severity of cancer).

[0209] In certain embodiments, it can be desirable to provide a continuous supply of the therapeutic agents to the subject to be treated, e.g., a patient. In some embodiments, continuous perfusion of the region of interest (such as the tumor) can be suitable. The time period for perfusion would be selected by the clinician for the particular subject and situation, but times could range from about 1-2 hours, to 2-6 hours, to about 6-10 hours, to about 10-24 hours, to about 1-2 days, to about 1-2 weeks or longer. Generally, the dose of the therapeutic agent via continuous perfusion will be equivalent to that given by single or multiple injections, adjusted for the period of time over which the doses are administered.

[0210] One of ordinary skill in the art would be familiar with techniques for administering therapeutic agents to an individual. Furthermore, one of ordinary' skill in the art would be familiar with techniques and pharmaceutical reagents necessary for preparation of these therapeutic agents prior to administration to an individual.|0211] In certain embodiments of the present disclosure, the therapeutic agents will be an aqueous composition that includes the chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions as described herein. Aqueous compositions of the present disclosure contain an effective amount of a therapeutic agent disclosed herein in a pharmaceutically acceptable carrier or aqueous medium. Thus, the “pharmaceutical preparation” or “pharmaceutical composition” of the disclosure can include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the recombinant cells disclosed herein, its use in the manufacture of the pharmaceutical compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions. For human administration, preparations should meet sterility, pyrogenicity, general safety, and purity standards as required by the FDA Center for Biologies.

[0212] One of ordinary skill in the art would appreciate that biological materials should be extensively dialyzed to remove undesired small molecular weight molecules and / or lyophilized for more ready formulation into a desired vehicle, where appropriate. The therapeutic agents described herein, e.g., chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions, will then generally be formulated for administration by any known route, such as parenteral administration. Determination of the amount of therapeutic agents to be administered will be made by one of skill in the art, and will in part be dependent on the extent and severity of cancer, and whetherthe recombinant cells are being administered for treatment of existing cancer or prevention of cancer. The preparation of the therapeutic agents containing the chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions of the disclosure will be known to those of skill in the art in light of the present disclosure.|0213] Upon formulation, therapeutic agents will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The therapeutic agents can be administered in a variety of dosage forms, such as the type of injectable solutions described above. For parenteral administration, the therapeutic agents disclosed herein should be suitably buffered. As discussed in greater detail below, the therapeutic agents as described herein can be administered with other therapeutic agents that are part of the therapeutic regiment of the individual, such as other immunotherapy or chemotherapy.|0214] The chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions described herein can be used to cure established tumors, inhibit tumor growth or metastasis of the NECTIN4-positive cancer in the treated subject relative to the tumor growth or metastasis in subjects who have not been administered one of the therapeutic compositions disclosed herein. In some embodiments, the chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions described herein can be used to stimulate proliferation and / or killing capacity of CAR T-cells in the treated subject relative to subjects who have not been administered one of the therapeutic compositions disclosed herein.A. Administration of recombinant cells to a subject

[0215] In some embodiments, the methods of the disclosure involve administering an effective amount or number of the recombinant cells provided herein to a subject in need thereof. This administering step can be accomplished using any method of implantation delivery in the art. For example, the recombinant cells can be infused directly in the subject’s bloodstream or otherwise administered to the subject.

[0216] In some embodiments, the methods disclosed herein include administering, which term is used interchangeably with the terms “introducing,” implanting,” and “transplanting,” recombinant cells into an individual, by a method or route that results in at least partial localization of the introduced cells at a desired site such that a desired effect(s) is / are produced. The recombinant cells or their differentiated progeny can be administered by any appropriate route that results in delivery to a desired location in the individual where at least aportion of the administered cells or components of the cells remain viable. The period of viability of the cells after administration to a subject can be as short as a few hours, e.g. , twenty -four hours, to a few days, to as long as several years, or even the lifetime of the individual, i.e., long-term engraftment.|0217] When provided prophylactically, the recombinant cells described herein can be administered to a subject in advance of any symptom of a disease or condition to be treated. Accordingly, in some embodiments the prophylactic administration of a recombinant cell population prevents the occurrence of symptoms of the disease or condition.

[0218] When provided therapeutically in some embodiments, recombinant cells are provided at (or after) the onset of a symptom or indication of a disease or condition, e.g., upon the onset of disease or condition.

[0219] For use in the various embodiments described herein, an effective amount of recombinant cells as disclosed herein, can be at least 102cells, at least 5 x 102cells, at least 103cells, at least 5 x 103cells, at least 104cells, at least 5 x io4cells, at least 105cells, at least 2 x 105cells, at least 3 x 105cells, at least 4 x 105cells, at least 5 x 105cells, at least 6 x 105cells, at least 7 x 105cells, at least 8 x 105cells, at least 9 x 105cells, at least 1 x 106cells, at least 2 x 106cells, at least 3 x io6cells, at least 4 x 106cells, at least 5 x io6cells, at least 6 x 106cells, at least 7 x 106cells, at least 8 x 106cells, at least 9 106cells, or multiples thereof. The recombinant cells can be derived from one or more donors or can be obtained from an autologous source. In some embodiments, the recombinant cells are expanded in culture prior to administration to a subject in need thereof.

[0220] In some embodiments, the delivery of a recombinant cell composition (e.g. , a composition including a plurality of recombinant cells according to any of the cells described herein) into a subject by a method or route results in at least partial localization of the cell composition at a desired site. A composition including recombinant cells can be administered by any appropriate route that results in effective treatment in the subject, e.g., administration results in delivery to a desired location in the subject where at least a portion of the composition delivered, e.g., at least 1 x 104cells, is delivered to the desired site for a period of time. Modes of administration include injection, infusion, and instillation. “Injection” includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, intracerebrospinal, and intrastemal injection and infusion. In some embodiments,the route is intravenous. For the delivery of cells, delivery by injection or infusion is a standard mode of administration.

[0221] In some embodiments, the recombinant cells are administered systemically, e.g., via infusion or injection. For example, a population of recombinant cells are administered other than directly into a target site, tissue, or organ, such that it enters, the subject’s circulatory system and, thus, is subject to metabolism and other similar biological processes.

[0222] The efficacy of a treatment including any of the compositions provided herein for the treatment of a disease or condition can be determined by a skilled clinician. However, one skilled in the art will appreciate that a treatment is considered effective if any one or all of the signs or symptoms or markers of disease are improved or ameliorated. Efficacy can also be measured by failure of a subject to worsen as assessed by decreased hospitalization or need for medical interventions (e.g. , progression of the disease is halted or at least slowed). Methods of measuring these indicators are known to those of skill in the art and / or described herein. Treatment includes any treatment of a disease in a subject or an animal (some nonlimiting examples include a human, or a mammal) and includes: (1) inhibiting the disease, e.g., arresting, or slowing the progression of symptoms; or (2) relieving the disease, e.g., causing regression of symptoms; and (3) preventing or reducing the likelihood of the development of symptoms.

[0223] Measurement of the degree of efficacy is based on parameters selected with regard to the disease being treated and the symptoms experienced. In general, a parameter is selected that is known or accepted as correlating with the degree or severity of the disease, such as a parameter accepted or used in the medical community. For example, in the treatment of a solid cancer, suitable parameters can include reduction in the number and / or size of metastases, number of months of progression-free survival, overall survival, stage or grade of the disease, the rate of disease progression, the reduction in diagnostic biomarkers (for example without limitation, a reduction in circulating tumor DNA or RNA, a reduction in circulating cell-free tumor DNA or RNA, and the like), and combinations thereof. It will be understood that the effective dose and the degree of efficacy will generally be determined with relation to a single subject and / or a group or population of subjects. Therapeutic methods of the disclosure reduce symptoms and / or disease severity and / or disease biomarkers by at least about 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98, 99, or 100%.10224] As discussed above, a therapeutically effective amount includes an amount of a therapeutic composition that is sufficient to promote a particular beneficial effect whenadministered to a subject, such as one who has, is suspected of having, or is at risk for a disease. In some embodiments, an effective amount includes an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom of the disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. It is understood that for any given case, an appropriate effective amount can be determined by one of ordinary skill in the art using routine experimentation.B. Additional therapies

[0225] As discussed supra, any one of the chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions described herein can be administered to a subject in need thereof as a sole therapy (e.g, monotherapy). In addition or alternatively, in some embodiments of the disclosure, the chimeric polypeptides, CARs, nucleic acids, recombinant cells, cell cultures, and / or pharmaceutical compositions described herein can be administered to a subject in combination with one or more additional therapeutic agents, e.g., at least one, two, three, four, or five additional therapies. Suitable therapies to be administered in combination with the compositions of the disclosure include, but are not limited to chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, targeted therapy, and surgery. Other suitable therapies include chemotherapeutics, anti-cancer agents, and anti-cancer therapies.

[0226] Administration “in combination with” one or more additional therapeutic includes simultaneous (e.g, concurrent) and consecutive administration in any order. In some embodiments, the one or more additional therapies is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, and surgery.

[0227] Accordingly, in some embodiments, the methods of the disclosure include administration of a composition disclosed herein to a subject individually as a sole therapy (e.g, monotherapy). In some embodiments, a composition of the disclosure is administered to a subject as a first therapy in combination with a second therapy, such as an anti-cancer agent, a chemotherapeutic, or an anti-cancer therapy. In some embodiments, the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxin therapy, and surgery. In some embodiments, the first therapy and the second therapy are administered concomitantly. In some embodiments, the first therapy and the second therapy are administered sequentially. In some embodiments, the first therapy is administered before the second therapy. In some embodiments, the first therapy isadministered before and / or after the second therapy. In some embodiments, the first therapy and the second therapy are administered in rotation. In some embodiments, the first therapy is administered at the same time as the second therapy. In some embodiments, the first therapy and the second therapy are administered together in a single formulation.|0228] In some embodiments, the second therapy includes an anti-diabetic drug. In some embodiments, the anti-diabetic drug includes thiazolidinedione and / or rosiglitazone. In some embodiments, the second therapy includes an agonist of peroxisome proliferator-activated receptor gamma (PPARy agonist). In some embodiments, the PPARy agonist comprises rosiglitazone.VII. KITS

[0229] Also provided herein are various kits for the practice of a method described herein. In particular, some embodiments of the disclosure provide kits for the prevention of a health condition in a subject in need thereof. Some other embodiments relate to kits for methods of treating a health condition in a subject in need thereof. For example, provided herein, in some embodiments, are kits that include one or more of the chimeric polypeptides (e.g, CARs), recombinant nucleic acids, recombinant cells, and / or pharmaceutical compositions as provided and described herein, as well as written instructions for making and using the same.

[0230] In some embodiments, the kits of the disclosure further include one or more means useful for the administration of any one of the provided chimeric polypeptides (e.g, CARs), recombinant nucleic acids, recombinant cells, or pharmaceutical compositions to an individual. For example, in some embodiments, the kits of the disclosure further include one or more syringes (including pre-filled syringes) and / or catheters (including pre-filled syringes) used to administer any one of the provided chimeric polypeptides (e g., CARs), recombinant nucleic acids, recombinant cells, or pharmaceutical compositions to an individual. In some embodiments, a kit can have one or more additional therapeutic agents that can be administered simultaneously or sequentially with the other kit components for a desired purpose, e.g. , for preventing and / or treating a health condition in a subject in need thereof.

[0231] Any of the above-described kits can further include one or more additional reagents, where such additional reagents can be one or more of the following: dilution buffers; reconstitution solutions, wash buffers, control reagents, control expression vectors, negative control polypeptides, positive control polypeptides, reagents suitable for in vitro or ex vivo production of the CARs.

[0232] In some embodiments, the components of a kit can be in separate containers. In some other embodiments, the components of a kit can be combined in a single container.

[0233] In some embodiments, a kit can further include instructions for using the components of the kit to practice the methods disclosed herein. The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate, such as paper or plastic, etc. The instructions can be present in the kit as a package insert, in the labeling of the container of the kit or components thereof (e.g., associated with the packaging or sub-packaging), etc. The instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g. CD-ROM, diskette, flash drive, etc. In some instances, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g., via the internet), can be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

[0234] Unless otherwise defined, all terms of art, notations and other scientific terms or terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this disclosure pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. Many of the techniques and procedures described or referenced herein are well understood and commonly employed using conventional methodology by those skilled in the art.

[0235] No admission is made that any reference cited herein constitutes prior art. The discussion of the references states what their authors assert, and the inventors reserve the right to challenge the accuracy and pertinence of the cited documents. It will be clearly understood that, although a number of information sources, including scientific journal articles, patent documents, and textbooks, are referred to herein; this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.

[0236] The discussion of the general methods given herein is intended for illustrative purposes only. Other alternative methods and alternatives will be apparent to those of skill in the art upon review of this disclosure, and are to be included within the spirit and purview of this application.EXAMPLES

[0237] Additional embodiments are disclosed in further detail in the following examples, which are provided by way of illustration and are not in any way intended to limit the scope of this disclosure or the claims.

[0238] As described in greater detail in the Examples below, an exemplary NECTIN4- targeting CAR T cell therapy has been demonstrated to be highly antigen-specific and possesses antitumor activity against multiple bladder cancer models, including EV resistant cells. It was observed that modulating the PPARy pathway increases NECTIN4 expression, which was subsequently leveraged by repurposing an FDA-approved anti-diabetes drug rosiglitazone to increase targeting and anti-tumor efficacy of NECTIN4-CAR T cells. Taken together, these preclinical results lay the groundwork for CAR T therapy development in bladder cancer, and suggest rational drug combinations that can expand the therapeutic window of NECTIN4-targeting therapies.EXAMPLE 1. Development of 2ndgeneration CAR constructs against NECTIN4 (N4- CAR)

[0239] This Example describes the development of 2ndgeneration CAR constructs against NECTIN4 (N4-CAR).

[0240] As illustrated in FIGS. 1A-1G, NECTIN4-targeting scFv sequences derived from human anti-nectin-4 monoclonal antibodies and were cloned into the BamHI site of a 28z CAR backbone. The heavy (VH) and light (VL) chains sequences were cloned in two configurations (VH-VL and VL-VH) into the CAR backbone plasmid using Gibson Assembly® protocol according to manufacturer’s instructions and lentivirus generated as below. For Lentivirus production: HEK293T-Lenti-X cells (Takara Bio) were thawed, cultured, and expanded in DMEM media supplemented with 10% FBS. HEK293T-Lenti-X cells were transfected with either the NECTIN4 CAR or the NECTIN4-V5 overexpression lentiviral plasmid and the packaging plasmids psPAX2 and pVSVG using TransIT-LTl transfection reagent (Mirus Bio) or calcium phosphate buffer. Cell supernatant was collected at 48 hours and 72h. The virus was filtered and concentrated using the Lenti-X Concentrator (Takara Bio) according to manufacturer’s instructions and resuspended in serum-free media.Human NECTIN4-CAR T cell production

[0241] Human T cells were previously isolated from a Leukopak (Stemcell Technologies) using the EasySep Human CD3+ T Cell Isolation Kit and grown in either ImmunoCult-XF T Cell Expansion Medium (Stemcell Technologies, 01981) or TexMACS™ Medium (Miltenyi Biotech, 130-097-196). Base media was supplemented with human recombinant IL-15 (Stemcell Technologies, 78031) and IL-7 (Stemcell Technologies, 78053) at 10 ng / ml. T cells were then plated on retronectin coated plates (Takara, T100 A), stimulated with Human CD3 / CD28 T Cell Activator (Stemcell Technologies, 10971) per million cells, and concentrated lentivirus was added. Cells with virus were spun at lOOOrpm for 45 minutes. After 72 hours of incubation, virus was removed and cells were allowed to recover for 2-3 days. Transduction efficiency was evaluated via flow cytometry for GFP. If transduction efficiency was <40% based on GFP positivity, T cells were sorted by FACS (BD Aria) or MACs sorted using a biotinylated c-myc antibody (Miltenyi Biotec, 130-124-877) and isolated using the MiniMACS separator and columns (Miltenyi) according to manufacturer’s protocol.. CAR T cells were counted every 2-3 days and maintained at a density of 106cells / ml of media. CAR T cells were expanded up until day 20 following activation. The nontransduced (NTD) T cells were not exposed to lentiviral supernatant and did not undergo spinoculation. Otherwise, the NTD T cells were stimulated and expanded in the same manner as the CAR T cells. Activated and expanded T cells were frozen using Cytiva Hy clone 2X (Fisher) and stored at -80°C. T cells were thawed into media supplemented with IL-15 and IL-7 per above and recovered for 1 day before in vitro or in vivo antitumor experiments. Immunophenotyping of CAR T cells was verified by flow cytometry using fluorescently- labeled antibodies to CD3, CD4, and CD8 (all from BD Biosciences).Incucyte Co-culture Assays

[0242] Cancer cells labeled with NucLightRed (Sartorius) were transduced according to manufacturer’s instructions, and isolated using puromycin (2pg / ml) or by FACS (BD Fusion). NucLightRed labeled cells were then co-cultured with human non-transduced (NTD) T cells or NECTIN4-CAR T cells at variable effector-to-target (E:T) ratios. On day 0, 2000- 5000 target cells were plated and allowed to adhere overnight. On day 1, effector T cells were added and tumor cell killing was monitored on an IncuCyte S3 (Sartorius). Images were obtained every 3-6 hours over 72-96 hours, and target cells were quantified based on the red object count or red area confluence, normalized to the starting day 1 values, and plotted on Prism (GraphPad, vlO).NECTIN4 Knockout Cells

[0243] For generating RT112 and UMUC-9 NECTIN4 KOs, parental RT112 or UMUC-9 cells transfected (Lipofectamine 3000) with PX458 (Addgene, #48138) containing one of the following sgRNA targeting sequences: (1) 5’-CATGTGAGCCCGGCTTACGA; (2) 5’- CCAGCTCACCCGCGGGGCAC or a scramble sgRNA (as control). 48-72 h after transfection, GFP-positive cells were sorted by FACS (BD Fusion) and expanded. Cells were then stained with aNECTIN4 antibody (Miltenyi, clone REA967, 1 :100), sorted a second time by FACS (BD Fusion), and negative cells were collected and expanded. Knockout was validated by WB and by surface protein staining and flow cytometry using the NECTIN4 antibody (Miltenyi, clone REA967, 1: 100).Surface protein staining

[0244] Adherent cells were trypsinized and washed, and then incubated with anti- NECTIN4 PE antibody or anti-NECTIN4 VioBright V423 (Miltenyi Biotec, clone REA9671 : 100) for 30-60 minutes on ice. Cells were analyzed using an Attune NxT Flow Cytometer and the median fluorescence intensity (MFI) was calculated and data were analyzed using FlowJo software.

[0245] The results described in this Example demonstrate that second-generation CD28 chimeric antigen receptor (CAR) targeting NECTIN4 can be successfully developed, and that its killing activity is dependent on NECTIN4-expression, since the NECTIN4 KO cannot be targeted with the NECTIN4 CAR.EXAMPLE 2. N4-CAR activity is correlated with NECTIN4 expression

[0246] This Example describes experiments performed to demonstrate that NECTIN4 CAR activity is correlated with NECTIN4 expression in cancer cells.

[0247] In these experiments, as shown in FIGS. 2A-2C, N4-CAR activity was found to be correlated with NECTIN4 expression. For western blotting, cells were lysed in RIPA buffer containing Halt protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific). Lysates were subjected to SDS-PAGE, transferred to PVDF membranes, blocked in 5% w / v BSA, and incubated with primary antibody overnight. The next day, Horseradish Peroxidase (HRP) conjugated secondary antibodies were used. The blot was visualized using ECL Detection Reagents after 24h (Genesee Scientific). Antibodies against GAPDH (Cell Signaling Technology), NECTIN4 (Abeam), PPARy (Cell Signaling Technology), HRP-anti- rabbit (Cell Signaling Technology) were used according to manufacturer’s recommended dilutions. The co-culture assays were performed as above. The scatter plot was plotted bycalculating the kill index (1 / AUC) and plotted against the relative NECTIN4 levels as determined by western blot in FIG. 2A.

[0248] The results described in this Example demonstrate that NECTIN4 CAR activity is correlated with NECTIN4 expression in cancer cells.EXAMPLE 3. NECTIN4 expression is sufficient to trigger N4-CAR T kill|0249] This Example describes experiments performed to demonstrate that NECTIN4 expression in cancer cells is sufficient to trigger NECTIN4 CAR T kill.

[0250] In these experiments, as shown in FIGS. 3A-3C, NECTIN4 expression was found to be sufficient to trigger N4-CAR kill. Western blot for UMUC3 and UMUC3-NECTIN4 overexpressing cells was performed as above. For generating NECTIN4 overexpressing cells, the NECTIN4 open reading frame (Horizon, clone ID 100006134) was cloned into lentiviral vectors pCMV-V5-Blast (Addgene) using Gateway cloning protocols (Thermo Fisher Scientific). Lentivirus was generated as above and cells were transduced with concentrated virus for 3 days, and then selected in blasticidin (3-5 pg / ml) for at least 5 days. Overexpression was validated by WB and by surface protein staining and flow cytometry using the NECTIN4 antibody (Miltenyi, clone REA967, 1:100). The co-culture assays were performed as described above in Example 1.|0251] The results described in this Example demonstrate that NECTIN4 expression is sufficient to trigger NECTIN4 CAR T kill.EXAMPLE 4. NECTIN4 is heterogeneously expressed in bladder cancer

[0252] This Example describes experiments performed to demonstrate that NECTIN4 is heterogeneously expressed in bladder cancer.

[0253] In these experiments, as shown in FIGS. 4A-4B and 5, NECTIN4 was found to be heterologously expressed in bladder cancer. Immunohistochemistry was performed using an anti-NECTIN4 antibody (abeam) using a bladder cancer tissue microarray comprised of muscle-invasive bladder cancer, and developed using standard protocols utilizing DAB. Examples are shown in FIG. 4A. In FIG. 4B, the H-score for NECTIN4 expression was performed blindly by a pathologist and plotted using GraphPad Prism, and separated by the known molecular subtype of each bladder cancer specimen on the tissue microarray. In FIG.5, the expression levels of GATA3, FOXA1 and PPARG are plotted against NECTIN4 expression using the Decipher cohort of bladder cancer. The Pearson correlation and p valueare shown for each graph in the bottom right, and broken by molecular subtype as indicated in the figure.

[0254] The results described in this Example indicate that NECTIN4 is heterogeneously expressed in muscle-invasive bladder cancer, i.e., NECTIN4 is not homogeneously expressed in all bladder cancer.EXAMPLE 5. PPARy agonists increase NECTIN4 expression while PPARy inhibition decreases NECTIN4 expression

[0255] This Example describes experiments performed to demonstrate that PPARy agonists increase NECTIN4 expression while PPARy inhibition decreases NECTIN4|0256] In these experiments, as shown in FIGS. 6A-6D, PPARy agonists were observed to increase NECTIN4 expression. Cells were treated for 48 to 72 hours with indicated concentrations of rosiglitazone (MedChemExpress). Dimethyl sulfoxide (DMSO) was used as the vehicle. Rosiglitazone at the indicated concentrations was added to standard complete MEM medium containing 10% FBS and 1% penicillin / streptomycin, up to a maximum of 1pm. Drug-containing media was aspirated and cells were washed with D-PBS and then cells were trypsinized and collected for western blot or flow cytometry as above. Protein quantification was performed using ImageJ. Flow cytometry histograms were generated using FlowJo software. As shown in FIG. 7, PPARy inhibition was observed to decrease NECTIN4 expression. Using both genetic and chemical perturbations, the data described herein suggest that PPARy directly controls expression of NECTIN4 in bladder cancer cell lines.

[0257] The results described in this Example indicate that using both genetic and chemical perturbations, the data described herein demonstrate that PPARy directly controls expression of NECTIN4 in bladder cancer cell lines, which can be leveraged to improve the therapeutic efficacy of NECTIN4-targeting therapeutics.EXAMPLE 6. PPARy agonists improve N4-CAR mediated kill

[0258] This Example describes experiments performed to demonstrate that PPARy agonists improve N4-CAR mediated kill of cancer cells.

[0259] In these experiments, as shown in FIGS. 8A-8H, PPARy agonists were observed to improve N4-CAR mediated kill. Indicated cells were pre-treated with either DMSO or rosiglitazone, and then plated. NECTIN4 CAR T cells were then added and nuclei count was monitored using an Incucyte, as described above for the co-culture assays. The kill indicesare plotted as shown. To assess T cell activation based on IFNy release, 96-well plates with co-cultures described above were centrifuged and 25-50 pl of co-culture supernatants were collected at 24 and / or 48 h of co-culture and stored at -80 °C. Samples were thawed and analyzed by sandwich ELISA for IFNy using the BD Human IFN-gamma ELISA Set (BD Biosciences, 555142) according to the manufacturer’s protocol. Plates were read at 450 nm and 570 nm wavelengths using a Biotek Synergy plate reader.

[0260] As shown in FIG. 9, anti-diabetes drug rosiglitazone was observed to enhance N4- CAR kill using timelapse microscopy to monitor red-labeled nuclei and the kinetics of cell kill, as plotted previously in FIG. 8.

[0261] As shown in FIG. 10, anti-diabetes drug rosiglitazone was observed to prime NECTIN4 expression and enhance N4-CAR kill in mouse models of bladder cancer. For subcutaneous xenografts, lx 106cells were injected into the left flank of 8-10 week old male NSG mice. The injected cells were resuspended in 1 :1 serum-free media and Matrigel (BD Biosciences). Mice were enrolled into treatment groups once tumor volumes reached between 50-100 mm3, typically 7-10 days after tumor cell inoculation. Mice were given rosiglitazone at a dose of 20 mg / kg body weight using oral needle gavage once daily for 5 days or an equal volume of vehicle solvent. 3-5 x 106nontransduced (NTD) control or NECTIN4 CAR T cells were injected intravenously through the tail vein. Tumors were measured with digital calipers and mice were weighed twice weekly in a blinded fashion. Tumor volumes were recorded using Studylog Animal Study Workflow software and plotted using Prism (GraphPad, vlO). Mice were euthanized when tumors reached 20mm in any direction. For survival analysis, a log-rank test was used to compare the overall survival of mice in each cohort.

[0262] The results described in this Example indicate that rosiglitazone pre-administration to mice bearing bladder tumor xenografts enhances the ability of NECTIN4 CAR T cells to kill cancer cells and suppress tumor grow th.EXAMPLE 7. NECTIN4 levels in EV-resistant cells and in post-EV biopsies

[0263] This Example describes experiments performed to demonstrate that NECTIN4 CAR T therapy can kill enfortumab vedotin (EV) resistant cancer cells.

[0264] In these experiments, as shown in FIGS. 11A-11C, it was observed that NECTIN4 is retained in EV-resistant cells. To generate EV-resistant cancer cells, RT112 cancer cells were repeatedly exposed to EV for 3-5 days, with dose escalation of 5 |ig / ml per treatment cycle, for a total of 6 treatment cycles. Cells were allowed to recover in between eachtreatment cycle, prior to the next treatment cycle with EV. After the 6th round of EV at a maximum dose of 25 pg / ml. the EV dose response of RT112-EV-2F-2 generation was assessed. To determine the dose-response and IC50 (half maximal inhibitory concentration) of EV in the parental and EV -resistant cell lines, cells were seeded in a 96-well plate in triplicate. After 24h, EV was added at indicated concentrations for 7-12 days, and cell number was monitored using an IncuCyte S3 (Sartorius), and the normalized confluence was plotted against the concentration of EV. For tumor growth experiments, mice were inoculated with subcutaneous RT112 parental or EV-resistant xenografts as above and treated with the vehicle or EV (4mg / kg). Tumors were measured using calipers as above over 34 days. As shown in FIGS. 12A-12B, NECTIN4 levels are retained in post-EV biopsies and N4-CAR remain active. Immunohistochemical stain for NECTIN4 was performed on biopsy samples obtained from patients before EV and after EV (at the time of resistance). The NECTIN4 Id- score was plotted in the pre and post biopsies, and statistically compared using the Student’s t test. NECTIN4 H-scores from pre and post-EV samples were also plotted for each individual patient.

[0265] Taken together, the results described in this Example indicate that:(1) N4-CAR T’s are active in EV-naive and EV-resistant bladder cancer cells.(2) NECTIN4 levels are an important determinant of N4-CAR activity.(3) PPARy controls NECTIN4 expression transcriptionally.(4) PPARy agonists can prime and upregulate NECTIN4 expression on tumor cells, which in turn, improves N4-CAR T kill.(5) NECTIN4 is retained in EV-resistant cell lines and patient biopsies.EXAMPLE 8. NECTIN4 is broadly expressed in breast cancer cells across the traditional molecular subtypes

[0266] This Example describes experiments performed to demonstrate that NECTIN4 is broadly expressed across molecular subtypes of breast cancer, including hormone receptor (HR) positive, HER2 positive, and triple-negative breast cancer (TNBC).|0267] As shown in FIGS. 13A-13B, NECTIN4 was observed to be broadly expressed in breast cancer cells across the traditional molecular subtypes. Surface protein staining for NECTIN4 was performed as above. Breast cancer cell lines were obtained from the ATCC or the UCSF Cell Culture Facility. Briefly, cells were trypsinized and washed, and then incubated with anti-NECTIN4 PE antibody (Miltenyi Biotec, clone REA967E 100) for 30-60minutes on ice. Cells were analyzed using an Attune NxT Flow Cytometer and the median fluorescence intensity (MFI) was calculated and data were analyzed using FlowJo software, and plotted on GraphPad Prism.

[0268] The results described in this Example demonstrate that NECTIN4 is broadly expressed in all traditional molecular subtypes of breast cancer.EXAMPLE 9. NECTIN4 is co-expressed with HER2 in breast cancer

[0269] This Example describes experiments performed to show that NECTIN4 is frequently co-expressed with HER2 in many breast cancer cells (in seven of eight tested cell lines).

[0270] In these experiments, as shown in FIGS. 14A-14C, NECTIN4 protein and mRNA are expressed along with HER2 protein and mRNA. Western blot for HER2 in the NECTIN4 positive breast cancer cell lines was performed as previously described. Surface protein expression of HER2 and NECTIN4 using flow cytometry was performed as previously described, and plotted on FlowJo software. The ERBB2 mRNA and NECTIN4 mRNA levels across 65 breast cancer cells are plotted using publicly available data from DepMap.

[0271] The results described in this Example demonstrate that HER2 / ERBB2 and NECTIN4 are frequently co-expressed in breast cancer, suggesting that strategies to co-target HER2 and NECTIN4 can be viable and can enhance anti-tumor specificity and targeting.EXAMPLE 10. N4-CAR T cells effectively control all molecular subtypes of breast cancer cells

[0272] This Example describes experiments performed to demonstrate that N4-CAR T cells effectively control and exhibit anti-tumor activity across all molecular breast cancer subtypes including hormone receptor (HR)+ (ZR75-1, T47-D), HER2+ (BT474) and TNBC (MDA- MB-468) and a TNBC patient-derived organoid (PDO) line. In these experiments, as shown in FIGS. 15A-15F, it was observed that N4-CAR T cells could effectively control and kill across all molecular breast cancer subtypes including hormone receptor (HR)+ ZR75-1, T47- D, HER2+ BT474 and TNBC MDA-MB-468 and a TNBC patient-derived organoid (PDO) line. Breast cancer cells were co-cultured N4 CAR T cells as previously described and monitored using an Incucyte. The results described in this Example demonstrate that effectively control and exhibit anti-tumor activity across all molecular breast cancer subtypes, including HR+, HER2+ and TNBC.EXAMPLE 11. N4-CAR T cells generated from different NECTIN4 binders exhibit varying degrees of anti-tumor activity

[0273] This Example describes experiments performed to demonstrate that N4-CAR T cells generated from different NECTIN4 binders have variable anti-tumor activity.|0274] In these experiments, as shown in FIGS. 16A-16C, it was observed that N4-CAR1, CAR2, CAR5, CAR7 but not CAR3 and CAR8 exhibit anti-tumor activity against NECTIN4-expressing RT112 cells. This is despite using high numbers of CAR T cells (E:T ratio of 8: 1). Importantly as a negative control, none of the CARs including CAR1, CAR2, CAR5 and CAR7 exhibit anti-tumor activity against the NECTIN4-negative UMUC3 cells, demonstrating specificity of the N4 CAR.

[0275] The results described in this Example demonstrate that not all NECTIN4 binders can be substituted from an antibody format and transferred in a CAR T backbone are capable of possessing or eliciting anti-tumor activity. The data described here suggest that optimization and evaluation of the VH and VL sequences, the linker length and the specific order that the VH and VL are linked together (i.e., VH-linker-VL versus VL-linker-VH) has important implications to obtain anti-tumor activity.|0276] While particular alternatives of the present disclosure have been disclosed, it is to be understood that various modifications and combinations are possible and are contemplated within the true spirit and scope of the appended claims. There is no intention, therefore, of limitations to the exact abstract and disclosure herein presented.

Claims

CLAIMSWHAT IS CLAIMED IS:

1. A chimeric polypeptide comprising:(a) an extracellular domain (ECD) comprising an antigen-binding moiety that has a binding affinity for nectin cell adhesion molecule 4 (NECTIN4);(b) a transmembrane domain (TMD) derived from CD28; and(c) an intracellular signaling domain (ICD) comprising:(i) a costimulatory domain derived from CD28; and(ii) a CD3 domain.

2. The chimeric polypeptide of claim 1, wherein the chimeric polypeptide is a chimeric antigen receptor (CAR).

3. The chimeric polypeptide of any one of claims 1-2, wherein the antigen-binding moiety is selected from the group consisting of an antibody, a fragment antigen binding (Fab), a monovalent fragment (Fab’), bivalent fragment (F(ab’)2), a fragment variable (Fv), a single-chain antibody variable fragment (scFv), a biparatopic scFv, a disulfide- stabilized variable fragment (dsFv), a minibody, a diabody, a tandem diabody, a triabody, a nanobody, a tandem scFv (taFv), a variable domain of heavy-chain antibody (VHH), a variable domain of new antigen receptor (VNAR), a bispecific T-cell engager (BiTE®), a BiTE®-like fragment, a dual-affinity re-targeting antibody fragment (DART®), and an alphabody®.

4. The chimeric polypeptide of claim 3, wherein the antigen-binding moiety comprises an anti-NECTIN4 scFv.

5. The chimeric polypeptide of any one of claims 1-4, wherein the antigen-binding moiety comprises:(a) heavy chain complementary determining regions (HCDRs) from a heavy chain variable (VH) domain selected from the group consisting of SEQ ID NOS: 1-6; and / or(b) light chain CDRs (LCDRs) from a light chain variable (VL) domain selected from the group consisting of SEQ ID NOS: 7-12.

6. The chimeric polypeptide of any one of claims 1-5, wherein the antigen-binding moiety comprises:(a) a VH domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity tothe VH domain selected from the group consisting of SEQ ID NOS: 1-6; and / or(b) a VL domain having at least 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the VL domain selected from the group consisting of SEQ ID NOS: 7-12.

7. The chimeric polypeptide of any one of claims 1-6, wherein the antigen-binding moiety comprises:(a) a VH domain having an amino acid sequence selected from the group consisting of SEQ ID NOS: 1-6; and(b) a VL domain having an amino acid sequence selected from the group consisting of SEQ ID NOS: 7-12, and further wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.

8. The chimeric polypeptide of any one of claims 1-7, wherein the antigen-binding moiety comprises:(a) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively;(b) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 2 and SEQ ID NO: 8, respectively;(c) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively;(d) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively;(e) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 5 and SEQ ID NO: 11, respectively; or(I) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively; and wherein one, two, three, four, or five amino acids in the amino acid sequence of the VH domain and / or VL domain is substituted by a different amino acid.

9. The chimeric polypeptide of any one of claims 1-8, wherein the antigen-binding moiety comprises:(a) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 1 and SEQ ID NO: 7, respectively;(b) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 2and SEQ ID NO: 8, respectively;(c) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 3 and SEQ ID NO: 9, respectively;(d) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 4 and SEQ ID NO: 10, respectively;(e) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 5 and SEQ ID NO: 11, respectively; or(f) a VH domain and a VL domain having the VH and VL sequences of SEQ ID NO: 6 and SEQ ID NO: 12, respectively.

10. The chimeric polypeptide of any one of claims 1-9, wherein the anti-NECTIN4 scFv comprises a VH domain and a VL domain and wherein the VH domain is operably linked upstream to the VL domain.

11. The chimeric polypeptide of any one of claims 1-9, wherein the anti-NECTIN4 scFv comprises a VH domain and a VL domain and wherein the VH domain is operably linked downstream to the VL domain.

12. The chimeric polypeptide of any one of claims 1-11, wherein the anti-NECTIN4 scFv further comprises a linker operably inserted between the VH domain and the VL domain.

13. The chimeric polypeptide of claim 12, wherein the linker comprises a peptide linker.

14. The chimeric polypeptide of any one of claims 1-13, wherein the chimeric polypeptide further comprises an extracellular spacer sequence inserted between the ECD and the TMD.

15. The chimeric polypeptide of claim 14, wherein the spacer sequence comprises an extracellular IgG4 (EQ) spacer.

16. The chimeric polypeptide of any one of claims 1-15, wherein the chimeric polypeptide further comprises a reporter polypeptide domain.

17. The chimeric polypeptide of claim 16, wherein the reporter polypeptide domain comprises an eGFP polypeptide.

18. The chimeric polypeptide of any one of claims 1-17, wherein the chimeric polypeptide further comprises one or more autoproteolytic cleavage sequences.

19. The chimeric polypeptide of claim 18, wherein the one or more autoproteolyticcleavage sequences are derived from Thosea asigna virus 2A (T2A), calcium-dependent serine endoprotease (furin), porcine teschovirus-1 2A (P2A), foot-and-mouth disease virus (FMDV) 2A (F2A), Equine Rhinitis A Virus (ERAV) 2A (E2A), cytoplasmic polyhedrosis virus 2A (BmCPV2A), and / or Flacherie Virus 2A (BmIFV2A).

20. The chimeric polypeptide of claim 19, wherein the chimeric polypeptide comprises a T2A autoproteolytic cleavage sequence inserted between the reporter polypeptide domain and the CD3^ ICD.

21. The chimeric polypeptide of any one of claims 1-20, comprising, in N-terminal to C- terminal direction:(a) an anti-NECTIN4 scFv domain;(b) an IgG4 (EQ) spacer;(c) a CD28 TMD; and(d) an ICD comprising a costimulatory domain derived from CD28 and a CD3^ domain.

22. A recombinant nucleic acid molecule comprising a nucleic acid sequence that encodes a chimeric polypeptide of any one of claims 1-21.

23. The recombinant nucleic acid molecule of claim 22, wherein the recombinant nucleic acid molecule is operably linked to a heterologous nucleic acid sequence.

24. The recombinant nucleic acid molecule of any one of claims 22-23, wherein the recombinant nucleic acid molecule is incorporated into an expression cassette or a vector.

25. The recombinant nucleic acid molecule of claim 24, wherein the vector is a lentiviral vector, an adeno virus vector, an adeno-associated virus vector, or a retroviral vector.

26. The recombinant nucleic acid molecule of claim 25, wherein the vector is a lentiviral vector.

27. A recombinant cell comprising: a chimeric polypeptide of any one of claims 1-21; and / or a nucleic acid molecule of any one of claims 22-26.

28. The recombinant cell of claim 27, wherein the recombinant cell is a prokaryotic cell or a eukaryotic cell.

29. The recombinant cell of any one of claims 27-28, wherein the recombinant cell is animmune system cell.

30. The recombinant cell of claim 29, wherein the immune system cell is a B cell, a monocyte, aNK cell, a natural killer T (NKT) cell, a basophil, an eosinophil, a neutrophil, a dendritic cell, a macrophage, a regulatory T cell, a helper T cell (TH), a cytotoxic T cell (TCTL), a memory T cell, a gamma delta (y5) T cell, another T cell, a hematopoietic stem cell, or a hematopoietic stem cell progenitor.

31. The recombinant cell of any one of claims 29-30, wherein the immune system cell is a T lymphocyte.

32. A method for making a recombinant cell, comprising:(a) providing a host cell capable of protein expression; and(b) transducing the provided host cell with a recombinant nucleic acid of any one of claims 22-26 to produce a recombinant cell.

33. A recombinant cell produced by the method of claim 32.

34. A cell culture comprising at least one recombinant cell of any one of claims 27-30 and a culture medium.

35. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and one or more of the following: a chimeric polypeptide of any one of claims 1-21; a nucleic acid molecule of any one of claims 22-26; and a recombinant cell of any one claims 27-30.

36. The pharmaceutical composition of claim 35, wherein the composition comprises a recombinant nucleic acid of any one of claims 22-26, a pharmaceutically acceptable carrier.

37. The pharmaceutical composition of claim 36, wherein the recombinant nucleic acid is encapsulated in a viral capsid or a lipid nanoparticle.

38. The pharmaceutical composition of claim 35, wherein the composition comprises a recombinant cell of any one of claims 27-30, a pharmaceutically acceptable carrier.

39. A method for preventing and / or treating a health condition in a subject in need thereof, comprising administering to the subject a composition comprising one or more of the following: a chimeric polypeptide of any one of claims 1-21;a nucleic acid molecule of any one of claims 22-26; a recombinant cell of any one of claims 27-30; and a pharmaceutical composition of any one of claims 35-38.

40. The method of claim 39, wherein the health condition is a cancer.

41. The method of claim 40, wherein the cancer expresses or overexpresses the NECTIN4 antigen (NECTIN4-positive cancer).

42. The method of claim 41, wherein the NECTIN4-positive cancer is breast cancer, bladder cancer, gastric cancer, pancreatic cancer, lung cancer, penile cancer, head and neck cancers, cholangiocarcinoma, skin cancer, liver cancer, or ovanan cancer.

43. The method of claim 42, wherein the NECTIN4-positive cancer is breast cancer or bladder cancer.

44. The method of claim 43, wherein the bladder cancer is a cancer with acquired resistance to enfortumab vedotin (VE).

45. The method of claim 41, wherein the NECTIN4-positive cancer is a solid tumor cancer.

46. The method of claim 45, wherein the solid tumor cell is lung cancer, liver cancer, pancreatic cancer, stomach cancer, colon cancer, kidney cancer, brain cancer, head and neck cancer, breast cancer, skin cancer, rectal cancer, uterine cancer, cervical cancer, ovarian cancer, testicular cancer, skin cancer, or esophageal cancer.

47. The method of any one of claims 39-46, wherein the cancer comprises a sarcoma cell, a rhabdoid cancer cell, a neuroblastoma cell, retinoblastoma cell, or a medulloblastoma cell.

48. The method of any one of claims 39-47, wherein the NECTIN4-positive cancer comprises a metastatic cancer cell, a multiply drug resistant cancer cell, or a recurrent cancer cell.

49. The method of any one of claims 39-48, wherein the administered composition inhibits tumor growth or metastasis of the NECTIN4-positive cancer in the subject.

50. The method of any one of claims 39-49, wherein the composition is administered to the subject as a sole therapy or as a first therapy in combination with a second therapy.

51. The method of claim 50, wherein the second therapy is selected from the group consisting of chemotherapy, radiotherapy, immunotherapy, hormonal therapy, toxintherapy, and surgery .

52. The method of any one of claims 50-51, wherein the second therapy comprises an antidiabetic drug.

53. The method of claim 52, wherein the anti-diabetic drug comprises thiazolidinedione and / or rosiglitazone.

54. The method of any one of claims 50-51, wherein the second therapy comprises an agonist of peroxisome proliferator-activated receptor gamma (PPARg agonist).

55. The method of claim 54, wherein the PPARg agonist comprises rosiglitazone.

56. A kit for the prevention and / or treatment a health condition in a subject in need thereof, the kit comprising:(a) a chimeric polypeptide of any one of claims 1-21;(b) a nucleic acid molecule of any one claims 22-26;(c) a recombinant cell of any one of claims 27-30;(d) a pharmaceutical composition of any one of claims 35-38; and(e) an instruction manual.

Images