Circular vector and method for producing same, and transfectant
A method for synthesizing long DNA chains with high GC content through one-pod ligation of DNA fragments addresses the challenges of mutation and cost, enabling efficient production of biosynthetic gene clusters for natural products and their analogs.
Patent Information
- Application Number
- PCT/JP2024/031596
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2024-09-03
- Publication Date
- 2026-03-12
AI Technical Summary
Existing methods for synthesizing long-chain DNA with high GC content are costly and prone to mutations, especially when using Type IIS restriction enzymes or HiFi DNA assembly, which limits the length and efficiency of DNA fragment assembly.
A method involving one-pod ligation of four or more DNA fragments with 40-60 bp overlaps to a linear vector using exonuclease, DNA polymerase, and DNA ligase, followed by screening for mutation-free plasmids, allows for the synthesis of long gene clusters up to 150 kbp with 70-75% GC content.
Enables low-cost, mutation-free synthesis of long DNA chains, facilitating the production of biosynthetic gene clusters for natural products and their analogs, with improved assembly efficiency and yield.
Smart Images

Figure JPOXMLDOC01-APPB-T000001 
Figure JPOXMLDOC01-APPB-T000002 
Figure JPOXMLDOC01-APPB-T000003
Abstract
Description
Circular vector, method for producing the same, and transformant
[0001] The present invention relates to a circular vector, a method for producing the same, and a transformant.
[0002] Even today, synthesizing long-chain DNA by joining multiple DNA fragments with a high GC content remains extremely difficult. Cloning a biosynthetic gene cluster (BGC) as long-chain DNA allows the preparation of physiologically active natural products (NPs) (Figure 1). A review article has pointed out that the general limit is 30 kilobases (Non-Patent Document 1). Known methods for synthesizing long-chain DNA include the OGAB method (Non-Patent Document 2) and the DiPaC method (Non-Patent Document 3).
[0003] The OGAB method uses Bacillus subtilis to synthesize 20-50 kilobase DNA fragments. Because it uses Type IIS restriction enzymes, which are less specific than Type IIP, the DNA fragments must be synthesized to avoid the creation of restriction enzyme recognition sites. This can lead to the introduction of mutations into the target DNA, especially when the number of DNA fragments is large. The DiPaC method uses HiFi DNA assembly to synthesize 20-50 kilobase DNA fragments by joining a small number of DNA fragments. However, it is difficult to synthesize DNA fragments larger than 30 kilobases in a single assembly. Furthermore, the direct use of PCR fragments poses challenges in synthesizing long, mutation-free DNA (Figures 2 and 3). On the other hand, because it does not use restriction enzymes, naturally occurring DNA can be used directly, regardless of its GC content, resulting in low costs.
[0004] Wan et al., Eng Microbiol 3 (2023) 100085, Tsuge at al, Sci Rep 2015, 5:10655 DOI:10.1038 / srep10655Greunke et al Metab Eng 47 (2018) 334-345,
[0005] The main object of the present invention is to provide a technique for synthesizing long-chain DNA at low cost without mutation.
[0006] The present inventors attempted to create a circular vector containing a long gene cluster by ligating four or more types of DNA fragments and a linear vector in one step in one pod, and found that four or more types of DNA fragments and a linear vector can be ligated in the correct order and in a short time to obtain a circular vector containing a mutation-free long gene cluster, thereby completing the present invention.
[0007] The present invention provides the following circular vectors, methods for producing the same, and transformants: [1] A method for producing a circular vector containing a mutation-free long gene cluster, comprising one-pod and one-step ligation of four or more DNA fragments constituting a long gene cluster, the DNA fragments having 40-60 bp overlap at both ends, to a linear vector in the presence of an exonuclease, a DNA polymerase, a DNA ligase, and a master mix. [2] The method according to [1], wherein the length of the long gene cluster is 32 kbp or more. [3] The method according to [1], wherein the GC content of the long gene cluster is 70-75%. [4] The method according to [1], comprising purifying four or more plasmids containing mutation-free DNA fragments by sequence analysis and screening, treating each of the purified plasmids with a restriction enzyme to prepare four or more DNA fragments, and ligating the resulting four or more DNA fragments to a linear vector in a one-pod manner in the presence of a master mix containing an exonuclease, a DNA polymerase, and a DNA ligase. [5] The method according to [4], wherein the DNA fragment is prepared according to the following steps 1) to 4): 1) amplifying the target DNA by PCR using the genome as a template, 2) treating the amplified DNA with a Type II restriction enzyme and cloning it into a vector, 3) analyzing the sequence to remove any plasmids containing mutations, and 4) cleaving the plasmid with a Type II restriction enzyme to prepare DNA fragments. [6] The method according to [1], wherein the long gene cluster is composed of 4 to 10 types of DNA fragments. [7] A circular vector comprising a mutation-free long gene cluster of 32 kbp or more. [8] The circular vector according to [7], wherein the GC content of the long gene cluster is 70 to 75%. [9] A transformant comprising the circular vector of [7] or [8].
[0008] According to the present invention, which is an improvement over the DiPaC method, long DNA chains with high GC content can be synthesized without mutations and at low cost.
[0009] The present invention involves the following steps: 1) amplifying target DNA by PCR using a genome as a template; 2) treating the amplified DNA with Type II restriction enzymes and cloning it into a vector; 3) analyzing the sequence to remove mutated plasmids; 4) cleaving the plasmid with Type II restriction enzymes to generate DNA fragments; 5) ligating the DNA fragments by mismatch assembly using HiFi DNA assembly; 6) transforming E. coli with the reaction products to obtain a plasmid; 7) cleaving the plasmid with Type II restriction enzymes to screen for the target plasmid; and 8) analyzing the sequence of the suspected target plasmid. The DiPaC method does not involve steps 2 through 4 above. Furthermore, because the DiPaC method does not use restriction enzymes, mismatch assembly does not occur, and in this method, sequences unrelated to assembly are added to both ends of the DNA.
[0010] The synthetic method of the present invention allows the use of naturally occurring DNA, significantly reducing synthesis costs. Furthermore, the present invention allows for the one-pod synthesis of long-chain DNA from multiple DNA fragments, enabling functional modification of existing biosynthetic gene clusters. Functional modification can be performed in two ways: to increase the production of natural products and to produce analogs of natural products. Many biosynthetic gene clusters with 20-100 kilobases and high GC content are involved in drug production, enabling the mass production of existing drugs and the production of analogs of existing drugs.
[0011] Cloning BGCs and Natural Product Production. Actinomycetes encode numerous BGCs in their genomes, providing more medicines to humanity than any other microorganism. However, under laboratory culture conditions, most BGCs remain dormant and must be activated by BGC editing. Overview of the DiPac method. PCR fragments derived from biosynthetic gene clusters are generated by long PCR. Several DNA fragments are assembled to create the desired plasmid. Synthesis of giant BCGs by the DiPac method. Due to the low assembly efficiency of the DiPac method, multiple DNA fragments cannot be assembled simultaneously. Therefore, BGCs are synthesized by sequentially enlarging the plasmid. Overview of the present method. Technical challenges of the conventional method (DiPac method) include the relatively high rate of mutation accumulation due to long PCR and the need for sequential plasmid construction due to low assembly efficiency. The present invention overcomes the technical challenges of the conventional method by subcloning and screening BGC fragments. 3'-terminal mismatch removal mechanism using NEBuilder® HiFi DNA Assembly. Double mismatch assembly of multiple fragments is achieved by utilizing the 3'-terminal mismatch removal mechanism. Cloning strategy for aureosin BGC. Three different sized plasmids were constructed in one pod, and the conventional method (DiPac method) and the present method were quantitatively evaluated. Mutation accumulation in the assembly product using the conventional method (DiPac method). Although a mutation-free plasmid was constructed with the smallest plasmid, a mutation-free plasmid was not obtained with the five-fragment assembly product. A seven-fragment assembly product was not obtained. Comparison of assembly efficiency between the conventional method (DiPac method) and the present method. The present method successfully obtained a seven-fragment assembly product that could not be synthesized using the conventional method. Assembly efficiency was also high. Heterologous production of aureosin. The target BGC was accurately constructed from DNA fragments, enabling highly efficient heterologous production of aureosin. By adding a strong promoter, we achieved a yield twice that of wild-type actinomycetes that produce aureosin. Synthesis of lipomycin BGC using the present method. We successfully synthesized lipomycin BGC (44 kb), which is longer than aureosin BGC (30 kb). Comparison of assembly efficiency for each long DNA length between the conventional method (DiPac method) and the method of the present invention.The present invention allows the preparation of long gene clusters of 32 kb or more, whereas conventional methods have only been able to prepare BGCs up to a maximum of 25 kb.
[0012] As used herein, the lower limit of the length of a long gene cluster is preferably 32 kbp, more preferably 34 kbp, and the upper limit is 150 kbp, alternatively 120 kbp, 100 kbp, or even 80 kbp, 70 kbp, 60 kbp, 55 kbp, or 49 kbp, e.g., 32 to 150 kbp, more preferably 34 to 120 kbp, 34 to 100 kbp, 34 to 80 kbp, 34 to 70 kbp, 34 to 60 kbp, 34 to 55 kbp, or 34 to 49 kbp. The GC content of the long gene cluster is preferably 60 to 80%, more preferably 70 to 80%, and even more preferably 70 to 75%.
[0013] A circular vector containing a long gene cluster can be constructed by ligating multiple DNA fragments to a linear vector. The number of DNA fragments to be ligated is 4 or more, preferably 4 to 20, more preferably 4 to 15, and even more preferably 4 to 10. The length of each DNA fragment is preferably 0.1 to 10 kbp, and even more preferably 0.1 to 5 kbp.
[0014] Long gene clusters with a high GC content are mainly biosynthetic gene clusters derived from actinomycetes, and examples of antibiotics produced using long gene clusters include aureosin, erythromycin, daptomycin, and fidaxomicin.
[0015] The DNA fragments have overlaps (homologous sequences) of preferably 40 to 80 bp, more preferably 40 to 60 bp, at both ends with the other DNA fragment or linear vector to be ligated. DNA fragments are preferably prepared according to the following steps 1) to 4) (Figure 4): 1) amplify the target DNA by PCR using the genome as a template; 2) treat the amplified DNA with Type II restriction enzymes and clone it into a vector; 3) analyze the sequence to remove any mutated plasmids; 4) cut the plasmid with Type II restriction enzymes to generate DNA fragments.
[0016] Ligation of DNA fragments to each other or to a linear vector can be performed in one step by double mismatch assembly of DNA fragments using HiFi DNA Assembly in the presence of a master mix containing exonuclease, DNA polymerase, and DNA ligase. The master mix containing exonuclease, DNA polymerase, and DNA ligase is available from NEBuilder. R HiFi DNA Assembly Master Mix can be used. The master mix used in this invention contains ATP, GTP, CTP, and TTP. Specifically, a 40-80 base 3' overhang containing overlapping (homologous) sequences is generated using a 5'-3' exonuclease. The homologous sequences in the single-stranded overhangs are then annealed. A high-fidelity DNA polymerase then fills the gaps without errors. DNA ligase then fills the nicks, ligating adjacent DNA fragments or a linear vector to create a circular vector (Figure 5). The resulting circular vector is transformed into E. coli to obtain a plasmid, which is then digested with a Type IIP restriction enzyme and screened for the desired plasmid. Further sequencing of the target plasmid allows for the identification of a circular vector containing a mutation-free long gene cluster.
[0017] A transformant can be obtained by introducing the circular vector into a host. By culturing this transformant, a substance based on the expression of the long gene cluster can be produced. Examples of substances produced include aureosin, erythromycin, daptomycin, and fidaxomicin. Examples of hosts include Escherichia coli and actinomycetes.
[0018] The present invention will be described in more detail below with reference to the following examples. Example 1 Using the genome or spore fluid of an aureosin-producing actinomycete (Streptomyces thioluteus, JCM4087) as a template, fragments 1 to 6 were prepared using the forward and reverse primers shown in Table 1 (Figure 6).
[0019] SK002: GCGCGTCTAGAGATCAGCTCGTCCCGTTCGGAGACG SK003: GCGCGAAGCTTGGTGGCGATGACGCGCTCGTTG SK004: GCGCGTCTAGAGCAGCGCGTGTTGACCGGGA SK005: GCGCGAAGCTTGTGCAGCCCGTTCTTGGCCAACT SK006: GCGCGTCTAGACCGGCGCCGAGGAGATCGAACT SK007: GCGCGAAGCTTGGGCCAGCTCGGGGTTCTCCTT SK008: GCGCGTCTAGAACTTCGCCCAGCACCCCGAC SK009: GCGCGAAGCTTAGGTGGTCACCGGGACCAGCTG SK010: GCGCGTCTAGAGAACTCCTCGCCCTGTTCGAGGGC SK011: GCGCGAAGCTTGTTGCGCAGTTCCATCGCCGTCA MAP066: CGCGCGGTACCTCGCCAGGCCCTTCACCGAC SK013: GCGCGAAGCTTTCAGTCAGTCGTCCAGGCGCG
[0020] Each DNA fragment was prepared under the conditions shown in Tables 2 and 3 below.
[0021]
[0022]
[0023] DNA fragments 1 to 6 were amplified by PCR, and the amplified DNA was treated with Type II restriction enzymes and cloned into a vector. Plasmids with mutations were excluded by sequence analysis, and plasmids without mutations were cleaved with Type II restriction enzymes to produce DNA fragments 1 to 6. The restriction enzymes used to cleave the plasmids are shown in Table 4, and the reagents used to prepare circular vectors by ligating DNA fragments and linear vectors are shown in Table 5. pUC19 was used as the vector to ligate DNA fragments 1 to 6.
[0024]
[0025]
[0026] Ligation of the linear vector and DNA fragment was carried out by incubation at 16°C for 1 hour and 30 minutes. The resulting plasmid was added to 25 μl of E. coli DH5α and transformed by the heat shock method (Amp plate). Three to four samples were cultured and the circular vector was purified.
[0027] The purified circular vector was sequenced by nanopore sequencing to identify a circular vector with the correct sequence, which was then used in the following experiments. The vector was also fragmented by PCR using the forward and reverse primers shown in Table 6 and plasmid p21 as a template, and used in the following experiments.
[0028] MAP067: GGCCGCATCCTGGTCAACCCGCCCATGACCACCGTCGTCTCCGAACGGGACGAGCTGATCATGGCGTATCCCCTTTCAGATACTCGCACTAAG MAP068: CGCTTCCAGCTGACGTCACGCGGCTGCGTGGGCATCTGGCGCGCCTGGACGACTGACTGAGCCGTTCGCGCCGCCCCG
[0029] Comparative Example 1: Accumulation of mutations in assembly products using the DiPac method. Following the method described in Non-Patent Document 3, circular vectors were constructed using 3, 5, and 7 DNA fragments, as shown in Figure 7. Using the DiPac method, 14 kB and 25 kb plasmids were constructed, but a 34 kb plasmid could not be constructed. Analysis of the mutations accumulated in each plasmid by nanopore sequencing revealed that not a single mutation-free 25 kb plasmid was obtained using the DiPac method.
[0030] Example 2 and Comparative Example 2 Using the method of the present invention (Example 2) and the DiPac method (Comparative Example 2), attempts were made to construct circular vectors of 14 kb, 25 kb, and 34 kb using 3, 5, and 7 DNA fragments, respectively. In the method of the present invention, 3'-terminal mismatches were removed using NEBuilder® HiFi DNA Assembly. Comparative Example 2 was performed according to the description in Non-Patent Document 3. Assembly efficiency was confirmed by transforming the DNA assembly and cleaving the resulting plasmid with restriction enzymes (Figure 8). Using the method of the present invention, all 14 kb, 25 kb, and 34 kb mutation-free circular vectors were successfully constructed, but no 34 kb circular vector was obtained in Comparative Example 2. Furthermore, all 25 kb circular vectors in Comparative Example 2 contained mutations (Figure 8).
[0031] Example 3 and Comparative Example 3 The experimental procedures for the production of aureosin using actinomycetes transformed with the circular vector obtained by the method of the present invention (Example 3) and the production of aureosin using a wild-type actinomycete that produces aureosin (Comparative Example 3) and the quantification results of aureosin are shown in Figure 9.
[0032] Example 4 As shown in FIG. 10, when an attempt was made to produce β-lipomycin BGC and an assembly product, a large vector containing β-lipomycin BGC of up to 49 kb was successfully synthesized (FIG. 10).
[0033] Example 5 In the same manner as described above, attempts were made to produce circular vectors by the method of the present invention and the DiPac method. It was found that, while circular vectors of 32 kb or more could not be obtained by the DiPac method, circular vectors of 14 to 49 kb could be obtained by the method of the present invention (Figure 11).
Claims
1. A method for producing a circular vector containing a mutation-free long gene cluster, which comprises one-pod and one-step ligation of four or more DNA fragments constituting a long gene cluster, each having 40-60 bp overlap at both ends, with a linear vector in the presence of exonuclease, DNA polymerase, DNA ligase, and a master mix.
2. The method of claim 1, wherein the long gene cluster is 32 kbp or more in length.
3. The method of claim 1, wherein the GC content of the long gene cluster is 70-75%.
4. The method of claim 1, comprising purifying four or more of the plasmids containing each of the DNA fragments without mutations by sequence analysis and screening, treating each of the purified plasmids with a restriction enzyme to prepare four or more DNA fragments, and ligating the four or more DNA fragments obtained and a linear vector in one pod in the presence of a master mix containing an exonuclease, a DNA polymerase, and a DNA ligase.
5. The method according to claim 4, wherein the DNA fragment is prepared according to the following steps 1) to 4): 1) amplifying the target DNA by PCR using the genome as a template; 2) treating the amplified DNA with a Type II restriction enzyme and cloning it into a vector; 3) analyzing the sequence to remove any plasmids containing mutations; 4) cleaving the plasmid with a Type II restriction enzyme to prepare a DNA fragment.
6. The method of claim 1, wherein the long gene cluster is composed of 4 to 10 types of DNA fragments.
7. Circular vectors containing mutation-free long gene clusters of 32 kbp or more.
8. The circular vector of claim 7, wherein the GC content of the long gene cluster is 70 to 75%.
9. A transformant comprising the circular vector according to claim 7 or 8.