Tetracyclic sesquiterpene compounds and synthetic gene clusters thereof

By heterologously expressing the tetracyclic disesquiterpene biosynthetic gene cluster of Fusarium oxysporum 14005 in Aspergillus oryzae, nine novel tetracyclic disesquiterpene compounds were successfully synthesized, isolated, and purified. This solved the problem of the difficulty in efficiently synthesizing Mangicols in existing technologies and provided abundant compound resources and opportunities for new drug development.

CN117105886BActive Publication Date: 2026-05-01EAST CHINA UNIV OF SCI & TECH
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310985911.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-08-08
Filing Date
2023-08-07
Publication Date
2026-05-01
Estimated Expiration
2043-08-07

AI Technical Summary

Technical Problem

Existing technologies struggle to efficiently discover and synthesize bioactive tetracyclic disesquiterpenoids (Mangicols), and there is a lack of effective biosynthetic gene clusters and synthetic methods.

Method used

A biosynthetic gene cluster fomd, comprising six genes, is provided for the tetracyclic disesquiterpenoids Mangicol H to Mangicol P. Gene expression was achieved in Aspergillus oryzae NSAR1 via heterologous expression, and the target compounds were obtained using PCR amplification and vector construction methods.

Benefits of technology

Nine novel tetracyclic disesquiterpenoids were successfully synthesized, isolated, and purified, providing abundant compound resources and lead compounds for new drug development. The process is simple, low-cost, and environmentally friendly.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117105886B_ABST
    Figure CN117105886B_ABST
Patent Text Reader

Abstract

The present application relates to a tetracyclic sesquiterpene compound and a synthetic gene cluster thereof, and belongs to the field of genetic engineering. The tetracyclic sesquiterpene compound synthetic gene cluster is derived from Fusarium oxysporum 14005, and the gene cluster contains six genes, namely, a gene fomdE or a functional equivalent thereof encoding a sesquiterpene synthase FoMS, genes fomdA, fomdC and fomdD or functional equivalents thereof encoding cytochrome P450 enzymes fomdA, fomdC and fomdD, a gene fomdB or a functional equivalent thereof encoding an aldehyde-ketone reductase fomdB, and a gene fomdF or a functional equivalent thereof encoding a hydrolase fomdF. The Mangicols gene cluster discovered in the present application catalyzes the production of a new tetracyclic sesquiterpene compound, and provides valuable lead compound resources for enriching the natural product compound library and discovering new antibiotics.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to tetracyclic disesquiterpenoids and their synthetic gene clusters. Background Technology

[0002] Fungal natural products are an important source for drug development. The deciphering of numerous fungal genomes has revealed a wealth of potential novel biosynthetic gene clusters – the "dark matter" within fungi. Terpenes, a collective term for all isoprene polymers and their derivatives, hold a crucial position in natural drug research due to their diverse structural types and broad bioactivities. Diterpenes and sesquiterpenes are among the most structurally diverse and important secondary metabolites in fungi, widely used in pharmaceuticals, fragrances, resins, and other fine chemicals. With the continuous expansion of the NCBI Unlocked Genomes Database, researchers have discovered a large number of terpenoid biosynthetic gene clusters within fungal genomes. This means that by mining terpenoid synthase genomes and employing metabolic engineering and synthetic biology strategies to reconstruct metabolic pathways within microorganisms, it is possible not only to obtain more novel, highly active compounds but also to discover the biosynthetic pathways of different types of compounds, providing a novel approach for new drug development.

[0003] Mangicols are a class of tetracyclic disesquiterpenoids with diverse potential medicinal uses. For example, mangicols A and B exhibit significant anti-inflammatory activity and good cytotoxic activity against various cancer cell lines. Since their first report in 2000, only 13 mangicols-like compounds have been discovered to date. Therefore, mangicols-like compounds have promising prospects for development and research. Heterologous expression of their biosynthetic gene clusters can effectively avoid the blind spots in traditional natural product research and efficiently uncover more bioactive mangicols-like compounds. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide tetracyclic disesquiterpenoids and their synthetic gene clusters.

[0005] The objective of this invention can be achieved through the following technical solutions:

[0006] This invention first provides a class of tetracyclic disesquiterpenoids, the structural formulas of Mangicol H to Mangicol P are shown below:

[0007]

[0008] This invention further provides a biosynthetic gene cluster fomd for tetracyclic disesquiterpenoids Mangicol H to Mangicol P, containing six genes: fomdE encoding the disesquiterpenoid synthase FoMS or its functional equivalent; fomdA, fomdC, fomdD encoding the cytochrome P450 enzymes fomdA, fomdC, fomdD or their functional equivalents; fomdB encoding the aldehyde-ketone reductase fomdB or its functional equivalent; and fomdF encoding the hydrolase fomdF or its functional equivalent. The nucleotide sequences of fomdA, fomdB, fomdC, fomdD, fomdF, and fomdE are shown in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, and SEQ ID NO. 6, respectively.

[0009] Alternatively, the nucleotide sequences of the six genes are DNA coding sequences that have an amino acid sequence identity of more than 80% with the proteins fomdA, fomdB, fomdC, fomdD, fomdF, and FoMS, respectively.

[0010] This invention further provides the application of the biosynthetic gene cluster fomd of tetracyclic disesquiterpenoids Mangicol H to Mangicol P in the preparation of terpenoid compounds.

[0011] In one embodiment of the present invention, the application of the biosynthetic gene cluster fomd of tetracyclic disesquiterpenoids Mangicol H to Mangicol P is provided in the synthesis of tetracyclic disesquiterpenoids Mangicol H to Mangicol P.

[0012] The present invention further provides a vector for expressing the biosynthetic gene cluster fomd of tetracyclic disesquiterpenoids Mangicol H to Mangicol P, which is a eukaryotic or prokaryotic expression vector containing genes fomdA, fomdB, fomdC, fomdD, fomdF and fomdE.

[0013] The present invention further provides a method for preparing the aforementioned tetracyclic disesquiterpenoids, wherein the tetracyclic disesquiterpenoids Mangicol H to Mangicol P are obtained by heterologous expression of genes in the biosynthetic gene cluster fomd of Fusarium oxysporum 14005 in Aspergillus oryzae NSAR1.

[0014] Among them, Aspergillus oryzae NSAR1 and Fusarium oxysporum 14005 are biological materials known to those skilled in the art.

[0015] In one embodiment of the present invention, the method for preparing the tetracyclic disesquiterpene compound includes the following steps:

[0016] (1) Using the genome of Fusarium oxysporum 14005 as a template, PCR amplification was performed on the genes fomdE (disesquiterpene synthase), fomdA-F / fomdA-R, fomdC-F / fomdC-R, fomdD-F / fomdD-R, fomdB-F / fomdB-R, and fomdF-F / fomdF-R, respectively, for the disesquiterpene synthase gene fomdE, the cytochrome P450 enzyme genes fomdA, fomdC, fomdD, the aldehyde-ketone reductase gene fomdB, and the hydrolase gene fomdF. The PCR products of genes fomdE, fomdA, fomdC, fomdD, fomdB, and fomdF were obtained. Then, Aspergillus oryzae was used as a template. The NSAR1 expression vector pUARA4 was used as the vector to construct the co-expression vector pUARA4-fomdACE of fomdE, fomdA and fomdC; the Aspergillus oryzae NSAR1 expression vector pUSA4 was used as the vector to construct the co-expression vector pUSA4-fomdBDF of fomdD, fomdB and fomdF.

[0017] (2) Under the mediation of PEG solvent, the co-expression vectors pUARA4-fomdACE and pUSA4-fomdBDF were co-transformed into the protoplasts of Aspergillus oryzae NSAR1 (niaD-, sC-, ΔargB, adeA-), a high-yielding host that readily expresses terpene synthase genes, to obtain the Aspergillus oryzae transformant AO-fomdABCDEF, which can produce tetracyclic disesquiterpenoids Mangicol H to Mangicol P.

[0018] (3) The mycelium of Aspergillus oryzae transformant AO-fomdABCDEF was inoculated and cultured to generate tetracyclic disesquiterpenoid compounds Mangicol H to Mangicol P.

[0019] In one embodiment of the present invention, the nucleotide sequences of the primers fomdA-F / fomdA-R are shown in SEQ ID NO. 7 and 8, respectively; the nucleotide sequences of fomdB-F / fomdB-R are shown in SEQ ID NO. 9 and 10, respectively; the nucleotide sequences of fomdC-F / fomdC-R are shown in SEQ ID NO. 11 and 12, respectively; the nucleotide sequences of fomdD-F / fomdD-R are shown in SEQ ID NO. 13 and 14, respectively; the nucleotide sequences of fomdE-F / fomdE-R are shown in SEQ ID NO. 15 and 16, respectively; and the nucleotide sequences of fomdF-F / fomdF-R are shown in SEQ ID NO. 17 and 18, respectively.

[0020] In one embodiment of the present invention, in step (3), the method for inoculating and culturing the mycelium of Aspergillus oryzae transformant AO-fomdABCDEF is as follows: the mycelium of Aspergillus oryzae transformant AO-fomdABCDEF is inoculated into MPY medium containing 0.1% adenine and cultured at 30°C and 220 rpm for 2 days as seed liquid. The seed liquid is then inoculated into rice solid medium containing 0.1% adenine at a ratio of 80g rice to 120mL deionized water and 5mL seed liquid, and cultured at 30°C for 18 days.

[0021] In one embodiment of the present invention, in step (3), after inoculating and culturing the mycelium of Aspergillus oryzae transformant AO-fomdABCDEF, the solid fermentation product of AO-fomdABCDEF is extracted three times with an equal volume of ethyl acetate, and the extract is evaporated to dryness to obtain an extract; the extract is extracted with petroleum ether to obtain a component with low polarity, and the petroleum ether extract is evaporated to dryness and then subjected to normal phase separation, using petroleum ether and ethyl acetate as mobile phases for elution and enrichment of target components Fr.5 and Fr.7; Fr.5 is separated by gel column chromatography, and finally Mangicol K is obtained by elution with a reversed-phase Cholester column using acetonitrile / 0.1% formic acid water at a volume ratio of 80:20; Fr.7 is separated by gel column chromatography to obtain three fractions Fr.7.1-Fr.7.3-Fr.7.2, which are semi-prepared by ACE C18-PFP column chromatography using acetonitrile / 0.1% formic acid water at a volume ratio of 75:25 as mobile phase. O and fraction Fr. 7.2.1; fraction Fr. 7.2.1 was further processed using a hand-type Chiralpak IA column with a hexane / ethanol volume ratio of 95:5 as the mobile phase to obtain Mangicols H and I, Fr. 7.3. Semi-preparative elution was performed using a Phenomenex column with an acetonitrile / 0.1% formic acid water volume ratio of 80:20 as the mobile phase to obtain Mangicol L, Mangicol N, and Mangicol P, as well as fraction Fr. 7.3.1; fraction Fr. 7.3.1 was further processed using a hand-type Chiralpak IA column with a hexane / ethanol volume ratio of 94:6 as the mobile phase to obtain Mangicol J and Mangicol M.

[0022] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0023] This invention provides a class of tetracyclic disesquiterpenoids, their preparation methods, and applications. During the research and development process, the inventors discovered a novel Mangicols HP biosynthetic gene cluster from Fusarium oxysporum 14005 using a genome mining strategy. Through heterologous expression, the genes in the Mangicols HP biosynthetic gene cluster were expressed in Aspergillus oryzae. Finally, nine novel tetracyclic disesquiterpenoids, namely Mangicol H to Mangicol P, were isolated and purified.

[0024] The innovation of this invention lies primarily in the use of genetic engineering methods to construct self-sufficient engineered bacteria that produce novel tetracyclic disesquiterpenoids, Mangicol H to Mangicol P. The entire process is simple, technologically mature, and low-cost, free of harmful impurities, non-toxic, and highly environmentally friendly. The obtained product, Mangicols HP, provides a new resource for the biosynthesis of disesquiterpenoids, offers an alternative for obtaining this class of compounds, and provides valuable lead compound resources for enriching the natural product compound library and discovering new antibiotics. Attached Figure Description

[0025] Figure 1 This is the ultraviolet absorption spectrum of the compound Mangicols HP from this invention.

[0026] Figure 2 This is the HR-EI-MS spectrum of the compound Mangicol H of this invention.

[0027] Figure 3 This is the HR-EI-MS spectrum of the compound Mangicol I of this invention.

[0028] Figure 4 This is the HR-EI-MS spectrum of the compound Mangicol J of this invention.

[0029] Figure 5 This is the HR-EI-MS spectrum of the compound Mangicol K of this invention.

[0030] Figure 6 This is the HR-EI-MS spectrum of the compound Mangicol L of this invention.

[0031] Figure 7 This is the HR-EI-MS spectrum of the compound Mangicol M of this invention.

[0032] Figure 8 This is the HR-EI-MS spectrum of the compound Mangicol N of this invention.

[0033] Figure 9 This is the HR-EI-MS spectrum of the compound Mangicol O of this invention.

[0034] Figure 10 This is the HR-EI-MS spectrum of the compound Mangicol P of this invention.

[0035] Figure 11 The compound Mangicol H of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0036] Figure 12 The compound Mangicol I of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0037] Figure 13 The compound Mangicol J of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0038] Figure 14 The compound Mangicol K of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0039] Figure 15 The compound Mangicol L of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0040] Figure 16 The compound Mangicol M of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0041] Figure 17 The compound Mangicol N of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0042] Figure 18 The compound Mangicol O of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0043] Figure 19 The compound Mangicol P of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum.

[0044] Figure 20 The compound Mangicol H of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0045] Figure 21 The compound Mangicol I of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0046] Figure 22 The compound Mangicol J of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0047] Figure 23 The compound Mangicol K of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0048] Figure 24 The compound Mangicol L of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0049] Figure 25 The compound Mangicol M of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0050] Figure 26 The compound Mangicol N of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0051] Figure 27 The compound Mangicol O of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0052] Figure 28 The compound Mangicol P of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum.

[0053] Figure 29 The HSQC spectrum of the compound Mangicol H of this invention dissolved in pyridine-d5 is shown.

[0054] Figure 30 This is the HSQC spectrum of the compound Mangicol I of this invention dissolved in pyridine-d5.

[0055] Figure 31 The HSQC spectrum of the compound Mangicol J of this invention dissolved in pyridine-d5 is shown.

[0056] Figure 32 This is the HSQC spectrum of the compound Mangicol K of this invention dissolved in pyridine-d5.

[0057] Figure 33 The HSQC spectrum of the compound Mangicol L of this invention dissolved in pyridine-d5 is shown.

[0058] Figure 34The image shows the HSQC spectrum of the compound Mangicol M dissolved in pyridine-d5.

[0059] Figure 35 The image shows the HSQC spectrum of the compound Mangicol N dissolved in pyridine-d5.

[0060] Figure 36 The HSQC spectrum of the compound Mangicol O of this invention dissolved in pyridine-d5 is shown.

[0061] Figure 37 The image shows the HSQC spectrum of the compound Mangicol P of this invention dissolved in pyridine-d5.

[0062] Figure 38 The compound Mangicol H of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0063] Figure 39 The compound Mangicol I of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0064] Figure 40 The compound Mangicol J of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0065] Figure 41 The compound Mangicol K of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0066] Figure 42 The compound Mangicol L of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0067] Figure 43 The compound Mangicol M of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0068] Figure 44 The compound Mangicol N of this invention is dissolved in pyridine-d5.1 H- 1 H COSY spectrum.

[0069] Figure 45 The compound Mangicol O of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0070] Figure 46 The compound Mangicol P of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum.

[0071] Figure 47 The image shows the HMBC spectrum of the compound Mangicol H of this invention dissolved in pyridine-d5.

[0072] Figure 48 This is the HMBC spectrum of the compound Mangicol I of this invention dissolved in pyridine-d5.

[0073] Figure 49 The HMBC spectrum of the compound Mangicol J of this invention dissolved in pyridine-d5 is shown.

[0074] Figure 50 This is the HMBC spectrum of the compound Mangicol K of this invention dissolved in pyridine-d5.

[0075] Figure 51 The HMBC spectrum of the compound Mangicol L of this invention dissolved in pyridine-d5 is shown.

[0076] Figure 52 The HMBC spectrum of the compound Mangicol M of this invention dissolved in pyridine-d5 is shown.

[0077] Figure 53 This is the HMBC spectrum of the compound Mangicol N of this invention dissolved in pyridine-d5.

[0078] Figure 54 The HMBC spectrum of the compound Mangicol O of this invention dissolved in pyridine-d5 is shown.

[0079] Figure 55 This is the HMBC spectrum of the compound Mangicol P of this invention dissolved in pyridine-d5.

[0080] Figure 56The NOESY spectrum of the compound Mangicol H of this invention dissolved in pyridine-d5 is shown.

[0081] Figure 57 The NOESY spectrum of the compound Mangicol I of this invention dissolved in pyridine-d5 is shown.

[0082] Figure 58 The NOESY spectrum of the compound Mangicol J of this invention dissolved in pyridine-d5 is shown.

[0083] Figure 59 The NOESY spectrum of the compound Mangicol K of this invention dissolved in pyridine-d5 is shown.

[0084] Figure 60 The NOESY spectrum of the compound Mangicol L of this invention dissolved in pyridine-d5 is shown.

[0085] Figure 61 The NOESY spectrum of the compound Mangicol M of this invention dissolved in pyridine-d5 is shown.

[0086] Figure 62 The NOESY spectrum of the compound Mangicol N of this invention dissolved in pyridine-d5 is shown.

[0087] Figure 63 The NOESY spectrum of the compound Mangicol O of this invention dissolved in pyridine-d5 is shown.

[0088] Figure 64 The NOESY spectrum of the compound Mangicol P of this invention dissolved in pyridine-d5 is shown.

[0089] Figure 65 This is the ICD spectrum of the compound Mangicol J of this invention. Detailed Implementation

[0090] The present invention will now be described in detail with reference to specific embodiments. The examples described below are merely preferred embodiments of the present invention and are not intended to limit the invention in any way. Any simple modifications, equivalent variations, and alterations made to the embodiments based on the technical essence of the present invention shall fall within the scope of the present invention. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods.

[0091] Unless otherwise specified, the basic molecular biology experimental techniques used in the embodiments of this invention, such as PCR amplification, plasmid extraction, and transformation, are generally performed according to conventional methods. For details, please refer to "Molecular Cloning: A Laboratory Manual" (3rd edition) (translated by Sambrook J, Russell DW, Janssen K, Argentine J. Huang Peitang et al., 2002, Beijing: Science Press), or follow the instructions provided by the relevant manufacturers.

[0092] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0093] The synthetic gene cluster of the tetracyclic disesquiterpenoid compound Mangicols provided by this invention was cloned from Fusarium oxysporum 14005. The gene cluster contains six genes: fomdE encoding the disesquiterpenoid synthase FoMS or its functional equivalent; fomdA, fomdC, fomdD encoding the cytochrome P450 enzymes fomdA, fomdC, and fomdD, or their functional equivalents; fomdB encoding the aldehyde-ketone reductase fomdB or its functional equivalent; and fomdF encoding the hydrolase fomdF or its functional equivalent. The nucleotide sequences of fomdA, fomdB, fomdC, fomdD, and fomdF are shown in SEQ ID NO.1, fomdB, fomdC, fomdD, fomdF, and fomdE, respectively. As shown in IDNO.6, or the nucleotide sequence of the gene is a DNA coding sequence that has an amino acid sequence identity of more than 80% with the proteins fomdA, fomdB, fomdC, fomdD, fomdF and FoMS, respectively.

[0094] Example 1

[0095] Heterologous expression of the synthetic gene of a tetracyclic disesquiterpene, Mangicols, and structural identification of the disesquiterpene skeleton compound.

[0096] Using heterologous expression, the Mangicol HP biosynthetic gene cluster from Fusarium oxysporum 14005 was transformed into the host Aspergillus oryzae by constructing an expression plasmid, and the product production of the heterologous expression strain was detected. The culture medium formulation used in this example is shown in Table 1.

[0097] Table 1. Culture medium formulations used in the examples.

[0098]

[0099]

[0100] 1. Construction of a heterologous expression vector for the Mangicols HP gene cluster

[0101] (1) Using the genome of F. oxysporum 14005 as a template, PCR amplification was performed on the genes fomdE (disesquiterpene synthase), fomdA (cytochrome P450 enzyme), fomdC (cytochrome P450 enzyme), fomdD (acetyl-ketone reductase), fomdB (acetyl-ketone reductase), and fomdF (acetyl-ketone reductase) and fomdF (acetyl-ketone reductase) using primers fomdE-F / fomdE-R, fomdA-F / fomdA-R, fomdC-F / fomdC-R, fomdD-F / fomdD-R, fomdB-F / fomdB-R, and fomdF-F / fomdF-R, respectively.

[0102] (2) The PCR products of genes fomdE, fomdA, and fomdC were purified using a nucleic acid purification kit. Then, fomdE was integrated into the linear vector pUARA4, which was digested with KpnI, using the Ezmax recombination kit. The ligation product was transformed into E. coli DH10B, and positive transformants were screened by ampicillin. Positive transformants were cultured in liquid culture, and plasmids were extracted and verified by PCR to obtain the pUARA4-fomdE plasmid. Based on this, fomdA was integrated into the linear vector pUARA4-fomdE, which was digested with PacI, using the Ezmax recombination kit. The ligation product was transformed into E. coli DH10B, and positive transformants were screened by ampicillin. Positive transformants were cultured in liquid culture, and plasmids were extracted and verified by PCR to obtain the pUARA4-fomdAE plasmid. Finally, fomdC was integrated into the NheI-digested linear vector pUARA4-fomdAE using the Ezmax recombination kit. The ligation product was transformed into *E. coli* DH10B, and positive transformants were screened using ampicillin. Positive transformants were also cultured in liquid culture, and plasmids were extracted and verified by PCR to obtain the expression vector pUARA4-fomdACE plasmid.

[0103] (3) Similarly, after purifying the PCR products of genes fomdD, fomdB, and fomdF using the above method with a nucleic acid purification kit, fomdD was integrated into the linear vector pUSA4 digested with KpnI using the Ezmax recombination kit. The ligation product was transformed into E. coli DH10B, and positive transformants were screened by ampicillin. Positive transformants were cultured in liquid culture, and plasmids were extracted and verified by PCR to obtain the pUSA4-fomdD plasmid. Based on this, fomdB was integrated into the linear vector pUSA4-fomdD digested with PacI using the Ezmax recombination kit. The ligation product was transformed into E. coli DH10B, and positive transformants were screened by ampicillin. Positive transformants were cultured in liquid culture, and plasmids were extracted and verified by PCR to obtain the pUSA4-fomdBD plasmid. Finally, fomdF was integrated into the NheI-digested linear vector pUSA4-fomdBD using the Ezmax recombination kit. The ligation product was transformed into *E. coli* DH10B, and positive transformants were screened using ampicillin. Positive transformants were cultured in liquid culture, and plasmids were extracted and verified by PCR to obtain the expression vector pUSA4-fomdBDF plasmid.

[0104] Primer sequences used in the examples in Table 2

[0105]

[0106] 2. Transformation of protoplasts

[0107] (1) Spread Aspergillus oryzae NSAR1 on a PDA plate and incubate at 30°C for 7 days.

[0108] (2) Collect spores in 10 mL of 0.1% Tween-80 (generally, one plate of spores is needed), and count them using a hemocytometer. Inoculate approximately 10... 7 Incubate 1 spore in 50 mL of DPY at 30 °C and 220 rpm for 2-3 days.

[0109] (3) Weigh 100mg Yatalase, add solution 0 to dissolve, filter 20mL through a 0.22μm filter membrane to sterilize, and add to a 50mL centrifuge tube.

[0110] (4) Collect the mycelium. Pour 100 mL of cultured mycelium into a P250 glass filter to remove the culture medium. Wash with sterile water (or 0.8 M NaCl) 3-5 times, squeeze out the water with a sterile spatula, and then add the squeezed mycelium to the Yatalase solution. Incubate at 30°C and 200 rpm with shaking for 1-2 hours, until the spherical mycelium disappears and the supernatant becomes noticeably turbid.

[0111] (5) Filter the digested bacterial solution with Miracloth filter cloth, collect the protoplasts, transfer them to a new 50mL centrifuge tube, and centrifuge at 4℃, 800g, for 5min.

[0112] (6) Remove the supernatant, add 20 mL of 0.8 M NaCl to resuspend and wash, centrifuge at 800 g for 5 min at 4 °C (wash twice). Remove the supernatant, add 10 mL of 0.8 M NaCl. Count the number of protoplasts under a microscope using a bacterial counter. Protoplast count = total count / 80 x 400 ml x 10 4 x is the dilution factor.

[0113] (7) Adjust the protoplast concentration to 2 x 10⁻⁶. 8 The cell / mL ratio is sol 2 / sol 3 = 4 / 1. Depending on the growth of the cells, 0.5 mL to 2 mL of protoplasts can be harvested.

[0114] (8) Transfer 200 μL of protoplast solution to a new 50 mL centrifuge tube, add 10 μg of expression plasmids pUARA4-fomdACE and pUSA4-fomdBDF respectively, and mix gently. Incubate on ice for 20 min. During this time, incubate the sterilized Topagar in a 50 °C water bath.

[0115] (9) Add 1 mL of sol 3 to the 10 mL suspension and mix gently with a pipette tip. Let stand at room temperature for 20 min. Add 10 mL of sol 2 and mix gently.

[0116] (10) Centrifuge at 4℃, 800g, for 10 min, remove the supernatant, add 1 mL of Sol 2, gently resuspend with a pipette, and add 200 μL to the center of a solid screening medium (x3 plates). Quickly add 5 mL of topagar (incubated at 50℃) around the petri dish and mix rapidly. After the surface of the plate is completely dry, wrap it with parafilm, place the cap down, and incubate at 30℃ for 3-7 days.

[0117] (11) Pick 2-3 clones from each plate, for a total of 8. Verify the transformed strains by PCR. The positive transformed strains are the heterologous expression strains of Mangicols HP gene cluster AO-fomdABCDEF.

[0118] 3. Isolation and purification of expression products from heterologous expression strain AO-fomdABCDEF

[0119] The mycelium of the heterologous expression strain AO-fomdABCDEF was inoculated into MPY medium containing 0.1% adenine and cultured at 30℃ and 220rpm for 2 days to obtain the seed culture. The seed culture was then inoculated into rice solid medium supplemented with 0.1% adenine at a ratio of 80g rice, 120mL deionized water and 5mL seed culture and cultured statically at 30℃ for 18 days.

[0120] The solid-state fermentation product of AO-fomdABCDEF was extracted three times with an equal volume of ethyl acetate, and the extract was evaporated to dryness to obtain an extract. The extract was extracted with petroleum ether to obtain the less polar fraction. The petroleum ether extract was evaporated to dryness and then subjected to normal-phase separation. The target fractions Fr.5 and Fr.7 were enriched by elution with petroleum ether and ethyl acetate as the mobile phase. Fr.5 was separated by gel column chromatography, and finally Mangicol K was obtained by elution with a reversed-phase Cholester column using acetonitrile / 0.1% formic acid water at a volume ratio of 80:20. Fr.7 was separated by gel column chromatography to obtain three fractions Fr.7.1-Fr.7.3. Fr.7.2 was semi-preparatively separated using an ACE C18-PFP column, eluting with acetonitrile / 0.1% formic acid and water at a mobile phase of 75:25 to obtain Mangicol O and fraction Fr.7.2.1. Fraction Fr.7.2.1 was further separated using a hand column Chiralpak IA, eluting with n-hexane / ethanol at a mobile phase of 95:5 to obtain Mangicols H and I. Fr.7.3 was semi-preparatively separated using a Phenomenex column, eluting with acetonitrile / 0.1% formic acid and water at a mobile phase of 80:20 to obtain Mangicols L, N, and P, as well as fraction Fr.7.3.1. Fraction Fr.7.3.1 was further separated using a hand column Chiralpak IA, eluting with n-hexane / ethanol at a mobile phase of 94:6 to obtain Mangicols J and M.

[0121] NMR analysis of isolated tetracyclic disesquiterpenes was performed using a Bruker 600MHz spectrometer. 1 H 600MHz; 13 (C 150MHz), the solvent is deuterated pyridine.

[0122] 4. Identification of tetracyclic disesquiterpenoids Mangicols HP.

[0123] The tetracyclic disesquiterpenoid Mangicols HP obtained above was identified as follows:

[0124] (1) Appearance: It is a light yellow, transparent oil.

[0125] (2) Solubility: It is readily soluble in methanol and sparingly soluble in water.

[0126] (3) Ultraviolet spectroscopy: The ultraviolet spectrum of the methanol solution of compound Mangicols HP shows a maximum absorption peak at 210 nm. The ultraviolet spectrum is shown in [reference needed]. Figure 1 As shown, Figure 1 This is the ultraviolet (UV) spectrum of the compound Mangicols HP from this invention. The UV spectrometer was a Mariner System 5304 instrument.

[0127] (4) Mass spectrometry: Figure 2 The HR-ESI-MS spectrum of the compound Mangicol H from this invention shows its [M+H] content. + The peak value of m / z 357.31519 suggests that its most likely molecular formula is C. 25 H 40 O. Figure 3 The HR-ESI-MS spectrum of Mangicol I, a compound of this invention, shows its [M+H] content. + The peak value of m / z 357.31519 suggests that its most likely molecular formula is C. 25 H 40 O. Figure 4 The HR-ESI-MS spectrum of the compound Mangicol J of this invention shows its [M-H2O+H] composition. + The peak value of m / z 371.29501 suggests that its most likely molecular formula is C. 25 H 39 O2. Figure 5 The HR-ESI-MS spectrum of the compound Mangicol K of this invention shows its [M+H] content. + The peak value of m / z 387.28937 suggests that its most likely molecular formula is C. 25 H 38 O3. Figure 6 The HR-ESI-MS spectrum of the compound Mangicol L of this invention shows its [M+H] content. + The peak at m / z 389.30502 suggests that its most likely molecular formula is C. 25 H 40 O3. Figure 7 The HR-ESI-MS spectrum of the compound Mangicol M of this invention shows its [M-H2O+H] composition. + The peak at m / z 371.29501 suggests that its most likely molecular formula is C. 25 H 39 O2. Figure 8 The HR-ESI-MS spectrum of the compound Mangicol N of this invention shows its [M-H2O+H] composition. +The peak value is m / z 389.30557, suggesting that its most likely molecular formula is C. 25 H 41 O3. Figure 9 The HR-ESI-MS spectrum of the compound Mangicol O of this invention shows its [M-H2O+H] composition. + The peak at m / z 431.31494 suggests that its most likely molecular formula is C. 27 H 45 O5. Figure 10 The HR-ESI-MS spectrum of the compound Mangicol P of this invention shows its [M-H2O+H] composition. + The peak at m / z 507.34674 suggests that its most likely molecular formula is C. 33 H 49 O5. HR-ESI-MS spectral analysis was performed using a Thermal Fisher Orbitrap Q Exactive mass spectrometer with methanol as the solvent.

[0128] (5) Nuclear magnetic resonance spectroscopy: Figure 11 The compound Mangicol H of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 12 The compound Mangicol I of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 13 The compound Mangicol J of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 14 The compound Mangicol K of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 15 The compound Mangicol L of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 16 The compound Mangicol M of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 17 The compound Mangicol N of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 18 The compound Mangicol O of this invention is dissolved in pyridine-d5. 1 H-NMR spectrum. Figure 19 The compound Mangicol P of this invention is dissolved in pyridine-d5. 1H-NMR spectrum. Figure 20 The compound Mangicol H of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 21 The compound Mangicol I of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 22 The compound Mangicol J of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 23 The compound Mangicol K of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 24 The compound Mangicol L of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 25 The compound Mangicol M of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 26 The compound Mangicol N of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 27 The compound Mangicol O of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 28 The compound Mangicol P of this invention is dissolved in pyridine-d5. 13 C-NMR spectrum. Figure 29 The HSQC spectrum of the compound Mangicol H of this invention dissolved in pyridine-d5 is shown. Figure 30 This is the HSQC spectrum of the compound Mangicol I of this invention dissolved in pyridine-d5. Figure 31 The HSQC spectrum of the compound Mangicol J of this invention dissolved in pyridine-d5 is shown. Figure 32 This is the HSQC spectrum of the compound Mangicol K of this invention dissolved in pyridine-d5. Figure 33 The HSQC spectrum of the compound Mangicol L of this invention dissolved in pyridine-d5 is shown. Figure 34 The image shows the HSQC spectrum of the compound Mangicol M dissolved in pyridine-d5. Figure 35 The image shows the HSQC spectrum of the compound Mangicol N dissolved in pyridine-d5. Figure 36The HSQC spectrum of the compound Mangicol O of this invention dissolved in pyridine-d5 is shown. Figure 37 The image shows the HSQC spectrum of the compound Mangicol P of this invention dissolved in pyridine-d5. Figure 38 The compound Mangicol H of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 39 The compound Mangicol I of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 40 The compound Mangicol J of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 41 The compound Mangicol K of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 42 The compound Mangicol L of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 43 The compound Mangicol M of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 44 The compound Mangicol N of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 45 The compound Mangicol O of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 46 The compound Mangicol P of this invention is dissolved in pyridine-d5. 1 H- 1 H COSY spectrum. Figure 47 The image shows the HMBC spectrum of the compound Mangicol H of this invention dissolved in pyridine-d5. Figure 48 This is the HMBC spectrum of the compound Mangicol I of this invention dissolved in pyridine-d5. Figure 49 The HMBC spectrum of the compound Mangicol J of this invention dissolved in pyridine-d5 is shown. Figure 50This is the HMBC spectrum of the compound Mangicol K of this invention dissolved in pyridine-d5. Figure 51 The HMBC spectrum of the compound Mangicol L of this invention dissolved in pyridine-d5 is shown. Figure 52 The HMBC spectrum of the compound Mangicol M of this invention dissolved in pyridine-d5 is shown. Figure 53 This is the HMBC spectrum of the compound Mangicol N of this invention dissolved in pyridine-d5. Figure 54 The HMBC spectrum of the compound Mangicol O of this invention dissolved in pyridine-d5 is shown. Figure 55 This is the HMBC spectrum of the compound Mangicol P of this invention dissolved in pyridine-d5. Figure 56 The NOESY spectrum of the compound Mangicol H of this invention dissolved in pyridine-d5 is shown. Figure 57 The NOESY spectrum of the compound Mangicol I of this invention dissolved in pyridine-d5 is shown. Figure 58 The NOESY spectrum of the compound Mangicol J of this invention dissolved in pyridine-d5 is shown. Figure 59 The NOESY spectrum of the compound Mangicol K of this invention dissolved in pyridine-d5 is shown. Figure 60 The NOESY spectrum of the compound Mangicol L of this invention dissolved in pyridine-d5 is shown. Figure 61 The NOESY spectrum of the compound Mangicol M of this invention dissolved in pyridine-d5 is shown. Figure 62 The NOESY spectrum of the compound Mangicol N of this invention dissolved in pyridine-d5 is shown. Figure 63 The NOESY spectrum of the compound Mangicol O of this invention dissolved in pyridine-d5 is shown. Figure 64 The NOESY spectrum of the compound Mangicol P of this invention dissolved in pyridine-d5 is shown.

[0129] (6) Figure 65 The absolute configuration at position C-19 of the compound Mangicol J of this invention is shown in the ICD spectrum obtained by the Snatzke method.

[0130] The final structural formula is as follows:

[0131]

[0132] Table 3. Compound Mangicols HJ 1 H and13 C-NMR spectrum peak assignment

[0133]

[0134] Table 4. Compound Mangicols KM 1 H and 13 C-NMR spectrum peak assignment

[0135]

[0136]

[0137] Table 5. Compound Mangicols NP 1 H and 13 C-NMR spectrum peak assignment

[0138]

[0139]

[0140] NMR analysis of the compound Mangicols HP was performed using a Bruker 600MHz laser. 1 H 600MHz; 13 (C 150MHz). The solvent for the compound Mangicols HP is pyridine-d5.

[0141] Antibacterial activity test of Mangicols-type disesquiterpenoids

[0142] (1) Antibacterial assay against Bacillus subtilis, Staphylococcus aureus, Staphylococcus epidermidis, Pseudomonas aeruginosa and Streptococcus mutans

[0143] The tested bacterial strains included: Bacillus subtilis strain HD11, Staphylococcus aureus strain ATCC 6538, Staphylococcus epidermidis strain CGMCC1.1757, Pseudomonas aeruginosa strain PA01, and Streptococcus mutans strain ATCC UA159. The inhibitory effect of the compounds on the growth of the selected bacteria was determined using a serial dilution method to obtain the minimum inhibitory concentration (MIC) of the compounds against different strains. The MIC is the lowest concentration of a drug required to inhibit bacterial growth. Vancomycin was selected as a positive control in this experiment.

[0144] The bacteria used in the test were first cultured to the logarithmic phase on Mueller-Hinton Broth (MHB) medium, and then the cultured bacteria were diluted with medium to a concentration of 10⁻⁶.4 CFU / mL bacterial suspension was inoculated into 96-well cell culture plates, with each well containing 78 μL of bacterial suspension. Two μL of a two-fold serial dilution of each compound was added. Samples and controls were dissolved in dimethyl sulfoxide (DMSO), with the final DMSO concentration not exceeding 0.05%. A series of sample concentrations from 4000 to 31.3 μg / mL were obtained using a serial dilution method, and the samples were incubated at 37°C aerobic conditions for 16 hours. The absorbance was measured at 600 nm before and after incubation using a microplate reader. The minimum inhibitory concentration (MIC) was calculated based on the change in absorbance. All experiments were performed in triplicate.

[0145] The experimental results are shown in Table 7:

[0146] Table 7 Results of in vitro antibacterial activity tests of compound Mangicols HP

[0147]

[0148] In vitro antibacterial activity studies showed that compound J had strong inhibitory activity against Streptococcus mutans (MIC = 6.25 μg / mL), and compounds L and M also had certain inhibitory activity against Streptococcus mutans (MIC = 12.5 μg / mL).

[0149] (2) Antifungal assay

[0150] The tested bacterial strains included Candida albicans strain SC 5314. The inhibitory effect of the compounds on the growth of the selected bacteria was determined using a serial dilution method to obtain the minimum inhibitory concentration (MIC) of the compounds against different strains. The MIC is the lowest concentration of a drug required to inhibit bacterial growth. Amphotericin B was selected as the positive control in this experiment, and DMSO treatment alone was set up as a negative control.

[0151] Single colonies of Candida albicans strain SC 5314 were suspended in RPMI 1640 at a concentration of 1×10⁻⁶. 4 CFU / mL was inoculated into 96-well cell culture plates, with each well containing 78 μL of fungal suspension. Two μL of a two-fold serial dilution of each compound was added. Samples and controls were dissolved in dimethyl sulfoxide (DMSO), with the final DMSO concentration not exceeding 0.05%. A series of sample concentrations from 4000 to 31.3 μg / mL were obtained using a serial dilution method, and the plates were incubated at 35°C for 16 hours. The absorbance was measured at 600 nm before and after incubation using a microplate reader. The minimum inhibitory concentration (MIC) was calculated based on the change in absorbance. All experiments were performed in triplicate.

[0152] The experimental results are shown in Table 8:

[0153] Table 8. Results of in vitro antifungal activity assays for compound Mangicols HP.

[0154] Cpd.NO. C. albicans (MIC, μg / mL) H ≥50 I ≥50 J ≥50 K ≥50 L ≥50 M ≥50 N ≥50 O ≥50 P ≥50

[0155] Compared with DMSO and amphotericin B, the above compounds did not have a significant inhibitory effect on Candida albicans (MIC value ≥50 mg / L).

[0156] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. The biosynthetic gene cluster fomd of tetracyclic disesquiterpenoids, characterized in that, There are 6 genes, including genes encoding sesquiterpene synthase FoMS. fomdE Genes encoding cytochrome P450 enzymes fomdA, fomdC, and fomdD fomdA , fomdC , fomdD The gene encoding the aldehyde-ketone reductase fomdB fomdB The gene encoding the hydrolase fomdF fomdF , wherein fomdA The nucleotide sequence is shown in SEQ ID NO.

1. fomdB The nucleotide sequence is shown in SEQ ID NO.

2. fomdC The nucleotide sequence is shown in SEQ ID NO.

3. fomdD The nucleotide sequence is shown in SEQ ID NO.

4. fomdF The nucleotide sequence is shown in SEQ ID NO.

5. fomdE The nucleotide sequence is shown in SEQ ID NO.

6.

2. The application of the biosynthetic gene cluster fomd of the tetracyclic disesquiterpenoid compound according to claim 1 in the preparation of the tetracyclic disesquiterpenoid compound, wherein the tetracyclic disesquiterpenoid compound is selected from one of Mangicol J, Mangicol L, and Mangicol M, and the structural formulas of Mangicol J, Mangicol L, and Mangicol M are shown below: 。 3. A vector expressing the biosynthetic gene cluster fomd of the tetracyclic disesquiterpenoid compound as described in claim 1, characterized in that, For containing genes fomdA , fomdB , fomdC , fomdD , fomdF and fomdE Aspergillus oryzae Aspergillus oryzae NSAR1.

4. The method for preparing the tetracyclic disesquiterpenoid compound from the biosynthetic gene cluster fomd according to claim 1, characterized in that, via Aspergillus oryzae Aspergillus oryzae The NSAR1 method of heterologous expression expresses genes from the fomd gene cluster of tetracyclic disesquiterpenoids as described in claim 1 in Fusarium oxysporum 14005 to obtain tetracyclic disesquiterpenoids Mangicol J, Mangicol L, and Mangicol M.

5. The method for preparing tetracyclic disesquiterpenoids according to claim 4, characterized in that, The preparation method of the tetracyclic disesquiterpene compound includes the following steps: (1) with Fusarium oxysporum Using the genome of 14005 as a template, primers fomdE-F / fomdE-R, fomdA-F / fomdA-R, fomdC-F / fomdC-R, fomdD-F / fomdD-R, fomdB-F / fomdB-R, and fomdF-F / fomdF-R were used to target the genes of disesquiterpene synthases. fomdE Cytochrome P450 enzyme gene fomdA , fomdC , fomdD Aldehyde reductase gene fomdB Hydrolytic enzyme gene fomdF PCR amplification was performed to obtain the gene. fomdE , fomdA , fomdC , fomdD , fomdB and fomdF The PCR product; then as Aspergillus oryzae Aspergillus oryzae The NSAR1 expression vector pUARA4 was used to construct the vector. fomdE , fomdA and fomdC co-expression vector pUARA4- fomdACE Aspergillus oryzae Aspergillus oryzae The NSAR1 expression vector pUSA4 was used to construct the vector. fomdD , fomdB and fomdF co-expression vector pUSA4- fomdBDF ; (2) Under the mediation of PEG solvent, the co-expression vector pUARA4- fomdACE and pUSA4- fomdBDF Co-transformed into Aspergillus oryzae, a high-yield host that readily expresses terpene synthase genes. A. oryzae In the protoplasts of NSAR1, Aspergillus oryzae transformants AO- were obtained that could produce tetracyclic disesquiterpenoids Mangicol J, Mangicol L, and Mangicol M. fomdABCDEF ; (3) Transformers of Aspergillus oryzae AO- fomdABCDEF Mycelia were inoculated and cultured to produce tetracyclic disesquiterpenoid compounds Mangicol J, Mangicol L, and Mangicol M.

6. The method for preparing tetracyclic disesquiterpenoids according to claim 5, characterized in that, The nucleotide sequences of the primers fomdE-F / fomdE-R, fomdA-F / fomdA-R, fomdC-F / fomdC-R, fomdD-F / fomdD-R, fomdB-F / fomdB-R, and fomdF-F / fomdF-R are as follows: fomdA -F:AAGCTCCGAATTCGAGCTCGATGGAGTACAGTGAGCTTAGCCTAG, fomdA -R:GAGCTACTACAGATCCCCGGTCAACAGTTCAGCGTAGATAAGTCC, fomdB -F:TTCGAATCGATTTGAGCTAGATGTCTCAGAAAGGCCCCCA, fomdB -R:ATCGGGTACGAGGCCGCTAGCTATGCTTCAAATACTGACCCAAAG, fomdC -F:AGCTCCGGAATTCGAGCTCGATGGCACACTACGACTTCAA, fomdC -R:AGCTACTACAGATCCCCGGCTAGTTAGAAAATGACTCAAACATGG, fomdD -F:CCCCACAGCAAGCTCCGTTAATGGACTTCACTTATCGCTACTCTT, fomdD -R:GTGCATATGATTTAAATTTACTATTCCACACGCAGCATCTCAAGA, fomdE -F:TTCGAATCGATTTGAGCTAGATGGGCAATTTCAGGTTAGATAATG, fomdE -R:GTCACTAGTGCGGCGCTAGCTACTTGATGGTGACTCGAA, fomdF -F:CCCCACAGCAAGCTCCGTTAATGAAGTTACTCGCTCTGTC, fomdF -R:GTGCATATGATTTAAATTTATCACGCCTGGCACAGAGCTC。 7. The method for preparing tetracyclic disesquiterpenoids according to claim 5, characterized in that, In step (3), the Aspergillus oryzae transformant AO- fomdABCDEF The method for inoculating and culturing the mycelium of Aspergillus oryzae is as follows: Aspergillus oryzae transformants AO- fomdABCDEF The mycelium was inoculated into MPY medium containing 0.1% adenine and cultured at 30℃ and 220 rpm for 2 days as seed culture. The seed culture was then inoculated into rice solid medium containing 0.1% adenine at a ratio of 80 g rice to 120 mL deionized water and added to 5 mL of seed culture. The culture was then incubated at 30℃ for 18 days.

8. The method for preparing tetracyclic disesquiterpenoids according to claim 5, characterized in that, In step (3), the Aspergillus oryzae transformant AO- fomdABCDEF After inoculating and culturing the mycelium, AO- fomdABCDEF The solid-state fermentation product was extracted three times with an equal volume of ethyl acetate, and the extract was evaporated to dryness to obtain an extract. The extract was extracted with petroleum ether to obtain fractions with low polarity. The petroleum ether extract was evaporated to dryness and then subjected to normal-phase separation. The target fractions Fr.5 and Fr.7 were eluted and enriched using petroleum ether and ethyl acetate as mobile phases. Fr.5 was separated by gel column chromatography, and finally Mangicol K was obtained by elution using a reversed-phase Cholester column with acetonitrile / 0.1% formic acid water at a volume ratio of 80:

20. Fr.7 was separated by gel column chromatography to obtain three fractions Fr.7.1-Fr.7.

3. Fr.7.2 was semi-preparatively separated using an ACE C18-PFP column with acetonitrile / 0.1% formic acid water at a volume ratio of 75:25 as mobile phase. O and fraction Fr. 7.2.1; fraction Fr. 7.2.1 was further eluted using a hand-type Chiralpak IA column with a hexane / ethanol volume ratio of 95:5 as the mobile phase to obtain Mangicols H and I, Fr. 7.

3. Semi-preparative elution was performed using a Phenomenex column with an acetonitrile / 0.1% formic acid water volume ratio of 80:20 as the mobile phase to obtain Mangicol L, Mangicol N, and Mangicol P, as well as fraction Fr. 7.3.1; fraction Fr. 7.3.1 was further eluted using a hand-type Chiralpak IA column with a hexane / ethanol volume ratio of 94:6 as the mobile phase to obtain Mangicol J and Mangicol M.

Citation Information

Patent Citations

  • Mangicols sesterterpene compounds, synthetic method, gene cluster, nucleic acid molecule, construct and application of Mangicols sesterterpene compound

    CN112142585A

  • Sesterterpene skeleton compound as well as synthetic gene and preparation method thereof

    CN113046332A