Recombinant microorganism for producing o-phosphoserine, and method for producing o-phosphoserine, cysteine, and derivatives thereof using same
A recombinant microorganism with enhanced MntH and YhhS variants addresses the inefficiency in OPS production, leading to improved yields of O-phosphoric acid and L-cysteine through optimized microbial fermentation.
Patent Information
- Application Number
- PCT/KR2024/014867
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-09-30
- Filing Date
- 2024-09-30
- Publication Date
- 2026-04-02
AI Technical Summary
Existing methods for producing L-cysteine require excessive production of OPS, a precursor, which is inefficient and not optimally addressed by current microbial fermentation processes.
A recombinant microorganism with enhanced MntH protein activity and YhhS variant, specifically modified at certain amino acid positions, is used to increase O-phosphoric acid production, thereby improving OPS yield and subsequent L-cysteine production.
The recombinant microorganism achieves higher yields of O-phosphoric acid and L-cysteine by optimizing OPS production, enhancing the microbial fermentation process efficiency.
Abstract
Description
O-phosphoric acid-producing recombinant microorganism and method for producing O-phosphoric acid, cysteine, and derivatives thereof using the same
[0001] The present application relates to a recombinant microorganism with increased O-phosphoric acid production capacity, and a method for producing O-phosphoric acid, cysteine, and derivatives thereof using the same.
[0002]
[0003] L-cysteine is an important amino acid in the sulfur metabolism of all living organisms, and is used not only in the synthesis of proteins in the body such as hair keratin, glutathione, biotin, methionine, and other sulfur-containing metabolites, but also as a precursor for the biosynthesis of coenzyme A.
[0004] Methods for producing L-cysteine using microorganisms include: 1) a method of biologically converting D,L-ATC (D,L-2-amino-2-thiazoline-4-carboxylate) using microorganisms; 2) a direct fermentation method of producing L-cysteine using E. coli (European Patent EP0885962B; Wada M and Takagi H, Appl. Microbiol. Biochem., 73:48-54, 2006); and 3) a method of producing O-phosphoserine (hereinafter "OPS") by fermentation using microorganisms, and then converting it into L-cysteine by reacting it with a sulfide under the catalytic action of O-phosphoserine sulfhydrylase (hereinafter "OPSS") (US 8557549 B2).
[0005] At this time, in order to produce high yield cysteine using the above 3) method, there was a need to produce an excess amount of the precursor OPS.
[0006]
[0007] The present application aims to provide a recombinant microorganism with increased O-phosphoric acid production capacity, and a method for producing O-phosphoric acid, cysteine, and derivatives thereof using the same.
[0008]
[0009] One objective of the present application is to provide a recombinant microorganism for producing O-phosphorin, comprising (a) an enhanced activity of the MntH protein relative to its intrinsic activity, and (b) a YhhS variant in which an amino acid corresponding to a specific position of the amino acid sequence of SEQ ID NO. 3 is substituted with another amino acid.
[0010] Another objective of the present application is to provide a recombinant microorganism for producing O-phosphorin, wherein (a) the activity of the MntH protein is enhanced relative to its intrinsic activity, (b) the YhhS variant in which an amino acid corresponding to a specific position of the amino acid sequence of SEQ ID NO. 3 is substituted with another amino acid, and (c) the activity of the Ahp protein is enhanced relative to its intrinsic activity.
[0011] Another objective of the present application is to provide a method for producing O-phosphorin using the recombinant microorganism for O-phosphorin production of the present application.
[0012] Another objective of the present application is to provide a method for producing cysteine or a derivative thereof using the recombinant microorganism for producing O-phosphorin of the present application.
[0013]
[0014] When O-phosphoric acid is produced using the O-phosphoric acid-producing recombinant microorganism of the present application, it is possible to produce O-phosphoric acid at a high yield compared to using existing non-modified strains.
[0015]
[0016] This is explained in detail as follows. Meanwhile, each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application should not be considered limited by the specific descriptions provided below.
[0017] Furthermore, numerous papers and patent documents are referenced and cited throughout this specification. The disclosures of the cited papers and patent documents are incorporated by reference into this specification in their entirety to more clearly explain the state of the art to which this application pertains and the content of this application.
[0018]
[0019] One aspect of the present application provides a recombinant microorganism for producing O-phosphorin, comprising (a) an MntH protein whose activity is enhanced relative to its intrinsic activity, and (b) a YhhS variant in which an amino acid corresponding to a specific position of the amino acid sequence of SEQ ID NO. 3 is substituted with another amino acid.
[0020] Specifically, the recombinant microorganism for producing O-phosphorin may include a YhhS variant in which (a) the activity of the MntH protein is enhanced compared to its intrinsic activity, and (b) the amino acid corresponding to the 129th and / or 241st position of the amino acid sequence of SEQ ID NO. 3 is substituted with another amino acid.
[0021] Additionally, specifically, the YhhS variant may be one in which the amino acid corresponding to the 246th and / or 330th position of the amino acid sequence of SEQ ID NO. 3 is additionally substituted with another amino acid.
[0022]
[0023] In this application, the term "O-phosphoserine (OPS)" refers to a phosphoric acid ester of serine and is a component of various proteins. The OPS is a precursor of L-cysteine and can be converted to cysteine by reacting with a sulfide under the catalytic action of OPS sulfhydrylase (OPSS), but is not limited thereto (US Patent 8557549 B2).
[0024]
[0025] The recombinant microorganism for O-phosphorin production of the present application is a microorganism in which the activity of the MntH protein is enhanced compared to its intrinsic activity.
[0026] In this application, the term "MntH protein" refers to a protein having divalent ion transporter activity classified as the NRAMP family, such as Mn 2+ It may be an influent NRAMP. In this application, the term "Mn 2+ Influx of NRAMP (natural resistance-associated macrophage protein) transporter (Mn 2+ The uptake NRAMP transporter, MntH,” is Mn 2+ / Fe 2+ : H + As a protein with symporator activity, it has the activity of introducing manganese (Mn) into the cell.
[0027] The amino acid sequence of the above MntH protein can be obtained from known databases such as NCBI's Genebank.
[0028] For example, the MntH protein of the present application may be derived from a microorganism. Specifically, the microorganism may be derived from a microorganism of the genus Escherichiasp., but is not limited thereto.
[0029] As another example, the amino acid sequence of the MntH protein of the present application may be WP000186369.1 or EEW8215783.1 derived from Escherichia coli, but it is obvious that it includes proteins having MntH protein activity of various origins.
[0030] In the present application, the MntH protein may have, include, be composed of, or essentially consist of the amino acid sequence of SEQ ID NO. 1.
[0031] In the present application, the MntH protein may comprise an amino acid sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO. 1. Furthermore, it is obvious that a protein having an amino acid sequence in which some sequences are deleted, modified, substituted, conservatively substituted, or added is included within the scope of the present application, provided that such an amino acid sequence has such homology or identity and exhibits efficacy corresponding to that of a protein comprising the amino acid sequence of SEQ ID NO. 1. For example, it may be composed of 412 to 428 amino acids including the amino acid sequence of SEQ ID NO. 1.
[0032] For example, this includes cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions that do not alter the function of the protein of the present application at the N-terminus, C-terminus, and / or within the above amino acid sequence.
[0033] The above "conservative substitution" refers to the substitution of one amino acid with another amino acid having similar structural and / or chemical properties. Such amino acid substitutions can generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphipathic nature of the residues. For example, among amino acids having electrically charged side chains, positively charged (basic) amino acids include arginine, lysine, and histidine, and negatively charged (acidic) amino acids include glutamic acid and aspartic acid; Among amino acids having uncharged side chains, nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline; polar or hydrophilic amino acids include serine, threonine, cysteine, tyrosine, asparagine, and glutamine; and among the above amino acids, aromatic amino acids include phenylalanine, tryptophan, and tyrosine. Typically, conservative substitutions have little to no effect on the activity of a protein or polypeptide.
[0034]
[0035] In this application, the terms “homology” or “identity” refer to the degree of similarity between two given amino acid sequences or base sequences and may be expressed as a percentage. The terms homology and identity may often be used interchangeably.
[0036] Sequence homology or identity of conserved polynucleotides or polypeptides is determined by standard arrangement algorithms, and a default gap penalty established by the program used may be utilized. Practically, homologous or identical sequences can generally be hybridized with the entire sequence or a part thereof under moderate or high stringent conditions. It is evident that hybridization also includes hybridization with polynucleotides containing common codons or codons that account for codon degeneracy.
[0037] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using a known computer algorithm, such as the “FASTA” program, using default parameters as in, for example, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (GCG program package (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] (Including Academic Press, San Diego, 1994, and [CARILLO ET AL](1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity can be determined using BLAST from the National Biotechnology Information Database Center or ClustalW.
[0038] The homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482, or Needleman et al. (1970), J Mol Biol. 48:443. In summary, a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly arranged symbols (i.e., nucleotides or amino acids). The default parameters for a GAP program are (1) a unitary matrix (containing values of 1 for identity and 0 for non-identity) and, as disclosed by Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979), or Gribskov et al. (1986) Nucl. Acids Res. 14: A weighted comparison matrix of 6745 (or an EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix); (2) a penalty of 3.0 for each gap and an additional penalty of 0.10 for each symbol in each gap (or a gap opening penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for terminal gaps.
[0039]
[0040] The MntH protein of the present application may be encoded by the mntH gene.
[0041] For example, the mntH gene may be a polynucleotide encoding EEW8215783.1 derived from Escherichia coli, but is not limited thereto. For another example, the mntH gene may be a polynucleotide encoding WP_000186369.1 derived from Escherichia coli, and for yet another example, may be a sequence contained in CP116188.1 derived from Escherichia coli, but is not limited thereto. It is evident that it includes mntH genes of various origins encoding proteins having MntH protein activity.
[0042] In this application, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are linked together in a long chain by covalent bonds, such as a DNA or RNA strand of a certain length or longer, and more specifically, a polynucleotide fragment encoding the protein.
[0043] The polynucleotide encoding the MntH protein of the present application may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO. 1. As an example of the present application, the polynucleotide of the present application may have or include the nucleotide sequence of SEQ ID NO. 2. Additionally, the polynucleotide of the present application may be composed of or essentially constitute the nucleotide sequence of SEQ ID NO. 2. Specifically, the mntH gene may be encoded by the polynucleotide described by the nucleotide sequence of SEQ ID NO. 2.
[0044] The polynucleotide of the present application may have various modifications made to its coding region within a range that does not alter the amino acid sequence of the MntH protein, taking into account the degeneracy of codons or the codons preferred by the organism intended to express the MntH protein of the present application. Specifically, the polynucleotide encoding the MntH protein of the present application may have or include a nucleotide sequence having homology or identity of 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, or may be composed of or essentially composed of a nucleotide sequence having homology or identity of 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, but is not limited thereto.
[0045] Additionally, the polynucleotide of the present application may include, without limitation, probes that can be prepared from known gene sequences, for example, sequences that can be hybridized under stringent conditions with a sequence complementary to all or part of the polynucleotide sequence of the present application. The "stringent condition" means a condition that enables specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51, 11.7-11.8). For example, conditions may be listed in which polynucleotides with high homology or identity are hybridized with each other, with homology or identity of 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, and polynucleotides with lower homology or identity are not hybridized with each other, or conditions in which the polynucleotides are washed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions of conventional southern hybridization, which are 60°C, 1×SSC, 0.1% SDS, specifically 60°C, 0.1×SSC, 0.1% SDS, more specifically 68°C, 0.1×SSC, 0.1% SDS.
[0046] Hybridization requires that two nucleic acids have complementary sequences, even though a mismatch between bases may be possible depending on the degree of hybridization. The term "complementary" is used to describe the relationship between nucleotide bases that can hybridize with each other. For example, regarding DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Accordingly, the polynucleotides of this application may also include isolated nucleic acid fragments that are complementary to the entire sequence, as well as substantially similar nucleic acid sequences.
[0047] Specifically, a polynucleotide having homology or identity with the polynucleotide of the present application can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and can be appropriately adjusted by a person skilled in the art according to the purpose.
[0048] The appropriate strictness for hybridizing the above polynucleotides depends on the length and degree of complementarity of the polynucleotides, and the variables are well known in the art (e.g., J. Sambrook et al., i.e.).
[0049]
[0050] In this application, the term “vector” means a DNA product containing a polynucleotide sequence encoding a target protein within a suitable host in a form operably linked to a regulatory sequence suitable for expressing the target protein. The expression regulatory sequence may include a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, the vector may replicate or function independently of the host genome and may be incorporated into the genome itself.
[0051] The vector used in this application is not particularly limited as long as it is capable of replicating within a host cell, and any vector known in the art may be used. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A may be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, pUC-based, pBluescriptII-based, pGEM-based, pTZ-based, pCL-based, and pET-based vectors may be used as plasmid vectors. Specifically, vectors such as pSKH130 (US Patent Publication US 2020-0048619), pSK, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, and pCC1BAC can be used.
[0052] The insertion of the above polynucleotide into the chromosome may be achieved by any method known in the art, for example, homologous recombination, but is not limited thereto.
[0053] In this application, the term "transformation" means introducing a recombinant vector containing a polynucleotide encoding a target protein into a host cell so that the protein encoded by said polynucleotide can be expressed within the host cell. As long as the transformed polynucleotide can be expressed within the host cell, it may include all of the following: inserted into the chromosomes of the host cell or located outside the chromosomes. The method of transformation includes any method of introducing nucleic acid into a cell, and depending on the host cell, a suitable standard technique as known in the art may be selected and performed. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.
[0054] In addition, the term "operably linked" as used above means that a polynucleotide sequence is functionally linked to a promoter sequence or expression regulatory region that initiates and mediates the transcription of the polynucleotide encoding the target protein of the present application. Operable linkage can be produced using gene recombination techniques known in the art, and site-specific DNA cleavage and linkage can be produced using cleavage and linkage enzymes of the art, but is not limited thereto.
[0055]
[0056] In this application, the term "enhancement" of polypeptide (including, for example, proteins specified by the names of each enzyme) means that the activity of the polypeptide is increased compared to its intrinsic activity. The term enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase. Here, activation, enhancement, up-regulation, overexpression, and increase may include exhibiting activity that was not originally possessed, or exhibiting improved activity compared to the intrinsic activity or activity prior to modification. The term "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain or the non-modified microorganism prior to the change in traits caused by genetic mutations due to natural or artificial factors. This may be used interchangeably with "activity prior to modification." "Enhancement," "upregulation," "overexpression," or "increase" of polypeptide activity relative to intrinsic activity means that it has been enhanced compared to the activity and / or concentration (expression amount) of a specific polypeptide originally possessed by the parent strain or non-modified microorganism prior to transformation.
[0057] The above enhancement can be achieved by introducing an exogenous polypeptide or by enhancing the activity and / or concentration (expression amount) of the intrinsic polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by an increase in the activity level, expression amount, or amount of product released from the polypeptide.
[0058] For the purposes of this application, the microorganism of this application has enhanced OPS production capacity as it possesses enhanced MntH protein activity, and the non-modified microorganism without enhanced MntH protein, which is the target strain for comparing whether said OPS production capacity or MntH protein has increased, may be wild-type Escherichia coli K-12 W3110 or CA07-0012 strains, but is not limited thereto.
[0059]
[0060] The enhancement of the activity of the above polypeptide may be achieved by applying various methods well known in the art, and is not limited to, as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification. Specifically, it may utilize, but is not limited to, gene engineering and / or protein engineering known to a person skilled in the art, which are routine methods of molecular biology (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
[0061] Specifically, the enhancement of the activity of the polypeptide of the present application is
[0062] 1) Increase in the intracellular copy number of polynucleotides encoding polypeptides;
[0063] 2) Modification of a chromosomal gene expression regulatory sequence encoding a polypeptide;
[0064] 3) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;
[0065] 4) Modification of the amino acid sequence of the polypeptide to enhance polypeptide activity;
[0066] 5) Modification of the polynucleotide sequence encoding the polypeptide to enhance polypeptide activity (e.g., modification of the polynucleotide sequence of the polypeptide gene to code for a polypeptide modified to enhance polypeptide activity);
[0067] 6) Introduction of an exogenous polypeptide exhibiting polypeptide activity or an exogenous polynucleotide encoding the same;
[0068] 7) Codon optimization of polynucleotides encoding polypeptides;
[0069] 8) Analyze the tertiary structure of the polypeptide to select and modify or chemically modify the exposed sites;
[0070] 9) Regulation of cellular localization of proteins (polypeptides); or
[0071] 10) It may be a combination of two or more selected from 1) to 9) above, but is not specifically limited thereto.
[0072] More specifically,
[0073] The increase in the intracellular copy number of the polynucleotide encoding the protein (polypeptide) described in 1) above may be achieved by introducing a vector containing the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence into a host cell (microorganism). Alternatively, one or more copies of the polynucleotide encoding the protein (polypeptide) operably linked to an appropriate regulatory sequence may be introduced into the chromosomes within the host cell (microorganism). The introduction into the chromosomes may be performed by introducing a vector capable of inserting the polynucleotide into the chromosomes within the host cell (microorganism), but is not limited thereto. The vector is as described above. The regulatory sequence may be a natural form (of the same origin) or a foreign sequence (derived from a different gene) with respect to the polynucleotide sequence, a variant of these, or another artificial sequence, and may induce the expression of the polynucleotide within the host cell (microorganism).
[0074] The replacement of a gene expression regulatory region (or expression regulatory sequence) on a chromosome encoding a protein (polypeptide) in the above 2) with a sequence having greater activity may, for example, involve introducing a sequence variation by deletion, insertion, substitution, or a combination thereof to further increase the activity of the expression regulatory region, or by replacing it with a sequence having greater activity. The expression regulatory region may include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation. As an example, the original promoter may be replaced with a potent promoter, but is not limited thereto.
[0075] Examples of known strong promoters include, but are not limited to, cj1 to cj7 promoters (US Patent No. 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13(sm3) promoter (US Patent No. 10584338 B2), O2 promoter (US Patent No. 10273491 B2), tkt promoter and yccA promoter, rmf promoter, serC promoter, etc.
[0076] The above 3) modification of the nucleotide sequence of the region coding for the start codon or 5'-UTR of the gene coding for the protein (polypeptide) may be, for example, a modification that codes for another start codon with a higher protein (polypeptide) expression rate compared to the intrinsic start codon, or an RBS sequence with a higher protein (polypeptide) expression rate compared to the intrinsic RBS (ribosome binding site) sequence, but is not limited thereto.
[0077] The modification of the amino acid sequence or polynucleotide sequence of the protein (polypeptide) in 4) and 5) above may be the introduction of a sequence variation by deletion, insertion, substitution, or a combination thereof to the amino acid sequence of the protein (polypeptide) or the polynucleotide sequence encoding the protein (polypeptide) to increase the activity of the protein (polypeptide), or the replacement with an amino acid sequence or polynucleotide sequence modified to increase activity, but is not limited thereto. The replacement may be performed, for example, by inserting the polynucleotide into the chromosome by homologous recombination, but is not limited thereto.
[0078] The introduction of an exogenous polynucleotide exhibiting the activity of the protein (polypeptide) described in 6) above may be the introduction into a host cell (microorganism) of an exogenous polynucleotide encoding a protein (polypeptide) that exhibits the same or similar activity as the protein (polypeptide). As long as the exogenous polynucleotide exhibits the same or similar activity as the protein (polypeptide), there are no restrictions on its origin or sequence. The method used for the introduction may be performed by a person skilled in the art by appropriately selecting a known transformation method, and the protein (polypeptide) may be produced and its activity increased by the expression of the introduced polynucleotide within the host cell.
[0079] The above 7) codon optimization of a polynucleotide encoding a protein (polypeptide) may be a codon optimization of the endogenous polynucleotide so that transcription or translation increases within the host cell (microorganism), or a codon optimization of the exogenous polynucleotide so that optimized transcription and translation occur within the host cell (microorganism).
[0080] 8) Analyzing the tertiary structure of the protein (polypeptide) above to select an exposed site for modification or chemical modification may, for example, involve determining a template protein candidate based on the degree of sequence similarity by comparing the sequence information of the protein (polypeptide) to be analyzed with a database in which sequence information of known proteins is stored, and confirming the structure based on this to select an exposed site to modify or chemically modify.
[0081] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.
[0082] Such an increase in protein (polypeptide) activity may be an increase in the activity or concentration of the corresponding protein (polypeptide) relative to the activity or concentration of the protein (polypeptide) expressed in the wild-type or pre-modification host cell (microorganism), or an increase in the amount of products attributable to the activity of the said protein (polypeptide), but is not limited thereto.
[0083] In this application, the terms "pre-modification strain" or "pre-modification microorganism" do not exclude strains containing mutations that may naturally occur in microorganisms, and refer to the natural strain itself or a strain prior to a change in phenotype caused by genetic variation due to natural or artificial factors. In this application, the said change in phenotype may be an enhancement of the activity of MntH protein. The terms "pre-modification strain" or "pre-modification microorganism" may be used interchangeably with "non-mutation strain," "non-modified strain," "non-mutation microorganism," "non-modified microorganism," or "reference microorganism."
[0084]
[0085] The recombinant microorganism for producing O-phosphorin of the present application comprises a YhhS variant in which an amino acid corresponding to a specific position of the YhhS protein having the amino acid sequence of SEQ ID NO. 3 is substituted with another amino acid.
[0086] In this application, the term "YhhS" refers to a polypeptide exhibiting O-phosphoserine (OPS) release activity, specifically a membrane protein having the activity to release OPS out of the cell. In this application, the YhhS may be a YhhS MFS (major facilitator superfamily) transporter, which is a membrane protein having the activity to release OPS out of the cell. The YhhS has been identified as a protein exhibiting OPS release activity in E. coli in which growth inhibition has been released under conditions where an excess amount of OPS is present.
[0087] Specifically, the YhhS of the present application may be used in combination with the YhhS MFS transporter. In the present application, the amino acid sequence of the YhhS can be obtained from known databases such as GenBank of NCBI. Specifically, the amino acid sequence may be a polypeptide having YhhS activity encoded by the yhhS gene, and more specifically, may have, include, or be composed of the amino acid sequence of SEQ ID NO. 3, or may be essentially composed of the amino acid sequence.
[0088]
[0089] The YhhS variant of the present application may be one in which the amino acid corresponding to the 129th and / or 241st position of the amino acid sequence of SEQ ID NO. 3 is substituted with another amino acid.
[0090] For example, the amino acid corresponding to the 129th position of the amino acid sequence of SEQ ID NO. 3 may be a polar amino acid. The polar amino acid may be, for example, serine, threonine, cysteine, tyrosine, asparagine, or glutamine, and specifically may be serine.
[0091] The YhhS variant of the present application may be one in which a polar amino acid corresponding to the 129th position based on the amino acid sequence of SEQ ID NO. 3 is substituted with a nonpolar amino acid. The nonpolar amino acid may be, for example, alanine, glycine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, or proline, and specifically may be alanine or glycine. The YhhS variant may include an amino acid sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with an amino acid sequence in which the amino acid corresponding to the 129th position based on the amino acid sequence of SEQ ID NO. 3 is alanine or glycine. Furthermore, it is evident that variants having amino acid sequences in which some sequences are deleted, modified, substituted, conservatively substituted, or added are included within the scope of this application, provided that such amino acid sequences possess homology or identity and exhibit efficacy corresponding to the variants of this application. For example, this includes cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservatively substituted sequences at the N-terminus, C-terminus, and / or within the amino acid sequence that do not alter the function of the variants of this application.
[0092]
[0093] The YhhS variant of the present application may be one in which isoleucine, the amino acid corresponding to the 241st position based on the amino acid sequence of SEQ ID NO. 3, is substituted with threonine or glutamine. The YhhS variant may include an amino acid sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with an amino acid sequence in which the amino acid corresponding to the 241st position based on the amino acid sequence of SEQ ID NO. 3 is threonine or glutamine. Furthermore, it is evident that variants having amino acid sequences in which some sequences are deleted, modified, substituted, conservatively substituted, or added are included within the scope of this application, provided that such amino acid sequences possess homology or identity and exhibit efficacy corresponding to the variants of this application. For example, this includes cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservatively substituted sequences at the N-terminus, C-terminus, and / or within the amino acid sequence that do not alter the function of the variants of this application.
[0094]
[0095] In addition, the YhhS variant of the present application may be a YhhS variant having a combination in which the amino acid corresponding to the 129th position is substituted with another amino acid and the amino acid corresponding to the 241st position is substituted with another amino acid based on the amino acid sequence of SEQ ID NO. 3.
[0096]
[0097] In addition, the YhhS variant of the present application may include, in addition to the substitution of the amino acid corresponding to the 129th and / or 241st position of the amino acid sequence of SEQ ID NO. 3, the amino acid corresponding to the 246th and / or 330th position of the amino acid sequence of SEQ ID NO. 3 is additionally substituted with another amino acid.
[0098] Specifically, it may include aspartic acid, which is the amino acid corresponding to the 246th position of the amino acid sequence of SEQ ID NO. 3, being further substituted with valine, and / or valine, which is the amino acid corresponding to the 330th position of the amino acid sequence of SEQ ID NO. 3, being further substituted with isoleucine.
[0099] In addition, the YhhS variant of the present application may have an amino acid corresponding to the 88th position of the amino acid sequence of SEQ ID NO. 3 that is phenylalanine, and an amino acid corresponding to the 207th position of the amino acid sequence of SEQ ID NO. 3 that is lysine.
[0100]
[0101] Specifically, the YhhS variant of the present application may comprise: Sequence No. 5, in which serine, an amino acid corresponding to the 129th position of the amino acid sequence of Sequence No. 3, is substituted with alanine; Sequence No. 6, in which serine, an amino acid corresponding to the 129th position of the amino acid sequence of Sequence No. 3, is substituted with glycine; Sequence No. 7, in which isoleucine, an amino acid corresponding to the 241st position of the amino acid sequence of Sequence No. 3, is substituted with threonine; Sequence No. 8, in which serine, an amino acid corresponding to the 241st position of the amino acid sequence of Sequence No. 3, is substituted with glutamine; Sequence No. 9, in which serine, an amino acid corresponding to the 129th position of the amino acid sequence of Sequence No. 3, is substituted with glycine; isoleucine, an amino acid corresponding to the 241st position, is substituted with threonine; aspartic acid, an amino acid corresponding to the 246th position, is substituted with valine; and valine, an amino acid corresponding to the 330th position, is substituted with isoleucine.
[0102] The YhhS variant of the present application may be composed of the amino acid sequences of SEQ ID NOs 5 to 9, or may be a polypeptide containing the amino acid sequences.
[0103] Additionally, the YhhS variant of the present application may have at least 99% sequence identity (homology or identity) with the amino acid sequences of SEQ ID NOs 5 to 9, but may have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, and 99.9% sequence identity with the amino acid sequences of SEQ ID NOs 5 to 9. Furthermore, it is obvious that variants having amino acid sequences in which some sequences are deleted, modified, substituted, conservatively substituted, or added are also included within the scope of this application, provided that such amino acid sequences possess such homology or identity and exhibit efficacy corresponding to the YhhS variant of this application.
[0104] Here, the terms "conservative substitution," "homology," or "identity" are as previously described.
[0105]
[0106] In this application, the term "variant" refers to a polypeptide in which one or more amino acids are conservatively substituted and / or modified, resulting in a sequence of amino acids different from that of the variant prior to modification, while retaining functions or properties. Such a variant can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide and evaluating the properties of the modified polypeptide. That is, the capabilities of the variant may be increased, unchanged, or decreased compared to the polypeptide prior to modification. Additionally, some variants may include variants in which one or more parts, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which a portion of the N- and / or C-terminus of a mature protein has been removed. The term "variant" above may be used interchangeably with terms such as variant, modification, variant polypeptide, mutated protein, mutation, and variant (in English expressions, modification, modified polypeptide, modified protein, mutant, mutein, divergent, etc.), and is not limited to these terms as long as they are used with the meaning of being mutated.
[0107] For example, the YhhS variant of the present application may have YhhS activity. Additionally, the variant of the present application may have activity that increases OPS release compared to the wild-type polypeptide.
[0108] Additionally, the variant may include deletions or additions of amino acids that have minimal effect on the properties and secondary structure of the polypeptide. For example, a signal (or leader) sequence involved in co-translational or post-translational protein translocation may be conjugated to the N-terminus of the variant. Additionally, the variant may be conjugated with another sequence or linker to enable identification, purification, or synthesis.
[0109] In this application, the term “corresponding to” refers to an amino acid residue at a position listed in the polypeptide, or an amino acid residue that is similar, identical, or homologous to a residue listed in the polypeptide. Identifying the amino acid at the corresponding position may involve determining a specific amino acid of a sequence that references a specific sequence. As used in this application, “corresponding region” generally refers to a similar or corresponding position in a related protein or a reference protein.
[0110] For example, any amino acid sequence can be aligned with sequence number 3, and based on this, each amino acid residue of the said amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of sequence number 3. For example, a sequence alignment algorithm such as that described in the present application can identify the position of an amino acid, or the position where modifications such as substitution, insertion, or deletion occur, by comparing with a query sequence (also referred to as a "reference sequence").
[0111] For such alignment, examples such as the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453), the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000), Trends Genet. 16: 276-277) can be used, but are not limited thereto, and sequence alignment programs and pairwise sequence comparison algorithms known in the art can be appropriately used.
[0112]
[0113] The recombinant microorganism for O-phosphorin production of the present application is a microorganism comprising the aforementioned YhhS variant of the present application, wherein the activity of the MntH protein is enhanced compared to the intrinsic activity. Specifically, the recombinant microorganism may be a microorganism capable of producing O-phosphorin, and the O-phosphorin production capacity may be increased compared to the intrinsic O-phosphorin production capacity.
[0114] In this application, the term “microorganism (or strain)” includes both wild-type microorganisms and microorganisms that have undergone natural or artificial genetic modification, and may be microorganisms in which specific mechanisms are weakened or strengthened due to causes such as the insertion of external genes or the enhancement or inactivation of the activity of endogenous genes, and may be microorganisms that include genetic modification for the production of a desired polypeptide, protein, or product.
[0115] The term "microorganism producing O-phosphorus (OPS)" in this application refers to a microorganism that naturally possesses the ability to produce OPS, or a microorganism in which the ability to produce OPS has been conferred upon a parent strain that lacks the ability to produce OPS. Specifically, the microorganism may be a microorganism that produces OPS, in which the activity of the MntH protein is enhanced and a YhhS variant is included, through natural or artificial genetic modification. For the purposes of this application, any microorganism capable of producing O-phosphorus (OPS) by the method disclosed in this application, in which the activity of the MntH protein is enhanced and a YhhS variant is included, is acceptable. In this application, the term "microorganism producing O-phosphorus (OPS)" may be used interchangeably with "microorganism producing O-phosphorus (OPS)," "microorganism for producing O-phosphorus (OPS)," and "microorganism having the ability to produce O-phosphorus (OPS)."
[0116] For example, the microorganism of the present application may be a genetically modified microorganism or a recombinant microorganism in which the activity of the MntH protein of the present application is enhanced and the desired OPS production capacity is increased, including the YhhS variant of the present application, but is not limited thereto. The recombinant microorganism may be a microorganism in which the O-phosphorin production capacity is increased compared to the intrinsic O-phosphorin production capacity.
[0117] For example, the recombinant microorganism with increased OPS production capacity may be increased by about 1% or more compared to the OPS production capacity of the parent strain before mutation or the non-mutated microorganism, specifically about 1.7% or more, 2% or more, about 2.3% or more, about 3% or more, about 4% or more, about 5% or more, about 5.3% or more, about 6% or more, about 7% or more, about 8% or more, about 9% or more, or about 10% or more (there is no special limit on the upper limit value, for example, it may be about 200% or less, about 150% or less, about 100% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 15% or less), but is not limited thereto as long as it has a positive increase amount compared to the production capacity of the parent strain before mutation or the non-mutated microorganism. In another example, the microorganism with increased production capacity may have an OPS production capacity increased by about 1.01 times, about 1.017 times, about 1.02 times, about 1.023 times, about 1.03 times, about 1.04 times, about 1.05 times, about 1.053 times, about 1.06 times, about 1.07 times, about 1.08 times, about 1.09 times, or about 1.10 times or more compared to the parent strain before mutation or the non-mutated microorganism (the upper limit is not specifically limited and may be, for example, about 10 times or less, about 5 times or less, about 3 times or less, or about 2 times or less), but is not limited thereto.
[0118] In this application, the term "non-mutated microorganism" does not exclude strains containing mutations that may naturally occur in microorganisms, and may refer to wild-type strains or natural-type strains themselves, or strains prior to genetic mutations caused by natural or artificial factors. For example, the non-mutated microorganism may refer to a strain prior to the enhancement of the MntH protein described herein, and / or prior to the introduction or non-introduction of the YhhS variant. The term "non-mutated microorganism" may be used interchangeably with "pre-mutation strain," "pre-mutation microorganism," "non-mutated strain," "non-mutated strain," "non-mutated microorganism," or "reference microorganism."
[0119] As another example of the present application, the microorganism of the present application may be a microorganism capable of producing O-phosphorin, and its type is not particularly limited. The microorganism of the present application may be either a prokaryotic cell or a eukaryotic cell, but specifically may be a prokaryotic cell. The prokaryotic cell may include, for example, microbial strains belonging to the genera Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, and Brevibacterium, and specifically may be a microorganism of the genus Escherichia, more specifically Escherichia coli, but is not limited thereto. In particular, the microorganisms of the genus Escherichia of the present application can produce OPS and L-serine through SerA, SerC, and SerB, which are enzymes of the L-serine biosynthetic pathway (Ahmed Zahoor, Computational and structural biotechnology journal, vol 3, 2012 October; Wendisch VF et al., Curr Opin Microbiol. 2006 Jun;9(3):268-74; Peters-Wendisch P et al., Appl Environ Microbiol. 2005 Nov;71(11):7 139-44.).
[0120]
[0121] The O-phosphorin-producing microorganism of the present application may additionally have enhanced activity of the Ahp protein compared to its intrinsic activity.
[0122] In this application, the term "alkyl hydroperoxide reductase (Ahp)" refers to a protein having the activity of converting NADH to NAD+. The alkyl hydroperoxide reductase may be used interchangeably with Ahp protein and Ahp.
[0123] The above Ahp protein may consist of AhpC (Alkyl hydroperoxide reductase subunit C) and AhpF (Alkyl hydroperoxide reductase subunit F). The amino acid sequences of AhpC or AhpF can be obtained from known databases such as Genebank of NCBI.
[0124] For example, AhpC or AhpF of the present application may be derived from a microorganism. Specifically, the microorganism may be derived from a microorganism of the genus Escherichia, but is not limited thereto.
[0125] As another example, the amino acid sequence of AhpC in the present application may be UMQ15446.1 derived from Escherichia coli, and the amino acid sequence of AhpF may be WP_000979839.1 derived from Escherichia coli, but it is obvious that it includes proteins having AhpC or AhpF activity of various origins. As an example, AhpC may be UMQ15446.1, EFF4225430.1, or WP_000052796.1, and AhpF may be NCBI Accession No. ANK05951.1, EFS6382721.1, or HCD8516410.1.
[0126] In the present application, AhpC may have, include, be composed of, or essentially consist of the amino acid sequence of SEQ ID NO. 15. In the present application, AhpF may have, include, be composed of, or essentially consist of the amino acid sequence of SEQ ID NO. 17.
[0127] In the present application, the amino acid sequence of AhpC may include an amino acid sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO. 15. In the present application, the amino acid sequence of AhpF may include an amino acid sequence having at least 70%, 75%, 76%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity with the amino acid sequence of SEQ ID NO. 17. Furthermore, it is obvious that proteins having amino acid sequences that exhibit efficacy corresponding to proteins comprising the amino acid sequences of SEQ ID NO. 15 and / or SEQ ID NO. 17, which possess such homology or identity, are also included within the scope of this application, provided that some of the sequences have deletions, modifications, substitutions, conservative substitutions, or additions. For example, AhpC may be composed of 187 to 193 amino acids comprising the amino acid sequence of SEQ ID NO. 15. For example, AhpF may be composed of 521 to 531 amino acids comprising the amino acid sequence of SEQ ID NO. 17. For example, cases where there are sequence additions or deletions, naturally occurring mutations, silent mutations, or conservative substitutions at the N-terminus, C-terminus, and / or within the amino acid sequence that do not alter the function of the protein of this application.
[0128] Here, the terms "conservative substitution," "homology," or "identity" are as previously described.
[0129]
[0130] AhpC and AhpF of the present application may be encoded by the ahpCF operon gene.
[0131] In this application, "operon" refers to a functional unit of DNA comprising a single expression-regulating sequence, specifically a group of genes whose expression is regulated by a single promoter. The mRNA transcribed by the operon may be polycistronic mRNA in which a single mRNA molecule codes for one or more proteins, or monocistronic mRNA in which a single mRNA molecule codes for one protein.
[0132] The above "ahpCF operon gene" may be used interchangeably with "ahpCF operon", "ahpCF gene", and "ahp gene".
[0133] The above ahpCF operon gene may include the ahpC gene and the ahpF gene.
[0134] For example, the ahpC gene may be a polynucleotide encoding UMQ15446.1 derived from Escherichia coli or part of CP101971.1, and the ahpF gene may be a polynucleotide encoding WP_000979839.1 derived from Escherichia coli, but is not limited thereto, and it is evident that it includes ahpC and / or ahpF genes of various origins encoding proteins having AhpC and / or AhpF activity.
[0135] The polynucleotide encoding the Ahp protein of the present application may include a nucleotide sequence encoding the amino acid sequence of SEQ ID NO. 15 and / or SEQ ID NO. 17. As an example of the present application, the polynucleotide of the present application may have or include the nucleotide sequence of SEQ ID NO. 16 and / or SEQ ID NO. 18. Additionally, the polynucleotide of the present application may be composed of or essentially constitute the nucleotide sequence of SEQ ID NO. 16 and / or SEQ ID NO. 18. Specifically, the Ahp protein may be encoded by the polynucleotide described by the nucleotide sequence of SEQ ID NO. 16 and / or SEQ ID NO. 18.
[0136] The polynucleotide encoding the Ahp protein of the present application may undergo various modifications to its coding region within a range that does not alter the amino acid sequence of the Ahp protein, taking into account the degeneracy of codons or codons preferred by the organism intended to express the Ahp protein of the present application. Specifically, the polynucleotide of the present application may have or include a nucleotide sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO. 16 and / or SEQ ID NO. 18, or may be composed of or essentially composed of a nucleotide sequence having 70% or more, 75% or more, 76% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more homology or identity with the sequence of SEQ ID NO. 16 and / or SEQ ID NO. 18, but is not limited thereto.
[0137] Meanwhile, as previously mentioned, an operon is a group of genes whose expression is regulated by a single promoter, and the expression of ahpC and ahpF in the ahpCF operon can be regulated by the ahpC promoter. Therefore, in one embodiment of the present application, the ahpCF operon promoter (ahp operon promoter) may be the ahpC promoter.
[0138]
[0139] The O-phosphoserine-producing microorganism of the present application may additionally have phosphoserine phosphatase (SerB) activity that is weakened compared to the intrinsic activity.
[0140] Since the SerB of the present application has the activity of converting O-phosphorin into L-serine, microorganisms mutated to weaken the SerB activity have the characteristic of accumulating O-phosphorin, and can be usefully utilized for the production of O-phosphorin. The SerB of the present application may be a protein having or including the amino acid sequence described in SEQ ID NO. 19, or a protein composed of or essentially consisting of the amino acid sequence described in SEQ ID NO. 19, but is not limited thereto. Furthermore, as long as the SerB exhibits SerB activity, the SerB of the present application may have or include an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% or more homology or identity with the amino acid sequence described in SEQ ID NO. 19. In addition, the SerB of the present application may be composed of, but is not limited to, an amino acid sequence having at least 70%, 80%, 90%, 95%, or 99% or more homology or identity with the amino acid sequence described in SEQ ID NO. 19. Furthermore, the polynucleotide encoding the SerB may have or include a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO. 19. In addition, the polynucleotide encoding the SerB may be composed of, or essentially consist of, a nucleotide sequence encoding the amino acid sequence described in SEQ ID NO. 19. The polynucleotide encoding the SerB of the present application may undergo various modifications to its coding region within a range that does not alter the amino acid sequence of the SerB protein, due to codon degeneracy or by considering the codons preferred by the organism intended to express the SerB protein. The polynucleotide encoding SerB of the present application may have or include a sequence having at least 70%, 80%, 90%, 95%, or 99% or more and less than 100% homology or identity with the sequence of SEQ ID NO. 20.In addition, the polynucleotide encoding SerB of the present application may be composed of, or essentially constitutes, a sequence having at least 70%, 80%, 90%, 95%, or 99% or more and less than 100% homology or identity with the sequence of SEQ ID NO. 20, but is not limited thereto.
[0141]
[0142] In this application, the term "weakening" of a polypeptide is a concept that encompasses both a decrease in activity relative to its intrinsic activity and the absence of activity. The term "weakening" may be used interchangeably with terms such as inactivation, deficiency, down-regulation, decrease, reduce, and attenuation.
[0143] The above weakening may include cases where the activity of the polypeptide itself is reduced or eliminated compared to the polypeptide activity originally possessed by the microorganism due to mutations in the polynucleotide encoding the polypeptide, etc.; cases where the overall degree and / or concentration (expression amount) of polypeptide activity within the cell is lower than that of the natural strain due to inhibition of gene expression of the polynucleotide encoding it or inhibition of translation into polypeptide; cases where the expression of the polynucleotide does not occur at all; and / or cases where there is no polypeptide activity even if the polynucleotide is expressed. The above "intrinsic activity" refers to the activity of a specific polypeptide originally possessed by the parent strain, wild-type, or non-modified microorganism prior to the change in traits caused by genetic mutations due to natural or artificial factors. This may be used interchangeably with "activity prior to modification." The statement that the activity of a polypeptide is "inactivated, deficient, reduced, downregulated, lowered, or attenuated" relative to its intrinsic activity means that the activity of a specific polypeptide has decreased compared to the activity originally possessed by the parent strain or non-transformed microorganism prior to the transformation.
[0144] The attenuation of the activity of such polypeptides can be performed by any method known in the art, but is not limited thereto, and can be achieved by the application of various methods well known in the art (e.g., Nakashima N et al., Bacterial cellular engineering by genome editing and gene silencing. Int J Mol Sci. 2014;15(2):2773-2793, Sambrook et al. Molecular Cloning 2012 et al.).
[0145]
[0146] Specifically, the weakening of the activity of the polypeptide of the present application is
[0147] 1) Deletion of all or part of a gene encoding a polypeptide;
[0148] 2) Modification of the expression regulatory region (or expression regulatory sequence) to reduce the expression of the gene encoding the polypeptide;
[0149] 3) Modification of the amino acid sequence constituting the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more amino acids in the amino acid sequence);
[0150] 4) Modification of the gene sequence encoding the polypeptide so as to remove or weaken the activity of the polypeptide (e.g., deletion / substitution / addition of one or more nucleotides on the nucleotide sequence of the polypeptide gene to code for a polypeptide modified so as to remove or weaken the activity of the polypeptide);
[0151] 5) A modification of the nucleotide sequence encoding the start codon or the 5'-UTR region of the gene transcript encoding the polypeptide;
[0152] 6) Introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide;
[0153] 7) Addition of a sequence complementary to the Shine-Dalgarno sequence to the upstream end of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure incapable of ribosome attachment;
[0154] 8) Addition of a reverse-transcribed promoter to the 3' end of the open reading frame (ORF) of a gene sequence encoding a polypeptide (Reverse transcription engineering, RTE); or
[0155] 9) Regulation of cellular localization of proteins (polypeptides); or
[0156] 10) It may be based on two or more combinations selected from 1) to 9) above, but is not specifically limited thereto.
[0157] for example,
[0158] The deletion of part or all of the gene encoding the polypeptide mentioned above 1) may be the removal of the entire polynucleotide encoding the intrinsic target polypeptide within the chromosome, the replacement with a polynucleotide in which some nucleotides have been deleted, or the replacement with a marker gene.
[0159] Additionally, modification of the expression regulatory region (or expression regulatory sequence) described in 2) above may be a deletion, insertion, non-conservative or conservative substitution, or a combination thereof, resulting in a mutation on the expression regulatory region (or expression regulatory sequence), or replacement with a sequence having weaker activity. The expression regulatory region includes, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence regulating the termination of transcription and translation.
[0160] The modification of the amino acid sequence or polynucleotide sequence of 3) and 4) above may be a sequence variation occurring by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to weaken the activity of the polypeptide, or a replacement with an amino acid sequence or polynucleotide sequence modified to have weaker activity or an amino acid sequence or polynucleotide sequence modified to have no activity, but is not limited thereto. For example, gene expression may be inhibited or weakened by introducing a variation within the polynucleotide sequence to form a stop codon, but is not limited thereto.
[0161] The above 5) modification of the nucleotide sequence encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide may, for example, be a substitution with a nucleotide sequence encoding another start codon that has a lower polypeptide expression rate compared to the intrinsic start codon, but is not limited thereto.
[0162] For the introduction of an antisense oligonucleotide (e.g., antisense RNA) that binds complementarily to the transcript of the gene encoding the polypeptide 6) mentioned above, refer to the literature [Weintraub, H. et al., Antisense-RNA as a molecular tool for genetic analysis, Reviews - Trends in Genetics, Vol. 1(1) 1986].
[0163] 7) Adding a sequence complementary to the Shine-Dalgarno sequence to the front of the Shine-Dalgarno sequence of a polypeptide-coding gene to form a secondary structure in which ribosome attachment is impossible may make mRNA translation impossible or slow it down.
[0164] Reverse transcription engineering (RTE) of a promoter that is transcribed in the opposite direction to the 3' end of the ORF (open reading frame) of the gene sequence encoding the polypeptide above may weaken the activity by creating an antisense nucleotide complementary to the transcript of the gene encoding the polypeptide.
[0165] The above 9) regulation of the intracellular localization of a protein (polypeptide) may involve targeting the protein (polypeptide) to a specific intracellular organelle or a specific intracellular space. For example, it may involve targeting to the periplasm or cytoplasm through the addition or removal of a leader sequence that functions for the targeting of the protein (polypeptide), but is not limited thereto.
[0166]
[0167] Another aspect of the present application provides a method for producing O-phosphorin, comprising the step of culturing the microorganism of the present application in a culture medium.
[0168] The above O-phosphorin and microorganisms are as described above.
[0169]
[0170] In this application, the term "culture" means growing the microorganism of this application under appropriately controlled environmental conditions. The culture process of this application may be carried out according to suitable media and culture conditions known in the art. Such a culture process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culture may be batch, continuous, and fed-batch, but is not limited thereto.
[0171] In this application, the term "medium" refers to a substance mixed with nutrients as the main component required to culture the microorganism of this application, and supplies nutrients and growth factors, including water, which is indispensable for survival and growth. Specifically, the medium and other culture conditions used for culturing the microorganism of this application may be any medium used for culturing ordinary microorganisms without special limitations; however, the microorganism of this application may be cultured under aerobic conditions while controlling the temperature, pH, etc., in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus, inorganic compounds, amino acids, and / or vitamins.
[0172] In the present application, the carbon source may include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, maltose, etc.; sugar alcohols such as mannitol, sorbitol, etc.; organic acids such as pyruvate, lactic acid, citric acid, etc.; and amino acids such as glutamic acid, methionine, lysine, etc. Additionally, natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice winter, cassava, sugarcane residue, and corn steeping liquid may be used. Specifically, carbohydrates such as glucose and sterilized pre-treated molasses (i.e., molasses converted into reducing sugars) may be used, and other carbon sources in appropriate amounts may be used in various ways without limitation. These carbon sources may be used individually or in combination of two or more types, but are not limited thereto.
[0173] The above nitrogen sources may include inorganic nitrogen sources such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; and organic nitrogen sources such as amino acids such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steep liquid, casein hydrolysate, fish or its decomposition products, defatted soybean cake or its decomposition products, etc. These nitrogen sources may be used alone or in combination of two or more types, but are not limited thereto.
[0174] The above ingredients may include monopotassium phosphate, dipotassium phosphate, or corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, etc., and may also include amino acids, vitamins, and / or suitable precursors. These components or precursors may be added to the culture medium in a batch or continuous manner. However, they are not limited thereto.
[0175] The above-mentioned medium may contain metal salts such as magnesium sulfate or iron sulfate, and may also contain amino acids, vitamins, and suitable precursors. These media or precursors may be added to the culture in a batch or continuous manner, but are not limited thereto.
[0176] For example, in the culture of a recombinant microorganism in which SerB activity is weakened relative to intrinsic activity, the serine requirement of the microorganism is induced, and glycine or serine may be additionally included in the medium. Glycine may be provided in the form of purified glycine, yeast extract containing glycine, or tryptone, and the concentration included in the culture medium may be typically 0.1 to 10 g / L, specifically 0.5 to 3 g / L. Additionally, serine may be provided in the form of purified serine, yeast extract containing serine, tryptone, etc., and the concentration included in the culture medium may be typically 0.1 to 5 g / L, specifically 0.1 to 1 g / L.
[0177] In addition, during the cultivation of the microorganism of the present application, compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc., may be added to the medium in an appropriate manner to adjust the pH of the medium. In addition, during cultivation, an antifoaming agent such as fatty acid polyglycol ester may be used to suppress the formation of bubbles. Furthermore, to maintain an aerobic state of the medium, oxygen or an oxygen-containing gas may be injected into the medium, or nitrogen, hydrogen, or carbon dioxide gas may be injected without gas injection to maintain an anaerobic and microaerobic state, but is not limited thereto.
[0178] In the culture of the present application, the culture temperature may be maintained at 20 to 45°C, specifically 25 to 40°C, and culture may be carried out for about 10 to 160 hours, but is not limited thereto.
[0179] The O-phosphorin produced by the culture of the present application may be secreted into the culture medium or remain within the cell.
[0180]
[0181] The method for producing O-phosphoric acid according to the present application may additionally include, for example, the step of preparing a microorganism according to the present application, the step of preparing a medium for culturing said microorganism, or a combination thereof (in any order), prior to the culturing step.
[0182] The method for producing O-phosphoric acid according to the present application may further include a step of recovering O-phosphoric acid from a culture medium (a culture medium in which the culture is performed) or microorganisms according to the culture. The recovery step may be additionally included after the culture step.
[0183] The above recovery may involve collecting the desired O-phosphorin using a suitable method known in the art according to the culture method of the microorganism of the present application, such as a batch, continuous, or fed-batch culture method. For example, various chromatographs such as centrifugation, filtration, treatment with a crystallizing protein precipitating agent (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, HPLC, or a combination thereof may be used, and the desired O-phosphorin can be recovered from the culture medium or microorganism using a suitable method known in the art.
[0184] In addition, the method for producing O-phosphoric acid according to the present application may additionally include a purification step. The purification may be performed using a suitable method known in the art. In one example, where the method for producing O-phosphoric acid according to the present application includes both a recovery step and a purification step, the recovery step and the purification step may be performed continuously or discontinuously regardless of the order, or simultaneously or integrated into a single step, but are not limited thereto.
[0185]
[0186] Another aspect of the present application provides a method for producing cysteine or a derivative thereof, comprising the steps of: (b) culturing a microorganism of the present application in a medium to produce O-phosphoserine or a medium containing the same; and (b) reacting the O-phosphoserine or the medium containing the same produced in step (a) with a sulfide in the presence of O-phosphoserine sulfliydrylase (OPSS) or a microorganism containing the same.
[0187] The above O-phosphorin and microorganisms are as described above.
[0188]
[0189] In this application, the term "derivative" refers to a similar compound obtained by chemically altering a part of a certain compound, generally meaning a compound in which a hydrogen atom or a specific atomic group is substituted by another atom or atomic group.
[0190] In this application, the term "cysteine derivative" refers to a compound in which a hydrogen atom or a specific atomic group of cysteine is substituted by another atom or atomic group. For example, it may be in the form in which another atom or atomic group is attached to the nitrogen atom of the amine group (-NH2) or the sulfur atom of the thiol group (-SH) of cysteine, examples of which include NAC (N-acetylcysteine), SCMC (S-Carboxymethylcysteine), BOC-CYS(ME)-OH, (R)-S-(2-Amino-2-carboxyethyl)-L-homocysteine, (R)-2-Amino-3-sulfopropionic acid, D-2-Amino-4-(ethylthio)butyric acid, 3-sulfino-L-alanine, Fmoc-Cys(Boc-methyl)-OH, Seleno-L-cysteine, S-(2-Thiazolyl)-L-cysteine, S-(2-Thienyl)-L-cysteine, S-(4-Tolyl)-L-cysteine, etc., but are not limited thereto.
[0191] If cysteine is produced according to the method of the present application, conversion to cysteine derivatives can be easily performed using methods widely known in the art to convert to various cysteine derivatives.
[0192]
[0193] In the present application, the method for producing a cysteine derivative may further include a step of converting the cysteine produced in step (b) into a cysteine derivative.
[0194] Specifically, in the present application, a method for producing a cysteine derivative may include the step of producing cysteine according to the method of the present application described above; and the step of converting the produced cysteine into a cysteine derivative.
[0195] The conversion of the above-mentioned cysteine into cysteine derivatives can be carried out by methods widely known in the art, for example, NAC (N-acetylcysteine) can be synthesized by reacting cysteine with an acetylation agent according to methods known in the art, or SCMC (S-Carboxymetylcysteine) can be synthesized by reacting cysteine with a haloacetic acid under basic conditions, but is not limited thereto.
[0196] The above-mentioned cysteine derivative may be used primarily as a pharmaceutical raw material for antitussives, cough relievers, and treatments for bronchitis, bronchial asthma, and pharyngitis, but is not limited thereto.
[0197]
[0198] In this application, the term "O-phosphoserine sulfhydrylase (OPSS)" refers to an enzyme that catalyzes the reaction of converting O-phosphoserine into cysteine by providing a thiol group (SH group) to O-phosphoserine. The enzyme may have been first identified in Aeropymm pernix, Mycobacterium tuberculosis, Mycobacterium megmatics, and Trichomonas vaginalis (Mino K and Ishikawa K, FEBSletters, 551:133-138, 2003; Bums KE et al. J. Am. Chem. Soc, 127: 11602-11603, 2005). In addition, the above O-phosphorine sulfidrillase includes not only wild-type O-phosphorine sulfidrillase but also variants in which some sequences of the polynucleotide sequence encoding the O-phosphorine sulfidrillase are deleted, substituted, or added, and which exhibit activity equivalent to or greater than the biological activity of the wild-type O-phosphorine sulfidrillase, and may also include all O-phosphorine sulfidrillases and variants thereof disclosed in U.S. Publication US 8557549 B2 and U.S. Publication US 9127324 B2.
[0199] The above sulfide is provided not only in the solid form commonly used in the relevant technical field, but also in the form of a liquid or gas due to differences in pH, pressure, and solubility, as sulfide (S 2- ), thiosulfate (S2O3 2-Any sulfide that can be converted into a thiol group (SH group) in the form of ) etc. may be used without limitation. Specifically, Na2S, NaSH, H2S, (NH4)2S, and Na2S2O3 that provide a thiol group to O-phosphorin may be used, but are not limited thereto. The above reaction is a reaction that produces one cysteine or cysteine derivative by providing one thiol group to one O-phosphorin reactor, and the amount of sulfide added during the above reaction may be 0.1 to 3 times the molar concentration of O-phosphorin, specifically 1 to 2 times, but is not limited thereto.
[0200] In addition, the present application may further include a step of recovering the cysteine produced through the above reaction step. At this time, the desired cysteine can be separated and purified from the reaction solution and collected using a suitable reaction known in the art.
[0201]
[0202] Another aspect of the present application provides a composition for producing derivatives of O-phosphorin, cysteine, or cysteine, comprising the O-phosphorin-producing recombinant microorganism of the present application; a culture medium in which the same is cultured; or a combination thereof.
[0203] The composition of the present application may further include any suitable excipients commonly used in compositions for producing O-phosphoric acid, cysteine, or derivatives of cysteine, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers, or isotonic agents, but are not limited thereto.
[0204]
[0205] Another aspect of the present application provides the use of the O-phosphorin-producing recombinant microorganism of the present application for the production of O-phosphorin, cysteine, or derivatives of cysteine.
[0206]
[0207] The present application will be explained in more detail below through examples. However, the following examples are merely preferred embodiments for illustrating the present application and are therefore not intended to limit the scope of the rights of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily implemented by a person skilled in the art who is proficient in the technical field of the present application or a similar technical field.
[0208]
[0209] Example 1: Preparation of an O-phosphoserine (OPS) producing strain with enhanced MntH expression
[0210] As a result of prior research, in the OPS-producing host strain CA07-0012 (KCCM 11121P, US Patent US 8557549 B2), in which the intrinsic phosphoserine phosphatase (SeB) of wild-type Escherichia coli (E. coli) K-12 W3110 is deficient and OPS degradation ability is weakened, the average transcription amounts of the genes mntH, serC, and rmf were found to be 698, 6215, and 32205, respectively, as shown in Table 1 below. This confirmed that the average transcription amount of the serC gene was 8.9 times higher and the average transcription amount of the rmf gene was 46 times higher than the average transcription amount of the mntH gene. Accordingly, it was confirmed that the serC and rmf gene promoters are relatively stronger promoters than the mntH gene promoter.
[0211]
[0212] Gene nameEarly ExponentialMid ExponentialLate ExponentialStationaryAveragemntH670740792589698serC53855485533886526215rmf3072528192281094179232205
[0213]
[0214] Accordingly, we intended to construct a strain with enhanced MntH expression by additionally inserting the serC promoter (Sequence No. 21) and the rmf promoter (Sequence No. 22), which were confirmed to be more active than the mntH gene (Sequence No. 2), into the end of the promoter of the mntH gene (Sequence No. 2) in the OPS-producing microorganism.
[0215] Specifically, PCR was performed using primer pairs of SEQ ID NOs 23 and 24; SEQ ID NOs 25 and 26; SEQ ID NOs 27 and 28; and SEQ ID NOs 29 and 30, respectively, with the chromosomal DNA of wild-type E. coli ATCC27325 as a template, and gene fragments of the upstream and downstream regions of the wild-type promoter of the mntH gene, as well as the promoter regions of the serC gene and the rmf gene, were obtained.
[0216] PCR is Solg TM Pfu-X DNA polymerase was used, and the process was carried out under conditions of denaturation at 95°C for 2 minutes, followed by denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and polymerization at 72°C for 60 seconds, repeated 30 times, followed by polymerization at 72°C for 5 minutes.
[0217] Recombinant plasmids were obtained by cloning the upstream and downstream fragments of the mntH promoter and the serC promoter fragment or rmf promoter fragment obtained through the above process together with the chromosomal transformation vector pSKH130 (U.S. Patent Publication No. 2020-0048619), which was cleaved with EcoRV restriction enzyme, using an infusion cloning kit, and were named pSKH130_PserC-mntH and pSKH130_Prmf-mntH, respectively.
[0218]
[0219] After transforming the OPS-producing strain CA07-0012 with the pSKH130_PserC-mntH and pSKH130_Prmf-mntH prepared above using electroporation, respectively, strains were obtained in which the promoter sequence of the serC or rmf gene was inserted into the end of the wild promoter sequence of the mntH gene, respectively, through a secondary crossover process. It was confirmed that the serC or rmf promoter sequence was inserted into each strain through PCR and sequencing analysis using the primer pair of SEQ ID NO. 31 and SEQ ID NO. 32, which can amplify the external regions of the corresponding homologous recombination upstream and downstream regions, and the obtained strains were named CA07-0014 (CA07-0012△Pn_mntH::PserC_mntH) and CA07-0015 (CA07-0012△Pn_mntH::Prmf_mntH).
[0220] The primer sequences used for this are as shown in Table 2 below.
[0221]
[0222] Sequence No. 23CTGCAGGAATTCgatAAGGATTCCAGTTTGCCCAT Sequence No. 24GCAATAGAAGCGGCTTCCTGCTTGTGCCTCTAAAAC Sequence No. 25TGAGGGAAACGAGGCATGACGAACTATCGC Sequence No. 26GTCGACTAGCGTgatGACAAAACCGGCAATAGTCA Sequence No. 27TTTTAGAGGCACAAGCAGGAAGCCGCTTCTATTGC Sequence No. 28GCGATAGTTCGTCATGCCTCGTTTCCCTCATACTG Sequence No. 29ACGTGGTGAGGGGAAATGACGAACTATCGCGTTGA Sequence No. 30GTCGACTAGCGTGATATTGACAAAACCGGCAATAG Sequence No. 31TCATACATTTCTGCTATGTT Sequence No. 32AGAGGATCTGAATCAGCATC
[0223]
[0224] Example 2: Production of an O-phosphoserine (OPS) producing strain with the YhhS mutation
[0225] Example 2-1: YhhS variant screening
[0226] To select YhhS variants with increased OPS efflux activity, a yhhS gene variant plasmid library was constructed. The specific procedure is as follows.
[0227] Using the genomic DNA of wild-type Escherichia coli (E. coli) K12 W3110 as a template, random mutagenic PCR was performed using primer pairs with the nucleotide sequences of SEQ ID NOs. 33 and 34 shown in Table 3 below. The procedure was performed using the Takara diversity PCR random mutation kit. The PCR reaction was carried out by denaturing at 94°C for 5 minutes, followed by 20 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes.
[0228] In order to insert the mutant gene fragments produced by this process into the pCL1920 vector containing the rhtB promoter, pCL_PrhtB was first constructed.
[0229] To obtain the rhtB promoter fragment, PCR was performed using SEQ ID NOs 35 and 36 with the genomic DNA of E. coli K12 W3110 as a template. The PCR reaction was performed by denaturing at 94°C for 5 minutes, followed by 30 cycles of denaturation at 94°C for 30 seconds, annealing at 55°C for 30 seconds, and polymerization at 72°C for 1 minute, followed by polymerization at 72°C for 5 minutes. The rhtB promoter fragment was cloned into the pCL1920 vector (GeneBank No. AB236930), which had been cleaved with EcoRI and SalI, using an infusion cloning kit, and pCL_PrhtB was obtained. After cleaving the obtained vector pCL_PrhtB with ScaI, the mutant gene fragments obtained through the above PCR were cloned using an infusion cloning kit. Cloning was performed by reacting at 50°C for 60 minutes, thereby constructing a pCL_PrhtB-yhhS gene variant plasmid library. Subsequently, the library was transformed into the OPS-producing strain CA07-0012 by electroporation.
[0230] Among these, two strains containing variants were selected, and plasmids were obtained from them and their nucleotide sequences were analyzed using sequencing techniques. As a result of the nucleotide sequence analysis, it was confirmed that the selected variants were a variant in which the 129th amino acid residue serine in the amino acid sequence of wild-type YhhS was substituted with glycine, and a variant in which the 241st amino acid residue isoleucine was substituted with glutamine.
[0231] The primer sequences used for this are as shown in Table 3 below.
[0232]
[0233] Sequence No. 33GGAGTTCATCagtATGCCCGAACCCGTAGCC Sequence No. 34CTGCAGGTCGAagtTTAAGATGATGAGGCGGC Sequence No. 35CGACGGCCAGTGAATTCGATGGTCGATGATTAAGACATC Sequence No. 36ATGCCTGCAGGTCGAAGTACTGATGAACTCCCGGTGTGTCT
[0234]
[0235] Example 2-2: Preparation of Vector and Strain for YhhS(S129A / G) Mutation Introduction
[0236] We intended to construct and evaluate a strain to confirm the OPS production capacity when the 129th amino acid residue serine of yhhS obtained in Example 2-1 above is substituted with glycine and other amino acids.
[0237] To insert the yhhS 129th amino acid variant on the chromosome of the strain, trc was used as the promoter, and the insertion site was the mgsA gene site.
[0238] Specifically, we sought to obtain a pSKH130△mgsA plasmid to introduce a form in which the 129th amino acid residue of yhhS at the mgsA gene site is substituted with alanine and glycine. To this end, gene fragments of the upstream and downstream regions of the mgsA gene were obtained using primer pairs of SEQ ID NOs. 37 and 38; and SEQ ID NOs. 39 and 40. After cutting the pSKH130 vector with BamHI, the plasmid was obtained using an infusion cloning kit.
[0239]
[0240] PCR was performed using SEQ ID NOs 41 and 42 to obtain the trc promoter fragment. To obtain the two variant yhhS ORFs, the upstream and downstream fragments of each variant were obtained using primer pairs SEQ ID NOs 43 and 44; SEQ ID NOs 45 and 46; SEQ ID NOs 43 and 47; and SEQ ID NOs 48 and 46. The two obtained upstream and downstream fragments were combined with the trc promoter fragment and a vector obtained by cutting pSKH130△mgsA with ScaI to obtain two plasmids, pSKH130△mgsA::Ptrc_yhhS(S129A) and pSKH130△mgsA::Ptrc_yhhS(S129G), using an infusion cloning kit. In addition, to obtain a strain in which wild-type yhhS was introduced at the mgsA position as a control, the pSKH130△mgsA::Ptrc_yhhS plasmid was constructed. To obtain the yhhS ORF, PCR was performed using the primer pair of SEQ ID NOs 43 and 46, and the plasmid was obtained using an infusion cloning kit with the trc promoter fragment and a vector in which pSKH130△mgsA was cut with ScaI.
[0241] The primer sequences used for this are as shown in Table 4 below.
[0242]
[0243] Sequence No. 37 CCTGCCATCGGATCCGGTATCCGTTTTTGCCACCA Sequence No. 38 ACCTGTGCAATAAGTACTAATGTACATCCGTAGTT Sequence No. 39 CGGATGTACATTAGTACTTATTGCACAGGTGGCAA Sequence No. 40 TGATATCGAATTCCTTCGCTGTTGGTGATGACTGG Sequence No. 41 CGGATGTACATTAGTCGCTTGCTGCAACTCTCTCA Sequence No. 42 GATAGCTCTCCTGTGTGAAATTGTTATCCGCTCAC Sequence No. 43 CACAGGAAAGATATCATGCCCGAACCCGTAGCCGA Sequence No. 44 TCCCGTTCCGGCAAAcgcTTGCCCAATCCCAAGGA Sequence No. 45 CTTGGGATTGGGCAAgcgTTTGCCGGAACGGGATC Sequence No. 46 ACCTGTGCAATAAGTTTAAGATGATGAGGCGGCCT Sequence No. 47ATTGGGCAAgGTTTTGCCGG Sequence Number 48CCGGCAAAACcTTGCCCAAT
[0244]
[0245] The obtained plasmid was transformed into CA07-0014 (CA07-0012△Pn_mntH::PserC_mntH) by electroporation, and two strains were obtained in which the yhhS variant was inserted at the mgsA position through a secondary crossover process. CA07-0014△mgsA::Ptrc_yhhS (S129A) and CA07-0014△mgsA::Ptrc_yhhS (S129G) were obtained through PCR and sequencing analysis using SEQ ID NO. 37 and SEQ ID NO. 46. The strain CA07-0014△mgsA::Ptrc_yhhS, into which the control was introduced, was also obtained through the same method.
[0246] The above CA07-0014△mgsA::Ptrc_yhhS(S129A) strain was named CA07-0017, the CA07-0014△mgsA::Ptrc_yhhS(S129G) strain was named CA07-0018, and the CA07-0014△mgsA::Ptrc_yhhS strain was named CA07-0016, respectively.
[0247]
[0248] Example 2-3: Preparation of vector and strain for YhhS(I241T / Q) mutant introduction
[0249] We intended to construct and evaluate a strain to confirm the OPS production capacity when the 241st amino acid residue isoleucine of yhhS obtained in Example 2-1 above is substituted with glutamine and other amino acids.
[0250] To insert the yhhS 241st amino acid variant on the chromosome of the strain, trc was used as the promoter as in Example 2-2 above, and the insertion site was the mgsA gene site.
[0251] Specifically, we intended to introduce a form in which the 241st amino acid residue of yhhS at the mgsA gene site is substituted with threonine and glutamine. To obtain two variant yhhS ORFs, the upstream and downstream fragments of each variant were obtained using primer pairs of SEQ ID NO. 43 and SEQ ID NO. 49; SEQ ID NO. 50 and SEQ ID NO. 46; SEQ ID NO. 43 and SEQ ID NO. 51; and SEQ ID NO. 52 and SEQ ID NO. 46. The two obtained upstream and downstream fragments were combined with the trc promoter fragment and a vector obtained by cutting pSKH130△mgsA with ScaI to obtain two plasmids, pSKH130△mgsA::Ptrc_yhhS(I241T) and pSKH130△mgsA::Ptrc_yhhS(I241Q).
[0252] The obtained plasmid was transformed into CA07-0014 (CA07-0012△Pn_mntH::PserC_mntH) by electroporation, and two strains were obtained in which a yhhS variant was inserted at the mgsA position through a secondary crossover process, and CA07-0014△mgsA::Ptrc_yhhS(I241T) and CA07-0014△mgsA::Ptrc_yhhS(I241Q) were obtained through PCR and nucleotide sequence analysis using SEQ ID NO. 37 and SEQ ID NO. 46.
[0253] The above strain CA07-0014△mgsA::Ptrc_yhhS(I241T) was named CA07-0019, and the strain CA07-0014△mgsA::Ptrc_yhhS(I241Q) was named CA07-0020, respectively.
[0254] The primer sequences used for this are as shown in Table 5 below.
[0255]
[0256] Sequence No. 49 TTAGCGTCATAAAACAGCGTggtAAAGGTGGCGATGAC Sequence No. 50 GTCATCGCCACCTTTaccACGCTGTTTTATGACGCTAA Sequence No. 51 GCCGGATTTGGCGTCATCGCCACCTTTcagACGCTGTTTTATGACGCT Sequence No. 52 CCAACCTTTAGCGTCATAAAACAGCGTctgAAAGGTGGCGATGACGCC
[0257]
[0258] Examples 2-4: Preparation of vector and strain for introduction of YhhS (S129G / I241T / D246V / V330I) mutant
[0259] To confirm the effects of various variant combinations on yhhS, we intended to construct and evaluate strains to verify OPS production capacity when the yhhS(S129G / I241T / D246V / V330I) variant was inserted.
[0260] To insert the yhhS S129G, I241T, D246V, and V330I amino acid variants onto the chromosome of the strain, trc was used as the promoter as in Example 2-2 above, and the insertion site was the mgsA gene site.
[0261] Specifically, to construct pSKH130△mgsA::Ptrc-yhhS(S129G / I241T / D246V / V330I), the upper and lower fragments of each variant were obtained using primer pairs of SEQ ID NO. 43 and SEQ ID NO. 53 and SEQ ID NO. 54 and SEQ ID NO. 46, respectively, using pSKH130△mgsA::Ptrc_yhhS(S129G / I241T / D246V) plasmid with the trc promoter fragment and a vector obtained by cutting pSKH130△mgsA with ScaI, and the two obtained upper and lower fragments were used to obtain the pSKH130△mgsA::Ptrc_yhhS(S129G / I241T / D246V) plasmid. Using the plasmid thus obtained as a template, the upper and lower fragments of each variant were obtained using primer pairs of SEQ ID NO. 43 and SEQ ID NO. 55; and SEQ ID NO. 56 and SEQ ID NO. 46, respectively. The two types of upper and lower fragments obtained were combined with the trc promoter fragment and a vector obtained by cutting pSKH130△mgsA with ScaI to obtain the pSKH130△mgsA::Ptrc_yhhS(S129G / I241T / D246V / V330I) plasmid using an infusion cloning kit.
[0262] After transforming CA07-0014 (CA07-0012△Pn_mntH::PserC_mntH) using electroporation, a strain with a yhhS variant inserted at the mgsA position was obtained through a secondary crossover process, and CA07-0014△mgsA::Ptrc_yhhS (S129G / I241T / D246V / V330I) was obtained through PCR and nucleotide sequence analysis using SEQ ID NO. 37 and SEQ ID NO. 46.
[0263] The above strain CA07-0014△mgsA::Ptrc_yhhS(S129G / I241T / D246V / V330I) was named CA07-0021.
[0264] The primer sequences used for this are as shown in Table 6 below.
[0265]
[0266] Sequence No. 53CCAACCTTTAGCgacATAAAACAGCGTgatAAAGGTGGCGATGACGCC Sequence No. 54GCCGGATTTGGCGTCATCGCCACCTTTatcACGCTGTTTTATgtcGCT Sequence No. 55CGGAACCGCTTTtatCGCCACTACACCCAA Sequence No. 56TTGGGTGTAGTGGCGataAAAGCGGTTCCG
[0267]
[0268] Example 3: Evaluation of OPS production capacity of an OPS-producing strain with enhanced MntH expression and introduced YhhS mutation
[0269] To evaluate the OPS production capacity of a strain containing a YhhS variant with enhanced MntH expression, the OPS production capacity of the OPS-producing strain prepared in Example 2 above was measured.
[0270] To measure OPS production capacity, the flask fermentation activity of the strains prepared above was evaluated in the manner described below.
[0271] Each strain was plated onto LB solid medium and cultured overnight in a 33°C incubator. The strains cultured overnight on LB solid medium were then inoculated into the following 25 mL potency medium and cultured for 48 hours at 33°C at 200 rpm in an incubator. After the culture was completed, the OPS concentration was measured using HPLC and is shown in Table 7 below.
[0272]
[0273] <Potential Badge>
[0274] Glucose 40g / L, KH2PO46g / L, (NH4)2SO417g / L, MgSO47H2O 1g / L, MnSO44H2O 5mg / L, FeSO47H2O 10mg / L, L-glycine 1.5g / L, yeast extract 2.5g / L, CaCO330g / L, pH 6.8
[0275]
[0276] Strain Name Parent Strain Additional Genotype OPS Concentration (g / L) CA07-0012W3110△serB5.53 CA07-0014 CA07-0012△Pn_mntH::PserC_mntH6.50 CA07-0015 CA07-0012△Pn_mntH::Prmf_mntH6.10 CA07-0016 CA07-0014△mgsA::Ptrc_yhhS7.60 CA07-0017 CA07-0014△mgsA::Ptrc_yhhS(S129A)8.07C A07-0018CA07-0014△mgsA::Ptrc_yhhS(S129G)9.60CA07-0019CA07-0014△mgsA::Ptrc_yhhS(I241T)9.40CA07-0020C A07-0014△mgsA::Ptrc_yhhS(I241Q)8.40CA07-0021CA07-0014△mgsA::Ptrc_yhhS(S129G / I241T / D246V / V330I)10.00
[0277]
[0278] As shown in Table 7 above, the mntH-enhanced CA07-0014 and CA07-0015 strains, based on the CA07-0012 strain as the parent strain, showed an increase in OPS production capacity of 18% and 10%, respectively, compared to the parent strain. In the case of the wild-type yhhS-enhanced strain based on the mntH-enhanced CA07-0014 strain, the OPS production capacity increased by 17% compared to the parent strain. In addition, for strain CA07-0017 with the yhhS(S129A) variant, strain CA07-0018 with the yhhS(S129G) variant, strain CA07-0019 with the yhhS(I241T) variant, strain CA07-0020 with the yhhS(I241Q) variant, and strain CA07-0021 with the yhhS(S129G / I241T / D246V / V330I) variant, the OPS production capacity increased by 24%, 48%, 45%, 29%, and 54%, respectively, compared to the parent strain.
[0279]
[0280] Through these results, it was confirmed that OPS production capacity increases when MntH expression is enhanced and the YhhS variant is included.
[0281]
[0282] Example 4: Preparation of an Ahp-enhanced O-phosphoserine (OPS) producing strain
[0283] As a result of a preliminary study, the average transcription levels of the genes apC, rhtB, serC, and rmf in OPS-producing host strains were determined. As shown in Table 6 below, the values were 11,123, 1,391, 24,861, and 32,205, respectively. This confirmed that the average transcription level of the rmf gene was 2.9 times higher and the average transcription level of the serC gene was 2.2 times higher than that of the apC gene. On the other hand, the average transcription level of the rhtB gene was found to be 0.1 times that of the apC gene. Accordingly, it was confirmed that the rmf and serC gene promoters are relatively stronger promoters than the Ahp operon (ahpCF operon) promoter, and the rhtB gene promoter is a relatively weak promoter.
[0284]
[0285] Gene nameEarly ExponentialMid ExponentialLate ExponentialStationaryAverageahpC1192510860115801012811123rhtB1711184212127991391serC2154221941213523460924861rmf3072528192281094179232205
[0286]
[0287] Accordingly, we intended to construct a strain that enhances the expression of the Ahp gene by additionally inserting the rmf promoter and serC promoter, which were confirmed to be more active than the ahpCF operon, into the end of the promoter of the ahpCF operon in the OPS-producing microorganism.
[0288] Specifically, PCR was performed using primer pairs of SEQ ID NOs. 57 and 58; SEQ ID NOs. 59 and 60; SEQ ID NOs. 61 and 62; and SEQ ID NOs. 63 and 64, respectively, with the chromosomal DNA of wild-type E. coli ATCC27325 as a template, and gene fragments of the upstream and downstream regions of the wild-type promoter of the ahpC gene, the rmf gene, and the promoter region of the serC gene were obtained.
[0289] The upstream and downstream fragments of the ahpC promoter and the rmf promoter fragment or serC promoter fragment obtained through the above process were each cloned using an infusion cloning kit with the chromosomal transformation vector pSKH130, which was cut with EcoRV restriction enzyme, to obtain recombinant plasmids, which were named pSKH130_Prmf-ahp and pSKH130_PserC-ahp.
[0290] After transforming the OPS-producing strain CA07-0012 with the pSKH130_Prmf-ahp and pSKH130_PserC-ahp prepared above using electroporation, respectively, strains were obtained in which the promoter sequence of the rmf or serC gene was inserted into the end of the wild promoter sequence of the aph gene, respectively, through a secondary crossover process. Through PCR and sequencing analysis using primer pairs of SEQ ID NO. 65 and SEQ ID NO. 66 capable of amplifying the external regions of the corresponding homologous recombination upstream and downstream regions, it was confirmed that the rmf or serC promoter sequence was inserted into each strain, and they were named CA07-0022 (CA07-0012△Pn_ahpC-ahpF::Prmf_ahpC-ahpF) and CA07-0023 (CA07-0012△Pn_ahpC-ahpF::PserC-ahpC-ahpF), respectively.
[0291] The primer sequences used for this are as shown in Table 9 below.
[0292]
[0293] Sequence No. 57GCTGCAGGAATTCgatTCCATCAGTTTCTCATTGTC Sequence No. 58CAACGAATACAGGCCTATACTTCCTCCGTGTTTTC Sequence No. 59ACGTGGTGAGGGGAAATGTCCTTGATTAACACCAA Sequence No. 60GTCGACTAGCGTgatCAAGGCGGCTAGCCTGTGAA Sequence No. 61ACGGAGGAAGTATAGCAGGAAGCCGCTTCTATTGC Sequence No. 62TGTTAATCAAGGACATGCCTCGTTTCCCTCATACTG Sequence No. 63ACGGAGGAAGTATAGGCCTGTATTCGTTGTAGTGA Sequence No. 64TAATCAAGGACATTTCCCCTCACCACGTTGCGTTG Sequence No. 65ATATTAAGCGTTTTCTGATC Sequence No. 66TTCTTTCGACGGATGACCAC
[0294]
[0295] In addition, we intended to further enhance Ahp expression in the OPS-producing strain prepared in Example 2 above, which has enhanced MntH expression and has the YhhS mutation introduced.
[0296] Specifically, CA07-0017 (CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(S129A)), CA07-0018 (CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(S129G)), CA07-0019 (CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(I241T)), CA07-0020 (CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(I241Q)), and prepared in Example 2 above. After transforming the CA07-0021 (CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(S129G / I241T / D246V / V330I)) strain with pSKH130_PserC-ahp using electroporation in the manner described above, a strain was obtained in which the promoter sequence of the serC gene was inserted at the end of the wild promoter sequence of the ahp gene through a second crossover process.In addition, through PCR and nucleotide sequence analysis using the primer pair of SEQ ID NO. 63 and SEQ ID NO. 64, it was confirmed that the serC promoter sequence was inserted into each strain, and respectively CA07-0023(CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(S129A)△Pn_ahpC-ahpF::PserC-ahpC-ahpF), CA07-0024(CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(S129G)△Pn_ahpC-ahpF::PserC-ahpC-ahpF), CA07-0025 (CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(I241T)△Pn_ahpC-ahpF::PserC-ahpC-ahpF), CA07-0026 (CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(I241Q)△Pn_ahpC-ahpF::PserC-ahpC-ahpF), and CA07-0027(CA07-0012△Pn_mntH::PserC_mntH△mgsA::Ptrc_yhhS(S129G / I241T / D246V / V330I)△Pn_ahpC-ahpF::PserC-ahpC-ahpF) was secured.
[0297]
[0298] Example 5: Evaluation of OPS production capacity of an OPS-producing strain with enhanced MntH and Ahp expression and introduced YhhS mutation
[0299] To evaluate the OPS production capacity of a strain containing a YhhS variant with enhanced expression of MntH and Ahp, the OPS production capacity of the OPS-producing strain prepared in Example 4 above was measured.
[0300] To measure OPS production capacity, the flask fermentation activity of the strains prepared above was evaluated in the manner described below.
[0301] Each strain was plated onto LB solid medium and cultured overnight in a 33°C incubator. The strains cultured overnight on LB solid medium were then inoculated into the following 25 mL potency medium and cultured in an incubator at 33°C at 200 rpm for 48 hours. After the culture was completed, the OPS concentration was measured using HPLC and is shown in Table 10 below.
[0302]
[0303] <Potential Badge>
[0304] Glucose 40g / L, KH2PO46g / L, (NH4)2SO417g / L, MgSO47H2O 1g / L, MnSO44H2O 5mg / L, FeSO47H2O 10mg / L, L-glycine 1.5g / L, yeast extract 2.5g / L, CaCO330g / L, pH 6.8
[0305]
[0306] Strain nameAdd parent strain GenotypeOPS Concentration (g / L)CA07-0012W3110ΔserB5.53CA07-0022CA07-0012ΔPn_ahpC-ahpF::Prmf_ahpC-ahpF6.20CA07-0023CA07-0012 ΔPn_ahpC-ahpF::PserC-ahpC-ahpF6.40CA07-0024CA07-0017ΔPn_ahpC-ahpF::PserC-ahpC-ahpF9.00CA07-0025CA07 -0018ΔPn_ahpC-ahpF::PserC-ahpC-ahpF11.32CA07-0026CA07-0019ΔPn_ahpC-ahpF::PserC-ahpC-ahpF11.30CA07-0 027CA07-0020ΔPn_ahpC-ahpF::PserC-ahpC-ahpF11.20CA07-0028CA07-0021ΔPn_ahpC-ahpF::PserC-ahpC-ahpF12.00
[0307]
[0308] As shown in Table 10 above, the ahp-enhanced CA07-0022 and CA07-0023 strains, based on the CA07-0012 strain as the parent strain, showed an increase in OPS production capacity of 12% and 16%, respectively, compared to the parent strain. In addition, the OPS production capacity of the CA07-0024, CA07-0025, CA07-0026, CA07-0027, and CA07-0028 strains, which are ahp-enhanced strains based on a strain in which mntH is enhanced and a yhhS variant is introduced, increased by 12%, 18%, 20%, 33%, and 20%, respectively, compared to the parent strain.
[0309] Through these results, it was confirmed that OPS production capacity increases when MntH and Ahp expression is enhanced and the YhhS variant is included.
[0310]
[0311] From the foregoing description, those skilled in the art to which this application pertains will understand that this application may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of this application should be interpreted as including all modifications and variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.
Claims
1. (a) The activity of MntH protein is enhanced relative to its intrinsic activity, and (b) comprising a YhhS variant in which the amino acid corresponding to the 129th and / or 241st position of the amino acid sequence of SEQ ID NO. 3 is substituted with another amino acid, Recombinant microorganism for O-phosphoric acid production.
2. In paragraph 1, the recombinant microorganism is a microorganism in which the O-phosphorin production capacity is increased compared to the intrinsic O-phosphorin production capacity.
3. A microorganism according to claim 1, wherein the MntH protein comprises the amino acid sequence of SEQ ID NO.
1.
4. A microorganism according to claim 1, wherein the polynucleotide encoding the MntH protein comprises the nucleotide sequence of SEQ ID NO.
2.
5. In claim 1, the microorganism in which the YhhS variant is a glycine or alanine substituted for the amino acid corresponding to the 129th position of the amino acid sequence of SEQ ID NO.
3.
6. In claim 1, the microorganism in which the YhhS variant is a microorganism in which the amino acid corresponding to the 241st position of the amino acid sequence of SEQ ID NO. 3 is substituted with threonine or glutamine.
7. The microorganism of claim 1, wherein the YhhS variant is a microorganism in which the amino acid corresponding to the 246th and / or 330th position of the amino acid sequence of SEQ ID NO. 3 is additionally substituted with another amino acid.
8. A microorganism according to claim 7, wherein the amino acid corresponding to the 246th position is substituted with valine.
9. A microorganism according to claim 7, wherein the amino acid corresponding to the 330th position is substituted with isoleucine.
10. A microorganism according to claim 1, wherein the YhhS variant is composed of an amino acid sequence selected from the group consisting of SEQ ID NOs 5 to 9.
11. In paragraph 1, the microorganism is further a microorganism in which the activity of the Ahp protein is enhanced relative to the intrinsic activity.
12. In paragraph 11, the microorganism is a microorganism in which one or more activities selected from the group consisting of AhpC (Alkyl hydroperoxide reductase subunit C) and AhpF (Alkyl hydroperoxide reductase subunit F) are enhanced.
13. In paragraph 11, the microorganism wherein the Ahp protein is encoded by the ahpCF operon gene.
14. In claim 12, the microorganism wherein the above AhpC comprises the amino acid sequence of SEQ ID NO.
15.
15. In paragraph 12, the microorganism wherein the above AhpF comprises the amino acid sequence of SEQ ID NO.
17.
16. In paragraph 1, the microorganism is further a microorganism in which the activity of phosphoserine phosphatase (SeB) is weakened relative to its intrinsic activity.
17. In paragraph 1, the microorganism is a microorganism of the genus Escherichiasp.
18. A method for producing O-phosphorin, comprising the step of culturing a microorganism of any one of claims 1 to 17 in a culture medium.
19. A method for producing O-phosphoric acid according to claim 18, further comprising the step of recovering O-phosphoric acid from the cultured medium or microorganism.
20. (a) a step of culturing a microorganism of any one of claims 1 to 17 in a medium to produce O-phosphorin or a medium containing the same; and (b) a method for producing cysteine or a derivative thereof, comprising the step of reacting the O-phosphoserine produced in step (a) or a medium containing the same with a sulfide in the presence of O-phosphoserine sulfliydrylase (OPSS) or a microorganism containing the same.
21. Use of the O-phosphorin-producing recombinant microorganism of any one of claims 1 to 17 for the production of O-phosphorin, cysteine, or derivatives of cysteine.