LYME disease mRNA vaccines

Abstract

This disclosure provides methods and compositions related to messenger ribonucleic acid (mRNA) vaccines for Lyme disease and related methods of prevention. The mRNA vaccines comprise an mRNA comprising an open reading frame(s) encoding for a protein comprising a Borrelia outer surface protein A (OspA) extracellular domain. In some aspects of the disclosure, the mRNA vaccines comprise an mRNA polynucleotide encoding for a single Borrelia outer surface protein A (OspA) extracellular domain. In some aspects of the disclosure, the mRNA vaccines comprise mRNA polynucleotides collectively encoding for at least seven different Borrelia outer surface protein A (OspA) extracellular domains.

Description

[0001]LYME DISEASE MRNA VACCINES RELATED APPLICATIONS This application claims the benefit under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 63 / 704,156, entitled “LYME DISEASE MRNA VACCINES,” filed on October 7, 2024, the entire contents of each of which are herein incorporated by reference. REFERENCE TO AN ELECTRONIC SEQUENCE LISTING The contents of the electronic sequence listing (M137870308WO00-SEQ-CRP.xml; Size: 211,076 bytes; and Date of Creation: October 6, 2025) are herein incorporated by reference in their entirety. BACKGROUND Lyme disease in the United States is primarily caused by the bacterium Borrelia burgdorferi, which is transmitted to humans through the bite of infected black-legged ticks. In Europe and Asia, Lyme disease is primarily caused by Borrelia afzelii, Borrelia garinii, and / or Borrelia bavariensis. Symptoms of Lyme disease include fever, headache, body aches fatigue, and a skin rash called erythema migrans. Left untreated, the infection can develop into a chronic illness that spreads to joints, the heart, and the nervous system, leading to long-term and serious health problems, such as Bell’s palsy and liver inflammation. There were two Lyme disease vaccines available in the United States, LYMERIX®and IMULYME®, but both were withdrawn from the market years ago due to low demand and concerns about possible side effects. Currently, there are no Lyme disease vaccines approved for use in humans in the United States, yet almost 40,000 cases are reported annually, and the Centers for Disease Control and Prevention estimates that the real number of infections may be 10 times greater. SUMMARY The present disclosure relates to mRNAs encoding Borrelia OspA proteins, including modified Borrelia OspA proteins having improved thermostability and / or improved functionality as vaccine antigens, as well as the use of such mRNAs as vaccines for the prevention of Lyme disease caused by Borrelia infection. Some aspects provide a messenger ribonucleic acid (mRNA) polynucleotide comprising a 5’ UTR, an open reading frame (ORF) encoding a polypeptide, and a 3’ UTR, wherein the polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 1, and wherein the polypeptide comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO:#14388136v1 1). SEQ ID NO: 1 comprises a valine (V) at position 184 and a (T) at position 204 (positions determined sequentially from M1 to K287), and polypeptides described here that have a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), maintain the amino acid corresponding to the valine (V) at position 184 and the amino acid corresponding to the threonine (T) at position 204, but may have variability – relative to SEQ ID NO: 1 – at other amino acid positions (e.g., such that the polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 1). As used herein, the phrases “numbering according to SEQ ID NO: 1” and “relative to the amino acid sequence of SEQ ID NO: 1” are synonymous and carry the same meaning. Position 184 of SEQ ID NO: 1 corresponds to position 170 of the native OspA S1 protein. Position 204 of SEQ ID NO: 1 corresponds to position 204 of the native OspA S1 protein. In some embodiments, the polypeptide comprises: an alanine (A) at position 87; a phenylalanine (F) at position 179; an isoleucine (I) at position 180; a valine at (V) at position 184; a phenylalanine (F) at position 185; a threonine (T) at position 204; a glutamine (Q) at position 216; and a valine (V) at position 267, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). SEQ ID NO: 1 comprises an alanine (A) at position 87, a phenylalanine (F) at position 179, an isoleucine (I) at position 180, a valine at (V) at position 184, a phenylalanine (F) at position 185, a threonine (T) at position 204, a glutamine (Q) at position 216, and a valine (V) at position 267 (positions determined sequentially from M1 to K287), and polypeptides described here that have a phenylalanine (F) at position 179, an isoleucine (I) at position 180, a valine at (V) at position 184, a phenylalanine (F) at position 185, a threonine (T) at position 204, a glutamine (Q) at position 216, and a valine (V) at position 267, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), maintain the amino acid corresponding to the phenylalanine (F) at position 179, the amino acid corresponding to the isoleucine (I) at position 180, the amino acid corresponding to the valine at (V) at position 184, the amino acid corresponding to the phenylalanine (F) at position 185, the amino acid corresponding to the threonine (T) at position 204, the amino acid corresponding to the glutamine (Q) at position 216, and the amino acid corresponding to the valine (V) at position 267, but may have variability – relative to SEQ ID NO: 1 – at other amino acid positions (e.g., such that the polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 1).#14388136v1 In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 1 (which has a valine (V) at position 184 and a threonine (T) at position 204). In some embodiments, the ORF comprises a sequence having at least 90% identity to the of SEQ ID NO: 32. In some embodiments, the ORF comprises the sequence of SEQ ID NO: 32. In some embodiments, 100% of uracil nucleosides in the open reading frame are N1- methylpseudouridine. Other aspects of the disclosure provide a vaccine comprising a messenger ribonucleic acid (mRNA) polynucleotide comprising a 5’ UTR, an open reading frame (ORF) encoding a polypeptide, and a 3’ UTR, wherein the polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 1, and wherein the polypeptide comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the polypeptide comprises: an alanine (A) at position 87; a phenylalanine (F) at position 179; an isoleucine (I) at position 180; a valine at (V) at position 184; a phenylalanine (F) at position 185; a threonine (T) at position 204; a glutamine (Q) at position 216; and a valine (V) at position 267, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the polypeptide comprises the amino acid sequence of SEQ ID NO: 1. In some embodiments, 100% of uracil nucleosides in the open reading frame are N1- methylpseudouridine. In some embodiments, the ORF comprises a sequence having at least 90% identity to the of SEQ ID NO: 32. In some embodiments, the ORF comprises the sequence of SEQ ID NO: 32. In some embodiments, the vaccine further comprises a lipid nanoparticle, wherein the lipid nanoparticle comprises an ionizable lipid, a neutral lipid, a sterol, and optionally a PEG- modified lipid. In some embodiments, the ionizable lipid comprises a structure of Compound (I): the neutral lipid is distearoylphosphatidylcholine (DSPC); the sterol is cholesterol; and / or the PEG-modified lipid, when included is 1,2 dimyristoyl-sn-glycerol, methoxypolyethyleneglycol (PEG-DMG). Other aspects of the disclosure provide a vaccine comprising a plurality of messenger ribonucleic acid (mRNA) polynucleotides, wherein the plurality comprises: (a) a first mRNA#14388136v1 polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a first polypeptide, and a 3’ UTR, wherein the first polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 1, and wherein the first polypeptide comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); (b) a second mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a second polypeptide, and a 3’ UTR, wherein the second polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 2; (c) a third mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a third polypeptide, and a 3’ UTR, wherein the third polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 3; (d) a fourth mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a fourth polypeptide, and a 3’ UTR, wherein the fourth polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 4; (e) a fifth mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a fifth polypeptide, and a 3’ UTR, wherein the fifth polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 5; (f) a sixth mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a sixth polypeptide, and a 3’ UTR, wherein the sixth polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 6; and (g) a seventh mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a seventh polypeptide, and a 3’ UTR, wherein the seventh polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, the first polypeptide comprises: an alanine (A) at position 87; a phenylalanine (F) at position 179; an isoleucine (I) at position 180; a valine at (V) at position 184; a phenylalanine (F) at position 185; a threonine (T) at position 204; a glutamine (Q) at position 216; and a valine (V) at position 267, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the first polypeptide comprises the amino acid sequence of SEQ ID NO: 1 (which has a valine (V) at position 184 and a threonine (T) at position 204); the second polypeptide comprises the amino acid sequence of SEQ ID NO: 2; the third polypeptide#14388136v1 comprises the amino acid sequence of SEQ ID NO: 3; the fourth polypeptide comprises the amino acid sequence of SEQ ID NO: 4; the fifth polypeptide comprises the amino acid sequence of SEQ ID NO: 5; the sixth polypeptide comprises the amino acid sequence of SEQ ID NO: 6; or the seventh polypeptide comprises the amino acid sequence of SEQ ID NO: 7. In some embodiments, the first polypeptide comprises the amino acid sequence of SEQ ID NO: 1 (which has a valine (V) at position 184 and a threonine (T) at position 204); the second polypeptide comprises the amino acid sequence of SEQ ID NO: 2; the third polypeptide comprises the amino acid sequence of SEQ ID NO: 3; the fourth polypeptide comprises the amino acid sequence of SEQ ID NO: 4; the fifth polypeptide comprises the amino acid sequence of SEQ ID NO: 5; the sixth polypeptide comprises the amino acid sequence of SEQ ID NO: 6; and the seventh polypeptide comprises the amino acid sequence of SEQ ID NO: 7. In some embodiments, the ORF of the first mRNA comprises a sequence having at least 90% identity to the sequence shown in SEQ ID NO: 32. In some embodiments, the ORF of the first mRNA comprises the sequence of SEQ ID NO: 32. In some embodiments, a Borrelia burgdorferi OspA S1 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 1, and wherein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the Borrelia burgdorferi OspA S1 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 1 and wherein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the amino acid sequence of the Borrelia burgdorferi OspA S1 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 1 and having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); and / or an amino acid having sequence having at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 1 and having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1)) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX#14388136v1 XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. The amino acid sequences of SEQ ID NOs: 70 and 71 were identified using the multiple sequence alignment shown in FIG. 7. SEQ ID NOs: 70 and 71 represent consensus sequences of highly conserved regions between OspA serotypes. In some embodiments, a Borrelia afzelii OspA S2 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 2. In some embodiments, the Borrelia afzelii OspA S2 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the amino acid sequence of the Borrelia afzelii OspA S2 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 2 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 2) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a Borrelia garinii OspA S3 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 3. In some embodiments, the Borrelia garinii OspA S3 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the amino acid sequence of the Borrelia#14388136v1 garinii OspA S3 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 3 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 3) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a Borrelia bavariensis OspA S4 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 4. In some embodiments, the Borrelia bavariensis OspA S4 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, the amino acid sequence of the Borrelia bavariensis OspA S4 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 4 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 4) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a Borrelia garinii OspA S5 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 5.#14388136v1 In some embodiments, the Borrelia garinii OspA S5 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, the amino acid sequence of the Borrelia garinii OspA S5 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 5 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 5) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a Borrelia garinii OspA S6 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 6. In some embodiments, the Borrelia garinii OspA S6 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, the amino acid sequence of the Borrelia garinii OspA S6 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 6 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 6) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid.#14388136v1 In some embodiments, a Borrelia garinii OspA S7 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 7. In some embodiments, the Borrelia garinii OspA S7 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, the amino acid sequence of the Borrelia garinii OspA S7 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 7 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 7) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, 100% of uracil nucleosides in the open reading frame of the first mRNA polynucleotide are N1-methylpseudouridine; 100% of uracil nucleosides in the open reading frame of the second mRNA polynucleotide are N1-methylpseudouridine; 100% of uracil nucleosides in the open reading frame of the third mRNA polynucleotide are N1- methylpseudouridine; 100% of uracil nucleosides in the open reading frame of the fourth mRNA polynucleotide are N1-methylpseudouridine; 100% of uracil nucleosides in the open reading frame of the fifth mRNA polynucleotide are N1-methylpseudouridine; 100% of uracil nucleosides in the open reading frame of the sixth mRNA polynucleotide are N1- methylpseudouridine; and 100% of uracil nucleosides in the open reading frame of the seventh mRNA polynucleotide are N1-methylpseudouridine. In some embodiments, the vaccine further comprises a lipid nanoparticle, wherein the lipid nanoparticle comprises an ionizable lipid, a neutral lipid, a sterol, and a PEG-modified lipid. In some embodiments, the ionizable lipid comprises a structure of Compound (I):#14388136v1 the neutral lipid is distearoylphosphatidylcholine (DSPC); the sterol is cholesterol; and / or the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethyleneglycol (PEG- DMG). Other aspects of the disclosure provide a method of inducing an immune response to a Borrelia antigen in a subject, the method comprising administering to the subject one or more doses of a vaccine described herein in an effective amount to produce an immune response to a Borrelia antigen in the subject. In some embodiments, the vaccine is administered intramuscularly. In some embodiments, the method comprises administering a dose of 12.5-150 µg of the mRNA comprised in the vaccine. In some embodiments, the method comprises administering a single dose of the vaccine to the subject; or administering a first dose of the vaccine, a second dose of the vaccine, and a third dose of the vaccine. In some embodiments, the second dose is administered two months following the first dose, the third dose is administered six months following the first dose, or a combination thereof. In some embodiments, the first dose, the second dose, and the third dose is 50 µg of the mRNA, and wherein the second dose is administered 2-3 months after the first dose, and the third dose is administered 4-6 months after the second dose; the first dose, the second dose, and the third dose is 100 µg of the mRNA, and wherein the second dose is administered 2-3 months after the first dose, and the third dose is administered 4-6 months after the second dose; or the first dose, the second dose, and the third dose is 150 µg of the mRNA, and wherein the second dose is administered 2 months after the first dose, and the third dose is administered 4 months after the second dose. Other aspects of the disclosure provide a messenger ribonucleic acid (mRNA) polynucleotide comprising an open reading frame sequence that lacks thymine and that has at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32 (which encodes an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204. Other aspects of the disclosure provide a vaccine comprising a plurality of polynucleotides, wherein the plurality comprises: a first polynucleotide comprising a sequence#14388136v1 having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 32 (which encodes an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204); a second polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the first polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32 (which encodes an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204); the second polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 9; the third polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 10; the fourth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 11; the fifth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 12; the sixth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 13; and the seventh polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 14. BRIEF DESCRIPTION OF THE DRAWINGS FIGs. 1A-1C show graphs of the total and functional antibody titers to recombinant antibodies. Shown are the total OspA-specific IgG titers (FIG. 1A) and functional equivalents, LA-2 (only bactericidal against S1) (FIG. 1B) and a positive control antibody (bactericidal against all 7 serotypes) (FIG. 1C). The groups tested were non-translating mRNA (NTFIX), and mRNA having an ORF encoding either an OspA S1 with the LFA epitope removed and an N- terminal transmembrane domain (OspA-S1-ND165-173-Nterm-TM; OspA S1 Nterm-TM), or mRNA having an ORF(s) encoding OspA S2-S5, S7, S1 with the LFA epitope removed and an N-terminal transmembrane domain and S6 with amino acid mutations S88L and A200V (OspA S1-S7 NtermTM) or mRNA having an ORF(s) encoding OspA S1 with a C-terminal transmembrane domain and ferritin stabilization (OspA S1 Cterm ferritin stabilized), and a#14388136v1 purified Recombitek® (i.e., lipidated OspA protein)+Alum. The total OspA-specific IgG titers were measured using mean fluorescence intensity (MFI) (FIG. 1A) and LA-2 competition ELISA and positive control antibodies were measured using signal reduction (1:20) (FIGs. 1B- 1C). FIG. 2 shows graphs of antibodies generated by administration of either OspA S1 with the LFA epitope removed and an N-terminal transmembrane domain (OspA-S1-ND165-173- Nterm-TM; OspA S1 NtermTM; mRNA-1982; SEQ ID NO: 8), or mRNA having an ORF(s) encoding OspA S2-S5, S7, S1 with the LFA epitope removed and an N-terminal transmembrane domain and S6 with amino acid mutations S88L and A200V (OspA S1-S7 NtermTM; mRNA- 1975; SEQ ID NOs: 8-14). OspA S1 NtermTM was administered at either 0.5µg or 1µg and OspA S1-S7 NtermTM was administered at either 3.5µg or 7µg. The mRNA vaccines were compared to mice administered PBS or Recombitek® or S1-S7 protein. Results were measured based on the mean fluorescence intensity (MFI) of the total OspA-specific IgG titers (S1, S2, S3, S4, S5, S6, S7) on day 20 and 35. FIGs. 3A-3B show the ability of antibodies generated in response to OspA-S1-ND165- 173-Nterm-TM (OspA S1 NtermTM) and OspA S1-S7 NtermTM to bind to Borrelia bacteria using a Surface binding assay. Groups tested include OspA S1 with the LFA epitope removed and an N-terminal transmembrane domain (S1), or mRNA having an ORF(s) encoding OspA S2-S5, S7, S1 with the LFA epitope removed and an N-terminal transmembrane domain and S6 with amino acid mutations S88L and A200V (S1-S7). The data from mice administered mRNA vaccines were compared to mice administered PBS or Recombitek® or S1-S7 protein, LA-2 or S1 Hyper+. The results are measured by percent (%) positive for Alexa-647 fluorescence (FIG. 3A) or the geometric mean (MFI) (FIG. 3B). FIGs. 4A-4B show the ability of antibodies generated in response to OspA-S1-ND165- 173-Nterm-TM (OspA S1 NtermTM) and OspA S1-S7 NtermTM to agglutinate (FIG. 4A) and compromise the membranes of Borrelia bacteria (FIG. 4B). These were measured using an Agglutination assay (FIG. 8A) and a Membrane Integrity assay (FIG. 4B). Groups tested include OspA S1 with the LFA epitope removed and an N-terminal transmembrane domain (S1), or mRNA having an ORF(s) encoding OspA S2-S5, S7, S1 with the LFA epitope removed and an N-terminal transmembrane domain and S6 with amino acid mutations S88L and A200V (S1-S7). The data from mice administered mRNA vaccines were compared to data from mice administered PBS or Recombitek® or S1-S7 protein, LA-2 or S1 Hyper+. The results are measured by percent (%) agglutination (FIG. 4A) and percent (%) propidium iodide positive (FIG. 4B).#14388136v1 FIG. 5 shows the serum bactericidal activity of antibodies generated in response to OspA-S1-ND165-173-Nterm-TM (OspA S1 NtermTM) and OspA S1-S7 NtermTM to kill Borrelia bacteria. This was measured using a serum bactericidal assay (SBA). Groups tested include OspA S1 with the LFA epitope removed and an N-terminal transmembrane domain (S1 mRNA), or mRNA having an ORF(s) encoding OspA S2-S5, S7, S1 with the LFA epitope removed and an N-terminal transmembrane domain and S6 with amino acid mutations S88L and A200V (S1-S7 mRNA). S1 mRNA was administered at either 0.5µg or 1µg and S1-S7 mRNA was administered at either 3.5µg or 7µg. The mRNA vaccines were compared to untreated IPTG, positive control antibody (10 µg / ml), LA-2 (10 µg / ml), PBS, S1 Hyper Immune or Recombitek® (1µg, 2µg or 5µg) or S1-S7 (7µg or 14µg) protein. Results were measured based on mScarlet fluorescence for serum dilutions of 1:400, 1:800, 1:1600 or 1:3200. FIGs. 6A-6G show graphs depicting the results of studies involving C3H / HeN mice administered vaccines comprising lipid nanoparticles formulated with an mRNA encoding OspA-ST1-2.6 (SEQ ID NO: 1), OspA-ST1-ND165-173 Nterm-TM (SEQ ID NO: 31), or a wild-type (WT) OspA S1 protein (OspA-ST1 hLFA-1), as described in Table 3. IgG binding titers to OspA expressed on the surface of Borrelia from vaccinated mice are shown in FIG. 6A. The percent (%) signal reduction measured by a LA-2 competition and positive control antibody competition ELISAs are shown in FIGs. 6B and 6F, respectively. The serum bactericidal activity of serum collected from vaccinated mice is shown in FIG. 6C. The percent (%) propidium iodide positive Borrelia bacteria cells and percent (%) agglutination of Borrelia bacteria cells in membrane integrity assays utilizing serum collected from vaccinated mice are shown in FIGs. 6D-6E, respectively. The total IgG amounts in serum samples from vaccinated mice binding to recombinant OspA is shown in FIG. 6G. In FIGs. 6A-6G mRNA encoding OspA-ST1-2.6 (SEQ ID NO: 1) is represented by circles, mRNA encoding OspA-ST1-ND165- 173 Nterm-TM (SEQ ID NO: 31) is represented by triangles, and mRNA encoding a wild-type (WT) OspA S1 protein (OspA-ST1 hLFA-1) is represented by squares. FIG. 7 shows a multiple sequence alignment of the OspA proteins of SEQ ID NOs: 1-7 and 24-31. The multiple sequence alignment was performed using Clustal Omega. The amino acid sequences of SEQ ID NOs: 70 and 71 were identified using the multiple sequence alignment. SEQ ID NOs: 70 and 71 represent consensus sequences of highly conserved regions between all serotypes. FIG. 8 shows a percent identity matrix comparing the amino acid sequences of the OspA proteins of SEQ ID NOs: 24-30 (which include OspA S1-S7 proteins) compared using multiple sequence alignment performed with Clustal Omega. The following additional comparisons were performed between OspA S1 proteins, between OspA S2 proteins, between OspA S3 proteins,#14388136v1 between OspA S4 proteins, between OspA S5 proteins, between OspA S6 proteins, and between OspA S7 proteins described herein: Borrelia burgdorferi OspA S1 (SEQ ID NO: 24) is 89.59% identical to OspA S1 (SEQ ID NO: 1); Borrelia afzelii OspA S2 (SEQ ID NO: 25) is 90.71% identical to OspA S2 (SEQ ID NO: 2); Borrelia garinii OspA S3 (SEQ ID NO: 26) is 90.37% identical to OspA S3 (SEQ ID NO: 3); Borrelia bavariensis OspA S4 (SEQ ID NO: 27) is 90.71% identical to OspA S4 (SEQ ID NO: 4); Borrelia garinii OspA S5 (SEQ ID NO: 28) is 91.85% identical to OspA S5 (SEQ ID NO: 5); Borrelia garinii OspA S6 (SEQ ID NO: 29) is 91.11% identical to OspA S6 (SEQ ID NO: 6); Borrelia garinii OspA S7 (SEQ ID NO: 30) is 91.48% identical to OspA S7 (SEQ ID NO: 7). FIGs. 9A-9F show results from a direct comparison of a mRNA vaccine encoding SEQ ID NO: 1 (“mRNA 1982”) and a mRNA vaccine encoding SEQ ID NO: 31 (“mRNA 1982 V0”). Protection from challenge with ticks infected with B. burgdorferi is demonstrated in FIG. 9A. Serum bactericidal activity of serum collected from vaccinated mice is depicted in FIG. 9B. FIGs. 9C and 9D represent IgG binding to OspA ST1 expressed on the surface of bacteria. Percent agglutination of the bacteria and disruption of bacterial membranes by vaccine-elicited antibodies are shown in FIG. 9E and FIG. 9F, respectively. DETAILED DESCRIPTION Lyme disease is an infectious disease caused by various species of Borrelia bacteria which are transmitted to humans through the bite of infected black-legged ticks. The disease is most commonly found in the northeastern, mid-Atlantic, and north-central regions of the United States, as well as in some parts of Europe and Asia. Lyme disease can cause a range of symptoms, including fever, fatigue, headache, and a characteristic “bull's-eye” rash. If left untreated, Lyme disease can lead to more serious complications. Vaccines have been developed to prevent Lyme disease, although currently there are no vaccines approved for use in the United States. In the past, two vaccines were available in the U.S., but they were withdrawn from the market primarily due to concerns about side effects, such as autoantibody production. The development of effective Lyme disease vaccines remains an important area of research, as tick- borne diseases continue to be a major public health concern in many parts of the world. The development of a safe and effective vaccine against Lyme disease has been met with several challenges, including a limited understanding of the disease, complexity of the bacterium that causes the disease, low prevalence of the disease, and limited animal models. Furthermore, relative to viral antigens, bacterial antigens are more complex and diverse. Borrelia burgdorferi (B. burgdorferi), a pathogenic spirochete responsible for Lyme disease, for example, has the ability to change its surface proteins, making it difficult for the immune system to recognize and#14388136v1 respond to the bacterium. This antigenic variability also makes it challenging to develop a vaccine that will be effective against more than one strain of the bacterium. As described herein, while Borrelia burgdorferi is the predominant strain that causes Lyme disease in the U.S., Borrelia afzelii, Borrelia garinii, and Borrelia bavariensis are the predominant strains to cause Lyme disease outside of the U.S. Furthermore, bacterial lipidation is thought to be essential for the proper function of Borrelia proteins (see, e.g., Zuckert WR Biochim Biophys Acta. 2014 Aug;1843(8):1509-16) but is challenging to reproduce in mammalian cells. Lastly, Borrelia bacterial proteins are associated with high reactogenicity, which refers to their ability to cause adverse reactions or side effects in the body, that can lead to inflammation, fever, or other adverse reactions. Surprisingly, the Borrelia proteins encoded by the mRNA vaccines provided herein elicit low reactogenicity and high immunogenicity, in some embodiments in response to multiple strains / serotypes of Borrelia, despite the absence of bacterial lipidation thought to be essential for proper functioning of the bacterial proteins. This is in part because these bacterial proteins are designed such that, when expressed in vivo by mammalian cells, they are still capable of folding into protein antigens having conformationally correct extracellular domains that preserve important epitopes critical for these properties. Moreover, the administration of these Borrelia proteins to a subject in the form of an mRNA vaccine stimulates the production of antibodies that exhibit high bactericidal and agglutination activity, properties that are not shared by identical Borrelia proteins when administered in the form of a protein vaccine. Thus, in some embodiments, the mRNA vaccines encode Borrelia OspA proteins that have conformationally correct extracellular domains. A conformationally correct protein domain is a protein domain that has the correct three-dimensional structure (i.e., conformation) that is useful for its proper function. In some embodiments, the mRNA vaccines encode modified Borrelia OspA proteins that have been modified to have increased thermostability. For example, and as disclosed herein, Borrelia OspA S1 proteins having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), (e.g., the OspA S1 protein of SEQ ID NO: 1) have unexpectedly been found to have increased thermostability relative to the Borrelia OspA S1 protein of SEQ ID NO: 31. In some embodiments, the increased thermostability results in the protein having functionality as an antigen in a vaccine. SEQ ID NO: 1 comprises a valine (V) at position 184 and a (T) at position 204 (positions determined sequentially from M1 to K287), and polypeptides described here that have a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), maintain the amino#14388136v1 acid corresponding to the valine (V) at position 184 and the amino acid corresponding to the threonine (T) at position 204. In some embodiments, the mRNA vaccines described herein are capable of eliciting the production of bactericidal antibodies. Bactericidal activity simply refers to the ability of the vaccine, or more precisely the antibodies produced by the body in response to the vaccine, to kill the bacteria. In some embodiments, the mRNA vaccines described herein are capable of eliciting the production of antibodies that exhibit high agglutination activity. Agglutination activity refers to the ability of those antibodies to cause agglutination (the clumping together) of the bacterial cells expressing the specific epitopes to which the antibodies bind. Borrelia Proteins Borrelia is a genus of bacteria that includes several species, some of which are known to cause Lyme disease in humans. The most common species associated with Lyme disease is Borrelia burgdorferi, which is primarily transmitted to humans through the bite of infected blacklegged ticks. Borrelia bacteria are spiral-shaped, gram-negative bacteria that are capable of surviving in a variety of environments, including inside the bodies of animals and insects. The bacteria have a complex life cycle that involves both ticks and mammals, and they are capable of adapting to different hosts and environments. Borrelia bacteria are known for their ability to evade the immune system and cause persistent infections. The bacteria are able to change their surface proteins, making it difficult for the immune system to recognize and respond to the infection. This ability to evade the immune system is thought to be one of the reasons why Lyme disease can become a chronic condition in some individuals. Despite methods by the bacteria to evade the host immune response, both the innate and adaptive immune systems respond to Borrelia infection. Most manifestations and symptoms of Lyme disease are caused by inflammation generated by the immune response because Borrelia does not produce toxins or extracellular matrix-degrading proteases. The host immune response can reduce bacterial infection and decrease symptoms within several weeks to months, even without antibiotic intervention. Nonetheless, persistent bacteria can survive for years in untreated patients resulting in chronic illness. Borrelia infection is characterized by several pathogenic processes. Such processes include adherence of bacteria to host target cells, local multiplication, and migration to distant sites. A number of proteins produced by Borrelia are important in mediating these pathogenic processes, including Outer Surface Protein A (OspA) and Outer Surface Protein C (OspC), making them attractive candidate vaccine antigens. OspA is an abundant surface protein of#14388136v1 Borrelia and is expressed primarily in the tick vector when the bacteria are present in the midgut. OspA is important for the initial attachment of the bacteria to the midgut of the tick and plays a critical role in the colonization of the tick vector. After the tick attaches to the mammalian host, the bacterium is stimulated in the midgut of the tick to undergo transformation from a state of colonization to infection. Once the bacteria are transmitted to a mammalian host during a tick bite, the expression of OspA is downregulated and OspC is upregulated. Thus, B. burgdorferi selectively produces OspA in ticks and OspC in mammals, after the bacteria has been transmitted to a mammalian host. OspC is thought to be critical for the establishment of the bacteria in the mammalian host and plays an important role in the early stages of the disease. OspC is involved in a number of processes that are important for the bacteria's survival in the mammalian host, including evasion of the host immune system and adhesion to host cells. Borrelia OspA protein is a 31 kilodalton lipoprotein having two globular domains that are connected via a unique single-layer beta-sheet. The C terminus of the protein contains a receptor binding domain and is variable among different OspA serotypes, while the N terminus attaches to the bacterial cell membrane via post-translational palmitoylation on the signal sequence. The OspA protein also contains human lymphocyte function associated antigen-1 (hLFA-1) epitope regions localized within OspA amino acid residues 165–173 (OspA165–173). In some embodiments, the hLFA-1 epitopes are modified or removed. In some embodiments, the OspA165–173epitope is removed. In some embodiments, the Borrelia protein encoded by an mRNA of the present disclosure is a Borrelia OspA protein. In some embodiments, the Borrelia protein is an OspA protein variant, relative to a naturally occurring Borrelia OspA protein. The terms “naturally occurring” and “wild type” are used interchangeably herein. A naturally occurring Borrelia OspA protein is a Borrelia OspA protein (e.g., one of Borrelia serotypes 1-7) that occurs in nature, i.e., which is a naturally occurring isolate. As is known in the art, a naturally occurring protein is not genetically engineered. A naturally occurring protein is not genetically (or otherwise) modified to substitute, remove, or add any amino acids. At least seven naturally occurring Borrelia OspA serotypes have been identified with eight monoclonal antibodies against different epitopes of the Borrelia OspA protein. As determined by 16S rRNA sequence analysis, these serotypes correlated well with recently delineated genospecies: serotype 1 (S1) corresponds to B. burgdorferi, serotype 2 (S2) corresponds to Borrelia afzelii, serotype 4 corresponds to Borrelia bavariensis, and serotypes 3 (S3) and 5-7 (S5-S7) correspond to Borrelia garinii. The mRNA vaccines provided herein may encode any one or more Borrelia OspA proteins selected from Borrelia burgdorferi OspA serotype 1 (S1); Borrelia afzelii OspA serotype 2 (S2); Borrelia garinii OspA serotype 3 (S3);#14388136v1 Borrelia bavariensis OspA serotype 4 (S4); Borrelia garinii OspA serotype 5 (S5); Borrelia garinii OspA serotype 6 (S6); and Borrelia garinii OspA serotype 7 (S7). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia burgdorferi OspA S1 (or a variant thereof). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia afzelii OspA S2 (or a variant thereof). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S3 (or a variant thereof). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia bavariensis OspA S4 (or a variant thereof). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S5 (or a variant thereof). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S6 (or a variant thereof). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S7 (or a variant thereof). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia burgdorferi OspA S1 or a variant thereof (e.g., SEQ ID NO: 1 and having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1)), an mRNA polynucleotide comprising an open reading frame encoding Borrelia afzelii OspA S2 or a variant thereof (e.g., SEQ ID NO: 2), an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S3 or a variant thereof (e.g., SEQ ID NO: 3), an mRNA polynucleotide comprising an open reading frame encoding Borrelia bavariensis OspA S4 or a variant thereof (e.g., SEQ ID NO: 4), an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S5 or a variant thereof (e.g., SEQ ID NO: 5), an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S6 or a variant thereof (e.g., SEQ ID NO: 6), and an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S7 or a variant thereof (e.g., SEQ ID NO: 7). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding Borrelia afzelii OspA S2 or a variant thereof (e.g., SEQ ID NO: 2), an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S3 or a variant thereof (e.g., SEQ ID NO: 3), an mRNA#14388136v1 polynucleotide comprising an open reading frame encoding Borrelia bavariensis OspA S4 or a variant thereof (e.g., SEQ ID NO: 4), an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S5 or a variant thereof (e.g., SEQ ID NO: 5), an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S6 or a variant thereof (e.g., SEQ ID NO: 6), and an mRNA polynucleotide comprising an open reading frame encoding Borrelia garinii OspA S7 or a variant thereof (e.g., SEQ ID NO: 7). Transmembrane Domains In some embodiments, the bacterial proteins encoded by the mRNA vaccines comprise a heterologous transmembrane domain. A transmembrane domain is a region of a protein that spans the lipid bilayer of a biological membrane, such as a cell membrane. Transmembrane domains are composed of hydrophobic amino acids that are able to interact with the hydrophobic core of the membrane, anchoring the protein to the membrane and allowing it to interact with other proteins or molecules on either side of the membrane. A transmembrane domain is “heterologous” to a protein if the protein does not naturally occur with the transmembrane domain. For example, a viral transmembrane domain is heterologous to a bacterial protein or a protein comprising a bacterial domain, such as a bacterial extracellular domain. In some embodiments, a Borrelia OspA protein comprises a Borrelia OspA extracellular domain and a viral transmembrane domain. In some embodiments, the viral transmembrane domain is from an influenza virus protein, for example, an influenza virus neuraminidase transmembrane domain. Other viral transmembrane domains may also be used to anchor bacterial proteins to a host cell membrane, including without limitation, the transmembrane domain from any of the following: human immunodeficiency virus (HIV) envelope glycoprotein (Env), hepatitis C virus (HCV) envelope glycoproteins E1 and E2, herpes simplex virus (HSV) glycoprotein D (gD), and other influenza virus proteins, such as hemagglutinin and M2 protein. In bacterial cells, the bacterial proteins are naturally anchored to the cell surface via lipidation at the N terminus of the protein. The bacterial antigens encoded by the mRNA of the disclosure, in some embodiments, have been modified to include a heterologous amino terminal (N terminal) transmembrane domain, which anchors the antigen to the surface of the mammalian cell. In some embodiments, the bacterial antigens encoded by the mRNA of the disclosure have been modified to include a heterologous carboxyl terminal (C terminal) transmembrane domain. When presented at the cell surface, the bacterial antigens are more conformationally accurate, thereby capable of eliciting a more effective immune response. As disclosed herein, the location of the heterologous transmembrane domain impacts the strength of the antibody response.#14388136v1 Higher neutralizing antibody titers were observed following administration of mRNA vaccines encoding Borrelia OspA proteins comprising an N-terminal heterologous transmembrane domain. N-Linked Glycan Site Mutations Some aspects of the present disclosure relate to an OspA S1 polypeptide comprising the amino acid sequence of SEQ ID NO: 1 and having a valine (V) at position 184 and a threonine (T) at position 204, and one or more of the mutations: an alanine (A) at position 87; a phenylalanine (F) at position 179; an isoleucine (I) at position 180; a valine at (V) at position 184; a phenylalanine (F) at position 185; a threonine (T) at position 204; a glutamine (Q) at position 216; and a valine (V) at position 267, wherein the one or more mutations is an N-linked glycan mutation (numbering according to SEQ ID NO: 1 or relative to the amino acid sequence of SEQ ID NO: 1). SEQ ID NO: 1 comprises an alanine (A) at position 87, a phenylalanine (F) at position 179, an isoleucine (I) at position 180, a valine at (V) at position 184, a phenylalanine (F) at position 185, a threonine (T) at position 204, a glutamine (Q) at position 216, and a valine (V) at position 267 (positions determined sequentially from M1 to K287), and polypeptides described here that have a phenylalanine (F) at position 179, an isoleucine (I) at position 180, a valine at (V) at position 184, a phenylalanine (F) at position 185, a threonine (T) at position 204, a glutamine (Q) at position 216, and a valine (V) at position 267, numbering according to SEQ ID NO: 1, maintain the amino acid corresponding to the phenylalanine (F) at position 179, the amino acid corresponding to the isoleucine (I) at position 180, the amino acid corresponding to the valine at (V) at position 184, the amino acid corresponding to the phenylalanine (F) at position 185, the amino acid corresponding to the threonine (T) at position 204, the amino acid corresponding to the glutamine (Q) at position 216, and the amino acid corresponding to the valine (V) at position 267. In some embodiments, the bacterial proteins encoded by the mRNA vaccines comprises one or more N-linked glycan site mutations. N-linked glycan site mutations refer to alterations in the amino acid sequence of a protein that affect the attachment of carbohydrate molecules, or glycans, at specific sites. N-linked glycans are attached to proteins at asparagine residues that are located in a specific amino acid sequence context (NxS / T / C, where x can be any amino acid except proline). These glycans can affect the structure, stability, and function of proteins and play important roles in many biological processes. Bacterial systems rarely glycosylate proteins; however, glycosylation does occur somewhat frequently in mammalian cells. To prevent glycosylation, the mRNA described herein, in some embodiments, encodes bacterial proteins#14388136v1 wherein residues prone to N-linked glycosylation (e.g., asparagine) have been removed, modified, or substituted in order to prevent glycosylation. Modifications to Increase Stability / Expression In some embodiments, the bacterial proteins encoded by the mRNA vaccines comprise one or more stabilizing mutations. Protein stabilizing mutations refer to alterations in the amino acid sequence of a protein that improve its stability, or its ability to maintain its folded structure and resist denaturation or aggregation. These mutations can enhance protein stability by strengthening intramolecular interactions, improving the packing of the protein core, or reducing the flexibility of the protein structure. As disclosed herein, the naturally occurring form of the Borrelia OspA S6 protein, for example, was not detected following expression in vitro. Two mutations (S88L and A200V) were made to enhance protein stability by providing better hydrophobic packing of the protein. Thus, in some embodiments, the Borrelia OspA proteins of the disclosure may be modified to improve hydrophobic packing of the protein, thereby stabilizing the protein and increasing expression of the protein, relative to the corresponding naturally occurring protein. Modifications to Increase Thermostability In some embodiments, the bacterial proteins encoded by the mRNA vaccines comprise one or more mutations to increase protein thermostability (i.e., are modified to have increased thermostability). These mutations can enhance protein thermostability by strengthening intramolecular interactions, by improving the packing of the protein core, and / or by reducing the flexibility of the protein structure. Thermostability refers to an ability of a protein to maintain its folded structure and resist denaturation or aggregation at high temperatures. Methods of measuring the thermostability of a protein are known in the art and include, but are not limited to, circular dichroism (CD) and differential scanning calorimetry (DSC). In some embodiments, a Borrelia OspA protein encoded by an mRNA vaccine described herein comprises one or more mutations to increase thermostability. For example, and as disclosed herein, Borrelia OspA S1 proteins having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), (e.g., the OspA S1 protein of SEQ ID NO: 1) have unexpectedly been found to have increased thermostability relative to the Borrelia OspA S1 protein of SEQ ID NO: 31. Another example, and as disclosed herein, Borrelia OspA S1 proteins having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), (e.g., the OspA S1 protein of#14388136v1 SEQ ID NO: 1) have unexpectedly been found to have increased thermostability relative to a wild type Borrelia OspA S1 protein. An alignment of the OspA S1 protein of SEQ ID NO: 1 and the wild type Borrelia OspA S1 protein (SEQ ID NO: 24) is provided in FIG. 7, and shows amino acid differences between the two. These differences include a valine (V) at position 184 and a threonine (T) at position 204 (positions provided according to the numbering of SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1)). As provided herein, amino acid positions of Borrelia OspA S1 proteins are provided according (or relative to) to the Borrelia OspA S1 protein of SEQ ID NO: 1, with its first amino acid (methionine, M) corresponding to position 1 and its last amino acid (lysine, K) corresponding to position 287. Therefore, the amino acid at position 184 of SEQ ID NO: 1 is valine (V), and the amino acid at position 204 of SEQ ID NO: 1 is threonine (T). In some embodiments, a Borrelia OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), has at least a 1%, at least a 2%, at least a 3%, at least a 4%, at least a 5%, at least a 6%, at least a 7%, at least a 8%, at least a 9%, or at least a 10% increase in thermostability relative to the thermostability of the Borrelia OspA S1 protein of SEQ ID NO: 31 (as measured under identical conditions, e.g., using DSC). In some embodiments, a Borrelia OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), has a thermostability that is increased by at least 0.5°C, at least 1.0°C, at least 1.5°C, at least 2.0°C, at least 2.5°C, at least 3.0°C, at least 3.5°C, at least 4.0°C, at least 4.5°C, at least at least 5.0°C, at least 5.5°C, at least 6.0°C, at least 6.5°C, at least 7.0°C, at least 7.5°C, at least 8.0°C, at least 8.5°C, at least 9.0°C, at least 9.5°C, or at least 10.0°C relative to the thermostability of the Borrelia OspA S1 protein of SEQ ID NO: 31 (as measured under identical conditions, e.g., using DSC). In some embodiments, a Borrelia OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), has improved functionality as a vaccine antigen relative to the Borrelia OspA S1 protein of SEQ ID NO: 31. For example, in some embodiments, serum from a subject administered a vaccine comprising an mRNA polynucleotide encoding a Borrelia OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), has one or more of the following properties relative to serum from a subject administered a vaccine comprising an mRNA polynucleotide encoding a Borrelia OspA S1 protein of SEQ ID NO: 31:#14388136v1 • increased average IgG binding (e.g., increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%) to whole Borrelia bacterial cells (as measured under identical conditions, e.g., as determined by gMFI); • increased LA-2 equivalent antibodies (e.g., increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%) (as measured under identical conditions, e.g., as determined by % signal reduction at a serum dilution of 20, 40, 60, 80, 160, 320, 640, 1280, or 2560); • increased serum bactericidal antibodies (e.g., increased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10%) against Borrelia bacterial cells (as measured under identical conditions); • increased capability to disrupt membrane integrity (e.g., increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%) of Borrelia bacterial cells (as measured under identical conditions, e.g., as measured by propidium iodide incorporation); • increased capability to cause agglutination (e.g., increased by at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50%) of Borrelia bacterial cells (as measured under identical conditions); and / or • increased total IgG (e.g., increased by at least 1%, at least 2%, at least 3%, at least 4%, at least 5%, at least 6%, at least 7%, at least 8%, at least 9%, or at least 10%) (as measured under identical conditions, e.g., as determined by luminex). Non-limiting examples of mRNA sequences encoding Borrelia OspA proteins and their corresponding amino acid sequences are provided in Table 1. Table 1: Vaccine Sequences and Naturally Occurring Protein Sequences #14388136v1 #14388136v1 #14388136v1 #14388136v1 #14388136v1 #14388136v1 #14388136v1 #14388136v1 #14388136v1 #14388136v1 Table 2 provides examples of naturally occurring Borrelia OspA proteins. Table 2: Naturally Occurring Borrelia Protein Sequence #14388136v1 In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S1 protein, wherein the OspA S1 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 1 and has a valine (V) at position 184 and a threonine (T) at position 204), numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the Borrelia OspA S1 protein comprises a valine (V) at position #14388136v1 184 and a threonine (T) at position 204. In some embodiment, the Borrelia OspA S1 protein comprises a valine (V) at position 184, a threonine (T) at position 204, and one or more of (e.g., two or more of, three or more of, four or more of, or five or more of): an alanine (A) at position 87; a phenylalanine (F) at position 179; an isoleucine (I) at position 180; a phenylalanine (F) at position 185; a glutamine (Q) at position 216; and a valine (V) at position 267, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiment, the Borrelia OspA S1 protein comprises a valine (V) at position 184, a threonine (T) at position 204, an alanine (A) at position 87, a phenylalanine (F) at position 179, an isoleucine (I) at position 180, a phenylalanine (F) at position 185, a glutamine (Q) at position 216, and a valine (V) at position 267, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiment, the Borrelia OspA S1 protein comprises the amino acid sequence of SEQ ID NO: 1 (which has a valine (V) at position 184 and a threonine (T) at position 204). In some embodiments, a Borrelia burgdorferi OspA S1 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 1, optionally wherein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the Borrelia burgdorferi OspA S1 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 1 and wherein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the amino acid sequence of the Borrelia burgdorferi OspA S1 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 1 and having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); and / or an amino acid having sequence having at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 1 and having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX#14388136v1 XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S2 protein, wherein the OspA S2 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, a Borrelia afzelii OspA S2 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 2. In some embodiments, the Borrelia afzelii OspA S2 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, the amino acid sequence of the Borrelia afzelii OspA S2 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 2 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 2) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S3 protein, wherein the OspA S3 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 3.#14388136v1 In some embodiments, a Borrelia garinii OspA S3 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 3. In some embodiments, the Borrelia garinii OspA S3 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, the amino acid sequence of the Borrelia garinii OspA S3 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 3 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 3) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S4 protein, wherein the OspA S4 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, a Borrelia bavariensis OspA S4 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 4. In some embodiments, the Borrelia bavariensis OspA S4 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, the amino acid sequence of the Borrelia bavariensis OspA S4 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-287 of SEQ ID NO: 4 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 4) comprises:#14388136v1 the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S5 protein, wherein the OspA S5 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, a Borrelia garinii OspA S5 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 5. In some embodiments, the Borrelia garinii OspA S5 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, the amino acid sequence of the Borrelia garinii OspA S5 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 5 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 5) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S6 protein,#14388136v1 wherein the OspA S6 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, a Borrelia garinii OspA S6 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 6. In some embodiments, the Borrelia garinii OspA S6 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, the amino acid sequence of the Borrelia garinii OspA S6 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 6 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 6) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S7 protein, wherein the OspA S7 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, a Borrelia garinii OspA S7 protein described herein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid residues 40-288 of SEQ ID NO: 7. In some embodiments, the Borrelia garinii OspA S7 protein comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, the amino acid sequence of the Borrelia garinii OspA S7 protein (e.g., an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to an amino acid sequence consisting of amino acid#14388136v1 residues 40-288 of SEQ ID NO: 7 and / or at least at least 80%, at least 85%, at least 90%, at least 95%, or 100% identity to the amino acid sequence of SEQ ID NO: 7) comprises: the amino acid sequence EKNSXSVDLPGXMXVLVSKEKXKDGKYXLXATVXKXELKGTSDKXNGXGXLEGXKX XKSKXKXTIXXDLXXTXXEXFKEDGKTLVSXKVXXKDKXSXXEXFNXKGXXSXKXX XRXXGTXLEYTXXXXDGXGKAKEVLKXXXLEG (SEQ ID NO: 70), wherein X is any amino acid; and / or the amino acid sequence LXVXXGTVXLSKXIXXSGEXXXXLXDXXXXXAXKKXXXWXSXTSTLTIXXNSXKXXX XVFTKXXTITVQXYXXXGXXLEGXXXEIXXLXXXKXALK(SEQ ID NO: 71), wherein X is any amino acid. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S1 protein, wherein the OspA S1 protein comprises the amino acid sequence of SEQ ID NO: 1 (which has a valine (V) at position 184 and a threonine (T) at position 204). In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S2 protein, wherein the OspA S2 protein comprises the amino acid sequence of SEQ ID NO: 2. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S3 protein, wherein the OspA S3 protein comprises the amino acid sequence of SEQ ID NO: 3. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S4 protein, wherein the OspA S4 protein comprises the amino acid sequence of SEQ ID NO: 4. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S5 protein, wherein the OspA S5 protein comprises the amino acid sequence of SEQ ID NO: 5. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S6 protein, wherein the OspA S6 protein comprises the amino acid sequence of SEQ ID NO: 6. In some embodiments, a vaccine of the present disclosure comprises an mRNA polynucleotide comprising an open reading frame encoding a Borrelia OspA S7 protein, wherein the OspA S7 protein comprises the amino acid sequence of SEQ ID NO: 7. The mRNA polynucleotides of the present disclosure encode at least one Borrelia protein of interest, intended to raise an immune response, which is protective against subsequent Borrelia infection in mammalian subjects. Thus, when administered to a subject, the mRNA vaccines lead to expression of Borrelia proteins of the present disclosure, which are antigenic,#14388136v1 i.e., they provoke a protective immune response. Antigenicity can be measured by the ability to generate cellular and / or humoral immune responses. Delivery of the mRNA polynucleotides of the present disclosure is achieved by formulating the mRNA in appropriate carriers or delivery vehicles (e.g., lipid nanoparticles) such that upon administration to cells, tissues, or subjects, the mRNA is taken up by cells which, in turn, express the protein(s) encoded by the mRNA. It should be understood that the term “protein” encompasses peptides (and polypeptides shorter than a full-length protein), and the term “antigen” encompasses antigenic fragments. The vaccines of the present disclosure provide a unique advantage over traditional protein-based vaccination approaches in which protein antigens are purified or produced in vitro, e.g., recombinant protein production technologies. The vaccines of the present disclosure comprise mRNA encoding the desired Borrelia antigen(s), which when introduced into the body, i.e., administered to a mammalian subject (for example a human) in vivo, cause the cells of the body to express the desired antigen(s). In order to facilitate delivery of the mRNA to the cells of the body, the mRNA is formulated (e.g., encapsulated) in a lipid nanoparticle. Upon delivery and uptake by cells of the body, the mRNA is translated in the cytosol and the antigens are generated by the host cell machinery. The antigens are expressed and presented by the host cells and elicit humoral and / or cellular immune responses. Neutralizing antibodies are directed against the expressed antigens, and hence the antigens are considered relevant target antigens for vaccine development. Many proteins have a quaternary or three-dimensional structure, which includes more than one polypeptide or several polypeptide chains that associate into an oligomeric molecule. As used herein the term “subunit” refers to a single protein molecule, for example, a polypeptide or polypeptide chain resulting from processing of a nascent protein molecule, which subunit assembles (or “coassembles”) with other protein molecules (e.g., subunits or chains) to form a protein complex. Proteins can have a relatively small number of subunits and therefore be described as “oligomeric” or can consist of a large number of subunits and therefore be described as “multimeric”. The subunits of an oligomeric or multimeric protein may be identical, homologous, or dissimilar and dedicated to disparate tasks. Proteins or protein subunits can further comprise domains. As used herein, the term “domain” refers to a distinct functional and / or structural unit within a protein. Typically, a “domain” is responsible for a particular function or interaction, contributing to the overall role of a protein. Domains can exist in a variety of biological contexts. Similar domains (i.e., domains sharing structural, functional and / or sequence homology) can exist within a single protein or can exist within distinct proteins having similar or different functions. A protein domain is often a conserved part of a given protein tertiary structure or sequence that can function and exist#14388136v1 independently of the rest of the protein or subunit thereof. An extracellular protein domain is a part of a protein molecule that is located outside of a cell. It is typically exposed to the extracellular environment and can interact with other proteins, molecules, or the cell surface. A transmembrane domain is a structural component of a protein that spans the lipid bilayer of a cell membrane. Transmembrane domains typically include one or more alpha helices or beta strands that cross the hydrophobic lipid bilayer of the cell membrane. As used herein, the term “antigen” is distinct from the term “epitope,” which is a substructure of an antigen. An epitope of a part of an antigen to which an antibody attaches. An epitope may be a peptide, for example, a 7-10 amino acid peptide, or a carbohydrate structure. The art describes protein antigens that are delivered to subjects or immune cells in isolated form, e.g., isolated proteins, however, the design, testing, validation, and production of protein antigens can be costly and time-consuming, especially when producing proteins at large scale. By contrast, mRNA technology is amenable to rapid design and testing of mRNA encoding a variety of antigens. Moreover, rapid production of mRNA coupled with formulation in appropriate delivery vehicles (e.g., lipid nanoparticles), can proceed quickly and can rapidly produce mRNA vaccines at large scale. Potential benefit also arises from the fact that antigens encoded by the mRNAs of the present disclosure are expressed by the cells of the subject, e.g., are expressed by the human body, and thus the subject, e.g., the human body, serves as the “factory” to produce the antigens which, in turn, elicits the desired immune response. The vaccines, as provided herein, may include an mRNA polynucleotide or multiple mRNA polynucleotides encoding two or more antigens of the same or different Borrelia strains. For example, multiple OspA antigens, e.g., S1, S2, S3, S4, S5, S6, and S7 can be included in the subject vaccines. Also provided herein are combination vaccines that include mRNA encoding one or more Borrelia antigens and one or more antigen(s) of a different organism. Thus, the vaccines of the present disclosure may be combination vaccines that target one or more antigens of the same strain / species, or one or more antigens of different strains / species, e.g., antigens that induce immunity to organisms that are found in the same geographic areas where the risk of Borrelia infection is high or organisms to which an individual is likely to be exposed to when exposed to Borrelia. Percent Identity In some embodiments, the compositions of the present disclosure include mRNA that encodes a Borrelia protein variant. Protein variants are proteins (including full length proteins and peptides) that differ in their amino acid sequence relative to a naturally occurring or reference amino acid sequence. A protein variant may possess one or more substitutions,#14388136v1 deletions, and / or insertions at certain positions within its amino acid sequence, as compared to a naturally occurring or reference amino acid sequence. Global sequence alignment and local sequence alignment are two common methods used to compare and analyze sequences of DNA, RNA, or protein. Global sequence alignment compares the entire length of two sequences and finds the best possible alignment of the entire length of the sequences. It is useful, for example, when the two sequences being compared are similar in length and share significant homology. Local sequence alignment, on the other hand, identifies regions of similarity between sequences, allowing for gaps and mismatches in the alignment. This method is useful for identifying short regions of homology within larger sequences, and can be used to identify functional domains, protein families, and binding sites. Local alignment can be computationally more efficient than global alignment, and can be applied to sequences of different lengths. Unless stated otherwise herein, “percent (%) identity” between two mRNA polynucleotides or between two proteins refers to percent (%) identity determined using a global sequence alignment, comparing the length of entire sequences (e.g., entire mRNA polynucleotide, entire open reading frame of an mRNA, or entire protein encoded by an mRNA, as described herein). A protein variant encoded by an mRNA of the disclosure may contain amino acid changes that confer any of a number of desirable properties, for example, that enhance its immunogenicity, enhance its expression, and / or improve its stability or PK / PD properties in a subject. Protein variants can be made using routine mutagenesis techniques and assayed as appropriate to determine whether they possess the desired property. Assays to determine expression levels and immunogenicity of proteins, including protein variants, are well known in the art. Similarly, PK / PD properties of a protein variant can be measured using art recognized techniques, for example, by determining expression of the protein variant in a vaccinated subject over time and / or by looking at the durability of an induced immune response. The stability of a protein variant encoded by an mRNA may be measured by assaying thermostability or stability upon urea denaturation or may be measured using in silico prediction, for example. Methods for such experiments and in silico determinations are known in the art. Other methods for determining protein variant expression levels, immunogenicity and / or PK / PD properties of a protein variant may be used. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence of any one of the sequences provided herein or comprises a nucleotide sequence that has at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to a nucleotide sequence of SEQ ID NO: 32#14388136v1 and encoding for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence of any one of the sequences provided herein or comprises a nucleotide sequence that has at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to a nucleotide sequence of SEQ ID NO: 32 and one or more of any one of the sequences provided herein. See, e.g., SEQ ID NOs: 9-14, wherein SEQ ID NO: 32 encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an mRNA polynucleotide#14388136v1 comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the#14388136v1 nucleotide sequence of SEQ ID NO: 11. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an mRNA polynucleotide comprises an#14388136v1 open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 9. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 10. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 12. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 13. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 14. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an mRNA#14388136v1 polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 33 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 70% identity to the nucleotide sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 33 and encodes for an OspA S2 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 75% identity to the nucleotide sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1).#14388136v1 In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 33 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 80% identity to the nucleotide sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 21. In some#14388136v1 embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 33 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 85% identity to the nucleotide sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 17. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 33 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 90% identity to the nucleotide sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide#14388136v1 sequence of SEQ ID NO: 17. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 21. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 33 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a nucleotide sequence that has at least 95% identity to the nucleotide sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 16. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 17. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 18. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 19. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises a the nucleotide sequence of SEQ ID NO: 20. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 21. In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 33 (which encodes an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204). In some embodiments, an mRNA polynucleotide comprises an open reading frame that comprises the nucleotide sequence of SEQ ID NO: 72 (which encodes an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence of SEQ ID NO: 1 and having a valine (V)#14388136v1 at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1), or comprises an amino acid sequence that has at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% identity to the amino acid sequence of SEQ ID NO: 1 and has a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence of SEQ ID NO: 1, optionally herein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 80% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence of SEQ ID NO: 1, optionally herein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes#14388136v1 a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 85% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence of SEQ ID NO: 1, and wherein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 90% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 1, and wherein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments,#14388136v1 an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has at least 95% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has 95% identity to the amino acid sequence of SEQ ID NO: 1, optionally herein the protein comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has 95% identity to the amino acid sequence of SEQ ID NO: 2. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has 95% identity to the amino acid sequence of SEQ ID NO: 3. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has 95% identity to the amino acid sequence of SEQ ID NO: 4. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has 95% identity to the amino acid sequence of SEQ ID NO: 5. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has 95% identity to the amino acid sequence of SEQ ID NO: 6. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising an amino acid sequence that has 95% identity to the amino acid sequence of SEQ ID NO: 7. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising the amino acid sequence of SEQ ID NO: 1 (which has a valine (V) at position 184 and a threonine (T) at position 204). In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising the amino acid sequence of SEQ ID NO: 2. In some embodiments, an mRNA polynucleotide comprises an#14388136v1 open reading frame that encodes a protein comprising the amino acid sequence of SEQ ID NO: 3. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising the amino acid sequence of SEQ ID NO: 4. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising the amino acid sequence of SEQ ID NO: 5. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising the amino acid sequence of SEQ ID NO: 6. In some embodiments, an mRNA polynucleotide comprises an open reading frame that encodes a protein comprising the amino acid sequence of SEQ ID NO: 7. “Identity” refers to a relationship between two or among three or more sequences (e.g., amino acid sequences or nucleotide sequences) as determined by comparing the sequences to each other. Identity also refers to the degree of sequence relatedness between or among sequences as determined by the number of matches between or among strings of amino acids (polypeptides) or strings of nucleotides (polynucleotides). Identity is a measure of the percent of identical matches between the smaller of two or more sequences with gap alignments (if any) addressed by a particular mathematical model or computer program (e.g., “algorithms”). Identity of related polypeptides and polynucleotides can be readily calculated by known methods. “Percent (%) identity” as it applies to polypeptide or polynucleotide sequences is defined as the percentage of residues (amino acid or nucleic acid residues) in the candidate (first) polypeptide or polynucleotide sequence that are identical with the residues in a second polypeptide or polynucleotide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity. As indicated above, unless stated otherwise herein, “percent (%) identity” between two mRNA polynucleotides or between two proteins refers to percent (%) identity determined using a global sequence alignment, comparing the length of entire sequences (e.g., entire mRNA polynucleotide, entire open reading frame of an mRNA, or entire protein encoded by an mRNA, as described herein). Methods and computer programs for the alignment are well known in the art. It is understood that identity depends on a calculation of percent identity but may differ in value due to gaps and penalties introduced in the calculation. Generally, variants of a particular polynucleotide or polypeptide have at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% but less than 100% sequence identity to that particular naturally occurring or reference sequence as determined by sequence alignment programs and parameters described herein and known to those skilled in the art. Such tools for alignment include but are not limited to those of the BLAST suite (Altschul, S.F., et al. Nucleic Acids Res. 1997;25:3389-3402); and those based on the Smith-Waterman algorithm (Smith, T.F. & Waterman, M.S. J. Mol. Biol. 1981;147:195- 197). A general global alignment technique based on dynamic programming is the Needleman–#14388136v1 Wunsch algorithm (Needleman, S.B. & Wunsch, C.D. J. Mol. Biol. 1920;48:443-453). A Fast Optimal Global Sequence Alignment Algorithm (FOGSAA) also has been developed that purportedly produces global alignment of nucleotide and protein sequences faster than other optimal global alignment methods, including the Needleman–Wunsch algorithm. Other non- limiting examples of global alignment tools include Needle (from EMBOSS), Clustal Omega, MUSCLE (Multiple Sequence Comparison by Log-Expectation), MAFFT (Multiple Alignment using Fast Fourier Transform), and T-Coffee (Tree-based Consistency Objective Function for Alignment Evaluation). Polynucleotides and polypeptides containing substitutions, insertions and / or deletions (e.g., indels), and covalent modifications with respect to naturally occurring or reference sequence, for example, the polypeptide (e.g., protein) sequences disclosed herein, are included within the scope of this disclosure. For example, sequence tags or amino acids, such as one or more lysine(s), can be added to polypeptide sequences (e.g., at the N-terminal and / or C-terminal end). Sequence tags can be used for peptide detection, purification and / or localization. Lysines can be used to increase peptide solubility or to allow for biotinylation. Alternatively, amino acid residues located at the N-terminal and / or C-terminal regions of the amino acid sequence of a protein may optionally be deleted providing for truncated sequences. Certain amino acids (e.g., C-terminal or N-terminal amino acids) may be deleted depending on the use of the sequence, as for example, expression of the sequence as part of a larger sequence that is soluble or linked to a solid support. In some embodiments, sequences for (or encoding) signal sequences, termination sequences, transmembrane domains, linkers, multimerization domains (e.g., foldon regions) and the like are substituted with alternative sequences that achieve the same or a similar function. In some embodiments, cavities in the core of proteins can be filled to improve stability, e.g., by introducing larger amino acids. In other embodiments, buried hydrogen bond networks are replaced with hydrophobic resides to improve stability. In yet other embodiments, glycosylation sites are removed and replaced with appropriate residues. Such sequences are readily identifiable to one of skill in the art. It should also be understood that some of the sequences provided herein contain sequence tags or terminal peptide sequences (e.g., at the N-terminal or C-terminal ends) that may be deleted, for example, prior to use in the preparation of an mRNA vaccine. As recognized by those skilled in the art, protein fragments, functional protein domains, and homologous proteins are also considered to be within the scope of Borrelia proteins provided herein. For example, provided herein is any protein fragment of (meaning a polypeptide sequence at least one amino acid residue shorter than but otherwise identical to) a naturally occurring or reference sequence, provided that the fragment is immunogenic and confers a protective immune response to LD. In addition to protein variants that are identical to#14388136v1 the naturally occurring or reference protein but are truncated, in some embodiments, a protein includes 2, 3, 4, 5, 6, 7, 8, 9, 10, or more mutations (e.g., substitutions, insertions and / or deletions), as shown in any of the sequences provided or referenced herein. Protein variants can range in length from about 4, 6, or 8 amino acids to full length proteins. Non-limiting examples of Borrelia protein variants are provided in Table 1. Exemplary sequence comparisons for OspA proteins (full length sequence comparisons) are provided in FIG. 3 (and its corresponding description). A full-length sequence alignment of exemplary OspA proteins is provided in FIG. 2. One having ordinary skill in the art would be able to identify from these comparisons which amino acids are amenable to alteration (e.g., those that are not conserved). Signal Peptides In some embodiments, an mRNA has an open reading frame that encodes a signal peptide fused to the Borrelia protein. Signal peptides, comprising the N-terminal 15-60 amino acids of proteins, are typically needed for the translocation across the membrane on the secretory pathway and, thus, universally control the entry of most proteins both in eukaryotes and prokaryotes to the secretory pathway. In eukaryotes, the signal peptide of a nascent precursor protein (pre-protein) directs the ribosome to the rough endoplasmic reticulum (ER) membrane and initiates the transport of the growing peptide chain across it for processing. ER processing produces mature proteins, wherein the signal peptide is cleaved from precursor proteins, typically by an ER-resident signal peptidase of the host cell, or they remain uncleaved and function as a membrane anchor. A signal peptide may also facilitate the targeting of the protein to the cell membrane. A signal peptide may have a length of 15-60 amino acids. For example, a signal peptide may have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 amino acids. In some embodiments, a signal peptide has a length of 20-60, 25-60, 30-60, 35- 60, 40-60, 45- 60, 50-60, 55-60, 15-55, 20-55, 25-55, 30-55, 35-55, 40-55, 45-55, 50-55, 15-50, 20-50, 25-50, 30-50, 35-50, 40-50, 45-50, 15-45, 20-45, 25-45, 30-45, 35-45, 40-45, 15-40, 20- 40, 25-40, 30-40, 35-40, 15-35, 20-35, 25-35, 30-35, 15-30, 20-30, 25-30, 15-25, 20-25, or 15- 20 amino acids. Signal peptides from heterologous genes (which regulate expression of genes other than Borrelia proteins in nature) are known in the art and can be tested for desired properties and then incorporated into a nucleic acid of the disclosure.#14388136v1 Fusion Proteins In some embodiments, an mRNA polynucleotide comprises an ORF that encodes a fusion protein. Thus, an encoded protein may include two or more proteins (e.g., protein and / or protein fragment) joined together with or without a linker. Fusion proteins, in some embodiments, retain the functional property of each independent (nonfusion) protein. In some embodiments, a fusion protein comprises 2, 3, 4, 5, 6, or 7 of the following Borrelia proteins: OspA serotype 1 (S1); OspA serotype 2 (S2); OspA serotype 3 (S3); OspA serotype 4 (S4); OspA serotype 5 (S5); OspA serotype 6 (S6); and OspA serotype 7 (S7). Linkers and Cleavable Peptides In some embodiments, an mRNA that encodes a fusion protein further encodes a linker located between at least one or each domain of the fusion protein. The linker may be, for example, a cleavable linker or protease-sensitive linker. In some embodiments, the linker is selected from the group consisting of F2A linker, P2A linker, T2A linker, E2A linker, and combinations thereof (see, e.g., WO 2017 / 127750). This family of self-cleaving peptide linkers, referred to as 2A peptides, has been described in the art (see, e.g., Kim, J.H. et al. PLoS ONE 2011;6:e18556). In some embodiments, the linker is an F2A linker. In some embodiments, the linker is a GS linker. GS linkers are polypeptide linkers that include glycine and serine amino acids repeats. They comprise flexible and hydrophilic residues and can be used to perform fusion of protein subunits without interfering in the folding and function of the protein domains, and without formation of secondary structures. In some embodiments, an mRNA polynucleotide comprises an ORF that encodes a fusion protein that comprises a GS linker that is 3 to 20 amino acids long. For example, the GS linker may have a length of (or have a length of at least) 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids. In some embodiments, a GS linker is (or is at least) 15 amino acids long (e.g., GGSGGSGGSGGSGGG (SEQ ID NO: 67)). In some embodiments, a GS linker is (or is at least) 8 amino acids long (e.g., GGGSGGGS (SEQ ID NO: 68)). In some embodiments, a GS linker is (or is at least) 7 amino acids long (e.g., GGGSGGG (SEQ ID NO: 69)). In some embodiments, a GS linker is (or is at least) 4 amino acid long (e.g., GGGS (SEQ ID NO: 34)). In some embodiments, the GS linker comprises (GGGS)n (SEQ ID NO: 35), where n is any integer from 1-5. In some embodiments, a GS linker is (or is at least) 4 amino acid long (e.g., GSGG (SEQ ID NO: 36)). In some embodiments, the GS linker comprises (GSGG)n (SEQ ID NO: 37), where n is any integer from 1-5. In some embodiments, a linker is a glycine linker, for example having a length of (or a length of at least) 3 amino acids (e.g., GGG). In some embodiments, a#14388136v1 protein encoded by an mRNA includes two or more linkers, which may be the same or different from each other. The skilled artisan will appreciate that other art-recognized linkers may be suitable for use in the constructs of the disclosure (e.g., encoded by the nucleic acids of the disclosure). The skilled artisan will likewise appreciate that other polycistronic constructs (mRNA encoding more than one protein separately within the same molecule) may be suitable for use as provided herein. Stabilization Domains Protein stabilization domains are protein sequences or structures that can enhance the stability of a protein to various environmental stresses, such as temperature, pH, and proteolysis. Non-limiting examples of protein stabilization domains for use to stabilize a Borrelia protein expressed by an mRNA include: lumazine synthase, ferritin, and thioredoxin. In some embodiments, a Borrelia OspA protein, e.g., an OspA S1 protein is fused to a lumazine synthase. Lumazine synthase is protein from bacteria and plants that can stabilize fusion partners by forming homodimers or oligomers, which can enhance the solubility and stability of the target protein. In some embodiments, a Borrelia OspA protein, e.g., an OspA S1 protein is fused to ferritin. Ferritin is a protein found in animals, plants, and bacteria that can form a cage-like structure that can store and sequester iron ions, protecting the cell from oxidative damage. Fusion of a target protein with ferritin can improve its stability and solubility. In some embodiments, a Borrelia OspA protein, e.g., an OspA S1 protein is fused to thioredoxin. Thioredoxin is small protein found in bacteria and eukaryotes that can act as a reducing agent and stabilize proteins by forming disulfide bonds. Nucleic Acids Encoding Lyme Disease Proteins mRNA polynucleotides of the present disclosure comprise an open reading frame (ORF) encoding a Borrelia protein. In some embodiments, the mRNA polynucleotides further comprise a 5^ untranslated region (UTR), 3^ UTR, a poly(A) tail and / or a 5^ cap analog. Some aspects of the present disclosure relate to polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the polynucleotide of the present disclosure comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 32 and one or more of any one of SEQ ID NOs: 9-14, wherein SEQ ID NO: 32 encodes an OspA protein having a valine (V) at position 184 and a threonine (T) at#14388136v1 position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the polynucleotide comprises the nucleic acid sequence of any one of SEQ ID NOs: 9-14, or 32. In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 9. In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 10. In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 11. In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 12. In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 13. In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32 (which encodes an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204). Some aspects of the present disclosure relate to a compositions comprising a plurality of polynucleotides, wherein the plurality comprises two or more of, three or more of, four or more of, five or more of, six or more of, or all seven of: a first polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); a second polynucleotide comprising a sequence having at least#14388136v1 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide comprising a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the plurality comprises two or more of, three or more of, four or more of, five or more of, six or more of, or all seven of: a first polynucleotide comprising a sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); a second polynucleotide comprising a sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide comprising a sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the plurality comprises two or more of, three or more of, four or more of, five or more of, six or more of, or all seven of: a first polynucleotide comprising a sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); a second polynucleotide comprising a sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide#14388136v1 comprising a sequence having at least 85% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the plurality comprises two or more of, three or more of, four or more of, five or more of, six or more of, or all seven of: a first polynucleotide comprising a sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); a second polynucleotide comprising a sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide comprising a sequence having at least 90% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the plurality comprises two or more of, three or more of, four or more of, five or more of, six or more of, or all seven of: a first polynucleotide comprising a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); a second polynucleotide comprising a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide comprising a sequence having at least 95% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the plurality comprises two or more of, three or more of, four or more of, five or more of, six or more of, or all seven of: a first polynucleotide comprising a sequence having at least 98% identity to the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID#14388136v1 NO: 1); a second polynucleotide comprising a sequence having at least 98% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 98% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 98% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 98% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 98% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide comprising a sequence having at least 98% identity to the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the first polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32 and encoding for an OspA protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1); the second polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 9; the third polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 10; the fourth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 11; the fifth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 12; the sixth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 13; and the seventh polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 14. In some embodiments, the second polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 9; the third polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 10; the fourth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 11; the fifth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 12; the sixth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 13; and the seventh polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 14. Messenger RNA Messenger RNA (mRNA) is RNA that encodes a (at least one) protein (a naturally- occurring, non-naturally-occurring, or modified polymer of amino acids) and can be translated to produce the encoded protein in vitro, in vivo, in situ, or ex vivo. It is understood that mRNA is not self-amplifying RNA (saRNA) (see, e.g., Bloom K et al. Gene Therapy 2021; 28: 117–129 for a comparison of mRNA and saRNA). saRNAs include alphavirus replicase sequences that encode an RNA-dependent RNA polymerase. mRNA does not include alphavirus replicase sequences. The skilled artisan will appreciate that, except where otherwise noted, nucleic acid sequences set forth in the instant application may recite “T”s in a representative DNA sequence#14388136v1 but where the sequence represents mRNA, the “T”s would be substituted for “U”s. Thus, any of the DNAs disclosed and identified by a particular sequence identification number herein also disclose the corresponding mRNA sequence complementary to the DNA, where each “T” of the DNA sequence is substituted with “U.” Naturally-occurring eukaryotic mRNA molecules can contain stabilizing elements, including, but not limited to, UTRs at their 5′-end (5′ UTR) and / or at their 3′-end (3′ UTR), in addition to other structural features, such as a 5′-cap structure or a 3′-poly(A) tail. Both the 5′ UTR and the 3′ UTR are typically transcribed from the genomic DNA and are elements of the premature mRNA. Characteristic structural features of mature mRNA, such as the 5′-cap and the 3′-poly(A) tail are usually added to the transcribed (premature) mRNA during mRNA processing. Exemplary sequences of mRNA that encode Borrelia proteins of the present disclosure are provided in Table 1. In some embodiments, the mRNA polynucleotide comprises an ORF that is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or identical to a sequence selected from SEQ ID NOs: 9-14, 16-21, 32-33, and 72. In some embodiments, the mRNA polynucleotide comprises a nucleotide sequence that is 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or identical to a sequence selected from SEQ ID NOs: 9-14, 16-21, 32, 33, 55, 57, 59, 61, 63, 65, and 72 wherein SEQ ID NOs: 32, 33, and 72 encode for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 55. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 57. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 59. In some embodiments, the mRNA polynucleotide comprises a sequence having#14388136v1 at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 61. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 63. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 21. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 65. In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 33 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the mRNA polynucleotide comprises a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of Table 1. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 16. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 55. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 17. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 57. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 18. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 59. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 19. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 61. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 20. In some embodiments, the mRNA polynucleotide comprises the#14388136v1 nucleic acid sequence of SEQ ID NO: 63. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 21. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 65. In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 33 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). In some embodiments, the mRNA polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 72 and encodes for an OspA S1 protein having a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1). Untranslated Regions (UTRs) The mRNAs of the present disclosure may comprise one or more regions or parts which act or function as an untranslated region. A “5′ untranslated region” (UTR) refers to a region of an mRNA that is directly upstream (i.e., 5′) from the start codon (i.e., the first codon of an mRNA transcript translated by a ribosome) that does not encode a polypeptide. A “3′ untranslated region” (UTR) refers to a region of an mRNA that is directly downstream (i.e., 3′) from the stop codon (i.e., the codon of an mRNA transcript that signals a termination of translation) that does not encode a polypeptide. When RNA transcripts are being generated, the 5’ UTR may comprise a promoter sequence. Such promoter sequences are known in the art. It should be understood that such promoter sequences will not be present in a vaccine of the disclosure. Where mRNAs are designed to encode a (at least one) bacterial protein, the mRNA may comprise a 5’ UTR and / or 3’ UTR. UTRs of an mRNA are transcribed but not translated. In mRNA, the 5′ UTR starts at the transcription start site and continues to the start codon but does not include the start codon; the 3′ UTR starts immediately following the stop codon and continues until the transcriptional termination signal. There is a growing body of evidence about the regulatory roles played by the UTRs in terms of stability of the nucleic acid molecule and translation. The regulatory features of a UTR can be incorporated into the polynucleotides of the present disclosure to, among other things, enhance the stability of the molecule. The specific features can also be incorporated to ensure controlled down-regulation of the transcript in case#14388136v1 they are misdirected to undesired organs sites. A variety of 5’ UTR and 3’ UTR sequences are known. It should also be understood that the mRNA of the present disclosure may include any 5’ UTR and / or any 3’ UTR. Exemplary UTR sequences include SEQ ID NOs: 22, 23, 38, 39, 41- 50, 53, 56, 58, 60, 62, 64, and 66; however, other UTR sequences may be used or exchanged for any of the UTR sequences described herein. In some embodiments, a 5' UTR of the present disclosure comprises a sequence selected from: GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGAGCCACC (SEQ ID NO: 38), GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC (SEQ ID NO: 39), GAGGAAAUCGCAAAAUUUGCUCUUCGCGUUAGAUUUCUUUUAGUUUUCUCGCAACUAGC AAGCUUUUUGUUCUCGCC (SEQ ID NO: 22), GGAAAUCGCAAAAUUUGCUCUUCGCGUUAGAUUUCUUUUAGUUUUCUCGCAACUAGCAA GCUUUUUGUUCUCGCC (SEQ ID NO: 41), AGGAAAUCGCAAAAUUUGCUCUUCGCGUUAGAUUUCUUUUAGUUUUCUCGCAACUAGCA AGCUUUUUGUUCUCGCC (SEQ ID NO: 50), and a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of any one of SEQ ID NOs: 38, 39, 22, 41, and 50. In some embodiments, a 3' UTR of the present disclosure comprises a sequence selected from UGAUAAUAGGCUGGAGCCUCGGUGGCCAUGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 42), UGAUAAUAGGCUGGAGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 43), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGAGAUUGAGUGUAGUGACUAGUGGUCUUUGAAUAAAGUCUG AGUGGGCGGC (SEQ ID NO: 44), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGAUUGAGACUACGGGUGGUCUUUGAAUAAAGUCUGAGUGGG CGGC (SEQ ID NO: 45), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGCAUAGACACUACGUGGUCUUUGAAUAAAGUCUGAGUGGGCG GC (SEQ ID NO: 46),#14388136v1 UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGAGAUUGAGUGUAGUGGUGGUCUUUGAAUAAAGUCUGAGUG GGCGGC (SEQ ID NO: 47), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGAGAUUGAGUGUAGUGACGUGGUCUUUGAAUAAAGUCUGAG UGGGCGGC (SEQ ID NO: 48), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 49), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCACCCGUACCCCCGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 23), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGUUAAGGAAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 53), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGUGACCUUAGAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGG C (SEQ ID NO: 56), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGUCCACAUAUCGAAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC(SEQ ID NO: 58), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGAUAACUGAAGGAAGAGUGGUCUUUGAAUAAAGUCUGAGUGG GCGGC (SEQ ID NO: 60), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGAGAGUGAGUGUAGUGAGGUGGUCUUUGAAUAAAGUCUGAG UGGGCGGC (SEQ ID NO: 62), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGGAGAGUGAGUGUAGUGAGUAAGUGGUCUUUGAAUAAAGUCU GAGUGGGCGGC (SEQ ID NO: 64), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAGUUGAGGCACGCGUCGGCAGGCGCAGUGGUCUUUGAAUAAAG UCUGAGUGGGCGGC (SEQ ID NO: 66), UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAUUCCAAAGUGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 73), and a sequence having at least 80%, 85%, 90%, 95%, or 98% identity to the nucleic acid sequence of any one of SEQ ID NOs: 42-49, 23, 53, 56, 58, 60, 62, 64, and 66.#14388136v1 In some embodiments, a 3′ UTR comprises, in 5′-to-3′ order: (a) the nucleic acid sequence UAAAGCUCCCCGGGGGCCUCGGUGGCCUAGCUUCUUGCCCCUUGGGCCUCCCCCCAGCCC CUCCUCCCCUUCCUGCAG (SEQ ID NO: 51), (b) an identification and ratio determination (IDR) sequence, and (c) the nucleic acid sequence UGGUCUUUGAAUAAAGUCUGAGUGGGCGGC (SEQ ID NO: 52). IDR sequences are described herein in the section entitled “Identification and Ratio Determination (IDR) Sequences.” UTRs may also be omitted from the mRNA provided herein. A 5^ UTR does not encode a protein (is non-coding). Natural 5′ UTRs have features that play roles in translation initiation. They harbor signatures like Kozak sequences which are commonly known to be involved in the process by which the ribosome initiates translation of many genes. Kozak sequences have the consensus CCR(A / G)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another 'G'.5′UTR also have been known to form secondary structures which are involved in elongation factor binding. In some embodiments of the disclosure, a 5’ UTR is a heterologous UTR, i.e., is a UTR found in nature associated with a different ORF. In other embodiments, a 5’ UTR is a synthetic UTR, i.e., does not occur in nature. Synthetic UTRs include UTRs that have been mutated to improve their properties, e.g., which increase gene expression as well as those which are completely synthetic. Exemplary 5’ UTRs include Xenopus or human derived a-globin or b- globin (8278063; 9012219), human cytochrome b-245 a polypeptide, and hydroxysteroid (17b) dehydrogenase, and Tobacco etch virus (US8278063, US9012219). CMV immediate-early 1 (IE1) gene (US2014 / 0206753, WO2013 / 185069), the sequence GGGAUCCUACC (SEQ ID NO: 54) (WO2014 / 144196) may also be used. In other embodiments, a 5' UTR is a 5' UTR of a TOP gene lacking the 5' TOP motif (the oligopyrimidine tract) (e.g., WO2015 / 101414, WO2015 / 101415, WO2015 / 062738, WO2015 / 024667, WO2015 / 024667); 5' UTR element derived from ribosomal protein Large 32 (L32) gene (WO2015 / 101414, WO2015 / 101415, WO2015 / 062738), 5' UTR element derived from the 5' UTR of an hydroxysteroid (17-β) dehydrogenase 4 gene (HSD17B4) (WO2015 / 024667), or a 5' UTR element derived from the 5' UTR of ATP5A1 (WO2015 / 024667) can be used. In some embodiments, an internal ribosome entry site (IRES) is used instead of a 5' UTR. A 3^ UTR does not encode a protein (is non-coding). Natural or wild type 3′ UTRs are known to have stretches of adenosines and uridines embedded in them. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into#14388136v1 three classes (Chen et al, 1995): Class I AREs contain several dispersed copies of an AUUUA motif within U-rich regions. C-Myc and MyoD contain class I AREs. Class II AREs possess two or more overlapping UUAUUUA(U / A)(U / A) nonamers. Molecules containing this type of AREs include GM-CSF and TNF-a. Class III ARES are less well defined. These U rich regions do not contain an AUUUA motif. c-Jun and Myogenin are two well-studied examples of this class. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3′ UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo. Introduction, removal or modification of 3′ UTR AU rich elements (AREs) can be used to modulate the stability of mRNA of the disclosure. When engineering specific nucleic acids, one or more copies of an ARE can be introduced to make nucleic acids of the disclosure less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein. Transfection experiments can be conducted in relevant cell lines, using nucleic acids of the disclosure and protein production can be assayed at various time points post-transfection. For example, cells can be transfected with different ARE-engineering molecules and by using an ELISA kit to the relevant protein and assaying protein produced at 6 hours, 12 hours, 1 day, 2 days, and 7 days post-transfection. Those of ordinary skill in the art will understand that 5’ UTRs that are heterologous or synthetic may be used with any desired 3’ UTR sequence. For example, a heterologous or synthetic 5’ UTR may be used with a synthetic 3’ UTR or with a heterologous 3’ UTR. Non-UTR sequences may also be used as regions or subregions within a nucleic acid. For example, introns or portions of introns sequences may be incorporated into regions of nucleic acid of the disclosure. Incorporation of intronic sequences may increase protein production as well as nucleic acid levels. Combinations of features may be included in flanking regions and may be contained within other features. For example, the ORF may be flanked by a 5' UTR which may contain a strong Kozak translational initiation signal and / or a 3' UTR which may include an oligo(dT) sequence for templated addition of a poly-A tail. 5′ UTR may comprise a first polynucleotide fragment and a second polynucleotide fragment from the same and / or different genes such as the 5′ UTRs described in US2010 / 0293625 and WO2015 / 085318A2, each of which is herein incorporated by reference.#14388136v1 It should be understood that any UTR from any gene may be incorporated into the regions of a nucleic acid. Furthermore, multiple wild-type UTRs of any known gene may be utilized. It is also within the scope of the present disclosure to provide artificial UTRs which are not variants of wild type regions. These UTRs or portions thereof may be placed in the same orientation as in the transcript from which they were selected or may be altered in orientation or location. Hence a 5′ or 3′ UTR may be inverted, shortened, lengthened, made with one or more other 5′ UTRs or 3′ UTRs. As used herein, the term “altered” as it relates to a UTR sequence, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3′ UTR or 5′ UTR may be altered relative to a wild-type / native UTR by the change in orientation or location as taught above or may be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. Any of these changes producing an “altered” UTR (whether 3′ or 5′) comprise a variant UTR. In some embodiments, a double, triple or quadruple UTR such as a 5′ UTR or 3′ UTR may be used. As used herein, a “double” UTR is one in which two copies of the same UTR are encoded either in series or substantially in series. For example, a double beta-globin 3′ UTR may be used as described in US2010 / 0129877, which is incorporated herein by reference. It is also within the scope of the present disclosure to have patterned UTRs. As used herein “patterned UTRs” are those UTRs which reflect a repeating or alternating pattern, such as ABABAB or AABBAABBAABB or ABCABCABC or variants thereof repeated once, twice, or more than 3 times. In these patterns, each letter, A, B, or C represent a different UTR at the nucleotide level. In some embodiments, flanking regions are selected from a family of transcripts whose proteins share a common function, structure, feature, or property. For example, polypeptides of interest may belong to a family of proteins which are expressed in a particular cell, tissue or at some time during development. The UTRs from any of these genes may be swapped for any other UTR of the same or different family of proteins to create a new polynucleotide. As used herein, a “family of proteins” is used in the broadest sense to refer to a group of two or more polypeptides of interest which share at least one function, structure, feature, localization, origin, or expression pattern. The untranslated region may also include translation enhancer elements (TEE). As a non- limiting example, the TEE may include those described in US 2009 / 0226470, herein incorporated by reference, and those known in the art. Open Reading Frames An open reading frame (ORF) is a continuous stretch of DNA or RNA beginning with a start codon (e.g., methionine (ATG or AUG)) and ending with a stop codon (e.g., TAA, TAG or#14388136v1 TGA, or UAA, UAG or UGA). An ORF typically encodes a protein. It will be understood that the sequences disclosed herein may further comprise additional elements, e.g., 5′ and / or 3′ UTRs, but that those elements, unlike the ORF, need not necessarily be present in an mRNA of the present disclosure. 5’ End Capping In some embodiments, an mRNA polynucleotide comprises a 5′ terminal cap. 5′-capping of polynucleotides may be completed concomitantly during an in vitro transcription reaction using, for example, the following chemical RNA cap analogs to generate the 5′-guanosine cap structure according to manufacturer protocols: 3´-O-Me-m7G(5')ppp(5') G [the ARCA cap];G(5')ppp(5')A; G(5')ppp(5')G; m7G(5')ppp(5')A; m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). 5′-capping of modified mRNA may be completed post-transcriptionally using, for example, a Vaccinia Virus Capping Enzyme to generate the “Cap 0” structure: m7G(5')ppp(5')G (New England BioLabs, Ipswich, MA). Cap 1 structure may be generated using both Vaccinia Virus Capping Enzyme and a 2′-O methyl-transferase to generate: m7G(5')ppp(5')G-2′-O-methyl. Cap 2 structure may be generated from the Cap 1 structure followed by the 2′-O-methylation of the 5′-antepenultimate nucleotide using a 2′-O methyl- transferase. Cap 3 structure may be generated from the Cap 2 structure followed by the 2′-O- methylation of the 5′-preantepenultimate nucleotide using a 2′-O methyl-transferase. Enzymes may be derived from a recombinant source. Other cap analogs may be used. Polyadenylation Tailing A “poly(A) tail” is a region of mRNA that is downstream, e.g., directly downstream (i.e., 3′), from the 3′ UTR that contains multiple, consecutive adenosine monophosphates. A poly(A) tail may contain 10 to 300 adenosine monophosphates. It can, in some instances, comprise up to about 400 adenine nucleotides. For example, a poly(A) tail may contain 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or 300 adenosine monophosphates. In some embodiments, a poly(A) tail contains 50 to 250 adenosine monophosphates. In a relevant biological setting (e.g., in cells, in vivo) the poly(A) tail functions to protect mRNA from enzymatic degradation, e.g., in the cytoplasm, and aids in transcription termination, and / or export of the mRNA from the nucleus and translation. In some embodiments, the length of the 3′-poly(A) tail may be an essential element with respect to the stability of the individual mRNA. In some embodiments, a poly(A) tail has a length of about 50, about 100, about 150, about 200, about 250, about 300, about 350, or about 400 nucleotides. In some embodiments, a poly(A) tail has a length of 100 nucleotides.#14388136v1 Sequence Optimization In some embodiments, an open reading frame encoding a protein of the disclosure is codon optimized. Codon optimization methods are known in the art. An open reading frame of any one or more of the sequences provided herein may be codon optimized. Codon optimization, in some embodiments, may be used to match codon frequencies in target and host organisms to ensure proper folding; bias GC content to increase mRNA stability or reduce secondary structures; minimize tandem repeat codons or base runs that may impair gene construction or expression; customize transcriptional and translational control regions; insert or remove protein trafficking sequences; remove / add post translation modification sites in encoded protein (e.g., glycosylation sites); add, remove or shuffle protein domains; insert or delete restriction sites; modify ribosome binding sites and mRNA degradation sites; adjust translational rates to allow the various domains of the protein to fold properly; or reduce or eliminate problem secondary structures within the polynucleotide. Codon optimization tools, algorithms and services are known in the art – non-limiting examples include services from GeneArt (Life Technologies), DNA2.0 (Menlo Park CA) and / or proprietary methods. In some embodiments, the open reading frame sequence is optimized using optimization algorithms. In some embodiments, a codon optimized sequence shares less than 95% sequence identity to a naturally-occurring or wild-type sequence open reading frame (e.g., a naturally- occurring or wild-type mRNA sequence encoding a Borrelia protein antigen). In some embodiments, a codon optimized sequence shares less than 90% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a Borrelia protein). In some embodiments, a codon optimized sequence shares less than 85% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a Borrelia protein). In some embodiments, a codon optimized sequence shares less than 80% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a Borrelia protein). In some embodiments, a codon optimized sequence shares less than 75% sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a Borrelia protein). In some embodiments, a codon optimized sequence shares between 65% and 85% (e.g., between about 67% and about 85% or between about 67% and about 80%) sequence identity to a naturally-occurring or wild-type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a Borrelia protein). In some embodiments, a codon optimized sequence shares between 65% and 75% or about 80% sequence identity to a naturally-occurring or wild-#14388136v1 type sequence (e.g., a naturally-occurring or wild-type mRNA sequence encoding a Borrelia protein). In some embodiments, a codon-optimized sequence encodes an antigen that is as immunogenic as, or more immunogenic than (e.g., at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 100%, or at least 200% more), than a Borrelia protein encoded by a non-codon-optimized sequence. When transfected into mammalian host cells, the modified mRNAs have a stability of between 12-18 hours, or greater than 18 hours, e.g., 24, 36, 48, 60, 72, or greater than 72 hours and are capable of being expressed by the mammalian host cells. In some embodiments, a codon optimized mRNA may be one in which the levels of G / C are enhanced. The G / C-content of nucleic acid molecules (e.g., mRNA) may influence the stability of the RNA. mRNA having an increased amount of guanine (G) and / or cytosine (C) residues may be functionally more stable than RNA containing a large amount of adenine (A) and thymine (T) or uracil (U) nucleotides. As an example, WO02 / 098443 discloses a pharmaceutical composition containing an mRNA stabilized by sequence modifications in the translated region. Due to the degeneracy of the genetic code, the modifications work by substituting existing codons for those that promote greater RNA stability without changing the resulting amino acid. The approach is limited to coding regions of the mRNA. Chemically Unmodified Nucleotides In some embodiments, an mRNA is not chemically modified and comprises the standard ribonucleotides consisting of adenosine, guanosine, cytosine and uridine. In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard nucleoside residues such as those present in transcribed RNA (e.g., A, G, C, or U). In some embodiments, nucleotides and nucleosides of the present disclosure comprise standard deoxyribonucleosides such as those present in DNA (e.g., dA, dG, dC, or dT). Chemically Modified Nucleotides The compositions of the present disclosure comprise, in some embodiments, an RNA having an open reading frame encoding a Borrelia protein, wherein the nucleic acid comprises nucleotides and / or nucleosides that can be standard (unmodified) or modified as is known in the art. In some embodiments, nucleotides and nucleosides of the present disclosure comprise modified nucleotides or nucleosides. Such modified nucleotides and nucleosides can be naturally-occurring modified nucleotides and nucleosides or non-naturally-occurring modified nucleotides and nucleosides. Such modifications can include those at the sugar, backbone, or nucleobase portion of the nucleotide and / or nucleoside as are recognized in the art.#14388136v1 In some embodiments, a naturally-occurring modified nucleotide or nucleotide of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such naturally-occurring modified nucleotides and nucleotides can be found, inter alia, in the widely recognized MODOMICS database. In some embodiments, a non-naturally-occurring modified nucleotide or nucleoside of the disclosure is one as is generally known or recognized in the art. Non-limiting examples of such non-naturally-occurring modified nucleotides and nucleosides can be found, inter alia, in international publication numbers WO2013 / 052523A1; WO2014 / 093924A1; WO2015 / 051173A2; WO2015 / 051169A2; WO2015 / 089511A2; or WO2017 / 153936A1, each of which is herein incorporated by reference in its entirety. Hence, nucleic acids of the disclosure (e.g., DNA and RNA, such as mRNA) can comprise standard nucleotides and nucleosides, naturally-occurring nucleotides and nucleosides, non-naturally-occurring nucleotides and nucleosides, or any combination thereof. Nucleic acids of the disclosure (e.g., DNA and RNA, such as mRNA), in some embodiments, comprise various (more than one) different types of standard and / or modified nucleotides and nucleosides. In some embodiments, a particular region of a nucleic acid contains one, two or more (optionally different) types of standard and / or modified nucleotides and nucleosides. In some embodiments, a modified mRNA introduced to a cell or organism, exhibits reduced degradation in the cell or organism, respectively, relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides. In some embodiments, a modified mRNA introduced into a cell or organism, may exhibit reduced immunogenicity in the cell or organism, respectively (e.g., a reduced innate response) relative to an unmodified nucleic acid comprising standard nucleotides and nucleosides. Nucleic acids (e.g., RNA, such as mRNA), in some embodiments, comprise non-natural modified nucleotides that are introduced during synthesis or post-synthesis of the nucleic acids to achieve desired functions or properties. The modifications may be present on internucleotide linkages, purine or pyrimidine bases, or sugars. The modification may be introduced with chemical synthesis or with a polymerase enzyme at the terminal of a chain or anywhere else in the chain. Any of the regions of a nucleic acid may be chemically modified. The present disclosure provides for modified nucleosides and nucleotides of a nucleic acid (e.g., RNA, such as mRNA). A “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”). A “nucleotide” refers to a nucleoside, including a phosphate group. Modified nucleotides may by#14388136v1 synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. Nucleic acids can comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the nucleic acids would comprise regions of nucleotides. Modified nucleotide base pairing encompasses not only the standard adenosine-thymine, adenosine-uracil, or guanosine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures, such as, for example, in those nucleic acids having at least one chemical modification. One example of such non-standard base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine or uracil. Any combination of base / sugar or linker may be incorporated into nucleic acids of the present disclosure. In some embodiments, modified nucleobases in nucleic acids (e.g., RNA, such as mRNA) comprise 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), 5-methoxy- uridine (mo5U), 5-methyl-cytidine (m5C), and / or pseudouridine (ψ). In some embodiments, modified nucleobases in nucleic acids (e.g., RNA, such as mRNA) comprise 5-methoxymethyl uridine, 5-methylthio uridine, 1-methoxymethyl pseudouridine, 5-methyl cytidine, and / or 5- methoxy cytidine. In some embodiments, the polyribonucleotide includes a combination of at least two (e.g., 2, 3, 4 or more) of any of the aforementioned modified nucleobases, including but not limited to chemical modifications. In some embodiments, an mRNA of the disclosure comprises 1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid. In some embodiments, an mRNA of the disclosure comprises 1-methyl-pseudouridine (m1ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid. In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid. In some embodiments, an mRNA of the disclosure comprises pseudouridine (ψ) substitutions at one or more or all uridine positions of the nucleic acid and 5-methyl cytidine substitutions at one or more or all cytidine positions of the nucleic acid. In some embodiments, an mRNA includes N1-methylpseudouridine. In some embodiments, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of uracil nucleotides in an mRNA comprise N1-#14388136v1 methylpseudouridine. In some embodiments, each uracil nucleotide of an mRNA transcript comprises N1-methylpseudouridine. In some embodiments, an mRNA includes 5- methylcytidine. In some embodiments, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of cytosine nucleotides in an mRNA comprise 5-methylcytidine. In some embodiments, each cytosine nucleotide of an mRNA transcript comprises 5-methylcytidine. In some embodiments, an mRNA includes 5- methyluridine. In some embodiments, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of uracil nucleotides in an mRNA comprise 5-methyluridine. In some embodiments, each uracil nucleotide of an mRNA transcript comprises 5-methyluridine. In some embodiments, an mRNA includes 5-methylcytidine and 5- methyluridine. In some embodiments, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of uracil nucleotides in an mRNA comprise 5-methyluridine and at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, or at least 99% of cytosine nucleotides in an mRNA comprise 5-methylcytidine. In some embodiments, each cytosine nucleotide of an mRNA transcript comprises 5-methylcytidine and each uracil nucleotide of an mRNA transcript comprises 5- methyluridine. In some embodiments, an mRNA of the disclosure comprises uridine at one or more or all uridine positions of the nucleic acid. In some embodiments, RNAs (e.g., mRNAs) are uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a nucleic acid can be uniformly modified with 1-methyl-pseudouridine, meaning that all uridine residues in the mRNA sequence are replaced with 1-methyl-pseudouridine. Similarly, a nucleic acid can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified residue such as those set forth above. The nucleic acids of the present disclosure may be partially or fully modified along the entire length of the molecule. For example, one or more or all or a given type of nucleotide (e.g., purine or pyrimidine, or any one or more or all of A, G, U, C) may be uniformly modified in a nucleic acid of the disclosure, or in a predetermined sequence region thereof (e.g., in the mRNA including or excluding the poly(A) tail). In some embodiments, all nucleotides X in a nucleic acid of the present disclosure (or in a sequence region thereof) are modified nucleotides, wherein X may be any one of nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C or A+G+C. The nucleic acid may contain from about 1% to about 100% modified nucleotides (either in relation to overall nucleotide content, or in relation to one or more types of nucleotide, i.e.,#14388136v1 any one or more of A, G, U or C) or any intervening percentage (e.g., from 1% to 20%, from 1% to 25%, from 1% to 50%, from 1% to 60%, from 1% to 70%, from 1% to 80%, from 1% to 90%, from 1% to 95%, from 10% to 20%, from 10% to 25%, from 10% to 50%, from 10% to 60%, from 10% to 70%, from 10% to 80%, from 10% to 90%, from 10% to 95%, from 10% to 100%, from 20% to 25%, from 20% to 50%, from 20% to 60%, from 20% to 70%, from 20% to 80%, from 20% to 90%, from 20% to 95%, from 20% to 100%, from 50% to 60%, from 50% to 70%, from 50% to 80%, from 50% to 90%, from 50% to 95%, from 50% to 100%, from 70% to 80%, from 70% to 90%, from 70% to 95%, from 70% to 100%, from 80% to 90%, from 80% to 95%, from 80% to 100%, from 90% to 95%, from 90% to 100%, and from 95% to 100%). It will be understood that any remaining percentage is accounted for by the presence of unmodified A, G, U, or C. The mRNA may contain at a minimum 1% and at maximum 100% modified nucleotides, or any intervening percentage, such as at least 5% modified nucleotides, at least 10% modified nucleotides, at least 25% modified nucleotides, at least 50% modified nucleotides, at least 80% modified nucleotides, or at least 90% modified nucleotides. For example, the nucleic acids may contain a modified pyrimidine such as a modified uracil or cytosine. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the uracil in the nucleic acid is replaced with a modified uracil (e.g., a 5-substituted uracil). The modified uracil can be replaced by a compound having a single unique structure or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90% or 100% of the cytosine in the nucleic acid is replaced with a modified cytosine (e.g., a 5-substituted cytosine). The modified cytosine can be replaced by a compound having a single unique structure or can be replaced by a plurality of compounds having different structures (e.g., 2, 3, 4 or more unique structures). Identification and Ratio Determination (IDR) Sequences An Identification and Ratio Determination (IDR) sequence is a sequence of a biological molecule (e.g., nucleic acid or protein) that, when combined with the sequence of a target biological molecule, serves to identify the target biological molecule. Typically, an IDR sequence is a heterologous sequence that is incorporated within or appended to a sequence of a target biological molecule and can be used as a reference to identify the target molecule. Thus, in some embodiments, a nucleic acid (e.g., mRNA) comprises (i) a target sequence of interest (e.g., a coding sequence encoding an antigenic peptide or protein); and (ii) a unique IDR sequence.#14388136v1 An RNA species (e.g., RNA having a given coding sequence) may comprise an IDR sequence that differs from the IDR sequence of other RNA species (e.g., RNA(s) having different coding sequence(s)). Each IDR sequence thus identifies a particular RNA species, and so the abundance of IDR sequences may be measured to determine the abundance of each RNA species in a composition. Use of distinct IDR sequences to identify RNA species allows for analysis of multivalent RNA compositions (e.g., containing multiple RNA species) containing RNA species with similar coding sequences and / or lengths, which could otherwise be difficult to distinguish using PCR- or chromatography-based analysis of full-length RNAs. Each RNA species in a multivalent RNA composition may comprise an IDR sequence that is not a sequence isomer of an IDR sequence of another RNA species in a multivalent RNA composition (e.g., the IDR sequence does not have the same number of adenosine nucleotides, the same number of cytosine nucleotides, the same number of guanine nucleotides, and the same number of uracil nucleotides, as another IDR sequence in the composition, even if those sequences have different sequences). Having identical nucleotide compositions causes sequence isomers to have the same mass, presenting a challenge to distinguishing sequence isomers using mass-based identification methods (e.g., mass spectrometry). Each RNA species in a multivalent RNA composition may comprise an IDR sequence having a mass that differs from the mass of IDR sequences of each other RNA species in a multivalent RNA composition. For example, the mass of each IDR sequence may differ from the mass of other IDR sequences by at least 9 Da, at least 25 Da, at least 25 Da, or at least 50 Da. Use of IDR sequences with distinct masses allows RNA fragments comprising different IDR sequences to be distinguished using mass-based analysis methods (e.g., mass spectrometry), which do not require reverse transcription, amplification, or sequencing of RNAs. Each RNA species in an RNA composition may comprise an IDR sequence with a different length. For example, each IDR sequence may have a length independently selected from 0 to 25 nucleotides. The length of a nucleic acid influences the rate at which the nucleic acid traverses a chromatography column, and so the use of IDR sequences of different lengths on different RNA species allows RNA fragments having different IDR sequences to be distinguished using chromatography-based methods (e.g., LC-UV). IDR sequences may be chosen such that no IDR sequence comprises a start codon, ‘AUG’. Lack of a start codon in an IDR sequence prevents undesired translation of nucleotide sequences within and / or downstream from the IDR sequence. IDR sequences may be chosen such that no IDR sequence comprises a recognition site for a restriction enzyme. In one example, no IDR sequence comprises a recognition site for XbaI, ‘UCUAG’. Lack of a recognition site for a restriction enzyme (e.g., XbaI recognition site#14388136v1 ‘UCUAG’) allows the restriction enzyme to be used in generating and modifying a DNA template for in vitro transcription, without affecting the IDR sequence or sequence of the transcribed RNA. Nucleic Acid Production Chemical Synthesis Solid-phase chemical synthesis. Nucleic acids the present disclosure may be manufactured in whole or in part using solid phase techniques. Solid-phase chemical synthesis of nucleic acids is an automated method wherein molecules are immobilized on a solid support and synthesized step by step in a reactant solution. Solid-phase synthesis is useful in site-specific introduction of chemical modifications in the nucleic acid sequences. The synthesis of nucleic acids of the present disclosure by the sequential addition of monomer building blocks may be carried out in a liquid phase. The synthetic methods discussed above each has its own advantages and limitations. Attempts have been conducted to combine these methods to overcome the limitations. Such combinations of methods are within the scope of the present disclosure. The use of solid-phase or liquid-phase chemical synthesis in combination with enzymatic ligation provides an efficient way to generate long chain nucleic acids that cannot be obtained by chemical synthesis alone. Ligation Assembling nucleic acids by a ligase may also be used. DNA or RNA ligases promote intermolecular ligation of the 5’ and 3’ ends of polynucleotide chains through the formation of a phosphodiester bond. Nucleic acids such as chimeric polynucleotides and / or circular nucleic acids may be prepared by ligation of one or more regions or subregions. DNA fragments can be joined by a ligase catalyzed reaction to create recombinant DNA with different functions. Two oligodeoxynucleotides, one with a 5’ phosphoryl group and another with a free 3’ hydroxyl group, serve as substrates for a DNA ligase. Purification Purification of the nucleic acids described herein may include, but is not limited to, nucleic acid clean-up, quality assurance and quality control. Clean-up may be performed by methods known in the arts such as, but not limited to, AGENCOURT® beads (Beckman Coulter Genomics, Danvers, MA), poly-T beads, LNATM oligo-T capture probes (EXIQON® Inc, Vedbaek, Denmark) or HPLC based purification methods such as, but not limited to, strong anion exchange HPLC, weak anion exchange HPLC, reverse phase HPLC (RP-HPLC), and hydrophobic interaction HPLC (HIC-HPLC). The term “purified” when used in relation to a nucleic acid such as a “purified nucleic acid” refers to one that is separated from at least one#14388136v1 contaminant. A “contaminant” is any substance that makes another unfit, impure or inferior. Thus, a purified nucleic acid (e.g., DNA and RNA) is present in a form or setting different from that in which it is found in nature, or a form or setting different from that which existed prior to subjecting it to a treatment or purification method. A quality assurance and / or quality control check may be conducted using methods such as, but not limited to, gel electrophoresis, UV absorbance, or analytical HPLC. In some embodiments, the nucleic acids may be sequenced by methods including, but not limited to reverse-transcriptase-PCR. In Vitro Transcription cDNA encoding the polynucleotides described herein may be transcribed using an in vitro transcription (IVT) system. In vitro transcription of mRNA is known in the art and is described in International Publication WO 2014 / 152027, which is incorporated by reference herein in its entirety. In some embodiments, the RNA of the present disclosure is prepared in accordance with any one or more of the methods described in WO 2018 / 053209 or WO 2019 / 036682, each of which is incorporated by reference herein. In some embodiments, the mRNA transcript is generated using a non-amplified, linearized DNA template in an in vitro transcription reaction to generate the RNA transcript. In some embodiments, the template DNA is isolated DNA. In some embodiments, the template DNA is cDNA. In some embodiments, the cDNA is formed by reverse transcription of an RNA, for example, but not limited to Borrelia mRNA. In some embodiments, cells, e.g., bacterial cells, e.g., E. coli, e.g., DH-1 cells are transfected with the plasmid DNA template. In some embodiments, the transfected cells are cultured to replicate the plasmid DNA which is then isolated and purified. In some embodiments, the DNA template includes an RNA polymerase promoter, e.g., a T7 promoter located 5 ' to and operably linked to the gene of interest. In some embodiments, an in vitro transcription template encodes a 5′ untranslated (UTR) region, contains an open reading frame, and encodes a 3′ UTR and a poly(A) tail. The particular nucleic acid sequence composition and length of an in vitro transcription template will depend on the mRNA encoded by the template. In some embodiments, a nucleic acid (e.g., template DNA and / or RNA) includes 200 to 3,000 nucleotides. For example, a nucleic acid may include 200 to 500, 200 to 1000, 200 to 1500, 200 to 3000, 500 to 1000, 500 to 1500, 500 to 2000, 500 to 3000, 1000 to 1500, 1000 to 2000, 1000 to 3000, 1500 to 3000, or 2000 to 3000 nucleotides. An in vitro transcription system typically comprises a transcription buffer (e.g., with magnesium), nucleotide triphosphates (NTPs), an RNase inhibitor and a polymerase (e.g., T7 RNA polymerase). In some embodiments, one or more of the NTPs is a chemically modified#14388136v1 NTP (e.g., with 1-methylpseudouridine or other chemical modifications described herein and / or known in the art). In some embodiments, the NTPs comprise adenosine triphosphate (ATP), cytidine triphosphate (CTP), uridine triphosphate (UTP), and guanosine triphosphate (GTP), or an analog of each respective NTP. The ratio of NTPs may vary. In some embodiments, the ratio of GTP:ATP:CTP:UTP is 1:1:1:1. In some embodiments, the amount of the GTP or an analogue thereof is greater than an amount of the UTP or an analogue thereof. In some embodiments, the amount of the GTP is greater than the amount of the UTP. In some embodiments, the amount of ATP is greater than the amount of UTP, and the amount of CTP is greater than the amount of UTP. In some embodiments, the amount of the GTP or an analogue thereof is greater than an amount of the UTP or an analogue thereof. In some embodiments, an IVT system comprises an at least 2:1 ratio of GTP concentration to ATP concentration, an at least 2:1 ratio of GTP concentration to CTP concentration, and an at least 4:1 ratio of GTP concentration to UTP concentration. In some embodiments, an IVT system comprises a 2:1 ratio of GTP concentration to ATP concentration, a 2:1 ratio of GTP concentration to CTP concentration, and a 4:1 ratio of GTP concentration to UTP concentration. In some embodiments, an IVT system comprises guanosine diphosphate (GDP). In some embodiments, an IVT system comprises an at least 3:1 ratio of GTP plus GDP concentration to ATP concentration, an at least 6:1 ratio of GTP plus GDP concentration to CTP concentration, and an at least 6:1 ratio of GTP plus GDP concentration to UTP concentration. The NTPs may be manufactured in house, may be selected from a supplier, or may be synthesized as described herein. The NTPs may be selected from, but are not limited to, those described herein including natural and unnatural (modified) NTPs. Any number of RNA polymerases or variants may be used in the method of the present disclosure. The polymerase may be selected from, but is not limited to, a phage RNA polymerase, e.g., a T7 RNA polymerase, a T3 RNA polymerase, a SP6 RNA polymerase, and / or mutant polymerases such as, but not limited to, polymerases able to incorporate modified nucleic acids and / or modified nucleotides, including chemically modified nucleic acids and / or nucleotides. Some embodiments exclude the use of DNase. An IVT system, in some embodiments, comprises magnesium buffer, dithiothreitol (DTT) spermidine, pyrophosphatase, and / or RNase inhibitor. In some embodiments, an IVT system omits an RNase inhibitor. An IVT system may be incubated at 25 degrees Celsius or at 37 degrees Celsius. Other temperatures may be used, depending in part on the polymerase (e.g., use of a variant polymerase).#14388136v1 In some embodiments, the RNA transcript is capped via enzymatic capping. In some embodiments, the RNA comprises 5' terminal cap, for example, 7mG(5’)ppp(5’)NlmpNp. Lipid Compositions In some embodiments, the nucleic acids of in (e.g., formulated as) a lipid composition, such as a composition comprising a lipid nanoparticle. In some embodiments, nucleic acids of the present disclosure are in (e.g., formulated as) lipid nanoparticle (LNP) compositions. Lipid nanoparticles typically comprise an ionizable amino lipid, non-cationic lipid (e.g., a phospholipid), structural lipid, and PEG lipid components along with the nucleic acid cargo (i.e., mRNA) of interest. A lipid nanoparticles of the present disclosure can be generated using components, compositions, and methods as are generally known in the art, see for example PCT / US2016 / 052352; PCT / US2016 / 068300; PCT / US2017 / 037551; PCT / US2015 / 027400; PCT / US2016 / 047406; PCT / US2016 / 000129; PCT / US2016 / 014280; PCT / US2017 / 038426; PCT / US2014 / 027077; PCT / US2014 / 055394; PCT / US2016 / 052117; PCT / US2012 / 069610; PCT / US2017 / 027492; PCT / US2016 / 059575; PCT / US2016 / 069491; PCT / US2016 / 069493; and PCT / US2014 / 066242, all of which are incorporated by reference herein in their entirety. In some embodiments, a lipid nanoparticle comprises at least one ionizable amino lipid, at least one non-cationic lipid, at least one sterol, and / or at least one polyethylene glycol (PEG)- modified lipid. In some embodiments, a lipid nanoparticle comprises 20-60 mole percent (mol%) ionizable amino lipid, 5-25 mol% non-cationic lipid, 25-55 mol% structural lipid, and 0.5-15 mol% PEG-modified lipid. In some embodiments, a lipid nanoparticle comprises 20-60 mol% ionizable amino lipid, 5-30 mol% non-cationic lipid, 10-55 mol% structural lipid, and 0.5-15 mol% PEG-modified lipid. In some embodiments, a lipid nanoparticle comprises 40-50 mol% ionizable lipid, optionally 45-50 mol%, for example, 45-46 mol%, 46-47 mol%, 47-48 mol%, 48-49 mol%, or 49-50 mol% for example about 45 mol%, 45.5 mol%, 46 mol%, 46.5 mol%, 47 mol%, 47.5 mol%, 48 mol%, 48.5 mol%, 49 mol%, or 49.5 mol%. In some embodiments, a lipid nanoparticle comprises 20-60 mol% ionizable amino lipid. For example, a lipid nanoparticle may comprise 20-50 mol%, 20-40 mol%, 20-30 mol%, 30-60 mol%, 30-50 mol%, 30-40 mol%, 40-60 mol%, 40-50 mol%, or 50-60 mol% ionizable amino lipid. In some embodiments, a lipid nanoparticle comprises 20 mol%, 30 mol%, 40 mol%, 50 mol%, or 60 mol% ionizable amino lipid. In some embodiments, a lipid nanoparticle comprises 35 mol%, 36 mol%, 37 mol%, 38 mol%, 39 mol%, 40 mol%, 41 mol%, 42 mol%, 43 mol%, 44#14388136v1 mol%, 45 mol%, 46 mol%, 47 mol%, 48 mol%, 49 mol%, 50 mol%, 51 mol%, 52 mol%, 53 mol%, 54 mol%, or 55 mol% ionizable amino lipid. In some embodiments, a lipid nanoparticle comprises 45-55 mol% ionizable amino lipid. For example, lipid nanoparticle may comprise 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, or 55 mol% ionizable amino lipid. In some embodiments, the ionizable lipid is a compound of Formula (IL*) or a salt thereof, wherein: R1is -OH, -NRN-C4-10 cycloalkenyl optionally substituted with one or more oxo or -N(RN’RN’’); RNis H or C1-6alkyl; RN’is H or C1-6 alkyl; RN’’is H or C1-6alkyl; o is 1, 2, 3, or 4; n is 4, 5, 6, 7, or 8; m is 4, 5, 6, 7, or 8; M is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R2; M’ is -C(=O)-O-* or -O-C(=O)-*, wherein * indicates attachment to R3; R2is or –(C1-6 alkylene)-(C3-8 cycloalkyl)-C1-6 alkyl; R2ais -H or C1-10alkyl; R2bis -H or C1-10 alkyl; R2cis C1-8alkyl or C2-8alkenyl; R3ais H or C1-10alkyl; R3bis H or C1-8 alkyl; and R3cis C1-10alkyl or C2-8alkenyl. In some embodiments, the ionizable lipid is of Formula (IL**-I):#14388136v1 or a salt thereof, wherein: R1is -OH; o is 2, 3, or 4; n is 4, 5, 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2cis C4-8 alkyl; R3ais C7-10alkyl; and R3cis C3-5alkyl. In some embodiments, the ionizable lipid is of Formula (IL**-III): (IL**-III) or a salt thereof, wherein: R1is NRN-C4-10cycloalkenyl optionally substituted with one or more oxo or -N(RN’RN’’); RNis H; RN’is C1-2 alkyl; RN’’is H; o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2ais C7-10alkyl; R2cis C4-6alkyl;#14388136v1 R3ais C1-3 alkyl; and R3cis C4-6alkyl. In some embodiments, the ionizable lipid is of Formula (IL**-IV): or a salt thereof, wherein: R1is OH; o is 2, 3, or 4; n is 6, 7, or 8; M is -C(=O)-O-*, wherein * indicates attachment to R2; m is 6, 7, or 8; M’ is -C(=O)-O-*, wherein * indicates attachment to R3; R2bis C3-5 alkyl; R2cis C2-4alkyl; R3ais C7-10alkyl; and R3cis C4-6 alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-I): or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*; and R3ais C1-8 alkyl. In some embodiments, ionizable lipid is of Formula (IL*-Ia): (IL*-Ia) or a salt thereof, wherein:#14388136v1 R1, o, m, n, M, M’, R2c, and R3care as defined for Formula IL*; and R3ais C1-8alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-Ia’): or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for variable IL*; and R3ais C1-8 alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IIa): (IL*-IIa) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for Formula IL*; and R3ais C1-8alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-II’): or a salt thereof, wherein: o, M, M’, R2cand R3care as defined for variable IL*; and R3ais C1-8alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-III): or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*;#14388136v1 R2ais a C1-8 alkyl; and R3ais C1-8alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IIIa): (IL*-IIIa) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*; R2bis a C1-8alkyl; and R3ais C1-8 alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IIIa): (IL*-IIIa) or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for variable IL*; R2ais a C1-8 alkyl; and R3ais C1-8alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IIIa’): or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for variable IL*; R2ais a C1-8alkyl; and R3ais C1-8 alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IIIb):#14388136v1 (IL*-IIIb) or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for variable IL*; R2ais a C1-8alkyl; and R3ais C1-8 alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IIIb’): or a salt thereof, wherein: R1, o, M, M’, R2c, and R3care as defined for variable IL*; R2ais a C1-8 alkyl; and R3ais C1-8alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IV): (IL*-IV) or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*; R2bis a C1-8alkyl; and R3ais C1-8 alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-IVa): (IL*-IVa)#14388136v1 or a salt thereof, wherein: R1, o, m, n, M, M’, R2c, and R3care as defined for variable IL*; R2bis a C1-8alkyl; and R3ais C1-8 alkyl. In some embodiments, the ionizable lipid is of Formula (IL*-Iva’): or a salt thereof, wherein: o, M, M’, R2c, and R3care as defined for variable IL*; R2ais a C1-8alkyl; and R3ais C1-8 alkyl. Variables o, R1, RN, RN’, RN’’of Ionizable Lipid In some embodiments of the ionizable lipid, o is 1. In some embodiments of the ionizable lipid, o is 2. In some embodiments of the ionizable lipid, o is 3. In some embodiments of the ionizable lipid, o is 4. In some embodiments of the ionizable lipid, R1is -OH. In some embodiments of the ionizable lipid, RNis H. In some embodiments of the ionizable lipid, RNis methyl. In some embodiments of the ionizable lipid, RNis ethyl. In some embodiments of the ionizable lipid, R1is -NRN-cyclobutenyl, wherein the cyclobutenyl is optionally substituted with one or more oxo or -N(RN’RN’’). In some embodiments of the ionizable lipid, RN’is H. In some embodiments of the ionizable lipid, RN’is methyl. In some embodiments of the ionizable lipid, RN’is ethyl. In some embodiments of the ionizable lipid, RN’’is H. In some embodiments of the ionizable lipid, RN’’is methyl. In some embodiments of the ionizable lipid, RN’’is ethyl. In some embodiments of the ionizable lipid, RN’is H and RN’’is methyl. #14388136v1 In some embodiments of the ionizable lipid, Variables m and n of the Ionizable Lipid In some embodiments of the ionizable lipid, m is 4. In some embodiments of the ionizable lipid, m is 5. In some embodiments of the ionizable lipid, m is 6. In some embodiments of the ionizable lipid, m is 7. In some embodiments of the ionizable lipid, m is 8. In some embodiments of the ionizable lipid, m is 4. In some embodiments of the ionizable lipid, n is 5. In some embodiments of the ionizable lipid, n is 6. In some embodiments of the ionizable lipid, n is 7. In some embodiments of the ionizable lipid, n is 8. In some embodiments of the ionizable lipid, n is 5 and m is 7. In some embodiments of the ionizable lipid, n is 7 and m is 7. In some embodiments of the ionizable lipid, m is 6 and n is 6. Variables M and M’ In some embodiments of the ionizable lipid, M is -O-C(=O)-*, wherein * indicates attachment to R2. In some embodiments of the ionizable lipid, M is -C(=O)-O-* wherein * indicates attachment to R2. In some embodiments of the ionizable lipid, M’ is -O-C(=O)-*, wherein * indicates attachment to R3. In some embodiments of the ionizable lipid, M’ is -C(=O)-O-* wherein * indicates attachment to R3. In some embodiments of the ionizable lipid, M is -O-C(=O)-*, wherein * indicates attachment to R2, and M’ is -C(=O)-O-* wherein * indicates attachment to R3. Variables R2, R2a, R2b, R2cIn some embodiments of the ionizable lipid, R2is . In some embodiments of the ionizable lipid, R2ais hydrogen. In some embodiments of the ionizable lipid, R2ais methyl.#14388136v1 In some embodiments of the ionizable lipid, R2ais ethyl. In some embodiments of the ionizable lipid, R2ais propyl. In some embodiments of the ionizable lipid, R2ais butyl. In some embodiments of the ionizable lipid, R2ais pentyl. In some embodiments of the ionizable lipid, R2ais hexyl. In some embodiments of the ionizable lipid, R2ais heptyl. In some embodiments of the ionizable lipid, R2ais octyl. In some embodiments of the ionizable lipid, R2bis hydrogen. In some embodiments of the ionizable lipid, R2bis methyl. In some embodiments of the ionizable lipid, R2bis ethyl. In some embodiments of the ionizable lipid, R2bis propyl. In some embodiments of the ionizable lipid, R2bis butyl. In some embodiments of the ionizable lipid, R2bis pentyl. In some embodiments of the ionizable lipid, R2bis hexyl. In some embodiments of the ionizable lipid, R2bis heptyl. In some embodiments of the ionizable lipid, R2bis octyl. In some embodiments of the ionizable lipid, R2ais hydrogen and R2bis hydrogen. In some embodiments of the ionizable lipid, R2ais hexyl and R2bis hydrogen. In some embodiments of the ionizable lipid, R2ais octyl and R2bis hydrogen. In some embodiments of the ionizable lipid, R2ais hydrogen and R2bis butyl. In some embodiments of the ionizable lipid, R2cis methyl. In some embodiments of the ionizable lipid, R2cis ethyl. In some embodiments of the ionizable lipid, R2cis propyl. In some embodiments of the ionizable lipid, R2cis butyl. In some embodiments of the ionizable lipid, R2cis pentyl. In some embodiments of the ionizable lipid, R2cis hexyl. In some embodiments of the ionizable lipid, R2cis heptyl. In some embodiments of the ionizable lipid, R2cis octyl. In some embodiments of the ionizable lipid, R2is –(C1-6alkylene)-(C3-8cycloalkyl)-C1-6alkyl. In some embodiments of the ionizable lipid, R2is –(C1-6 alkylene)-(cyclohexyl)-C1-6 alkyl. In some embodiments of the ionizable lipid, R2is –(C1-6alkylene)-(cyclopentyl)-C1-6alkyl. Variables R3, R3a, R3b, and R3c#14388136v1In some embodiments of the ionizable lipid, R3 is .In some embodiments of the ionizable lipid, R3ais hydrogen. In some embodiments of the ionizable lipid, R3ais methyl. In some embodiments of the ionizable lipid, R3ais ethyl. In some embodiments of the ionizable lipid, R3ais propyl. In some embodiments of the ionizable lipid, R3ais butyl. In some embodiments of the ionizable lipid, R3ais pentyl. In some embodiments of the ionizable lipid, R3ais hexyl. In some embodiments of the ionizable lipid, R3ais heptyl. In some embodiments of the ionizable lipid, R3ais octyl. In some embodiments of the ionizable lipid, R3bis hydrogen. In some embodiments of the ionizable lipid, R3bis methyl. In some embodiments of the ionizable lipid, R3bis ethyl. In some embodiments of the ionizable lipid, R3bis propyl. In some embodiments of the ionizable lipid, R3bis butyl. In some embodiments of the ionizable lipid, R3bis pentyl. In some embodiments of the ionizable lipid, R3bis hexyl. In some embodiments of the ionizable lipid, R3bis heptyl. In some embodiments of the ionizable lipid, R3bis octyl. In some embodiments of the ionizable lipid, R3ais octyl and R3bis hydrogen. In some embodiments of the ionizable lipid, R3ais ethyl and R3bis hydrogen. In some embodiments of the ionizable lipid, R3ais hexyl and R3bis hydrogen. In some embodiments of the ionizable lipid, R3cis methyl. In some embodiments of the ionizable lipid, R3cis ethyl. In some embodiments of the ionizable lipid, R3cis propyl. In some embodiments of the ionizable lipid, R3cis butyl. In some embodiments of the ionizable lipid, R3cis pentyl. In some embodiments of the ionizable lipid, R3cis hexyl. In some embodiments of the ionizable lipid, R3cis heptyl. In some embodiments of the ionizable lipid, R3cis octyl. It is understood that, for an ionizable lipid, variables o, R1, RN, RN’, RN’, m, n, M, M’, R2, R2a, R2b, R2c, R3, R3a, R3b, and R3ccan each be, where applicable, selected from the groups described herein, and any group described herein for any of variables o,.R1, RN, RN’, RN’, m, n, M, M’, R2, R2a, R2b, R2c, R3, R3a, R3b, and R3ccan be combined, where applicable, with any#14388136v1 group described herein for one or more of the remainder of variables o, R1, RN, RN’, RN’, m, n, M, M’, R2, R2a, R2b, R2c, R3, R3a, R3b, and R3c. In some embodiments, the ionizable lipid is a compound selected from: In some embodiments, the ionizable lipid is In some embodiments, the ionizable lipid is#14388136v1 Without wishing to be bound by theory, it is understood that an ionizable lipid may have a positive or partial positive charge at physiological pH. Such lipids may be referred to as cationic or ionizable (amino)lipids. Lipids may also be zwitterionic, i.e., neutral molecules having both a positive and a negative charge. mRNA-Lipid Adduct It has been determined that certain ionizable lipids are susceptible to the formation of lipid-polynucleotide adducts. In particular, ionizable lipids that comprise a tertiary amine group may decompose into one or both of a secondary amine and a reactive aldehyde species capable of interacting with polynucleotides (such as mRNA) to form an ionizable lipid-polynucleotide adduct impurity that can be detected by reverse phase ion pair chromatography (RP-IP HPLC). For example, oxidation of the tertiary amine may lead to N-oxide formation that can undergo acid / base-catalyzed hydrolysis at the amine to generate aldehydes and secondary amines which may form adducts with mRNA. Thus, in some aspects, the ionizable lipid-polynucleotide adduct impurity is an aldehyde-mRNA adduct impurity. It also has been determined that such adducts may disrupt mRNA translation and impact the activity of lipid nanoparticle (LNP) formulated mRNA products. Thus, it can be advantageous to prepare and use LNP compositions with a reduced content of ionizable lipid- polynucleotide adduct impurity, such as wherein less than about 20%, less than about 10%, less than about 5%, or less than about 1%, of the mRNA is in the form of ionizable lipid- polynucleotide adduct impurity, as may be measured by RP-IP HPLC. Thus, in accordance with some aspects, an LNP composition is provided wherein less than about 10%, less than about 5%, or less than about 1%, of the mRNA is in the form of ionizable lipid-polynucleotide adduct impurity, including less than 10%, less than 5%, or less than 1%, as may be measured by RP-IP HPLC. In some aspects, an amount of lipid aldehydes in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of N- oxide compounds in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of transition metals, such as Fe, in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of alkyl halide compounds in the composition is less than about 50#14388136v1 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of anhydride compounds in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of ketone compounds in the composition is less than about 50 ppm, including less than 50 ppm. Additionally or alternatively, in some aspects an amount of conjugated diene compounds in the composition is less than about 50 ppm, including less than 50 ppm. In some aspects, the composition is stable against the formation of ionizable lipid- polynucleotide adduct impurity. In some aspects, an amount of ionizable lipid-polynucleotide adduct impurity in the composition increases at an average rate of less than about 2% per day when stored at a temperature of about 25 °C or below, including at an average rate of less than 2% per day. In some aspects, an amount of ionizable lipid-polynucleotide adduct impurity in the composition increases at an average rate of less than about 0.5% per day when stored at a temperature of about 5 °C or below, including at an average rate of less than 0.5% per day. In some aspects, an amount of ionizable lipid-polynucleotide adduct impurity in the composition increases at an average rate of less than about 0.5% per day when stored at a refrigerated temperature, optionally wherein the refrigerated temperature is about 5 °C. Lipid vehicle (e.g., LNP) compositions with a reduced content of ionizable lipid- polynucleotide adduct impurity can be prepared by methods that inhibit formation of one or both of N-oxides and aldehydes. Such methods may comprise treating a composition comprising an ionizable lipid comprising a tertiary amine group to inhibit formation of one or both of N-oxides and aldehydes, such as by treating the composition with a reducing agent; treating the composition with a chelating agent; adjusting the pH of the composition; adjusting the temperature of the composition; and adjusting the buffer in the composition. Such methods may comprise, prior to combining the ionizable lipid with a polynucleotide, one or more of treating the ionizable lipid with a scavenging agent; treating the ionizable lipid with a reductive treatment agent; treating the ionizable lipid with a reducing agent; treating the ionizable lipid with a chelating agent; treating the polynucleotide with a reducing agent; and treating the polynucleotide with a chelating agent. In accordance with any of the foregoing, the scavenging agent, reductive treatment agent, and / or reducing agent may be an agent that reacts with aldehyde, ketone, anhydride and / or diene compounds. A scavenging agent may comprise one or more selected from (O-(2,3,4,5,6- Pentafluorobenzyl)hydroxylamine hydrochloride) (PFBHA), methoxyamine (e.g., methoxyamine hydrochloride), benzyloxyamine (e.g., benzyloxyamine hydrochloride), ethoxyamine (e.g., ethoxyamine hydrochloride), 4-[2-(aminooxy)ethyl]morpholine dihydrochloride, butoxyamine (e.g., tert-butoxyamine hydrochloride), 4-Dimethylaminopyridine#14388136v1 (DMAP), 1,4-diazabicyclo[2.2.2]octane (DABCO), Triethylamine (TEA), Piperidine 4- carboxylate (BPPC), and combinations thereof. A reductive treatment agent may comprise a boron compound (e.g., sodium borohydride and / or bis(pinacolato)diboron). A reductive treatment agent may comprise a boron compound, such as one or both of sodium borohydride and bis(pinacolato)diboron). A chelating agent may comprise immobilized iminodiacetic acid. A reducing agent may comprise an immobilized reducing agent, such as immobilized diphenylphosphine on silica (Si-DPP), immobilized thiol on agarose (Ag-Thiol), immobilized cysteine on silica (Si-Cysteine), immobilized thiol on silica (Si-Thiol), or a combination thereof. A reducing agent may comprise a free reducing agent, such as potassium metabisulfite, sodium thioglycolate, tris(2-carboxyethyl)phosphine (TCEP), sodium thiosulfate, N-acetyl cysteine, glutathione, dithiothreitol (DTT), cystamine, dithioerythritol (DTE), dichlorodiphenyltrichloroethane (DDT), homocysteine, lipoic acid, or a combination thereof. In accordance with any of the foregoing, the pH may be, or adjusted to be, a pH of from about 7 to about 9 (for example, about 7, about 7.5, about 8, about 8.5, or about 9). In accordance with any of the foregoing, a buffer may be selected from sodium phosphate, sodium citrate, sodium succinate, histidine, histidine-HCl, sodium malate, sodium carbonate, and TRIS (tris(hydroxymethyl)aminomethane). In accordance with any of the foregoing, a buffer may be TRIS and may be, or adjusted to be, from about 20 mM to about 150 mM TRIS. In accordance with any of the foregoing, the temperature of the composition may be, or adjusted to be, 25 ⁰C or less. The composition may also comprise a free reducing agent or antioxidant. Non-cationic lipids In certain embodiments, a lipid nanoparticle described herein comprise one or more non- cationic lipids. Non-cationic lipids may be phospholipids. In some embodiments, a lipid nanoparticle comprises 5-25 mol% non-cationic lipid. For example, a lipid nanoparticle may comprise 5-20 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, or 20-25 mol% non-cationic lipid. In some embodiments, a lipid nanoparticle comprises 5 mol%, 10 mol%, 15 mol%, 20 mol%, or 25 mol% non-cationic lipid. In some embodiments, a non-cationic lipid of the disclosure comprises 1,2-distearoyl-sn- glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero- phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl- sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-#14388136v1 palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3- phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3- phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2- dilinolenoyl-sn-glycero-3-phosphocholine,1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3- phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2- dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3- phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2- didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac- (1-glycerol) sodium salt (DOPG), sphingomyelin, or mixtures thereof. In some embodiments, a lipid nanoparticle comprises 5 – 15 mol%, 5 – 10 mol%, or 10 – 15 mol% DSPC. For example, a lipid nanoparticle may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mol% DSPC. In certain embodiments, the lipid composition of a lipid nanoparticle composition disclosed herein can comprise one or more phospholipids, for example, one or more saturated or (poly)unsaturated phospholipids or a combination thereof. In general, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties. A phospholipid moiety can be selected, for example, from the non-limiting group consisting of phosphatidyl choline, phosphatidyl ethanolamine, phosphatidyl glycerol, phosphatidyl serine, phosphatidic acid, 2-lysophosphatidyl choline, and a sphingomyelin. A fatty acid moiety can be selected, for example, from the non-limiting group consisting of lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanoic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid. Particular phospholipids can facilitate fusion to a membrane. For example, a cationic phospholipid can interact with one or more negatively charged phospholipids of a membrane (e.g., a cellular or intracellular membrane). Fusion of a phospholipid to a membrane can allow one or more elements (e.g., an mRNA) of a lipid-containing composition (e.g., LNPs) to pass through the membrane permitting, e.g., delivery of the one or more elements to a target tissue. Non-natural phospholipid species including natural species with modifications and substitutions including branching, oxidation, cyclization, and alkynes are also contemplated. For example, a phospholipid can be functionalized with or cross-linked to one or more alkynes (e.g., an alkenyl group in which one or more double bonds is replaced with a triple bond). Under appropriate reaction conditions, an alkyne group can undergo a copper-catalyzed cycloaddition upon exposure to an azide. Such reactions can be useful in functionalizing a lipid bilayer of a#14388136v1 nanoparticle composition to facilitate membrane permeation or cellular recognition or in conjugating a nanoparticle composition to a useful component such as a targeting or imaging moiety (e.g., a dye). Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholines, phosphatidylethanolamines, phosphatidylserines, phosphatidylinositols, phosphatidylglycerols, and phosphatidic acids. Phospholipids also include phosphosphingolipid, such as sphingomyelin. In some embodiments, a phospholipid of the present disclosure comprises 1,2-distearoyl- sn-glycero-3-phosphocholine (DSPC), 1,2-Distearoyl-sn-glycero-3-phosphoethanolamine (DSPE), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3- phosphocholine (DLPC), 1,2-dimyristoyl-sn-gly cero-phosphocholine (DMPC), 1,2-dioleoyl-sn- glycero-3-phosphocholine (DOPC), l,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2- diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3- phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2 cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl- sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3- phosphocholine,1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn- glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3- phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl- sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), sphingomyelin, or mixtures thereof. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is an analog or variant of DSPC. In certain embodiments, a phospholipid useful or potentially useful in the present disclosure is a compound of Formula (IX): or a salt thereof, wherein: each R1is independently optionally substituted alkyl; or optionally two R1are joined together with the intervening atoms to form optionally substituted monocyclic carbocyclyl or optionally substituted monocyclic heterocyclyl; or optionally three R1are joined together with#14388136v1 the intervening atoms to form optionally substituted bicyclic carbocyclyl or optionally substitute bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the formula: each instance of L2is independently a bond or optionally substituted C1-6 alkylene, wherein one methylene unit of the optionally substituted C1-6alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), - NRNC(O)O, or NRNC(O)N(RN); each instance of R2is independently optionally substituted C1-30alkyl, optionally substituted C1-30alkenyl, or optionally substituted C1-30alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), - OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, - OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or - N(RN)S(O)2O; each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2; provided that the compound is not of the formula: , wherein each instance of R2is independently unsubstituted alkyl, unsubstituted alkenyl, or unsubstituted alkynyl. In some embodiments, the phospholipids may be one or more of the phospholipids described in PCT Application No. PCT / US2018 / 037922.#14388136v1 In some embodiments, a lipid nanoparticle comprises 5-25 mol% non-cationic lipid relative to the other lipid components. For example, a lipid nanoparticle may comprise 5-30 mol%, 5-15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, 20-25 mol%, or 25-30 mol% non-cationic lipid. In some embodiments, a lipid nanoparticle comprises a 5 mol%, 10 mol%, 15 mol%, 20 mol%, 25 mol%, or 30 mol% non- cationic lipid. In some embodiments, a lipid nanoparticle comprises 5-25 mol% phospholipid relative to the other lipid components. For example, the lipid nanoparticle may comprise 5-30 mol%, 5- 15 mol%, 5-10 mol%, 10-25 mol%, 10-20 mol%, 10-25 mol%, 15-25 mol%, 15-20 mol%, 20-25 mol%, or 25-30 mol% phospholipid. In some embodiments, the lipid nanoparticle 5 mol%, 10 mol%, 15 mol%, 20 mol%, 25 mol%, or 30 mol% phospholipid lipid. Structural Lipids The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more structural lipids. As used herein, the term “structural lipid” includes sterols and also to lipids containing sterol moieties. Incorporation of structural lipids in a lipid nanoparticle may help mitigate aggregation of other lipids in the particle. Structural lipids can be selected from the group including but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structural lipid is a sterol. As defined herein, “sterols” are a subgroup of steroids consisting of steroid alcohols. In certain embodiments, the structural lipid is a steroid. In certain embodiments, the structural lipid is cholesterol. In certain embodiments, the structural lipid is an analog of cholesterol. In certain embodiments, the structural lipid is alpha-tocopherol. In some embodiments, the structural lipids may be one or more of the structural lipids described in U.S. Application No. 16 / 493,814. In some embodiments, a lipid nanoparticle comprises 25-55 mol% structural lipid relative to the other lipid components. For example, a lipid nanoparticle may comprise 10-55 mol%, 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% structural lipid. In some embodiments, a lipid nanoparticle comprises 10 mol%, 15 mol%, 20 mol%, 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% structural lipid.#14388136v1 In some embodiments, a lipid nanoparticle comprises 30-45 mol% sterol, optionally 35- 40 mol%, for example, 30-31 mol%, 31-32 mol%, 32-33 mol%, 33-34 mol%, 34-35 mol%, 35- 36 mol%, 36-37 mol%, 37-38 mol%, 38-39 mol%, or 39-40 mol%. In some embodiments, a lipid nanoparticle comprises 25-55 mol% sterol. For example, a lipid nanoparticle may comprise 25-50 mol%, 25-45 mol%, 25-40 mol%, 25-35 mol%, 25-30 mol%, 30-55 mol%, 30-50 mol%, 30-45 mol%, 30-40 mol%, 30-35 mol%, 35-55 mol%, 35-50 mol%, 35-45 mol%, 35-40 mol%, 40-55 mol%, 40-50 mol%, 40-45 mol%, 45-55 mol%, 45-50 mol%, or 50-55 mol% sterol. In some embodiments, a lipid nanoparticle comprises 25 mol%, 30 mol%, 35 mol%, 40 mol%, 45 mol%, 50 mol%, or 55 mol% sterol. In some embodiments, a lipid nanoparticle comprises 35-40 mol% cholesterol. For example, a lipid nanoparticle may comprise 35, 35.5, 36, 36.5, 37, 37.5, 38, 38.5, 39, 39.5, or 40 mol% cholesterol. Polyethylene Glycol (PEG)-Lipids The lipid composition of a pharmaceutical composition disclosed herein can comprise one or more polyethylene glycol (PEG) lipids. As used herein, the term “PEG-lipid” or “PEG-modified lipid” refers to polyethylene glycol (PEG)-modified lipids. Non-limiting examples of PEG-lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamines, and PEG-modified 1,2-diacyloxypropan-3- amines. Such lipids are also referred to as PEGylated lipids. For example, a PEG lipid can be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments, the PEG-lipid includes, but not limited to 1,2-dimyristoyl-sn- glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3- phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disteryl glycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG- DAG), PEG-dipalmitoyl phosphatidylethanolamine (PEG-DPPE), or PEG-l,2- dimyristyloxlpropyl-3-amine (PEG-c-DMA). In some embodiments, the PEG-lipid is selected from the group consisting of a PEG- modified phosphatidylethanolamine, a PEG-modified phosphatidic acid, a PEG-modified ceramide, a PEG-modified dialkylamine, a PEG-modified diacylglycerol, a PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG-modified lipid is PEG- DMG, PEG-c-DOMG (also referred to as PEG-DOMG), PEG-DSG, and / or PEG-DPG. In some embodiments, the lipid moiety of the PEG-lipids includes those having lengths of from about C14to about C22, preferably from about C14to about C16. In some embodiments, a#14388136v1 PEG moiety, for example an mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000 or 20,000 daltons. In some embodiments, the PEG-lipid is PEG2k-DMG. In some embodiments, a lipid nanoparticle described herein can comprise a PEG lipid which is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG- DSG and PEG-DSPE. PEG-lipids are known in the art, such as those described in U.S. Patent No. 8158601 and International Publ. No. WO 2015 / 130584 A2, which are incorporated herein by reference in their entirety. In general, some of the other lipid components (e.g., PEG lipids) of various formulae described herein may be synthesized as described International Patent Application No. PCT / US2016 / 000129, filed December 10, 2016, entitled “Compositions and Methods for Delivery of Therapeutic Agents,” which is incorporated by reference in its entirety. The lipid component of a lipid nanoparticle composition may include one or more molecules comprising polyethylene glycol, such as PEG or PEG-modified lipids. Such species may be alternately referred to as PEGylated lipids. A PEG lipid is a lipid modified with polyethylene glycol. A PEG lipid may be selected from the non-limiting group including PEG- modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG- DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or a PEG-DSPE lipid. In some embodiments the PEG-modified lipids are a modified form of PEG DMG. PEG- DMG has the following structure: In some embodiments, PEG lipids useful in the present disclosure can be PEGylated lipids described in International Publication No. WO2012099755, the contents of which is herein incorporated by reference in its entirety. Any of these exemplary PEG lipids described herein may be modified to comprise a hydroxyl group on the PEG chain. In certain embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a “PEG-OH lipid” (also referred to herein as “hydroxy-PEGylated lipid”) is a PEGylated lipid having one or more hydroxyl (–OH) groups on the lipid. In certain embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In certain embodiments, a PEG-OH or hydroxy-#14388136v1 PEGylated lipid comprises an –OH group at the terminus of the PEG chain. Each possibility represents a separate embodiment of the present disclosure. In certain embodiments, a PEG lipid useful in the present disclosure is a compound of Formula (X): or salts thereof, wherein: R3is –ORO; ROis hydrogen, optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; L1is optionally substituted C1-10 alkylene, wherein at least one methylene of the optionally substituted C1-10alkylene is independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, or NRNC(O)N(RN); D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is of the formula: each instance of L2is independently a bond or optionally substituted C1-6alkylene, wherein one methylene unit of the optionally substituted C1-6 alkylene is optionally replaced with O, N(RN), S, C(O), C(O)N(RN), NRNC(O), C(O)O, OC(O), OC(O)O, OC(O)N(RN), - NRNC(O)O, or NRNC(O)N(RN); each instance of R2is independently optionally substituted C1-30 alkyl, optionally substituted C1-30 alkenyl, or optionally substituted C1-30 alkynyl; optionally wherein one or more methylene units of R2are independently replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), - OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O) , OS(O), S(O)O, - OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or - N(RN)S(O)2O;#14388136v1 each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group; Ring B is optionally substituted carbocyclyl, optionally substituted heterocyclyl, optionally substituted aryl, or optionally substituted heteroaryl; and p is 1 or 2. In certain embodiments, the compound of Formula (X) is a PEG-OH lipid (i.e., R3is – ORO, and ROis hydrogen). In certain embodiments, the compound of Formula (X) is of Formula (X-OH): or a salt thereof. In certain embodiments, a PEG lipid useful in the present disclosure is a PEGylated fatty acid. In certain embodiments, a PEG lipid useful in the present disclosure is a compound of Formula (XI). Provided herein are compounds of Formula (XI): or a salt thereof, wherein: R3is–ORO; ROis hydrogen, optionally substituted alkyl or an oxygen protecting group; r is an integer between 1 and 100, inclusive; R5is optionally substituted C10-40alkyl, optionally substituted C10-40alkenyl, or optionally substituted C10-40 alkynyl; and optionally one or more methylene groups of R5are replaced with optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(RN), O, S, C(O), - C(O)N(RN), NRNC(O), NRNC(O)N(RN), C(O)O, OC(O), OC(O)O, OC(O)N(RN), NRNC(O)O, C(O)S, SC(O), C(=NRN), C(=NRN)N(RN), NRNC(=NRN), NRNC(=NRN)N(RN), C(S), - C(S)N(RN), NRNC(S), NRNC(S)N(RN), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, - OS(O)2O, N(RN)S(O), S(O)N(RN), N(RN)S(O)N(RN), OS(O)N(RN), N(RN)S(O)O, S(O)2, - N(RN)S(O)2, S(O)2N(RN), N(RN)S(O)2N(RN), OS(O)2N(RN), or N(RN)S(O)2O; and each instance of RNis independently hydrogen, optionally substituted alkyl, or a nitrogen protecting group. In certain embodiments, the compound of Formula (XI) is of Formula (XI-OH): (XI-OH),#14388136v1 or a salt thereof. In some embodiments, r is 40-50. In yet other embodiments the compound of Formula (XI) is: . or a salt thereof. In some embodiments, the compound of Formula (XI) is . In some embodiments, the lipid composition of the pharmaceutical compositions disclosed herein does not comprise a PEG-lipid. In some embodiments, the PEG-lipids may be one or more of the PEG lipids described in U.S. Application No. US15 / 674,872. In some embodiments, a lipid nanoparticle comprises 0.5-15 mol% PEG lipid relative to the other lipid components. For example, a lipid nanoparticle may comprise 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol% PEG lipid. In some embodiments, a lipid nanoparticle comprises 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG- lipid. In some embodiments, a lipid nanoparticle comprises 1-5% PEG-modified lipid, optionally 1-3 mol%, for example, 1.5 to 2.5 mol%, 1-2 mol%, 2-3 mol%, 3-4 mol%, or 4-5 mol%. In some embodiments, a lipid nanoparticle comprises 0.5-15 mol% PEG-modified lipid. For example, a lipid nanoparticle may comprise 0.5-10 mol%, 0.5-5 mol%, 1-15 mol%, 1-10 mol%, 1-5 mol%, 2-15 mol%, 2-10 mol%, 2-5 mol%, 5-15 mol%, 5-10 mol%, or 10-15 mol%. In some embodiments, a lipid nanoparticle comprises 0.5 mol%, 1 mol%, 2 mol%, 3 mol%, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, 11 mol%, 12 mol%, 13 mol%, 14 mol%, or 15 mol% PEG-modified lipid. Some embodiments comprise adding PEG to a composition comprising an LNP encapsulating a nucleic acid (e.g., which already includes PEG in the amounts listed above). Without being bound by theory, it is believed that spiking an LNP composition with additional PEG can provide benefits during lyophilization. Thus, some embodiments, comprise adding additional PEG as compared to an amount used for a non-lyophilized LNP composition. In embodiments comprise adding about 0.5mo% or more PEG to an LNP composition, such as about 1mol%, about 1.5mol%, about 2mol%, about 2.5mol%, about 3mol%, about 3.5mol%,#14388136v1 about 4mol%, about 5mol%, or more after formation of an LNP composition (e.g., which already contains PEG in amount listed elsewhere herein). In some embodiments, a lipid nanoparticle comprises 20-60 mol% ionizable amino lipid, 5-25 mol% non-cationic lipid, 25-55 mol% sterol, and 0.5-15 mol% PEG-modified lipid. In some embodiments, an LNP of the disclosure comprises an ionizable amino lipid of Compound 1, wherein the non-cationic lipid is DSPC, the structural lipid that is cholesterol, and the PEG lipid is DMG-PEG. In some embodiments, an LNP of the present disclosure comprises an ionizable amino lipid of any of Formula VI, VII or VIIII, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising PEG-DMG. In some embodiments, an LNP of the present disclosure comprises an ionizable amino lipid of any of Formula VI, VII or VIII, a phospholipid comprising DSPC, a structural lipid, and a PEG lipid comprising a compound having Formula XI. In some embodiments, an LNP of the present disclosure comprises an ionizable amino lipid of Formula VI, VII or VIII, a phospholipid comprising a compound having Formula VIII, a structural lipid, and the PEG lipid comprising a compound having Formula X or XI. In some embodiments, an LNP of the present disclosure comprises an ionizable amino lipid of Formula VI, VII or VIII, a phospholipid comprising a compound having Formula IX, a structural lipid, and the PEG lipid comprising a compound having Formula X or XI. In some embodiments, an LNP of the present disclosure comprises an ionizable amino lipid of Formula VI, VII or VIII, a phospholipid having Formula IX, a structural lipid, and a PEG lipid comprising a compound having Formula XI. In some embodiments, a lipid nanoparticle comprises 49 mol% ionizable amino lipid, 10 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG. In some embodiments, a lipid nanoparticle comprises 49 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 1.5 mol% DMG-PEG. In some embodiments, a lipid nanoparticle comprises 48 mol% ionizable amino lipid, 11 mol% DSPC, 38.5 mol% cholesterol, and 2.5 mol% DMG-PEG. In some embodiments, an LNP of the present disclosure comprises an N:P ratio of from about 2:1 to about 30:1. In some embodiments, an LNP of the present disclosure comprises an N:P ratio of about 6:1. In some embodiments, an LNP of the present disclosure comprises an N:P ratio of about 3:1, 4:1, or 5:1.#14388136v1 In some embodiments, an LNP of the present disclosure comprises a wt / wt ratio of the ionizable amino lipid component to the RNA of from about 10:1 to about 100:1. In some embodiments, an LNP of the present disclosure comprises a wt / wt ratio of the ionizable amino lipid component to the RNA of about 20:1. In some embodiments, an LNP of the present disclosure comprises a wt / wt ratio of the ionizable amino lipid component to the RNA of about 10:1. Some embodiments comprise a composition having one or more LNPs having a diameter of about 150 nm or less, such as about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. Some embodiments comprise a composition having a mean LNP diameter of about 150 nm or less, such as about 140 nm, 130 nm, 120 nm, 110 nm, 100 nm, 90 nm, 80 nm, 70 nm, 60 nm, 50 nm, 40 nm, 30 nm, or 20 nm or less. In some embodiments, the composition has a mean LNP diameter from about 30nm to about 150nm, or a mean diameter from about 60nm to about 120nm. An LNP may comprise or one or more types of lipids, including but not limited to amino lipids (e.g., ionizable amino lipids), neutral lipids, non-cationic lipids, charged lipids, PEG- modified lipids, phospholipids, structural lipids and sterols. In some embodiments, an LNP may further comprise one or more cargo molecules, including but not limited to nucleic acids (e.g., mRNA, plasmid DNA, DNA or RNA oligonucleotides, siRNA, shRNA, snRNA, snoRNA, lncRNA, etc.), small molecules, proteins and peptides. In some embodiments, the composition comprises a liposome. A liposome is a lipid particle comprising lipids arranged into one or more concentric lipid bilayers around a central region. The central region of a liposome may comprise an aqueous solution, suspension, or other aqueous composition. In some embodiments, a lipid nanoparticle may comprise two or more components (e.g., amino lipid and nucleic acid, PEG-lipid, phospholipid, structural lipid). For instance, a lipid nanoparticle may comprise an amino lipid and a nucleic acid. Compositions comprising lipid nanoparticles, such as those described herein, may be used for a wide variety of applications, including the stealth delivery of mRNA with minimal adverse innate immune response. Effective in vivo delivery of nucleic acids represents a continuing medical challenge. Exogenous nucleic acids (i.e., originating from outside of a cell or organism) are readily degraded in the body, e.g., by the immune system. Accordingly, effective delivery of nucleic acids to cells often requires the use of a particulate carrier (e.g., lipid nanoparticles). The particulate carrier should be formulated to have minimal particle aggregation, be relatively stable prior to intracellular delivery, effectively deliver nucleic acids intracellularly, and illicit no or minimal immune response. To achieve minimal particle aggregation and pre-delivery#14388136v1 stability, many conventional particulate carriers have relied on the presence and / or concentration of certain components (e.g., PEG-lipid). However, it has been discovered that certain components may decrease the stability of encapsulated nucleic acids (e.g., mRNA molecules). The reduced stability may limit the broad applicability of the particulate carriers. As such, there remains a need for methods by which to improve the stability of nucleic acid (e.g., mRNA) encapsulated within lipid nanoparticles. In some embodiments, a lipid nanoparticle comprises one or more of ionizable molecules, polynucleotides, and optional components, such as structural lipids, sterols, neutral lipids, phospholipids and a molecule capable of reducing particle aggregation (e.g., polyethylene glycol (PEG), PEG-modified lipid), such as those described above. In some embodiments, an LNP described herein may include one or more ionizable molecules (e.g., amino lipids or ionizable lipids). The ionizable molecule may comprise a charged group and may have a certain pKa. In certain embodiments, the pKa of the ionizable molecule may be greater than or equal to about 6, greater than or equal to about 6.2, greater than or equal to about 6.5, greater than or equal to about 6.8, greater than or equal to about 7, greater than or equal to about 7.2, greater than or equal to about 7.5, greater than or equal to about 7.8, greater than or equal to about 8. In some embodiments, the pKa of the ionizable molecule may be less than or equal to about 10, less than or equal to about 9.8, less than or equal to about 9.5, less than or equal to about 9.2, less than or equal to about 9.0, less than or equal to about 8.8, or less than or equal to about 8.5. Combinations of the above referenced ranges are also possible (e.g., greater than or equal to 6 and less than or equal to about 8.5). Other ranges are also possible. In embodiments in which more than one type of ionizable molecule are present in a particle, each type of ionizable molecule may independently have a pKa in one or more of the ranges described above. In general, an ionizable molecule comprises one or more charged groups. In some embodiments, an ionizable molecule may be positively charged or negatively charged. For instance, an ionizable molecule may be positively charged. For example, an ionizable molecule may comprise an amine group. As used herein, the term “ionizable molecule” has its ordinary meaning in the art and may refer to a molecule or matrix comprising one or more charged moiety. As used herein, a “charged moiety” is a chemical moiety that carries a formal electronic charge, e.g., monovalent (+1, or -1), divalent (+2, or -2), trivalent (+3, or -3), etc. The charged moiety may be anionic (i.e., negatively charged) or cationic (i.e., positively charged). Examples of positively-charged moieties include amine groups (e.g., primary, secondary, and / or tertiary amines), ammonium groups, pyridinium group, guanidine groups, and imidizolium groups. In a particular embodiment, the charged moieties comprise amine groups. Examples of negatively-#14388136v1 charged groups or precursors thereof, include carboxylate groups, sulfonate groups, sulfate groups, phosphonate groups, phosphate groups, hydroxyl groups, and the like. The charge of the charged moiety may vary, in some cases, with the environmental conditions, for example, changes in pH may alter the charge of the moiety, and / or cause the moiety to become charged or uncharged. In general, the charge density of the molecule and / or matrix may be selected as desired. In some cases, an ionizable molecule (e.g., an amino lipid or ionizable lipid) may include one or more precursor moieties that can be converted to charged moieties. For instance, the ionizable molecule may include a neutral moiety that can be hydrolyzed to form a charged moiety, such as those described above. As a non-limiting specific example, the molecule or matrix may include an amide, which can be hydrolyzed to form an amine, respectively. Those of ordinary skill in the art will be able to determine whether a given chemical moiety carries a formal electronic charge (for example, by inspection, pH titration, ionic conductivity measurements, etc.), and / or whether a given chemical moiety can be reacted (e.g., hydrolyzed) to form a chemical moiety that carries a formal electronic charge. The ionizable molecule (e.g., amino lipid or ionizable lipid) may have any suitable molecular weight. In certain embodiments, the molecular weight of an ionizable molecule is less than or equal to about 2,500 g / mol, less than or equal to about 2,000 g / mol, less than or equal to about 1,500 g / mol, less than or equal to about 1,250 g / mol, less than or equal to about 1,000 g / mol, less than or equal to about 900 g / mol, less than or equal to about 800 g / mol, less than or equal to about 700 g / mol, less than or equal to about 600 g / mol, less than or equal to about 500 g / mol, less than or equal to about 400 g / mol, less than or equal to about 300 g / mol, less than or equal to about 200 g / mol, or less than or equal to about 100 g / mol. In some instances, the molecular weight of an ionizable molecule is greater than or equal to about 100 g / mol, greater than or equal to about 200 g / mol, greater than or equal to about 300 g / mol, greater than or equal to about 400 g / mol, greater than or equal to about 500 g / mol, greater than or equal to about 600 g / mol, greater than or equal to about 700 g / mol, greater than or equal to about 1000 g / mol, greater than or equal to about 1,250 g / mol, greater than or equal to about 1,500 g / mol, greater than or equal to about 1,750 g / mol, greater than or equal to about 2,000 g / mol, or greater than or equal to about 2,250 g / mol. Combinations of the above ranges (e.g., at least about 200 g / mol and less than or equal to about 2,500 g / mol) are also possible. In embodiments in which more than one type of ionizable molecules are present in a particle, each type of ionizable molecule may independently have a molecular weight in one or more of the ranges described above. In some embodiments, the percentage (e.g., by weight, or by mole) of a single type of ionizable molecule (e.g., amino lipid or ionizable lipid) and / or of all the ionizable molecules#14388136v1 within a particle may be greater than or equal to about 15%, greater than or equal to about 16%, greater than or equal to about 17%, greater than or equal to about 18%, greater than or equal to about 19%, greater than or equal to about 20%, greater than or equal to about 21%, greater than or equal to about 22%, greater than or equal to about 23%, greater than or equal to about 24%, greater than or equal to about 25%, greater than or equal to about 30%, greater than or equal to about 35%, greater than or equal to about 40%, greater than or equal to about 42%, greater than or equal to about 45%, greater than or equal to about 48%, greater than or equal to about 50%, greater than or equal to about 52%, greater than or equal to about 55%, greater than or equal to about 58%, greater than or equal to about 60%, greater than or equal to about 62%, greater than or equal to about 65%, or greater than or equal to about 68%. In some instances, the percentage (e.g., by weight, or by mole) may be less than or equal to about 70%, less than or equal to about 68%, less than or equal to about 65%, less than or equal to about 62%, less than or equal to about 60%, less than or equal to about 58%, less than or equal to about 55%, less than or equal to about 52%, less than or equal to about 50%, or less than or equal to about 48%. Combinations of the above referenced ranges are also possible (e.g., greater than or equal to 20% and less than or equal to about 60%, greater than or equal to 40% and less than or equal to about 55%, etc.). In embodiments in which more than one type of ionizable molecule is present in a particle, each type of ionizable molecule may independently have a percentage (e.g., by weight, or by mole) in one or more of the ranges described above. The percentage (e.g., by weight, or by mole) may be determined by extracting the ionizable molecule(s) from the dried particles using, e.g., organic solvents, and measuring the quantity of the agent using high pressure liquid chromatography (i.e., HPLC), liquid chromatography-mass spectrometry (LC-MS), nuclear magnetic resonance (NMR), or mass spectrometry (MS). Those of ordinary skill in the art would be knowledgeable of techniques to determine the quantity of a component using the above-referenced techniques. For example, HPLC may be used to quantify the amount of a component, by, e.g., comparing the area under the curve of a HPLC chromatogram to a standard curve. It should be understood that the terms “charged” or “charged moiety” does not refer to a “partial negative charge" or “partial positive charge" on a molecule. The terms “partial negative charge" and “partial positive charge" are given their ordinary meaning in the art. A “partial negative charge" may result when a functional group comprises a bond that becomes polarized such that electron density is pulled toward one atom of the bond, creating a partial negative charge on the atom. Those of ordinary skill in the art will, in general, recognize bonds that can become polarized in this way.#14388136v1 According to the disclosures herein, a lipid composition may comprise one or more lipids as described herein. Such lipids may include those useful in the preparation of lipid nanoparticle formulations as described above or as known in the art. Multivalent Vaccines As described herein, the term “monovalent” refers to an mRNA polynucleotide having an ORF encoding one Borrelia proteins. As described herein, the term “multivalent” refers to an mRNA polynucleotide (or an mRNA vaccine) encoding multiple Borrelia proteins (on one or more mRNAs). As described herein, the term “hexavalent” refers to six mRNA polynucleotides, each mRNA comprising an ORF encoding one or more Borrelia proteins. As described herein, the term “heptavalent” refers to seven mRNA polynucleotides, each mRNA comprising an ORF encoding one or more Borrelia proteins. The compositions, as provided herein, may include one mRNA polynucleotide or multiple RNA polynucleotides (e.g., mRNAs) collectively encoding two or more antigens of the same or different species. In some embodiments, composition includes an mRNA polynucleotide or multiple mRNA polynucleotides collectively encoding two or more Borrelia proteins. In some embodiments, a single mRNA polynucleotide encodes 2, 3, 4, 5, 6, 7, 8, 9, or 10, or more Borrelia proteins. In some embodiments, the mRNA polynucleotide comprises an ORF that encodes 2 or more Borrelia proteins (e.g., 2 or more of OspA S1-S7). In some embodiments, the mRNA polynucleotide comprises an ORF that encodes 3 or more Borrelia proteins (e.g., 3 or more of OspA S1-S7). In some embodiments, the mRNA polynucleotide comprises an ORF that encodes 4 or more Borrelia proteins (e.g., 4 or more of OspA S1-S7). In some embodiments, the mRNA polynucleotide comprises an ORF that encodes 5 or more Borrelia proteins (e.g., 5 or more of OspA S1-S7). In some embodiments, the mRNA polynucleotide comprises an ORF that encodes 6 or more Borrelia proteins (e.g., 6 or more of OspA S1-S7). In some embodiments, the mRNA polynucleotide comprises an ORF that encodes 7 or more Borrelia proteins (e.g., each of OspA S1-S7). In preferred embodiments, a composition comprises multiple mRNA polynucleotides each encoding a distinct Borrelia protein. In some embodiments, a composition comprises a first mRNA polynucleotide comprising an ORF encoding a first Borrelia protein (e.g., one of OspA S1-S7) and a second mRNA polynucleotide comprising an ORF encoding a second Borrelia protein (e.g., one of OspA S1-S7), wherein the first Borrelia protein and the second Borrelia protein are distinct proteins. In some embodiments, a composition comprises a first mRNA polynucleotide encoding a first Borrelia protein (e.g., one of OspA S1-S7), a second RNA#14388136v1 polynucleotide encoding a second Borrelia protein (e.g., one of OspA S1-S7), and a third RNA polynucleotide encoding a third Borrelia protein (e.g., one of OspA S1-S7), wherein the first Borrelia protein, the second Borrelia protein, and the third Borrelia protein are distinct proteins. In some embodiments, a composition comprises a first mRNA polynucleotide encoding a first Borrelia protein (e.g., one of OspA S1-S7), a second mRNA polynucleotide encoding a second Borrelia protein (e.g., one of OspA S1-S7), a third mRNA polynucleotide encoding a third Borrelia protein (e.g., one of OspA S1-S7), and a fourth mRNA polynucleotide encoding a fourth Borrelia protein (e.g., one of OspA S1-S7), wherein the first Borrelia protein, the second Borrelia protein, the third Borrelia protein, and the fourth Borrelia protein are distinct proteins. In some embodiments, a composition comprises a first mRNA polynucleotide encoding a first Borrelia protein (e.g., one of OspA S1-S7), a second mRNA polynucleotide encoding a second Borrelia protein (e.g., one of OspA S1-S7), a third mRNA polynucleotide encoding a third Borrelia protein (e.g., one of OspA S1-S7), a fourth mRNA polynucleotide encoding a fourth Borrelia protein (e.g., one of OspA S1-S7), and a fifth mRNA polynucleotide encoding a fifth Borrelia protein (e.g., one of OspA S1-S7), wherein the first Borrelia protein, the second Borrelia protein, the third Borrelia protein, the fourth Borrelia protein, and the fifth Borrelia protein are distinct proteins. In some embodiments, a composition comprises a first mRNA polynucleotide encoding a first Borrelia protein (e.g., one of OspA S1-S7), a second mRNA polynucleotide encoding a second Borrelia protein (e.g., one of OspA S1-S7), a third mRNA polynucleotide encoding a third Borrelia protein (e.g., one of OspA S1-S7), a fourth RNA encoding a fourth Borrelia protein (e.g., one of OspA S1-S7), a fifth mRNA polynucleotide encoding a fifth Borrelia proteins (e.g., one of OspA S1-S7), and a sixth mRNA polynucleotide encoding a sixth Borrelia protein (e.g., one of OspA S1-S7), wherein the first Borrelia protein, the second Borrelia protein, the third Borrelia protein, the fourth Borrelia protein, the fifth Borrelia protein, and the sixth Borrelia protein are distinct proteins. In some embodiments, a composition comprises a first mRNA polynucleotide encoding a first Borrelia protein (e.g., OspA S1), a second mRNA polynucleotide encoding a second Borrelia protein (e.g., OspA S2), a third mRNA polynucleotide encoding a third Borrelia protein (e.g., OspA S3), a fourth mRNA polynucleotide encoding a fourth Borrelia protein (e.g., OspA S4), a fifth mRNA polynucleotide encoding a fifth Borrelia proteins (e.g., OspA S4), a sixth mRNA polynucleotide encoding a sixth Borrelia protein (e.g., OspA S6), and a seventh mRNA polynucleotide encoding a seventh Borrelia protein (e.g., OspA S7) wherein the first Borrelia protein, the second Borrelia protein, the third Borrelia protein, the fourth Borrelia protein, the fifth Borrelia protein, and the sixth Borrelia protein are distinct proteins.#14388136v1 In some embodiments, two or more different mRNA polynucleotides encoding antigens may be formulated in the same lipid nanoparticle. In other embodiments, two or more different mRNA encoding antigens may be formulated in separate lipid nanoparticles (each mRNA formulated in a single lipid nanoparticle). Lipid nanoparticles may then be combined and administered as a single vaccine composition (e.g., comprising multiple RNAs (e.g., mRNAs) encoding multiple antigens) or may be administered separately. Pharmaceutical Formulations Provided herein are compositions (e.g., pharmaceutical compositions, such as vaccines), methods, kits and reagents for prevention of Lyme disease and other conditions directly or indirectly cause by Borrelia infection in humans and other mammals, for example. The compositions provided herein can be used as a prophylactic agent to prevent a Borrelia infection, and thus Lyme disease, caused by a Borrelia infection. In some embodiments, the compositions containing mRNA polynucleotide(s) as described herein can be administered to a subject (e.g., a mammalian subject, such as a human subject), and the mRNA polynucleotides are translated in vivo to produce an antigenic polypeptide (antigen). An “effective amount” of a composition (e.g., an mRNA vaccine of the instant invention) is based, at least in part, on the target tissue, target cell type, means of administration, physical characteristics of the mRNA (e.g., length, nucleotide composition, and / or extent of modified nucleosides), other components of the vaccine, and other determinants, such as age, body weight, height, sex and general health of the subject. Typically, an effective amount of a composition induces or boosts an immune response as a function of antigen production in the cells of the subject. In some embodiments, an effective amount of the composition containing mRNA polynucleotide(s) having at least one chemical modification are more efficient than a composition containing a corresponding unmodified polynucleotide encoding the same antigen or a peptide antigen. Increased antigen production may be demonstrated by increased cell transfection (the percentage of cells transfected with the mRNA vaccine), increased protein translation and / or expression from the polynucleotide, decreased nucleic acid degradation (as demonstrated, for example, by increased duration of protein translation from a modified polynucleotide), or altered antigen specific immune response of the host cell. The term "pharmaceutical composition" refers to the combination of an active agent (e.g., mRNA polynucleotide) with a carrier (e.g., lipid composition, e.g., LNP)), inert or active, making the composition especially suitable for prophylactic use in vivo or ex vivo. A "pharmaceutically acceptable carrier," after administered to or upon a subject, does not cause#14388136v1 undesirable physiological effects. The carrier in the pharmaceutical composition must be "acceptable" also in the sense that it is compatible with the active ingredient and can be capable of stabilizing it. One or more solubilizing agents can be utilized as pharmaceutical carriers for delivery of an active agent. Examples of a pharmaceutically acceptable carriers include, but are not limited to, biocompatible vehicles, adjuvants, additives, and diluents to achieve a composition usable as a dosage form. Examples of other carriers include colloidal silicon oxide, magnesium stearate, cellulose, and sodium lauryl sulfate. Additional suitable pharmaceutical carriers and diluents, as well as pharmaceutical necessities for their use, are described in Remington's Pharmaceutical Sciences. In some embodiments, the compositions (comprising polynucleotides and their encoded polypeptides) in accordance with the present disclosure may be used for the prevention of a Borrelia infection. A composition may be administered prophylactically as part of an active immunization scheme to healthy individuals or early in infection during the incubation phase. In some embodiments, the amount of mRNA provided to a cell, a tissue or a subject may be an amount effective for immune prophylaxis. In some embodiments, the compositions (comprising polynucleotides and their encoded polypeptides) in accordance with the present disclosure may be used in a method of vaccinating a subject. As used herein, the term “vaccinating” refers to a method of inducing an immune response in a subject to a particular antigen or pathogen. As used herein, when referring to a prophylactic composition, such as a vaccine, the term “booster” refers to administration of the prophylactic (vaccine) composition to a subject that has had a previous infection or has had a previous vaccine. A booster (or booster vaccine) may be given after an earlier administration of the prophylactic composition. The time of administration between the initial administration of the prophylactic composition and the booster may be, but is not limited to, 12 hours, 1 day, 36 hours, 2 days, 3 days, 4 days, 5 days, 6 days, 1 week, 10 days, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 18 months, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, 10 years, or more. In exemplary embodiments, the time of administration between the initial administration of the prophylactic composition and the booster may be, but is not limited to, 1 week, 2 weeks, 3 weeks, 1 month, 2 months, 3 months, or 6 months. As is described herein, the booster may comprise the same or different mRNA as compared to the earlier administration of the prophylactic composition. The booster, in some embodiments, is monovalent (e.g., the mRNA polynucleotide comprises an ORF that encodes a single antigen). In some embodiments, the booster is multivalent (e.g., the mRNA#14388136v1 polynucleotide comprises an ORF that encodes more than one antigen and / or the booster comprises two or more mRNA polynucleotides, collectively encoding more than one antigen). In some embodiments, “administering” or “administration” means providing a material to a subject in a manner that is pharmacologically useful. In some embodiments, a composition disclosed herein is administered to the subject parenterally. In some embodiments, a composition disclosed herein is administered to a subject subcutaneously or intramuscularly. A composition may be utilized in various settings depending on the prevalence of the infection or the degree or level of unmet medical need. As a non-limiting example, the mRNA vaccines may be utilized to prevent Lyme disease. mRNA vaccines have superior properties in that they produce much larger antibody titers, better neutralizing immunity, produce more durable immune responses, and / or produce responses earlier than commercially available vaccines. Provided herein are pharmaceutical compositions including mRNA and / or complexes optionally in combination with one or more pharmaceutically acceptable excipients. The mRNA may be formulated or administered alone or in conjunction with one or more other components. For example, a vaccine may comprise other components including, but not limited to, adjuvants. In a preferred embodiment, a vaccine does not include an adjuvant (they are adjuvant free). An mRNA may be formulated or administered in combination with one or more pharmaceutically-acceptable excipients. In some embodiments, vaccines comprise at least one additional active substance, such as, for example, a therapeutically-active substance, a prophylactically-active substance, or a combination of both. Vaccine compositions may be sterile, pyrogen-free or both sterile and pyrogen-free. General considerations in the formulation and / or manufacture of pharmaceutical agents, such as vaccines, may be found, for example, in Remington: The Science and Practice of Pharmacy 21st ed., Lippincott Williams & Wilkins, 2005 (incorporated herein by reference in its entirety). In some embodiments, a vaccine is administered to humans, human patients or subjects. For the purposes of the present disclosure, the phrase “active ingredient” generally refers to the mRNA contained therein, for example, mRNA encoding Borrelia protein antigens. Formulations of the vaccines described herein may be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include the step of bringing the active ingredient (e.g., mRNA) into association with an excipient and / or one or more other accessory ingredients, and then, if necessary and / or desirable, dividing, shaping and / or packaging the product into a desired single- or multi-dose unit.#14388136v1 Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and / or any additional ingredients in a pharmaceutical composition in accordance with the disclosure will vary, depending upon the identity, size, and / or condition of the subject treated and further depending upon the route by which the composition is to be administered. Methods of Prophylaxis Provided herein are compositions (e.g., vaccines), methods, kits and reagents for the prevention of a Borrelia infection in humans and other mammals. The compositions can be used as prophylactic agents, for example. In some embodiments, the compositions are used to provide prophylactic protection or lessen the symptoms of a Borrelia infection. A subject may be any mammal, including non-human primate and human subjects. Typically, a subject is a human subject. In some embodiments, a composition is administered to a subject (e.g., a mammalian subject, such as a human subject) in an effective amount to induce an immune response which is effective in preventing infection with or lessening the symptoms of infection with Borrelia. The RNA encoding the subject Borrelia proteins is expressed and translated in vivo to produce the antigen, which then stimulates an immune response in the subject. The compositions can be administered once, twice, three times, four times or more but it is likely sufficient to administer the composition once (optionally followed by repeated administration). Dosing may need to be adjusted accordingly. In some embodiments, the immune response in the subject is induced 2 days, 3 days, 1 week, 2 weeks, 3 weeks, 5 weeks, or 10 weeks earlier relative to an immune response induced in a subject vaccinated with a prophylactically effective dose of a traditional vaccine. Also provided herein are methods of eliciting an immune response in a subject against Borrelia by administering to the subject an mRNA having an open reading frame encoding at least one Borrelia protein, wherein the mRNA does not include a stabilization element, and wherein an adjuvant is not co-formulated or co-administered with the vaccine. A composition may be administered by any route that results in a prophylactically effective outcome. These include, but are not limited, to intradermal, intramuscular, and / or subcutaneous administration. The present disclosure provides methods comprising administering mRNA vaccines to a subject in need thereof. The exact amount required will vary from subject to subject, depending on the species, age, and general condition of the subject, the severity of the disease, the particular composition, its mode of administration, its mode of activity, and the like. The mRNA is typically formulated in dosage unit form for ease of administration and uniformity of dosage. It will be understood, however, that the total daily usage of the mRNA may be#14388136v1 decided by the attending physician within the scope of sound medical judgment. The specific prophylactically effective dose level for any particular patient will depend upon a variety of factors including the disorder being addressed and the severity of the disorder; the activity of the specific compound employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific compound employed; and like factors well known in the medical arts. The effective amount of the mRNA (e.g., an effective dose), as provided herein, may be as low as 20 µg, administered for example as a single dose or as two 10 µg doses (e.g., a first effective vaccine dose and a second effective vaccine dose). In some embodiments, the first effective vaccine dose and the second effective vaccine dose are the same amount. In some embodiments, the first effective vaccine dose and the second effective vaccine dose are different amounts. In some embodiments, the effective amount is a total dose of 5 µg-30 µg, 5 µg-25 µg, 5 µg-20 µg, 5 µg-15 µg, 5 µg-10 µg, 10 µg-30 µg, 10 µg-25 µg, 10 µg-20 µg, 10 µg-15 µg, 15 µg-30 µg, 15 µg-25 µg, 15 µg-20 µg, 20 µg-30 µg, 25 µg-30 µg, or 25 µg-300 µg. In some embodiments, the effective dose (e.g., effective amount) is at least 10 µg and less than 25 µg of the composition. In some embodiments, the effective dose (e.g., effective amount) is at least 5 µg and less than 25 µg of the composition. For example, the effective amount may be a total dose of 5 µg, 10 µg, 15 µg, 20 µg, 25 µg, 30 µg, 35 µg, 40 µg, 45 µg, 50 µg, 55 µg, 60 µg, 65 µg, 70 µg, 75 µg, 80 µg, 85 µg, 90 µg, 95 µg, 100 µg, 110 µg, 120 µg, 130 µg, 140 µg, 150 µg, 160 µg, 170 µg, 180 µg, 190 µg, 200 µg, 250 µg, or 300 µg. In some embodiments, the effective amount (e.g., effective dose) is a total dose of 10 μg. In some embodiments, the effective amount is a total dose of 20 μg (e.g., two 10 μg doses). In some embodiments, the effective amount is a total dose of 25 μg. In some embodiments, the effective amount is a total dose of 30 μg. In some embodiments, the effective amount is a total dose of 50 μg. In some embodiments, the effective amount is a total dose of 60 μg (e.g., two 30 μg doses). In some embodiments, the effective amount is a total dose of 75 μg. In some embodiments, the effective amount is a total dose of 100 μg. In some embodiments, the effective amount is a total dose of 150 μg. In some embodiments, the effective amount is a total dose of 200 μg. In some embodiments, the effective amount is a total dose of 250 μg. In some embodiments, the effective amount is a total dose of 300 μg. In some embodiments, an mRNA vaccine is a monovalent mRNA vaccine comprising a single mRNA polynucleotide comprising an ORF that encodes OspA S1, such as a construct comprising SEQ ID NO: 32, (which encodes an OspA S1 protein having a valine (V) at position#14388136v1 184 and a threonine (T) at position 204). In some embodiments, the effective dose (e.g., effective amount) of monovalent mRNA vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32) is between about 10 µg and about 150 µg (e.g., between about 12.5 µg and about 50 µg). In some embodiments, the effective dose of monovalent mRNA vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32) is about 10 µg, about 12.5 µg, about 15 µg, about 20 µg, about 25 µg, about 30 µg, about 35 µg, about 40 µg, about 45 µg, about 50 µg, about 55 µg, about 60 µg, about 65 µg, about 70 µg, about 75 µg, about 80 µg, about 85 µg, about 90 µg, about 95 µg, about 100 µg, about 110 µg, about 120 µg, about 130 µg, about 140 µg, or about 150 µg. In some embodiments, the effective dose of monovalent mRNA vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32), is 10 µg, 12.5 µg, 15 µg, 20 µg, 25 µg, 30 µg, 35 µg, 40 µg, 45 µg, 50 µg, 55 µg, 60 µg, 65 µg, 70 µg, 75 µg, 80 µg, 85 µg, 90 µg, 95 µg, 100 µg, 110 µg, 120 µg, 130 µg, 140 µg, or 150 µg. In some embodiments, the effective dose of monovalent mRNA vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32) is about 12.5 µg. In some embodiments, the effective dose of monovalent mRNA vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32) is about 25 µg. In some embodiments, the effective dose of monovalent mRNA vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32) is about 50 µg. The effective dose (e.g., effective amount) of monovalent mRNA vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32) may be administered for example as a single dose. The effective does of monovalent vaccine (e.g., a construct comprising the sequence of SEQ ID NO: 32) may be administered as multiple doses (e.g., a first effective vaccine dose, a second effective vaccine dose, a third effective vaccine dose). In some embodiments, the first effective vaccine dose, the second effective vaccine dose, and / or the third effective vaccine dose are the same amount (e.g., each 25 µg, 50 µg, 100 µg, or 150 µg). In some embodiments, first effective vaccine dose, the second effective vaccine dose, and / or the third effective vaccine dose are different amounts. In some embodiments, the effective vaccine doses are administered at least about 2 months (e.g., 2 weeks, 3 weeks, 4 weeks, 1 month, 1.5 months, 2 months, 3 months, 4 months, 5 months, 6 months) apart. In some embodiments, the effective vaccine doses are administered at least about 2 weeks, 3 weeks, 4 weeks, 1 month, 1.5 months, 2 months, 3 months, 4 months, 5 months, 6 months apart. In some embodiments, the effective vaccine doses are administered at least about 2 months apart (e.g., a second does at 2 months and a third does at 3 months). In some embodiments, an mRNA vaccine is a heptavalent mRNA vaccine comprising seven mRNA constructs, each comprising an ORF, collectively encoding for OspA S1-S7, wherein the OspA S1 protein comprises a valine (V) at position 184 and a threonine (T) at#14388136v1 position 204, numbering according to SEQ ID NO: 1 (or relative to the amino acid sequence of SEQ ID NO: 1) (e.g., a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14). In some embodiments, the effective dose (e.g., effective amount) of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14). In some embodiments, the effective dose of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14) is about 20 µg, about 25 µg, about 30 µg, about 35 µg, about 40 µg, about 45 µg, about 50 µg, about 55 µg, about 60 µg, about 65 µg, about 70 µg, about 75 µg, about 80 µg, about 85 µg, about 90 µg, about 95 µg, about 100 µg, about 110 µg, about 120 µg, about 130 µg, about 140 µg, about 150 µg, about 160 µg, about 170 µg, about 180 µg, about 190 µg, about 200 µg, about 250 µg, about 300 µg, or about 450 µg. In some embodiments, the effective dose of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14), is 20 µg, 25 µg, 30 µg, 35 µg, 40 µg, 45 µg, 50 µg, 55 µg, 60 µg, 65 µg, 70 µg, 75 µg, 80 µg, 85 µg, 90 µg, 95 µg, 100 µg, 110 µg, 120 µg, 130 µg, 140 µg, 150 µg, 160 µg, 170 µg, 180 µg, 190 µg, 200 µg, 250 µg, 300 µg, or 450 µg. In some embodiments, the effective dose of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence#14388136v1 of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14) is about 25 µg. In some embodiments, the effective dose of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14) is about 50 µg. In some embodiments, the effective dose of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14) is about 100 µg. In some embodiments, the effective dose of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID No: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14) is about 150 µg. The effective dose (e.g., effective amount) of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID No: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14) may be administered for example as a single dose. The effective dose of heptavalent mRNA vaccine (e.g., comprising a first construct comprising the sequence of SEQ ID NO: 32, a second construct comprising the sequence of SEQ ID NO: 9, a third construct comprising the sequence of SEQ ID NO: 10, a fourth construct comprising the sequence of SEQ ID NO: 11, a fifth construct comprising the sequence of SEQ ID NO: 12, a sixth construct comprising the sequence of SEQ ID NO: 13, and a seventh construct comprising the sequence of SEQ ID NO: 14) may be administered as multiple doses (e.g., a first effective vaccine dose, a second effective vaccine dose, a third effective vaccine dose). In some embodiments, the first effective vaccine dose, the second effective vaccine dose, and / or the third effective vaccine dose are the same amount (e.g., each 12.5 µg, 25 µg, or 50 µg). In some embodiments, first effective vaccine dose, the second#14388136v1 effective vaccine dose, and / or the third effective vaccine dose are different amounts. In some embodiments, the effective vaccine doses are administered at least about 2 months (e.g., 2 weeks, 3 weeks, 4 weeks, 1 month, 1.5 months, 2 months, 3 months, 4 months, 5 months, 6 months) apart. In some embodiments, the effective vaccine doses are administered at least about 2 weeks, 3 weeks, 4 weeks, 1 month, 1.5 months, 2 months, 3 months, 4 months, 5 months, 6 months apart. In some embodiments, the effective vaccine doses are administered at least about 2 months apart (e.g., a second does at 2 months and a third does at 3 months). In some embodiments, the ratio of mRNA comprising an ORF encoding OspA S1: OspA S2: OspA S3: OspA S4: OspA S5: OspA S6: OspA S7 is 1:1:1:1:1:1:1. In some embodiments, the ratio of mRNA comprising an ORF encoding OspA S1: OspA S2: OspA S3: OspA S4: OspA S5: OspA S6: OspA S7 is 1:2:1:1:1:1:1. In some embodiments, the ratio of mRNA comprising an ORF encoding OspA S1: OspA S2: OspA S3: OspA S4: OspA S5: OspA S6: OspA S7 is 1:1:2:1:1:1:1. In some embodiments, the ratio of mRNA comprising an ORF encoding OspA S1: OspA S2: OspA S3: OspA S4: OspA S5: OspA S6: OspA S7 is 1:1:1:2:1:1:1. In some embodiments, the ratio of mRNA comprising an ORF encoding OspA S1: OspA S2: OspA S3: OspA S4: OspA S5: OspA S6: OspA S7 is 1:1:1:1:2:1:1. In some embodiments, the ratio of mRNA comprising an ORF encoding OspA S1: OspA S2: OspA S3: OspA S4: OspA S5: OspA S6: OspA S7 is 1:1:1:1:1:2:1. In some embodiments, the ratio of mRNA comprising an ORF encoding OspA S1: OspA S2: OspA S3: OspA S4: OspA S5: OspA S6: OspA S7 is 1:1:1:1:1:1:2. Vaccine Efficacy Some aspects of the present disclosure provide formulations of the compositions (e.g., RNA vaccines), wherein the mRNA is formulated in an effective amount to produce an effective immune response in a subject (e.g., production of antibodies specific to a Borrelia antigen). “An effective amount” is a dose of the mRNA effective to Prevent or lessen the symptoms of infection with Borrelia. As used herein, an immune response to a vaccine of the present disclosure is the development in a subject of a protective humoral and / or a cellular immune response to a (one or more) Borrelia protein(s) encoded by the mRNA present in the vaccine. For purposes of the present disclosure, a “humoral” immune response refers to an immune response mediated by antibody molecules, including, e.g., secretory (IgA) or IgG molecules, while a “cellular” immune response is one mediated by T-lymphocytes (e.g., CD4+ helper and / or CD8+ T cells (e.g., CTLs) and / or other white blood cells. One important aspect of cellular immunity involves an antigen-specific response by cytolytic T-cells (CTLs). CTLs have specificity for peptide#14388136v1 antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the surfaces of cells. CTLs help induce and promote the destruction of intracellular microbes or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves and antigen-specific response by helper T-cells. Helper T- cells act to help stimulate the function and focus the activity nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface. A cellular immune response also leads to the production of cytokines, chemokines, and other such molecules produced by activated T-cells and / or other white blood cells including those derived from CD4+ and CD8+ T-cells. Immune responses may be further divided into Th1 and Th2 responses, resulting the production of Th1-type cytokines and Th2-type cytokines, respectively. Th1-type cytokines tend to produce the proinflammatory responses responsible for killing intracellular parasites and for perpetuating autoimmune responses. The main Th1 cytokine is interferon gamma. Excessive proinflammatory responses (e.g., Th1-based responses), in some embodiments, can lead to uncontrolled tissue damage, and are counteracted by the Th2-type cytokines. The Th2-type cytokines include interleukins 4, 5, and 13, which are associated with the promotion of IgE and eosinophilic responses in atopy, and also interleukin-10, which is anti- inflammatory. In excess, Th2 responses will counteract the Th1 mediated microbicidal action. Accordingly, in some embodiments, the vaccines provided herein elicit a balanced Th1 and Th2 response. In some embodiments, administration of the vaccines provided herein may result in a Th17 response. T helper 17 cells (Th17) are a subset of pro-inflammatory T helper cells defined by their production of interleukin 17. Th17 cells maintain mucosal barriers and contribute to pathogen clearance at the mucosal surfaces. The Th17-type cytokines target innate immune cells and epithelial cells to produce G-CSF and Il-8, leading to neutrophil production and recruitment. In some embodiments, the compositions (e.g., vaccines) of the present disclosure produce a Th1 response. In some embodiments, the compositions (e.g., vaccines) of the present disclosure produce a Th2 response. In some embodiments, the compositions (e.g., vaccines) of the present disclosure produce a Th17 response. In some embodiments, the compositions (e.g., vaccines) of the present disclosure produce Th1 and Th2 responses, Th1 and Th17 responses, Th2 and Th17 responses, or Th1, Th2, and Th17 responses. A variety of serological tests can be used to measure antibody against encoded antigen of interest, for example, a Borrelia antigen. These tests include the hemagglutination-inhibition test, complement fixation test, fluorescent antibody test, enzyme-linked immunosorbent assay (ELISA), and plaque reduction neutralization test (PRNT). In functional assays intended to assess vaccine immunogenicity, the serum sample dilution series for antibody titration should ideally start below the “seroprotective” threshold#14388136v1 titer. Regarding Borrelia neutralizing antibodies, a seropositivity threshold of 1:10 can be considered a seroprotection threshold in certain embodiments. In some embodiments, an antibody titer is used to assess whether a subject has had an infection or to determine whether an immunization is required. In some embodiments, an antibody titer is used to determine the strength of an autoimmune response, to determine whether a booster immunization is needed, to determine whether a previous vaccine was effective, and to identify any recent or prior infections. In accordance with the present disclosure, an antibody titer may be used to determine the strength of an immune response induced in a subject by an RNA vaccine. In some embodiments, the anti-Borrelia antigen antibody titer, produced in a subject is increased by at least 1 log relative to a control that has not been vaccinated. For example, the anti-Borrelia antigen antibody titer produced in a subject may be increased by at least 1.5, at least 2, at least 2.5, or at least 3 log relative to a control. In some embodiments, the anti-Borrelia antigen antibody titer produced in the subject is increased by 1, 1.5, 2, 2.5 or 3 log relative to a control. In some embodiments, the anti-Borrelia antigen antibody titer produced in the subject is increased by 1-3 log relative to a control. For example, the anti-Borrelia antigen antibody titer produced in a subject may be increased by 1-1.5, 1-2, 1-2.5, 1-3, 1.5-2, 1.5-2.5, 1.5-3, 2-2.5, 2-3, or 2.5-3 log relative to a control. In some embodiments, the anti-Borrelia antigen antibody titer produced in a subject is increased at least 2 times relative to a control that has not been vaccinated. For example, the anti-Borrelia antigen antibody titer produced in a subject may be increased at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or at least 10 times relative to a control. In some embodiments, the anti-Borrelia antigen antibody titer produced in the subject is increased 2, 3, 4, 5, 6, 7, 8, 9, or 10 times relative to a control. In some embodiments, the anti-Borrelia antigen antibody titer produced in a subject is increased 2- 10 times relative to a control. For example, the anti-Borrelia antigen antibody titer produced in a subject may be increased 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8- 9, or 9-10 times relative to a control. In some embodiments, an antigen-specific immune response is measured as a ratio of geometric mean titer (GMT), referred to as a geometric mean ratio (GMR), of serum neutralizing antibody titers to LD. A geometric mean titer (GMT) is the average antibody titer for a group of subjects calculated by multiplying all values and taking the nth root of the number, where n is the number of subjects with available data.#14388136v1 A control, in some embodiments, is an anti-Borrelia antigen antibody titer produced in a subject who has not been administered an mRNA vaccine. In some embodiments, a control is an anti-Borrelia antigen antibody titer produced in a subject administered a recombinant or purified protein vaccine. Recombinant protein vaccines typically include protein antigens that either have been produced in a heterologous expression system (e.g., bacteria or yeast) or purified from large amounts of the pathogenic organism. Titer....

Claims

1. CLAIMS What is claimed is:

1. A messenger ribonucleic acid (mRNA) polynucleotide comprising a 5’ UTR, an open reading frame (ORF) encoding a polypeptide, and a 3’ UTR, wherein the polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 1, and wherein the polypeptide comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO:

1.

2. The mRNA polynucleotide of claim 1, wherein the polypeptide comprises: an alanine (A) at position 87; a phenylalanine (F) at position 179; an isoleucine (I) at position 180; a valine at (V) at position 184; a phenylalanine (F) at position 185; a threonine (T) at position 204; a glutamine (Q) at position 216; and a valine (V) at position 267, numbering according to SEQ ID NO:

1.

3. The mRNA polynucleotide of claim 1 or claim 2, wherein the polypeptide comprises the amino acid sequence of SEQ ID NO:

1.

4. The mRNA polynucleotide of claim 3, wherein the ORF comprises a sequence having at least 90% identity to the sequence of SEQ ID NO:

32.

5. The mRNA polynucleotide of claim 3, wherein the ORF comprises the sequence of SEQ ID NO:

32.

6. The mRNA polynucleotide of any one of claims 1-5, wherein 100% of uracil nucleosides in the open reading frame are N1-methylpseudouridine.#14388136v17. A vaccine comprising the mRNA polynucleotide of any one of claims 1-6 and a lipid nanoparticle, wherein the lipid nanoparticle comprises an ionizable lipid, a neutral lipid, a sterol, and a PEG-modified lipid.

8. The vaccine of claim 7, wherein the ionizable lipid comprises a structure of Compound (I):the neutral lipid is distearoylphosphatidylcholine (DSPC); the sterol is cholesterol; and / or the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethyleneglycol (PEG-DMG).

9. A vaccine comprising a plurality of messenger ribonucleic acid (mRNA) polynucleotides, wherein the plurality comprises: (a) a first mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a first polypeptide, and a 3’ UTR, wherein the first polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 1, and wherein the first polypeptide comprises a valine (V) at position 184 and a threonine (T) at position 204, numbering according to SEQ ID NO: 1; (b) a second mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a second polypeptide, and a 3’ UTR, wherein the second polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 2; (c) a third mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a third polypeptide, and a 3’ UTR, wherein the third polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 3; (d) a fourth mRNA polynucleotide having a 5’ UTR, an open reading frame encoding (ORF) a fourth polypeptide, and a 3’ UTR, wherein the fourth polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 4;#14388136v1(e) a fifth mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a fifth polypeptide, and a 3’ UTR, wherein the fifth polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 5; (f) a sixth mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a sixth polypeptide, and a 3’ UTR, wherein the sixth polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO: 6; and (g) a seventh mRNA polynucleotide having a 5’ UTR, an open reading frame (ORF) encoding a seventh polypeptide, and a 3’ UTR, wherein the seventh polypeptide comprises an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the amino acid sequence of SEQ ID NO:

7.

10. The vaccine of claim 9, wherein the first polypeptide comprises: an alanine (A) at position 87; a phenylalanine (F) at position 179; an isoleucine (I) at position 180; a valine at (V) at position 184; a phenylalanine (F) at position 185; a threonine (T) at position 204; a glutamine (Q) at position 216; and a valine (V) at position 267, numbering according to SEQ ID NO:

1.

11. The vaccine of claim 9 or claim 10, wherein: the first polypeptide comprises the amino acid sequence of SEQ ID NO: 1; the second polypeptide comprises the amino acid sequence of SEQ ID NO: 2; the third polypeptide comprises the amino acid sequence of SEQ ID NO: 3; the fourth polypeptide comprises the amino acid sequence of SEQ ID NO: 4; the fifth polypeptide comprises the amino acid sequence of SEQ ID NO: 5; the sixth polypeptide comprises the amino acid sequence of SEQ ID NO: 6; or the seventh polypeptide comprises the amino acid sequence of SEQ ID NO: 7.#14388136v112. The vaccine of any one of claims 9-11, wherein the ORF of the first mRNA comprises a sequence having at least 90% identity to the sequence of SEQ ID NO:

32.

13. The vaccine of any one of claims 9-11, wherein the ORF of the first mRNA comprises the sequence of SEQ ID NO:

32.

14. The vaccine of any one of claims 9-13, wherein: the first polypeptide comprises the amino acid sequence of SEQ ID NO: 1; the second polypeptide comprises the amino acid sequence of SEQ ID NO: 2; the third polypeptide comprises the amino acid sequence of SEQ ID NO: 3; the fourth polypeptide comprises the amino acid sequence of SEQ ID NO: 4; the fifth polypeptide comprises the amino acid sequence of SEQ ID NO: 5; the sixth polypeptide comprises the amino acid sequence of SEQ ID NO: 6; and the seventh polypeptide comprises the amino acid sequence of SEQ ID NO:

7.

15. The vaccine of any one of claims 9-14, wherein 100% of uracil nucleosides in the open reading frame of each of the polynucleotides are N1 methylpseudouridine.

16. The vaccine of any one of claims 9-15, further comprising a lipid nanoparticle, wherein the lipid nanoparticle comprises an ionizable lipid, a neutral lipid, a sterol, and a PEG-modified lipid.

17. The vaccine of claim 16, wherein the ionizable lipid comprises a structure of Compound (I):the neutral lipid is distearoylphosphatidylcholine (DSPC); the sterol is cholesterol; and / or the PEG-modified lipid is 1,2 dimyristoyl-sn-glycerol, methoxypolyethyleneglycol (PEG-DMG).#14388136v118. A method of inducing an immune response to a Borrelia antigen in a subject, the method comprising administering to the subject one or more doses of the vaccine of any one of claims 7- 17 in an effective amount to produce an immune response to a Borrelia antigen in the subject.

19. The method of claim 18, wherein the vaccine is administered intramuscularly.

20. The method of claim 18 or claim 19, comprising administering a dose of 12.5-150 µg of the mRNA comprised in the vaccine.

21. The method of any one of claims 18-20, comprising: administering a single dose of the vaccine to the subject; or administering a first dose of the vaccine, a second dose of the vaccine, and a third dose of the vaccine, optionally wherein the second dose is administered two months following the first dose, the third dose is administered six months following the first dose, or a combination thereof.

22. The method of claim 21, wherein: the first dose, the second dose, and the third dose is 50 µg of the mRNA, and wherein the second dose is administered 2-3 months after the first dose, and the third dose is administered 4- 6 months after the second dose; the first dose, the second dose, and the third dose is 100 µg of the mRNA, and wherein the second dose is administered 2-3 months after the first dose, and the third dose is administered 4-6 months after the second dose; or the first dose, the second dose, and the third dose is 150 µg of the mRNA, and wherein the second dose is administered 2 months after the first dose, and the third dose is administered 4 months after the second dose.

23. A messenger ribonucleic acid (mRNA) polynucleotide comprising an open reading frame sequence that lacks thymine and that has at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO:

32.

24. The polynucleotide of claim 23, comprising the nucleic acid sequence of SEQ ID NO:

32.

25. A vaccine comprising a plurality of polynucleotides, wherein the plurality comprises:#14388136v1a first polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 32; a second polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 9; a third polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 10; a fourth polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 11; a fifth polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 12; a sixth polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO: 13; and a seventh polynucleotide comprising a sequence having at least 80%, at least 85%, at least 90%, at least 95%, or at least 98% identity to the nucleic acid sequence of SEQ ID NO:

14.

26. The vaccine of claim 25, wherein: the first polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 32; the second polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 9; the third polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 10; the fourth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 11; the fifth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 12; the sixth polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 13; and the seventh polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 14.#14388136v1

Images