Novel eukaryotic cells and methods for recombinantly expressing products of interest

Abstract

The present disclosure relates to novel eukaryotic cells suitable for recombinant production of products of interest, wherein the host cell genome is altered, e.g. by reducing or abolishing the functional expression of the gene FAM60A, such that the effect of the protein FAM60A in the cell is impaired, thereby improving the stability properties. Furthermore, the present disclosure provides related technologies, wherein such host cells are used in recombinant production technologies.

Description

Technical Field

[0001] This disclosure relates to the field of recombinant expression technology. It provides modified eukaryotic cells capable of expressing products of interest with increased stability and their application in recombinant expression methods. Furthermore, it provides eukaryotic cells capable of expressing recombinant products with improved stability based on eukaryotic cell expression profiling early in the selection process. The eukaryotic cells are preferably mammalian cells. Background Technology

[0002] As biopharmaceuticals become increasingly important to modern medicine, the biopharmaceutical market continues its rapid growth. Currently, more and more biopharmaceuticals are being produced in eukaryotic cells, such as specific mammalian cells. Therefore, successful and high-yield production of biopharmaceuticals in eukaryotic cells is crucial. The time to generate these cell lines that produce proteins of interest is a significant part of the time required for any biopharmaceutical to reach clinical trials. Furthermore, given the production costs of biopharmaceuticals and other recombinant products, having recombinant eukaryotic cell lines that express proteins highly, but especially stably, is important, particularly mammalian cell lines.

[0003] To improve biopharmaceutical production efficiency, especially on an industrial scale, significant efforts are made in clonal selection processes, aiming to identify high-yielding clones with good stability and growth characteristics within a short period. However, even when high-expression clones are identified during screening, these initially high-expression clones often lose their favorable expression characteristics and experience reduced expression yields over time. The gradual loss of recombinant protein expression in cell clones during prolonged subculture is a common problem in many cell lines, such as CHO cell lines, and is termed instability. This instability significantly impacts the industrial production of recombinant peptides. The anticipated causes of production instability are associated with recombinant gene copy loss, resulting from host cell genetic instability and epigenetic silencing of transgenic sequences. Furthermore, the instability rate has been found to vary depending on the specific item (i.e., the individual product to be expressed). Instability rates of 25% to almost 90% have been observed in eukaryotic cell lines. Therefore, caution is essential to identify cell / individual cell clones from successfully expressing cell populations, and even from cell clones initially expressing the protein of interest in good yields, that exhibit high production stability over long-term culture and are therefore less likely to show gradual loss of recombinant protein expression. These clones are also called "stable" clones. During long culture periods, stable clones should lose no more than 30% of their initial productivity over a period of 8–12 weeks (e.g., 10 weeks), preferably no more than 25%. Productivity is defined as volumetric productivity, which is the amount of protein expressed per volume (e.g., g / L) at a given culture time point; individually, as cell-specific productivity, it is the specific amount of protein expressed per cell per day (e.g., pg / cell / day). To prevent cell clones that are prone to instability and thus will lose titer during long cultures from being selected for subsequent large-scale production, extensive stability analyses are typically performed over several weeks to several months to remove those cell clones that become unstable during this period and to identify stable clones. Therefore, the generation of recombinant cell clones for the large-scale production of therapeutic proteins and other recombinant peptides often involves over-screening individual clones through time-consuming stability studies to identify cell clones that exhibit the expression stability required for large-scale production. This screening practice of reducing unstable clones and identifying stable clones extends the development of biotechnology production processes. Even when using a highly rigorous selection system that favors the survival of cells with high expression under the selected conditions, it is still difficult to find suitable production clones that combine high expression rates with good growth and stability characteristics within the surviving population.

[0004] One object of the present invention is to improve the recombinant production of products of interest in eukaryotic cells, particularly mammalian cells. Specifically, one object is to provide novel eukaryotic cell lines that express products of interest with enhanced stability after stable transfection with polynucleotides encoding the products of interest. In particular, an object is to provide recombinant eukaryotic cells in which the risk of significant loss of productivity during prolonged culture is reduced. Another object is to provide an improved method for recombinant production of products of interest using stably transfected eukaryotic cells, particularly mammalian cells. Furthermore, an object is to provide analytical tools that can distinguish between stable and unstable cell clones early in the development process. Summary of the Invention

[0005] This disclosure is particularly based on the unexpected finding that, for example, by reducing or eliminating the functional expression of the FAM60A gene, altering the eukaryotic cell genome to weaken the effect of the protein FAM60A in the cells can significantly increase the expression stability of the recombinant product of interest in the cells. For the FAM60A gene, a key gene affecting recombinant expression stability has been identified. Weakening the effect of FAM60A in the cells can significantly improve the recombinant production of the product of interest by increasing expression stability. As illustrated in the examples, when using the novel eukaryotic cells described herein as host cells, recombinant cell clones exhibiting significantly improved stability characteristics were obtained after selection. For the respective host cells, significant loss of expression stability during long-term culture is less common compared to cells in which the genome was not altered to weaken the effect of the protein FAM60A in the cells; and if it occurs, the resulting reduction in productivity is less significant compared to other cells. The abundance of stable clones increases after stable transfection. Therefore, the stability analysis of host cells that are not prone to or are less prone to instability can be shortened or even skipped. This is a significant advantage because it reduces the time required to obtain stable expression cell clones that express the recombinant product of interest in high yield over an extended period, thus making it suitable for large-scale production. Therefore, this invention significantly reduces screening efforts and makes a significant contribution to the prior art.

[0006] According to a first aspect, this disclosure provides isolated eukaryotic cells, wherein the genome of the eukaryotic cells is altered such that the effect of protein FAM60A in the cells is impaired, and wherein the cells comprise heteropolynucleotides encoding a product of interest integrated into their genome. The effect of protein FAM60A in the cells may be impaired by, for example, by reducing or eliminating the functional expression of the endogenous gene FAM60A, through gene silencing, gene deletion, or by mutating the gene to express a non-functional or less functional protein. Other options are also described herein.

[0007] According to the second aspect, a method is provided for selecting host cells that recombinantly express a product of interest, including...

[0008] (a) Providing the eukaryotic cells described in the first aspect as host cells; and

[0009] (b) Select one or more host cells that express the product of interest.

[0010] According to a third aspect, a method for recombinantly producing a product of interest is provided, comprising using the eukaryotic cells described in the first aspect as host cells for recombinant expression of the product of interest. The product of interest is encoded by heteropolynucleotides stably integrated into the genome of the eukaryotic cells described in the first aspect. As mentioned above, these novel eukaryotic cells are particularly suitable as host cells for recombinant production of products of interest due to their advantageous expression stability.

[0011] According to the fourth aspect, a method for producing eukaryotic cells suitable for recombinant production of a product of interest is provided, comprising the following to impair the effect of the protein FAM60A in eukaryotic cells: altering the cell genome and stably transfecting the cells with at least one expression vector comprising a polynucleotide encoding the product of interest. The effect of FAM60A in the cells may be impaired, for example, by reducing or eliminating the functional expression of the gene FAM60A.

[0012] According to the fifth aspect, methods are provided to analyze the suitability of eukaryotic cells as host cells for stable expression of recombinant products of interest, including directly or indirectly analyzing whether the effect of protein FAM60A is impaired in the cells. This method can be advantageously used, for example, in conjunction with the methods described in the fourth aspect, to identify whether eukaryotic cells in which the effect of protein FAM60A is impaired are obtained. Furthermore, this method can be used as an analytical tool to distinguish between stable and unstable cell clones expressing products of interest early in the selection process.

[0013] According to a sixth aspect, this disclosure relates to the use of isolated eukaryotic cells in recombinant expression of a product of interest, wherein the genome of the eukaryotic cells is altered such that the effect of the protein FAM60A in the cells is impaired.

[0014] Other objects, features, advantages, and aspects of this application will be apparent to those skilled in the art from the following description and appended claims. However, it should be understood that the following description, appended claims, and specific embodiments, while indicating preferred embodiments of the application, are given by way of example only. Various variations and modifications within the disclosed inventive spirit and scope will become apparent to those skilled in the art upon reading the following. Attached Figure Description

[0015] Figure 1An overview diagram of the telomere region of chromosome 8 and the genes located in the telomere region is provided for Chinese hamster ovary (CHO) cells. The genomic region shown in the diagram is the result of fused splice sequences 6 and 25 on chromosome 8. An overview of genes and putative genes on chromosome 8 of CHO cells can be found using the assembly-related gene bank annotation files of Brinkrolf et al. (Nature Biotechnology, Vol. 31, 694–695 (2013); see Genebank: APMK00000000, APMK01000000, as described in the publication). In addition, Beijing BGI Genomics Co., Ltd. provides annotations for this region (Xu et al., Nature Biotechnology, Vol. 29, No. 8, 735–741 (2011); see Genebank: AFTD00000000, AFTD01000000). Figure 1 The annotations marked with * are from the gene bank file AFTD01000000.

[0016] An overview of the telomere region of mouse chromosome 6 can be found in databases such as Ensembl. Mouse chromosome 6 has a structure corresponding to Chinese hamster chromosome 8. The following link in the Ensembl database shows the telomere region of mouse chromosome 6 containing the FAM60A gene:

[0017] http: / / www.ensembl.org / Mus_musculus / Location / View?db=core;g=ENSMUSG00000039985;r=6:148921035-148946467

[0018] Table 1 below provides Figure 1 An overview of the abbreviations and alternative names (aliases) of the genes and their encoded products is provided, and (where possible) the corresponding annotations for mice and Chinese hamsters are indicated (according to Brinkrolf et al., 2013 and / or Xu et al., 2011). Table 1 also lists the alternative names used, for example, in different species. Wherein this disclosure refers to a specific protein or gene name, any alternative name for said protein or gene is also referred to and encompassed, for example, used to characterize the corresponding gene or protein in different species. Specifically, this includes homologs and orthologs having the same function.

[0019] Table 1: Abbreviations and alternative names (aliases) of the products encoded by genes located on chromosome 8 of Chinese hamsters or chromosome 6 of mice.

[0020]

[0021]

[0022]

[0023] Figure 2 The relative expression levels of genes located in the telomere region of chromosome 8 in the CHO cell line are shown, namely TMTC1(1), RPS4Y2(2), IPO8(3), CAPRIN2(4), FAM60A(5), Dennd5b(6), METTL20(7), AMN1(8), C12orf35(9) and Bicd1(10).

[0024] Figure 3 The results of a 7 / 8-week stability assay were shown using three different cell clones (CHO wild-type and two FAM60A knockout clones s16 and s23 derived from the wild-type) after stable transfection with an expression vector encoding the antibody of interest. (1) Stability results were shown using parental wild-type cells (derived from CHO-K1); (2) Stability results were shown using FAM60A knockout clone s16; (3) Stability results were shown using FAM60A knockout clone s23. It can be seen that expression stability was significantly increased in cell clones derived from FAM60A knockout cells (see (2) and (3)). The number of stable clones was significantly increased when FAM60A knockout cells were used for recombinant expression. Therefore, weakening the effect of FAM60A in the host cells (here weakened by gene knockout) can significantly improve expression stability.

[0025] Figure 4AL shows the FACS distribution obtained after reducing the expression of different target genes with siRNA, the genes being located in the telomere region of chromosome 8 of Chinese hamster (CHO) cells. Cells stably transfected with expression vectors and expressing antibodies encoding the product of interest were stained with fluorescent staining to detect the amount of recombinantly expressed antibodies. Higher intensity in the FACS distribution indicates more antibody expression in the stained cells. The left peak in the FACS distribution corresponds to the parental cell line (untransfected and therefore not expressing antibodies), which was included for comparison purposes. Two other curves represent results from cell clones stably transfected with expression vectors and recombinantly expressing antibodies. These cell clones were transfected with either a negative siRNA control (dark curve; no effect on the expression of any gene) or siRNA that reduced target gene expression (light gray curve). If target gene silencing did not affect antibody recombinant expression, the fluorescence curves of the siRNA control and the target siRNA overlapped and remained identical. If target gene silencing increased the expression rate of recombinantly expressed antibodies, the intensity of the corresponding FACS distribution increased and shifted to the right. A: Gene Mettl20_1, 125 pmol, 24.9%; B: Gene C12orf35_1, 125 pmol, 30.6%; C: Gene C12orf35_2, 150 pmol, 31.7%; D: Gene Caprin2_6, 100 pmol, 53.3%; E: FAM60A_3, 150 pmol, 48%; F: Ipo8_1, 125 pmol, 20.3%; G: Ipo8_2 H: Ipo8_3, 150 pmol, 21.5%; I: Dennd5b_2, 100 pmol, 36.9%; J: Amn1_4, 125 pmol, 30.8%; K: TMTC1_1, 150 pmol, 60.6%; L: TMTC1_2, 150 pmol, 53.4% ​​(percentages correspond to target gene mRNA expression of the proposed siRNA compared to the control siRNA). Figure 4 Figures B and C show that downregulating the C12orf35 gene significantly increases recombinant antibody expression and thus yields higher productivity, as indicated by a marked rightward shift in the FACS distribution (see the light gray curve on the right, also marked with an arrow). Therefore, according to one implementation, the effectiveness of the C12orf35 gene expression product in host cells is further impaired in order to increase productivity.

[0026] Figure 5 and 6This study shows the mRNA expression levels of the light and heavy chains of two different pattern of interest peptides (antibody 1 and 2) from different clones and libraries after reducing the expression of the gene C12orf35 in CHO cells via RNAi. If the expression of the gene C12orf35 is reduced by gene silencing, the mRNA level of the antibody chain is upregulated. Therefore, the reduction of C12orf35 expression unexpectedly led to an increase in mRNA levels in both HC and LC.

[0027] Figure 7 The results showed that silencing the C12orf35 gene with siRNA resulted in significantly higher cell-specific expression titers (calculated on days 3, 4, 5, and 6 of self-culture).

[0028] Figure 8 The highest-yielding clones (black) derived from the CHO cell line (C8DEL) showed higher titers than the 45 highest-yielding clones derived from the parental cell line. C8DEL lacked the telomere region containing the genes FAM60A and C12orf35 on chromosome 8 (q arm), while the parental cell line tested positive for IPO8 (gray).

[0029] Figure 9 The FACS distribution of a stably transfected C8DEL cell library after selection using the folate receptor / DHFR system is shown. MTX concentration increases from A to E (A: no MTX; B: 1 nM MTX; C: 5 nM MTX; D: 10 nM MTX; E: 50 nM MTX). Recombinant antibody expression was detected based on fluorescence. At 50 nM MTX, as confirmed by FACS analysis, the resulting library primarily consisted of high-yielding cells. The distribution of the resulting library significantly resembled that of the cell clones. This supports the significant improvement in the expression characteristics of recombinant host cells achieved by the technique described herein. Detailed Implementation

[0030] This disclosure is particularly based on the unexpected discovery that eukaryotic cells with impaired FAM60A expression can express recombinant products of interest with significantly enhanced stability after stable transfection. The impairment is caused by, for example, reduced or eliminated functional expression of the endogenous FAM60A gene in the cells, deletion of the gene, or introduction of mutations into the coding sequence. As illustrated in mammalian cell examples, the correspondingly altered cells unexpectedly exhibit highly stable expression characteristics over long culture periods, thereby shortening or even skipping time-consuming stability analyses for identifying stable clones. In successfully transfected host cell populations, the number of host cells losing their advantageous expression characteristics during long culture periods is significantly reduced when using the correspondingly altered eukaryotic cells. Therefore, these altered eukaryotic cells are particularly suitable as host cells for recombinant production technologies and can be used for the recombinant production of products of interest due to their advantageous stability. Based on this unexpected discovery of the strong influence of the FAM60A gene on the stability of recombinant expression in eukaryotic host cells, this disclosure also provides novel options and production methods for improving the recombinant production of products of interest, as well as related technologies. Therefore, this disclosure makes an important contribution to the prior art.

[0031] The relevant aspects and their suitable and preferred implementations will now be described in detail.

[0032] A. Modified eukaryotic cells

[0033] According to a first aspect, this disclosure provides isolated eukaryotic cells in which the eukaryotic cell genome is altered such that the effect of protein FAM60A is impaired in the cells, and wherein the cells comprise heteropolynucleotides encoding a product of interest integrated into their genome. As illustrated in the examples, these altered cells exhibit significantly higher production stability of the product of interest than unmodified cells in which the effect of FAM60A is not impaired. As illustrated in the preferred embodiments, the abundance of cells exhibiting stable expression characteristics increases in the transfected cell population, wherein mammalian cells are used as eukaryotic cells. This enhanced expression stability can shorten or even skip time-consuming stability analysis of highly expressing cell clones. Other advantages are also described below and will become apparent from the examples. Therefore, using these advantageous novel eukaryotic cell lines for recombinant production of products of interest reduces the screening effort required to identify highly expressing cells or cell clones with stable expression characteristics, and in particular reduces the time required to obtain stable cell clones suitable for large-scale production of products of interest. Thus, these altered eukaryotic cell lines have significant advantages when used as host cells for recombinant production technologies.

[0034] FAM60A is a subunit of the SIN3-histone deacetylase (HDAC) complex (SIN3 / HDAC complex), which acts on transcriptional repression (Munoz et al., 2012, THE Journal of Biological Chemistry, Vol. 287, No. 39, pp. 32346-32353; Smith et al., 2012, Mol Cell Proteomics 11(12):1815-1828). Histone deacetylases (HDACs) catalyze the removal of acetyl groups from histones. Histone acetylation at lysine is a major mechanism regulating chromatin conformation. Histone acetylation promotes a relaxed, transcriptionally active chromatin state, while deacetylation catalyzed by histone deacetylases (HDACs) tends to result in a silent, inactive state. Database analysis revealed the presence of at least one FAM60A ortholog in most metazoans, but none in nematodes. The FAM60A gene is conserved in metazoans and is present in all fully sequenced vertebrate genomes and most invertebrate genomes. For example, 100% sequence identity of the FAM60A protein can be found among humans, rats, mice, and cattle. Sequence similarity studies of FAM60A homologs show that this family is the only single representative member in the genome. There are few exceptions. According to Smith et al., 2012, the FAM60A protein has a unique sequence lacking any known protein domains. Furthermore, Smith et al., 2012, describe it as showing no sequence homology with any other known proteins in the human proteome. Sequence comparisons of FAM60A proteins from different species show that the FAM60A protein generally comprises three regions: (1) an N-terminus containing a highly conserved segment in all metazoans; (2) a middle region, which is highly conserved in vertebrates but consists of variable-length non-conserved spacers in invertebrates; and (3) a C-terminus containing a highly conserved segment in all metazoans. Therefore, the highest conservation is observed in the N- and C-termini of FAM60A.

[0035] As mentioned above, studies have shown that FAM60A is associated with the SIN3 / HDAC complex in various eukaryotic cell types, particularly mammalian cell types. However, functional information about FAM60A has been quite limited to date. Recent functional studies (see Smith et al., 2012) have shown that FAM60A can suppress gene expression and regulate specific gene subsets. Smith et al. (2012) reported the role of FAM60A in regulating the TGF-β signaling pathway, which plays a crucial role in processes such as cancer progression, metastasis, cell migration, and immune surveillance. They found that FAM60A acts as a transcriptional repressor of components of the TGF-β signaling pathway, and this function of FAM60A appears to be permitted through its role in the SIN3-HDAC complex. Depletion of FAM60A in different cancer cell lines using siRNA targeting FAM60A induced morphological changes in normal cancer cells. Furthermore, it was found that FAM60A protein levels do indeed change periodically during the cell cycle progression of U2OS cells (Munoz et al., 2012). FAM60A knockdown experiments using FAM60A siRNA in U2OS human osteosarcoma cells revealed that FAM60A restricts cyclin D1 gene expression. Against this scientific backdrop, it was unexpectedly found that attenuating the effect of FAM60A in eukaryotic cells, such as preferred mammalian cells, significantly increases the stability of heterologous gene expression in these cells without negatively impacting other cellular characteristics important for recombinant expression. This association between the effect of FAM60A and expression stability during long-term cell culture is surprising.

[0036] As described, the FAM60A gene is endogenously expressed in metazoans and thus in mammals such as humans, mice, rats, and hamsters, and the amino acid sequence of FAM60A is highly conserved in mammals and vertebrates. The altered eukaryotic cells described in the first aspect are derived from eukaryotic cells that endogenously express FAM60A. For simplicity, the protein FAM60A and the FAM60A gene encoding the protein FAM60A are spelled in uppercase letters herein, even though different spellings are used for the gene and / or protein in some species. The sequence listing shows exemplary amino acid sequences of known and / or predicted FAM60A proteins from different vertebrate species, including *Homo sapiens* (SEQ ID NO:1), *Rattus norvegicus* (SEQ ID NO:2), *Mus musculus* (SEQ ID NO:3), *Cricetulus griseus* (SEQ ID NO:4), *Gallus gallus* (SEQ ID NO:5), *Pan troglodytes* (SEQ ID NO:6), *Pongo abelii* (SEQ ID NO:7), and *Bos taurus* (SEQ ID NO:8). The predicted FAM60A cDNA from *Cricetulus griseus* is shown in SEQ ID NO:9 (coding sequence from 14-679; see also NCBI reference sequence: XM_003505482.1). The protein FAM60A or the FAM60A gene may have different names in different species, and non-sex-restricted names (aliases) are also listed in Table 1 above. The term "FAM60A" as used herein also includes any FAM60A homologs and orthologs having the same function as FAM60A. According to one embodiment, the term "FAM60A" as used herein specifically refers to a protein sharing at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology with one or more amino acid sequences shown in SEQ ID NO:1-8. According to one embodiment, the aforementioned percentages refer to polypeptide identity, not homology. Homology and corresponding identity can be calculated from the full length of a reference protein. The corresponding protein preferably has the same function as a protein having the amino acid sequence shown in SEQ ID NO:1 or one or more of SEQ ID NO:2-8 (preferably SEQ ID NO:4). The FAM60A protein is not described in detail in the literature.Therefore, it is quite surprising that if the host cell genome is altered to impair the effect of the endogenous protein FAM60A in the cell, such as by reducing or eliminating the functional expression of the FAM60A gene in the cell, the expression stability of the recombinant host cell is improved. Unexpectedly, FAM60A affects the expression stability of the recombinant product of interest.

[0037] The FAM60A gene, encoding the FAM60A protein, can be modified, as described herein, to weaken the effects of FAM60A in cells. This can be achieved, for example, through genetic engineering techniques such as gene knockout. The genome sequences of different mammals are known, and are described, for example, in Homo sapiens (NCBI Gene-ID: 58516); brown rat (NCBI Gene-ID: 686611); house mouse (NCBI Gene-ID: 56306); and domestic cattle (NCBI Gene-ID: 538649). Transcriptomorphs can exist in species-dependent manner and in varying numbers. For example, the human FAM60A gene expresses a putative transcript isotype with three UTRs that differ but encode the same protein.

[0038] This disclosure particularly relates to modified eukaryotic cells, such as preferably mammalian cells, in which the eukaryotic cell genome is impaired by alteration to the protein FAM60A, which is endogenously expressed by the corresponding unmodified eukaryotic cells. This modification increases the number of stably expressing cells in a cell population stably transfected with an expression vector containing a polynucleotide encoding the product of interest.

[0039] Several alternative methods exist for modifying the cellular genome to attenuate the effects of the protein FAM60A in the cell. For example, the effects of FAM60A can be attenuated at the gene or protein level. The effects of FAM60A can be attenuated, for example, by modifying its structure / sequence, transcription, translation, and / or interactions with other components that form the SIN3 / HDAC complex. The following describes non-limiting cases.

[0040] According to one implementation, the effect of protein FAM60A is impaired because the functional expression of the FAM60A gene in the cell is reduced or eliminated. As illustrated in the examples, altering the expression of the FAM60A gene, for example by gene knockout or reduction of expression levels, is a highly effective measure to provide altered cells that can express the recombinant product of interest with enhanced stability.

[0041] Reducing or eliminating the functional expression of the FAM60A gene can be achieved in a variety of ways. For example, functional expression can be reduced by lowering the expression level of FAM60A, disrupting FAM60A function, or by a combination of such methods. According to one embodiment, the cells are altered to reduce or eliminate the functional expression of the FAM60A gene by gene knockout, gene mutation, gene deletion, gene silencing, or any combination of the foregoing methods. According to one embodiment, the functional expression of the FAM60A gene is reduced or eliminated in the cells by gene knockout. Gene knockout is a gene technique that renders a gene ineffective by disrupting its function. For example, nucleic acids can be inserted into the coding sequence, thereby disrupting gene function. Furthermore, the complete FAM60A gene or a portion thereof can be deleted, resulting in the corresponding altered cells having no protein expression or no functional protein expression. Another option is to introduce one or more knockout mutations into the coding sequence to produce a no-functional or less functional expression product. For example, one or more frameshift mutations can be introduced into the coding sequence to produce a no-functional or less functional expression product. Alternatively or supplementarily, one or more stop codons can be introduced into the coding sequence to obtain a truncated, no-functional, or less functional protein. Furthermore, the splicing site can be altered. Therefore, according to one embodiment, the FAM60A gene includes one or more mutations that provide a non-functional or less functional expression product. According to one embodiment, one or more mutations are introduced into exon 1 of the FAM60A gene. According to one embodiment, due to the introduction of one or more mutations, all or part of the FAM60A N-terminus or C-terminus is absent in the expression product. Other options include, but are not limited to, one or more mutations in the promoter, 5'- and / or 3'UTR, or other regulatory elements. According to one embodiment, the promoter function of the FAM60A gene is disrupted, for example by introducing promoter deletion or introducing a construct between the promoter and transcription initiation. Those skilled in the art are also familiar with methods for achieving gene knockout to suppress or eliminate target gene expression, and therefore no detailed description is necessary herein. Nevertheless, some non-limiting embodiments are described below.

[0042] According to one implementation, the FAM60A gene is functionally knocked out through genetic engineering. Examples include, but are not limited to, genome editing, such as artificial nuclease-mediated genome editing (GEEN). This is a type of genetic engineering in which artificial nucleases, or "molecular scissors," are used to insert, replace, or remove DNA from the genome. The nuclease generates a specific double-strand break (DSB) at the desired location in the genome and repairs the induced break using endogenous cellular mechanisms through natural processes of homologous recombination (HR) and non-homologous end joining (NHEJ). There are at least four families of engineered nucleases that can be used: zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), CRISPR, and engineered meganuclease re-engineered homing endonucleases. TALEN technology is also used in embodiments providing altered mammalian cells in which the FAM60A gene is knocked out, thereby attenuating the effect of the protein FAM60A in the cells.

[0043] According to one embodiment, at least one copy and optionally all copies (if more copies of the FAM60A gene are present in the eukaryotic genome) are altered, such as knocked out, deleted, or otherwise rendered ineffective, to reduce or eliminate and thus weaken the effect of the protein FAM60A in eukaryotic cells. Thus, according to one embodiment, at least one copy of the FAM60A gene is deleted or inactivated in the eukaryotic genome. For example, one or more mutations may be inserted into one or more copies of the FAM60A gene to provide a non-functional or less functional expression product, or to completely remove or reduce expression and thus weaken the effect of FAM60A in eukaryotic cells. Consequently, the FAM60A gene is substantially inactivated in the genome. According to one embodiment, all copies of the FAM60A gene are correspondingly altered in eukaryotic cells, preferably mammalian cells.

[0044] According to one embodiment, the eukaryotic cell is a metazoan cell, a vertebrate cell, or preferably a mammalian cell. According to one embodiment, the chromosome in the cell has a partial deletion, wherein the deleted portion includes the gene FAM60A. According to one embodiment, if more than one copy is present, the chromosomal portion containing the gene FAM60A is deleted in all chromosomes containing copies of the gene FAM60A. Therefore, all copies of the gene C12orf35 are deleted from the genome.

[0045] According to one embodiment, a portion of the telomere region of a chromosome is deleted, wherein the deleted portion includes the gene FAM60A. According to a preferred embodiment, the modified cells are rodent cells. According to one embodiment, the cells are hamster cells, such as CHO cells, and at least a portion of the telomere region of chromosome 8 is deleted from the genome, wherein the deleted portion includes the gene FAM60A. The meaning of the term "FAM60A" is as explained above, and non-restrictive sex designations of homologs and orthologs covered by the scope of the term are also shown in Table 1. According to one embodiment, such deletions occur in the q-arm of chromosome 8 in hamster cells, particularly Chinese hamster cells, and include the FAM60A gene. As shown in the examples, CHO cells containing the corresponding deletion in the telomere region of chromosome 8 are particularly suitable as host cells for recombinant expression. After stable transfection with the expression vector, these cells showed significantly higher productivity than cells that did not lose the portion of the telomere region of chromosome 8. Furthermore, the abundance and therefore proportion of stably expressing cells in the transfected cell population increased significantly. Significant loss of titer was rarely observed during long-term culture. Therefore, in these hamster cells that have lost the telomere region of chromosome 8, the stability of recombinant expression is significantly improved. Other important advantages are detailed in the examples, which further characterize CHO cells with the corresponding portion of the telomere region of chromosome 8 missing due to chromosome breakage. These superior properties make these hamster cells particularly suitable as industrial production cell lines. Alternatively, the modified rodent cells can be mouse cells, wherein at least a portion of the telomere region of chromosome 6 is missing from the genome, wherein the missing portion includes the gene FAM60A. The telomere region of mouse chromosome 6 is highly similar to the telomere region of hamster chromosome 8.

[0046] According to one embodiment, at least a portion of the telomere region is missing or absent in both chromosomes of hamster chromosome pair 8 (or chromosome pair 6 in the case of mouse cells), wherein the missing portion includes the FAM60A gene.

[0047] According to one embodiment, at least a portion of the telomere region is deleted from one chromosome of chromosome pair 8 in hamsters (or chromosome pair 6 in the case of mice), wherein said deleted portion includes the FAM60A gene, and if other copies are present, the expression of the FAM60A gene in the other chromosome is reduced or eliminated. Suitable methods for reducing or eliminating gene expression are known to those skilled in the art, and non-limiting embodiments are also described herein. According to one embodiment, this deletion occurs in the 8q arm of chromosome 8 in hamsters, particularly Chinese hamsters.

[0048] According to one embodiment, the missing chromosomal region includes the FAM60A gene and additionally includes one or more genes selected from the group consisting of: Bicd1, C12orf35, Amn1, methyltransferase-like protein 20, Dennd5b, Caprin2, and Ipo8. According to one embodiment, all of the above genes are missing. According to one embodiment, the missing chromosomal region additionally includes at least a portion or the entire Tmtc1 gene. In hamster cells such as CHO cells, these genes are also located in the telomere region of chromosome 8. According to one embodiment, the missing chromosomal region additionally includes the gene RPS4Y2 (if present). Figure 1 The provided Chinese hamster genome provides an overview of the locations of the aforementioned genes in the telomere region of chromosome 8. As an example, CHO cells containing the corresponding deletion of the chromosome 8 telomere region (q arm) exhibit particularly advantageous properties in terms of expression yield and stability. In mouse cells, the aforementioned genes are located in the chromosome 6 telomere region. The unrestricted sex names of the aforementioned individual genes and / or encoded proteins containing orthologs and homologs are also shown in Table 1 above, and the terminology used for individual genes above covers these corresponding genes.

[0049] According to one embodiment, the deletion of the FAM60A gene is caused by chromosome breakage. Chromosomal breakage can be induced, for example, by treating eukaryotic cells with a cytotoxic agent that promotes chromosome breakage, such as MTX, afedipine, or hygromycin. Other options for inducing chromosome breakage include, but are not limited to, radiation, irradiation, mutagens, carcinogens, and bleomycin. Chromosomal breakage can also occur spontaneously during transfection, such as electroporation. Methods for inducing chromosome breakage are also known to those skilled in the art and therefore do not require further detail herein. After inducing chromosome breakage, eukaryotic cells with the desired breakpoint (resulting in the deletion of the FAM60A gene) can be identified, for example, by DNA analysis or using the methods described in the fifth aspect of this disclosure. For example, the expression distribution of treated cells can be analyzed to determine whether the FAM60A gene or the gene located at the centromere of the FAM60A gene is expressed, whether expression is reduced, or whether the gene is not expressed. For example, in the case of mouse or hamster cells, it is possible to analyze whether the gene FAM60A is expressed, or alternatively, to analyze whether one or more genes selected from Bicd1, C12orf35, methyltransferase-like protein 20, Dennd5b, Caprin2, Ipo8, Tmtc1, or genes located at the telomere ends of the aforementioned genes (where telomere ends here mean the direction of entry into the telomere end) are expressed by the cell and / or whether their expression is reduced or eliminated. If the induced breakpoint is located at the centromere end of the corresponding gene (where centromere ends here mean further entry into the chromosome and therefore further away from the telomere end), the deletion of the telomere end containing said gene will eliminate or reduce its expression (if other gene copies elsewhere are expressed). Figure 1As observed, the gene FAM60A is located at the telomere end of the aforementioned genes Caprin2, Ipo8, and Tmtc1, i.e., it is positioned further towards the telomere terminus. Therefore, if these genes are deleted via chromosome breakage, the deleted region also includes the gene FAM60A. Thus, these genes can be effectively used as markers to indirectly determine whether induced chromosome breakage results in the partial deletion of chromosomes containing the gene FAM60A. Furthermore, it was found that even at the telomere end of the gene FAM60A, other genes such as Bicd or C12orf35 can be used as markers to determine whether chromosome breakage causing the deletion of the gene FAM60A is induced. In CHO cells, it was found that if, for example, genes Bicd1 or C12orf35 are deleted due to chromosome breakage, the deletion usually also includes the gene FAM60A. Analysis of the expression characteristics of hundreds of clones confirmed that these genes can be effectively used as markers to distinguish cell clones with high and stable expression characteristics from those with low and unstable expression characteristics. Figure 2 This shows the relative expression of the above genes in CHO cells. For example... Figure 2 As shown, in normal CHO-K1 cells excluding chromosome 8 telomere deletions, the genes Ipo8(3), FAM60A(5), and C12orf35(9) are expressed at higher levels than other genes located in the chromosome 8 telomere region. Therefore, it is advantageous to include one or more of these genes in the analysis, as this simplifies the detection of their expression elimination or reduction. The unrestricted sex designations of the aforementioned individual genes and their encoded proteins containing homologs and orthologs are also shown in Table 1 above, and the terminology used for individual genes above covers the corresponding genes.

[0050] According to one embodiment, the breakpoint on chromosome 8 is located at the centromere of the FAM60A gene, the Caprin2 gene, the Ipo8 gene, or the RPS4Y2 gene. It has been found that breakpoints on chromosome 8 in the hamster genome are typically located at the centromere of the Ipo8 gene. According to one embodiment, the breakpoint on chromosome 8 is located within the Tmtc1 gene, which is not expressed or is expressed at low levels. According to one embodiment, the Ergic2 gene, located at the centromere of the Tmtc1 gene, is not deleted on chromosome 8. Therefore, according to one embodiment, the breakpoint is at the telomere end of the Ergic2 gene (where telomere end here means downwards towards the telomere tip) and the Ergic2 gene is present.

[0051] According to one embodiment, the cell genome is altered, thereby reducing or eliminating the functional expression of the gene FAM60A. The functional expression of the gene FAM60A can be affected in various ways, such as by altering the promoter and / or enhancer of the gene FAM60A to produce less or no transcripts, or by gene silencing techniques such as transcriptional or post-transcriptional gene silencing. According to one embodiment, one or more mutations are made in the promoter region of the gene FAM60A in isolated eukaryotic cells. For example, the promoter region can be altered to provide a promoter with less or no function, or the promoter can be completely removed. Alternatively or additionally, a polynucleotide sequence encoding a polypeptide containing a stop codon can be inserted between the FAM60A gene promoter and the start codon, causing the expression of other polypeptides instead of FAM60A. Such methods are well known to those skilled in the art and therefore require no further detail herein.

[0052] The reduction of functional gene expression can reach or even eliminate expression levels. For example, posttranscriptional gene silencing can be achieved through antisense molecules or molecules that mediate RNA interference. Non-limiting examples are briefly described below.

[0053] Antisense polynucleotides can be engineered to specifically bind to RNA, inducing RNA-DNA or RNA-RNA hybrid formation, and blocking reverse transcription or messenger RNA translation. Many antisense forms have been developed and can be broadly classified as enzyme-dependent antisense or spatially stacked antisense. Enzyme-dependent antisenses include those that depend on RNase H activity to degrade target mRNA, including single-stranded DNA and RNA forms, as well as phosphate-thiolated antisenses. Antisense polynucleotides are typically produced intracellularly by expressing antisense constructs containing the antisense strand as the transcription strand. Trans-cleavage catalyzes RNA (ribozymes), which are RNA molecules with endonuclease activity. Ribozymes can be specifically engineered for specific targets and can be modified to cleave any type of RNA at specific sites within the cellular RNA context. The cleavage event destabilizes the mRNA and prevents protein expression. The eukaryotic genome can be altered to express (e.g., permanently) the corresponding antisense molecules.

[0054] Another suitable option for reducing the functional expression of the gene FAM60A at the posttranscriptional level is based on RNA interference (RNAi). Methods of silencing genes via RNAi are well known to those skilled in the art and therefore require no further detail herein. Several embodiments and variations of siRNA compounds are known in the art and can be used to reduce the expression of the gene FAM60A. Suitable siRNAs targeting selected / identified target sequences in the target gene at the RNA level can be identified using appropriate computational methods and certain design-algorithms. According to another embodiment, the RNAi-inducing compound is expressed by a vector transfected into eukaryotic cells and thus integrated into the eukaryotic genome. For siRNA, this can be done, for example, by introducing a loop between the two strands to produce a single transcript, which can then be processed into a functional siRNA in eukaryotic cells. Such transcript cassettes generally use RNA polymerase III promoters (e.g., U6 or H1) that typically guide the transcription of small nuclear RNA (shRNA). It is assumed that the shRNA transcript obtained from the vector is subsequently processed by a dicer to produce a double-stranded siRNA molecule, preferably having a characteristic 3' overhang. According to one embodiment, such shRNAs provide a vector that is stably integrated into the eukaryotic genome. This implementation is advantageous because the downregulation of gene FAM60A is stable and non-transient due to continuously generated siRNA, and therefore can be used to provide enhanced expression stability to mammalian host cells. Cells containing the corresponding shRNA-providing vector can then be transfected with an expression vector containing a polynucleotide encoding the product of interest. Alternatively, a co-transfection strategy can be employed, in which the shRNA-producing vector is co-transfected with an expression vector containing a polynucleotide encoding the product of interest.

[0055] For example, transcriptional gene silencing can include epigenetic modifications. According to one implementation, the functional expression of the gene FAM60A is reduced through epigenetic silencing. Furthermore, the FAM60A gene sequence can be altered to shorten the half-life of FAM60A mRNA. Thus, less FAM60A protein is obtained, and the influence of FAM60A protein in cells is also reduced.

[0056] According to one implementation, functional expression of the gene FAM60A is reduced or eliminated by targeting regulatory elements involved in regulating gene FAM60A expression. For example, by knocking out, deleting, downregulating, or otherwise inactivating or reducing the activity of the regulatory element, transcription factors, promoters (see also above), enhancers, UTRs, or other regulatory elements can be targeted to prevent or reduce the functional expression of gene FAM60A and thus weaken the effect of endogenous expression products.

[0057] According to one embodiment, the eukaryotic cell genome is altered to attenuate the effect of FAM60A by heterologous expression of a mutant FAM60A, which is nonfunctional or less functional compared to endogenously expressed FAM60A protein. In this embodiment, in addition to the heterologous polynucleotide encoding the polypeptide of interest, the isolated eukaryotic cell also includes another heterologous polynucleotide encoding the mutant FAM60A. Overexpression of the corresponding nonfunctional or less functional mutant FAM60A can produce a dominant-negative regulatory phenotype. Another option to attenuate and thus reduce the effect of FAM60A in cells is to heterologously express a protein, such as an antibody that neutralizes FAM60A and thus attenuates its effect in cells. According to one embodiment, the effect of FAM60A in cells is impaired by reducing or eliminating the functional expression of molecules that functionally interact with FAM60A, such as reducing or eliminating the functional expression of one or more members of the SIN3 / HDAC complex. These implementations also weaken the effects of FAM60A because one or more FAM60A interacting partners required for FAM60A to exert its biological effects are not present in a functional form due to reduced or eliminated functional expression.

[0058] According to one embodiment, the expression of the gene FAM60A is decreased by at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 75-fold, at least 80-fold, at least 90-fold, at least 100-fold, or at least 125-fold, at least 250-fold, at least 500-fold, at least 750-fold, at least 1000-fold, at least 1250-fold, at least 1500-fold, at least 1750-fold, at least 2000-fold, at least 2500-fold, at least 3000-fold, or at least 3500-fold. Expression can be measured, for example, by real-time RT-PCR or other sensitive RNA detection methods. This decrease can be obtained, for example, by comparison with unmodified control cells where the expression of the endogenous gene FAM60A is not reduced. According to one embodiment, compared to the expression of 18S RNA in the same cell (set as 100%), the expression of the FAM60A gene is 0.05% or less, 0.04% or less, 0.03% or less, 0.02% or less, 0.01% or less, 0.005% or less, or 0.0025% or less. According to one embodiment, compared to the expression of 18S RNA in the same cell (set as 100%), the expression of the FAM60A gene is even less, such as 0.001% or less, 0.0005% or less, or even 0.0002% or less.

[0059] According to one embodiment, preferably, isolated eukaryotic cells derived from a population of eukaryotic cells are altered to impair the effect of protein FAM60A in these cells, and wherein these cells comprise heteropolynucleotides encoding a product of interest that are stably integrated into their genome, wherein typically at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% of the cells derived from the population lose no more than 30%, preferably no more than 25%, of their product of interest expression titer over a period of at least 8 weeks, preferably 10 weeks, more preferably 12 weeks. As illustrated in the examples, after transfection and identification of stable transfected cells, when altered with the methods described herein, an increase in the number of cells that do not show a gradual loss of productivity during long-term culture is observed, i.e., more stable cell clones can be obtained from the selected cell population. Stability properties can be tested as follows: individual cells from the population are cultured as cell clones and titers are determined over the indicated time periods. For example, stability properties are detected using the tests described in the examples. As explained above, stability rates may vary between different items depending on the expressed protein and whether it has, for example, codon optimization. However, when using the modified eukaryotic cells described in this disclosure, a significant increase in stably expressing clones was observed in all analyzed items compared to unmodified wild-type cells. The percentage of cell clones stably expressing the product of interest in the analyzed clones during long-term culture periods was 80% or even higher in some items, spanning 8–12 weeks. Therefore, the abundance of cells with stable expression characteristics was significantly increased in successfully transfected host cell populations. Thus, the risk of selecting unstable clones that gradually lose productivity during long-term culture for large-scale production can be significantly reduced by the teachings of this disclosure. This important advantage can significantly reduce or even completely eliminate the need for long-term stability analyses to remove unstable clones.

[0060] According to one embodiment, the expression products of one or more genes selected from Bicd1, C12orf35, Amn1, methyltransferase-like protein 20, Dennd5b, FAM60A, Caprin2, Ipo8, RPS4Y2, and Tmtc1, or one or more genes located at the telomere ends of the aforementioned genes, are additionally impaired. The non-restrictive sex designations of the aforementioned individual genes and / or encoded proteins containing homologs and orthologs are also shown in Table 1 above, and the terminology used above for the individual genes or proteins encoded by said genes encompasses the corresponding genes encoding the corresponding proteins. Impaired effects can also be achieved, for example, by reducing or eliminating the functional expression of the corresponding genes. Suitable techniques and embodiments described above in conjunction with the FAM60A gene are equally applicable to any other target genes. As mentioned above, the gene is located in the telomere region of Chinese hamster chromosome 8 and mouse chromosome 6. If a portion of the telomere region is deleted, for example, through the aforementioned induced chromosome breakage, the deleted region typically includes one or more of the aforementioned genes.

[0061] According to a preferred embodiment, in cells where the effect of protein FAM60A is impaired, the effect of the gene C12orf35 expression product in the cells is further attenuated, preferably by reducing or eliminating the functional expression of gene C12orf35. Another unexpected finding is that attenuating the effect of gene C12orf35 expression product in eukaryotic cells, for example by reducing or eliminating the functional expression of the endogenous gene, results in a significant increase in the expression of the recombinant product of interest. Thus, another key gene affecting recombinant expression has been identified. As demonstrated in the examples, attenuating the effect of gene C12orf35 expression product in eukaryotic cells can significantly increase the expression yield. Therefore, attenuating the effects of FAM60A and C12orf35 is particularly advantageous because the provided host cells exhibit improved characteristics in terms of expression stability and yield, and thus show particularly advantageous characteristics for the production of the recombinant product of interest. As stated, the host cells are preferably mammalian cells.

[0062] The C12orf35 gene is endogenously expressed in eukaryotic cells, such as those of mammals like humans, mice, and hamsters. The expression product of the C12orf35 gene is a relatively large protein. The sequence listing shows exemplary or putative amino acid sequences of the proteins encoded by endogenous C12orf35 genes in different mammals, such as hamsters (SEQ ID NO:10 and 11), humans (SEQ ID NO:12 and 13), mice (SEQ ID NO:14), cattle (SEQ ID NO:15), and wild boars (SEQ ID NO:16). The CDS (coding DNA sequence) of C12orf35 from Chinese hamsters is shown in SEQ ID NO:17. Furthermore, fragments of the 5'UTR (see SEQ ID NO:18) and 3'UTR (see SEQ ID NO:19) of the C12orf35 mRNA from Chinese hamsters were sequenced. The gene C12orf35 is also known as C12orf35-like or C12orf35 homolog in hamsters, or 2810474O19Rik in mice. Information on the gene, coding sequence, and predicted C12orf35 protein in the gray hamster (Cricetulus griseus) is publicly available at NCBI:XM_003512865, which is incorporated herein by reference. It is also known as KIAA1551 in humans. The protein or gene may be given different names in different species; non-sex-restricted names (aliases) are also listed in Table 1 above. Therefore, the term "C12orf35 gene" as used herein specifically encompasses any endogenous gene whose encoded protein shares at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% homology or identity with the amino acid sequences shown in one or more SEQ ID NO:10-16 or the protein encoded in SEQ ID NO:17. The protein encoded by the gene preferably has the same function as a protein containing the amino acid sequences shown in SEQ ID NO:10 or one or more SEQ ID NO:11-16 or the protein encoded in SEQ ID NO:17. The gene can be modified as described herein to attenuate the function of the expression product expressed in unmodified cells. The protein expressed by the C12orf35 gene is not described in detail in the literature. As used herein, the terms “C12orf35 protein” or “expression product of endogenous C12orf35 gene” and similar expressions particularly cover any protein that shares at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% homology or identity with the amino acid sequences shown in one or more of SEQ ID NO:10-16 or the protein encoded by SEQ ID NO 17.Homology and corresponding identity can be calculated based on the full length of the reference protein. According to one embodiment, the expression of the gene C12orf35 is decreased by at least 3-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, at least 50-fold, at least 60-fold, at least 70-fold, at least 75-fold, at least 80-fold, at least 90-fold, at least 100-fold, or at least 125-fold, at least 250-fold, at least 500-fold, at least 750-fold, at least 1000-fold, at least 1250-fold, at least 1500-fold, at least 1750-fold, or at least 2000-fold. This can be measured, for example, by real-time RT-PCR or other sensitive RNA detection methods. This decrease can be obtained, for example, by comparison with unmodified reference cells where the expression of the endogenous gene C12orf35 is not reduced. According to one embodiment, compared to the expression of 18S RNA in the same cell (set as 100%), the expression of the gene C12orf35 is 0.05% or less, 0.0475% or less, 0.045% or less, 0.0425% or less, 0.04% or less, 0.0375% or less, 0.035% or less, 0.0325% or less, 0.03% or less, 0.0275% or less, 0.025% or less, 0.0225% or less, 0.02% or less, 0.0175% or less, or 0.015% or less. According to one embodiment, compared to the expression of 18S RNA in the same cell (set as 100%), the expression of the gene C12orf35 is even less, such as 0.001% or less, 0.0001% or less, or even 0.00001% or less. The functional expression of gene C12orf35 is reduced, thereby causing an increase in the expression of the recombinant product of interest compared to the corresponding cells when the modified eukaryotic cells are transfected with an expression vector encoding the product of interest, and the functional expression of gene C12orf35 in the corresponding cells is not reduced or eliminated. According to one embodiment, the expression of the recombinant product or product of interest is at least 1.5-fold, at least 1.75-fold, at least 2-fold, at least 2.5-fold, at least 3-fold, at least 4-fold, or at least 5-fold compared to the expression in the corresponding cells, and the functional expression of gene C12orf35 in the corresponding cells is not reduced or eliminated. According to another embodiment, the resulting expression rate is at least 8-fold, at least 10-fold, or at least 15-fold compared to the expression in the corresponding cells, and the expression of gene C12orf35 in the corresponding cells is not reduced or eliminated. For example, the expression rate of the recombinant product can be measured, for example, by the assay described in the examples.

[0063] Eukaryotic cells are derived from cell types that normally endogenously express FAM60A. Examples are described below. As explained above (see also Smith et al., 2012), FAM60A is endogenously expressed in eukaryotic cells, such as all metazoans, especially vertebrates, as well as invertebrates and all mammalian cells. The term "isolated" is used to clearly indicate that the eukaryotic cells are not contained within a living organism such as an animal or human. As described herein, these cells can be provided as cell cultures, cell lines, cell clones, etc. Examples are also described below. As described above, compared to a corresponding unmodified eukaryotic cell endogenously expressing FAM60A, the eukaryotic cell is modified to weaken the effect of FAM60A in the cell, for example, by reducing or eliminating the effect of FAM60A. Weakening is preferably achieved by reducing or eliminating the functional expression of the gene FAM60A in the cell. Non-limiting embodiments are described above. To provide a production cell line that is uniform and thus has predictable and stable characteristics, the eukaryotic cell genome is modified to achieve this result. Suitable embodiments are described above. Subsequently, the correspondingly modified eukaryotic cells can be stably transfected with an expression vector containing a polynucleotide encoding a product of interest to provide eukaryotic cells as described in the first aspect, comprising a heterologous polynucleotide encoding a product of interest integrated into the genome. The eukaryotic cells are preferably vertebrate cells, more preferably mammalian cells. Therefore, all embodiments described herein with respect to eukaryotic cells can generally be applied to preferred embodiments in which mammalian cells are used. For example, eukaryotic cells may be selected from rodent cells, human cells, and monkey cells. Preferred mammalian cells are rodent cells, such as cells derived from hamsters or mice. They can be selected from the group consisting of Chinese hamster cells such as CHO cells, BHK cells, NSO cells, C127 cells, mouse 3T3 fibroblasts, and SP2 / 0 cells. Particularly preferred are CHO cells, such as CHO-K1, CHO-S, CHO-K1SV, CHO-SSF3, CHO-DG44, CHO-DUXB11, or cell lines derived therefrom. As illustrated in the embodiments, knocking out the FAM60A gene in CHO cells provides a CHO cell population with an increased abundance of stably transfected cells exhibiting prolonged stability. The FAM60A gene is also expressed in human cells. Therefore, according to one embodiment, the mammalian cells are derived from human cells, such as HEK293 cells, MCF-7 cells, PerC6 cells, CAP cells, hematopoietic cells, and HeLa cells. Another alternative is monkey cells, which may be selected, for example, from COS cells, COS-1 cells, COS-7 cells, and Vero cells. According to one embodiment, the eukaryotic cells (preferably mammalian cells) are provided as cell clones or cell lines.

[0064] The following eukaryotic cells can be used as starting materials for preparing the eukaryotic cells described in this disclosure, wherein the genome has been altered to weaken the effect of FAM60A in the cells and does not include heteropolynucleotides encoding products of interest, heteropolynucleotides encoding selection markers, and / or heteropolynucleotides encoding reporter peptides expressed, especially secreted, by the cells. For example, the corresponding “empty” altered eukaryotic cells can be used as clonal cell lines for recombinant production technologies. The corresponding cells can be stably transfected with heteropolynucleotides encoding products of interest, for example, using suitable expression vectors. Such “empty” eukaryotic cells, which are impaired in their effect of FAM60A and do not yet express or, in particular, secrete recombinant products, can therefore be transfected with different expression vectors depending on the desired product of interest to be recombinantly produced. Thus, such eukaryotic cell lines can be used for different projects, i.e., for the production of different products of interest, especially different secreted peptides of interest.

[0065] The eukaryotic cell described in the first aspect comprises a heteropolynucleotide stably integrated into its genome encoding a product of interest. The product of interest is a recombinant product that should be expressed in large quantities by the eukaryotic cell. The product of interest is preferably a polypeptide. According to a preferred embodiment, the polypeptide of interest is secreted by the cell. The eukaryotic cell may additionally include a heteropolynucleotide encoding a selection marker and / or a heteropolynucleotide encoding a reporter. This simplifies the selection of host cells that have been successfully transfected and thus express the product of interest. Furthermore, the eukaryotic cell may include several polynucleotides encoding different selection markers and / or reporter polypeptides.

[0066] As used in this article, the terms "heteronucleotide" or "heteronucleotide" specifically refer to polynucleotide sequences, such as those introduced into eukaryotic cells using recombinant techniques (e.g., transfection). Depending on the context, "polynucleotide" specifically refers to a polymer of nucleotides typically linked from one deoxyribose or ribose sugar to another, referring to both DNA and RNA. The term "polynucleotide" does not include any size limitations.

[0067] Expression vectors can be used to introduce heterologous polynucleotides. These polynucleotides can be contained within an expression cassette. The polynucleotide encoding the product of interest and the polynucleotide encoding a selectable marker or reporter peptide can reside in the same or different expression vectors. For example, introduction into eukaryotic cells can be accomplished by transfecting a suitable expression vector into a host cell, the vector comprising the polynucleotide encoding the product of interest. The expression vector integrates into the host cell genome (stable transfection). As illustrated in the examples, the novel eukaryotic cells described herein facilitate stable transfection because of the increased number of clones with prolonged stability. Stable transfection is also the standard for producing high-expression clones for industrial-scale production of products of interest, such as peptides of interest. This is particularly important for therapeutic or diagnostic peptides of interest. Several suitable methods are known in the art for introducing heterologous nucleic acids, such as expression vectors, into eukaryotic (e.g., mammalian) host cells, and therefore do not require further detail herein. These methods include, but are not limited to, calcium phosphate transfection, electroporation, lipid transfection, gene gun, or polymer-mediated gene transfer. In addition to conventional random integration-based methods, recombination-mediated methods can also be used to transfer heterologous polynucleotides into the host cell genome. These methods are well known in the art and do not require further detail herein. Non-limiting embodiments with suitable carrier designs are also described below and referenced to the relevant disclosures.

[0068] Expression vectors used to achieve the expression of recombinant products of interest typically contain transcriptional control elements suitable for driving transcription, such as promoters, enhancers, polyadenylation signals, and transcriptional pause or termination signals, which are commonly used as expression cassette elements. If the desired product is a polypeptide, the vector preferably includes suitable translational control elements, such as generating a 5' untranslated region suitable for recruiting ribosomes into a 5' cap structure, and a stop codon to terminate the translation process. The resulting transcript contains functional translational elements that promote protein expression (i.e., translation) and appropriate translation termination. The functional expression unit that can appropriately drive the expression of the included polynucleotide is also called an "expression cassette". Those skilled in the art know how expression cassettes should be designed to enable expression in eukaryotic cells, preferably mammalian cells.

[0069] The expression cassette preferably includes a polynucleotide encoding the product of interest as described herein, and a polynucleotide encoding a selection marker and / or reporter peptide. Several embodiments are suitable. For example, the respective polynucleotides can be included in separate expression cassettes. This is also known as a monocistronic setting. The scope of the invention also covers the inclusion of at least two of the respective polynucleotides in one expression cassette. According to one embodiment, at least one internal ribosome entry site (IRES) element is functionally located between polynucleotides expressed from the same expression cassette. Thus, separate translation products are obtained from the transcript. IRES-based expression techniques, as well as other bicistronic and polycistronic systems, are known and therefore need not be described further herein.

[0070] As described, the expression vector may include at least one promoter and / or promoter / enhancer element as an expression cassette element. Promoters can be divided into two categories: constitutively functional promoters and promoters regulated by induction or derepression. Both are suitable. Strongly constitutive promoters driving expression in many cell types include, but are not limited to, adenovirus major late promoter, human cytomegalovirus immediate early promoter, SV40 and Rous sarcoma virus promoters, mouse glycerol-3-phosphate kinase promoter, and EF1a. According to one embodiment, the promoter and / or enhancer are derived from CMV and / or SV40. Transcription promoters can be selected from the group consisting of: SV40 promoter, CMV promoter, EF1α promoter, RSV promoter, BROAD3 promoter, mouse rosa 26 promoter, pCEFL promoter, and β-actin promoter. Other promoters may also be used if they can induce expression of the product of interest in eukaryotic cells (preferably mammalian cells).

[0071] Furthermore, the expression cassette may include at least one intron. Typically, the intron is located at the 5' end of the open reading frame, but it may also be located at the 3' end. The intron may be located between the promoter and / or promoter / enhancer element and the 5' end of the polynucleotide open reading frame encoding the product of interest to be expressed. Several suitable introns compatible with this disclosure are known at present.

[0072] The product of interest can be any biological product that can be produced by transcription, translation, or any other genetic information expression event, wherein the genetic information is encoded by a polynucleotide encoding the product of interest. The product of interest can be selected from polypeptides and nucleic acids, especially RNA. The product can be a drug or therapeutically active compound, or a research tool to be used in experiments, etc. The product of interest is preferably a polypeptide. Any polypeptide of interest can be expressed using the methods of the present invention. The term "polypeptide" refers to a molecule containing a polymer of amino acids linked together by peptide bonds. Polypeptides include polypeptides of any length, including proteins (e.g., having more than 50 amino acids) and peptides (e.g., 2-49 amino acids). Polypeptides include proteins and / or peptides of any activity, function, or size, and may include, for example, enzymes (e.g., proteases, kinases, phosphatases), receptors, transport proteins, bactericidal and / or endotoxin-binding proteins, structural polypeptides, membrane-bound polypeptides, glycoproteins, globular proteins, immune polypeptides, toxins, antibiotics, hormones, growth factors, blood factors, vaccines, etc. The polypeptide can be selected from peptide hormones, interleukins, tissue plasminogen activators, cytokines, immunoglobulins, especially antibodies or functional antibody fragments or variants thereof, and Fc-fusion proteins. The polypeptide of interest expressed according to the teachings described herein can also be a subunit or domain of a polypeptide, such as an antibody heavy or light chain, or a functional fragment or derivative thereof. The terms “product of interest” or “polypeptide of interest” may refer, depending on the context, to the individual subunit or domain or the final protein composed of multiple corresponding subunits or domains. In a preferred embodiment, the polypeptide of interest is an immunoglobulin molecule, more preferably an antibody or its subunit or domain, such as an antibody heavy or light chain. As used herein, the term “antibody” specifically refers to a protein containing at least two heavy chains and two light chains linked by disulfide bonds. The term “antibody” includes naturally occurring antibodies as well as all recombinant forms of antibodies, such as humanized antibodies, fully human antibodies, and chimeric antibodies. The corresponding heavy chain typically includes a heavy chain variable region (VH) and a heavy chain constant region (CH). The corresponding light chain typically includes a light chain variable region (VL) and a light chain constant region (CL). However, the term “antibody” also includes other antibody types, such as single-domain antibodies, heavy chain antibodies (i.e., antibodies composed of only one or more, particularly two, heavy chains), and nanobodies (i.e., antibodies composed of only a single monomeric variable domain). As described above, the polynucleotide encoding the polypeptide of interest may also encode one or more antibody subunits or domains as the polypeptide of interest, such as the heavy chain or light chain, or functional fragments or derivatives thereof. These subunits or domains can be expressed from the same or different expression cassettes. Specifically, an antibody's "functional fragment or derivative" refers to a polypeptide derived from the antibody and capable of binding to the same antigen, especially the same epitope. Antigen-binding function of antibodies has been shown to be achieved by full-length antibody fragments or derivatives thereof.Examples of antibody fragments or derivatives include (i) Fab fragments, monovalent fragments consisting of variable regions of the respective heavy and light chains and a first constant domain; (ii) F(ab)2 fragments, divalent fragments containing two Fab fragments linked by disulfide bonds in the hinge region; (iii) Fd fragments, consisting of a variable region of the heavy chain and a first constant domain CH1; (iv) Fv fragments, consisting of variable regions of the heavy and light chains of an antibody arm; (v) scFv fragments, Fv fragments consisting of a single polypeptide chain; (vi) (Fv)2 fragments, consisting of two Fv fragments covalently linked together; (vii) a heavy chain variable domain; and (viii) polyantibodies, consisting of heavy chain and light chain variable regions covalently linked together such that the linking of the heavy and light chain variable regions occurs only intermolecularly rather than intramolecularly. According to one embodiment, eukaryotic cells secrete the polypeptide of interest into a cell culture medium. According to one embodiment, the polypeptide of interest is not SIN3A or does not include SIN3A. According to one implementation, the polypeptide of interest is not FAM60A or does not include FAM60A.

[0073] Eukaryotic cells may or may not include endogenous polynucleotides that correspond to and are identical to the polynucleotides encoding the product of interest. According to one embodiment, the eukaryotic cell does not include the endogenous gene corresponding to the product of interest.

[0074] As described, in several embodiments, in addition to the heteropolynucleotide encoding the product of interest, the eukaryotic cell includes at least one heteropolynucleotide encoding a selection marker and / or a reporter polypeptide.

[0075] "Selection markers" allow for the selection of host cells expressing the selection marker under suitable selection culture conditions. The selection marker provides a vector of the marker that exhibits survival and / or growth advantage under selection conditions. Thus, successfully transfected host cells with the expression vector can be selected under suitable selection conditions. Typically, the selection marker gene confers resistance to a selection agent (such as a drug, antibiotic, or other toxic agent) or compensates for metabolic or catabolism defects in the host cell. It can be a positive or negative selection marker. To select successfully transfected host cells, the culture medium used to culture the host cells contains a selection agent that selects the selected marker. In other embodiments, the selection marker enables host cells to survive and proliferate in the absence or reduction of compounds essential for the survival and / or proliferation of host cells lacking the selection marker. By culturing host cells in a medium lacking concentrations sufficient to enable host cell survival and / or proliferation, or containing reduced amounts of the essential compounds, only host cells expressing the selection marker can survive and / or proliferate. According to one embodiment, the selection marker is a drug resistance marker, encoding a protein that confers resistance to the drug selection conditions involved. Various selection marker genes have been described (see, for example, WO 92 / 08796, WO 94 / 28143, WO2004 / 081167, WO2009 / 080759, WO2010 / 097240). For example, at least one selection marker can be used to confer resistance to one or more antibiotics. According to one embodiment, the selection marker is an amplifiable selection marker. An amplifiable selection marker can select host cells containing a vector and promote gene amplification of the vector in the host cells. Selection marker genes commonly used in eukaryotic cells (e.g., particularly mammalian cells) include: aminoglycoside phosphotransferase (APH), hygromycin phosphotransferase (hyg), dihydrofolate reductase (DHFR), thymidine kinase (tk), gamma-glutamyl synthase, asparagine synthase, and genes encoding resistance to neomycin (G418), puromycin, hygromycin, zeocin, ouabain, blastomycin, histidine D, bleomycin, humicin, and mycophenolic acid. According to one embodiment, the novel eukaryotic cells described herein, preferably mammalian cells, are selected using a folate receptor as a marker (see, for example, WO2009 / 080759). According to one embodiment, the folate-dependent eukaryotic cells include heteropolynucleotides encoding the folate receptor as a marker and / or heteropolynucleotides encoding dihydrofolate reductase (DHFR) as a marker. This embodiment is further detailed below in conjunction with the selection method described in the second aspect. The eukaryotic cells may endogenously express DHFR and the folate receptor.

[0076] "Reporter peptides" enable the identification of cells expressing the reporter peptide based on reporter properties (such as fluorescence). Reporter genes typically do not provide a survival advantage to host cells. However, the expression of a reporter peptide can be used to distinguish cells expressing the reporter peptide from those that do not. Therefore, reporter genes can also select successfully transfected host cells. Suitable reporter peptides include, but are not limited to, green fluorescent protein (GFP), YFP, CFP, and luciferase. According to one embodiment, the reporter peptide has properties that allow selection by flow cytometry.

[0077] As described, the expression vector containing the polynucleotide encoding the product of interest may also include more than one select marker and / or reporter gene. Furthermore, one or more polynucleotides encoding the select marker and / or one or more polynucleotides encoding the reporter polypeptide may be provided on one or more different expression vectors, which are co-transfected with the expression vector containing the polynucleotide encoding the product of interest. This equally selectable co-transfection strategy is well known in the art.

[0078] Expression vectors contained in eukaryotic cells, or combinations of at least two expression vectors, may additionally include other vector elements. For example, they may include at least one additional polynucleotide encoding other products of interest. As explained above and as seen from the examples of expressible polypeptides described in this teaching, the final polypeptide to be produced from and preferably secreted by the host cell may also be a protein composed of several individual subunits or domains. Preferred examples of the corresponding protein are immunoglobulin molecules, especially antibodies containing, for example, heavy and light chains. Several options are available for producing the corresponding protein composed of different individual subunits or domains, and suitable vector designs are known in the art. According to one embodiment, two or more subunits or domains of the protein are expressed from a single expression cassette. In this embodiment, a long transcript is obtained from the corresponding expression cassette containing the coding regions of the individual protein subunits or domains. According to one embodiment, at least one IRES element (internal ribosome entry site) is functionally located between the coding regions of these individual subunits or domains, preceded by a secretion leader sequence. Thus, it is ensured that a single translation product is obtained from the transcript, and the final protein is correctly assembled and secreted. The relevant techniques are known in the prior art and therefore do not require further details in this article.

[0079] For some implementations, such as antibody expression, it is also preferred to express individual subunits or domains from different expression cassettes. According to one implementation, the expression cassette for expressing the product of interest is a monocistronic expression cassette. All expression cassettes contained in the expression vector or combination of expression vectors may be monocistronic. Thus, according to one implementation, a corresponding expression cassette designed for expressing the product of interest includes a polynucleotide encoding a subunit or domain of the protein to be expressed as a polypeptide of interest. For example, in the case of antibodies, one expression cassette may encode the antibody light chain while another expression cassette may encode the antibody heavy chain. After the individual subunit or domain is expressed from the individual expression cassette, the final protein, such as an antibody, is assembled from the subunit or domain and secreted by the host cell. This implementation is particularly suitable for expressing immunoglobulin molecules such as antibodies. In this case, a first heteropolynucleotide encoding the product of interest encodes, for example, the heavy or light chain of an immunoglobulin molecule, and a second heteropolynucleotide encoding the product of interest encodes another chain of the immunoglobulin molecule. According to one embodiment, an expression vector or combination of at least two expression vectors for transfecting mammalian host cells comprises at least one expression cassette containing a polynucleotide encoded by a heavy chain of an immunoglobulin molecule or a functional fragment thereof, and at least one expression cassette containing a polynucleotide encoded by a light chain of an immunoglobulin molecule or a functional fragment thereof. When using a combination of at least two expression vectors, the polynucleotide may be located in the same or different expression vectors. After expression of the polynucleotide in the transfected host cells, a functional immunoglobulin molecule is obtained, preferably secreted from the host cells. As illustrated in the examples, cells and cell lines with impaired efficacy using the FAM60A described herein are particularly suitable for protein expression due to their enhanced stability properties, the impairment preferably resulting from alterations to the host cell genome by reducing or eliminating the functional expression of the gene. Furthermore, in several embodiments, the expression of the gene C12orf35 is particularly impaired, with significantly increased expression yield. Therefore, the novel eukaryotic cell lines described herein have particular advantages for recombinant expression of peptides comprising proteins (such as antibodies) consisting of several domain subunits. Other advantages are also described in conjunction with examples.

[0080] B. Selection Method

[0081] According to the second aspect, a method is provided for selecting host cells that recombinantly express a product of interest, including...

[0082] a) Provide the eukaryotic cells described in the first aspect as host cells, and

[0083] b) Select one or more host cells that express the product of interest.

[0084] The first aspect (including suitable and preferred embodiments) describes the eukaryotic host cells and their advantages in detail above and with reference to the corresponding disclosures that are equally applicable herein. As described, vertebrate cells, especially mammalian cells, are preferably used as host cells. For example, the superior characteristics of the eukaryotic cells simplify the selection of suitable production clones and thus simplify their identification. Furthermore, when using the eukaryotic cells described herein, fewer clones are required for analysis and screening of production characteristics to identify suitable stable production clones because the proportion of cells with favorable stable characteristics in the transfected cell population is significantly increased. This saves time and allows for the parallel processing of more projects. In addition, in several embodiments, as demonstrated by the examples, the number of highly expressed cells with favorable characteristics increases proportionally after the stabilization transfection and selection steps. These expressing cells are also called cell banks that produce large quantities of products of interest. Therefore, such cell banks containing highly expressed cells can, for example, be used to produce peptides of interest in a short timeframe. Thus, products of interest can be rapidly produced in the corresponding cells.

[0085] According to one embodiment, stage (a) of the selection method described in the second aspect includes transfecting eukaryotic cells with a heteropolynucleotide encoding a product of interest, wherein the genome of the cells is altered so that the effect of protein FAM60A in the cells is impaired, thereby providing a corresponding eukaryotic cell containing a heteropolynucleotide stably integrated into the genome encoding the product of interest. As described, mammalian cells are preferably used as eukaryotic host cells. The polynucleotide encoding the product of interest may be included in an expression vector subsequently transfected into the eukaryotic cells.

[0086] To select and thus identify host cells that express the product of interest in high yields, selection phase (b) can be a multi-step selection process comprising several selection steps. For example, phase (b) may include one or more selection steps to identify successfully transfected cells and one or more subsequent selection steps to select highly expressive cells from a successfully transfected cell bank. A suitable selection strategy depends on the design of the expression vector used to introduce the polynucleotide encoding the product of interest, and particularly on the selection markers and / or reporter used. Non-limiting embodiments are described below.

[0087] As described above, the eukaryotic cells may include at least one heterologous polynucleotide encoding a selection marker. The same or different co-transfection expression vectors may be used to introduce the polynucleotide encoding the selection marker along with the polynucleotide encoding the product of interest into the host cells. Then, stage (b) includes culturing these host cells under conditions that provide selective pressure to the host cells, for example, in a suitable selective medium to identify successfully transfected host cells. As described herein, “selective medium” specifically refers to a cell culture medium used to select host cells expressing the selection marker. For example, it may include a screening agent, such as a toxic agent capable of identifying successfully transfected host cells. Alternatively, the selective medium may lack the essential compound or its concentration may be reduced. According to one embodiment, host cells that are unsuccessfully transfected and therefore do not express the selection marker or express it at low levels fail to proliferate or die under selective culture conditions. Conversely, host cells successfully transfected with the expression vector and expressing the selection marker (and the corresponding co-introduced product of interest) in sufficient yield are resistant to selective pressure or less affected by it, and therefore can proliferate, growing beyond unsuccessfully transfected host cells or those with unfavorable integration sites within their cellular genome. According to one embodiment, the selection marker is selected from antibiotic resistance markers, drug resistance markers, and metabolic markers. Suitable examples of selection markers and selection principles are given above in conjunction with the first aspect, and suitable selection criteria for individual selection markers are also well known to those skilled in the art. Non-limiting but advantageous implementations are briefly described below.

[0088] As illustrated in the examples, one advantage of the novel eukaryotic cells described herein is that, following a standard selection step such as G418 / neo selection, the percentage of high-producing cells with stable properties is significantly increased. These eukaryotic cells, in particular, include CHO cell lines with telomere deletions on chromosome 8 containing the gene FAM60A and therefore also the gene C12orf35. For example, when transfecting normal CHO cell lines without corresponding alterations, typically 60% or even up to 80% of the surviving cells after G418 / neo selection are non-productive cells. Using the novel cell lines described herein, the number of non-productive or low-producing cells is significantly reduced. This allows for efficient selection of stage (b) using only one selection marker and therefore only one selection step, such as G418 / neo selection (if desired). This increases the speed of selection and thus reduces the time required to obtain stable transfected cells expressing the product of interest. Furthermore, due to the increased number of high and stable producing cells, it has been found that even without specifically selecting high-producing cells, a cell population with clonal properties can still be generated (and thus in a very short time). Thus, the product of interest can even be produced from the library. Therefore, such a rapid selection system is highly advantageous for applications where only a specific amount of protein is rapidly required, such as for research or testing purposes, to quickly generate good production cells or production cell libraries.

[0089] However, if further increases in productivity are required, the multi-step approach of stage (b) is preferred. This is especially true when the goal is to establish clonal cell lines for large-scale, particularly industrial-scale, production of the product of interest.

[0090] As described above, one or more expression vectors introduced into the cells described herein may include two or more selectable marker genes, and the selection of different selectable markers may be performed simultaneously or sequentially to select host cells successfully transfected with the expression vector and expressing the product of interest in high yield. The selective culture medium used for culturing may include selection agents for all selected markers used. In another embodiment, culturing may be performed first with a selective culture medium containing only a selection agent for one or a subset of the selected marker genes used, followed by the addition of selection agents for one or more remaining selected marker genes. In another embodiment, host cells are cultured with a first selective culture medium containing only a selection agent for one or a subset of the vector's selected marker genes, and then with a second selective culture medium containing one or more selection agents for the remaining selected marker genes. According to one embodiment, the second selective culture medium does not include the selection agent used in the first selective culture medium.

[0091] According to one embodiment, the eukaryotic cells provided in stage (a) comprise a heteropolynucleotide encoding dihydrofolate reductase (DHFR) as a selection marker, and stage (b) comprises a DHFR selection step. The corresponding selection step typically involves a selective medium containing a DHFR inhibitor. Several suitable DHFR enzymes and corresponding DHFR genes are known in the art and can be used as selection markers. The term DHFR refers to wild-type DHFR as well as: DHFR enzymes having one or more amino acid sequence exchanges (e.g., deletions, substitutions, or additions) compared to the corresponding wild-type DHFR enzyme; fusion proteins comprising one or more DHFR enzymes modified to provide additional structure and / or function, and the aforementioned functional fragments, which still possess the function of at least one DHFR enzyme. These embodiments are well known in the art and therefore do not require detailed description. For example, DHFR enzymes can be used as selection markers that are more or less sensitive to folate antagonists such as MTX compared to wild-type DHFR enzymes and / or DHFR enzymes expressed endogenously in host cells (if expressed). The corresponding DHFR enzymes are well known in the art, for example, as described in EP 0 246 049 and other literature. DHFR enzymes are derived from any species and, as long as they are functional within the scope of this invention, are compatible with the mammalian host cells used. For example, DHFR from major anti-MTX mutant mice has been widely used as a dominant selection marker in eukaryotic cells. DHFR enzymes can be used as selection markers, compared to DHFR +(+) Endogenously expressed DHFR enzymes in host cells and therefore in host cells containing a functional endogenous DHFR gene are less sensitive to DHFR inhibitors such as MTX. According to one embodiment, an intron or a fragment thereof is placed at the 3' end of the open reading frame of the DHFR gene. The intron used in the DHFR expression cassette produces a smaller, nonfunctional DHFR gene variant (Grillari et al., 2001, J. Biotechnol. 87, 59-65). This reduces DHFR gene expression levels, further improving selection rigor. Alternative methods for reducing DHFR gene expression levels using introns are described in EP0724 639 and are also applicable.

[0092] "DHFR inhibitor" specifically refers to a compound that inhibits the activity of dihydrofolate reductase (DHFR). For example, the corresponding inhibitor can competitively bind to DHFR substrates. Suitable DHFR inhibitors, for example, are folate antagonists such as methotrexate (MTX). Therefore, according to one embodiment, stage (b) includes the following DHFR selection step: culturing these host cells in a selective medium comprising at least one DHFR inhibitor, such as a preferred folate antagonist. The corresponding selection conditions are known to those skilled in the art. According to one embodiment, the selective medium used in stage (b) contains the following concentrations of folate antagonist: 1500 nM or less, 1250 nM or less, 1000 nM or less, 750 nM or less, 500 nM or less, 250 nM or less, 200 nM or less, 150 nM or less, 125 nM or less, 100 nM or less, or 75 nM or less. The concentration of the inhibitor used in the selective medium (which may also be gradually increased) determines the rigor of the selection conditions. Preferred concentration ranges for folic acid antagonists include 500 nM-0.1 nM, 350 nM-1 nM, 200 nM-2.5 nM, 150 nM-5 nM, 100 nM-7.5 nM, and 75 nM-10 nM. According to one embodiment, the selective culture medium includes MTX as a folic acid antagonist. Low MTX concentrations can be used in combination with the novel eukaryotic cells described herein for DHFR selection, especially when combined with limiting concentrations of folic acid.

[0093] According to one embodiment, the host cell provided in phase (a) of this disclosure includes a heteropolynucleotide encoding a folate transporter as a selection marker. Folate transporter-based selection systems offer several advantages when used in conjunction with folate-dependent eukaryotic cells, such as mammalian cells. Folate transporters can deliver at least one folate substance from the culture medium into the host cell, preferably a mammalian cell. According to one embodiment, the folate transporter is a reduced folate carrier (RFC) or includes an RFC. RFCs are broadly expressed membrane glycoproteins that act as major transporters for the uptake of reduced folates such as 5-methyl-THF and 5-formyl-THF into the cell. However, RFCs exhibit extremely weak affinity for oxidized folate and folate. Therefore, cells lacking RFC expression or with the RFC locus removed from their genome can act as recipients for transfection with the selection marker gene RFC, thereby enabling the identification of cells with increased expression levels of this folate transporter and the corresponding product of interest under conditions of stepwise removal of reduced folates such as 5-formyl-THF from the growth medium. When an RFC is used as a selection marker, the appropriate selection criteria are known to a person skilled in the art and described, for example, in WO2006 / 059323.

[0094] According to an embodiment detailed below and in the Examples section, the folate transporter used as the selection marker is a folate receptor. Folate receptor-based selection systems offer several advantages. For example, no toxic substances are required for selection (although they can be used), and the host cell's endogenous folate receptors do not need to be knocked out. Furthermore, this expression system works exceptionally well in conjunction with the novel cell types described herein, preferably mammalian cells.

[0095] As used herein, "folate receptor" refers to a functional folate receptor capable of introducing or taking up folate or its derivatives into eukaryotic cells. Preferably, the receptor is capable of unidirectionally introducing or taking up folate or its derivatives into eukaryotic cells. Furthermore, the folate receptor used herein is membrane-bound. Therefore, the folate receptor described herein is a functional membrane-bound folate receptor. For example, membrane anchoring can be achieved through a transmembrane anchor or a GPI anchor. A GPI anchor is preferred because it corresponds to the natural setting of the membrane-bound folate receptor. The folate receptor (FR) is a high-affinity folate-binding glycoprotein. It is encoded by three different genes, FRα, FRβ, and FRγ. FRα and FRβ are glycosylphosphatidylinositol (GPI)-anchored, cell surface glycoproteins, while FRγ lacks a GPI anchor and is a secreted protein. However, it can be genetically modified to include a transmembrane domain or a GPI anchor. Such a membrane-anchored modified FRγ is also considered a membrane-bound folate receptor, provided it can introduce or take up folate or its derivatives into eukaryotic cells. The term "folate receptor" also includes membrane-bound mutants of wild-type folate receptors that can take up folate, as well as fusion proteins containing the corresponding folate receptors.

[0096] The folic acid receptor used can be derived from folic acid receptors of any species, provided that it is functional within the scope of this invention, compatible with the host cells used, and capable of incorporating folic acid, especially folic acid, from the culture medium into folic acid-dependent host cells when expressed in transfected host cells. Generally, the folic acid receptor introduced into the host cell as a selection marker can be homologous to or heterologous to the host cell's endogenous folic acid receptor (preferably if an endogenous folic acid receptor is present). If homologous, it is derived from the same species as the host cell, preferably mammalian host cells. If heterologous, it is derived from another species besides the host cell. For example, the human folic acid receptor can be used as a selection marker for rodent host cells such as hamster cells, like CHO cells. It is preferred to use folic acid receptors derived from mammals, such as rodents like mice, rats, or hamsters, or more preferably from humans. The membrane-bound folic acid receptor used as a selection marker can be selected from folic acid receptor α, folic acid receptor β, and folic acid receptor γ. According to one embodiment, human folic acid receptor α is used as the selection marker.

[0097] Membrane-bound folate receptors are advantageous for use as folate transporters because cells that express their own folate receptors endogenously can be used and folate can be processed by the folate receptors. Suitable membrane-bound folate receptors and suitable selection conditions are also described in WO2009 / 080759, which describes folate receptors that can be used as selection markers for folate-dependent eukaryotic cells (such as mammalian cells), and this patent is incorporated herein by reference. According to one embodiment, a mature wild-type human folate receptor α is used, comprising the amino acid sequence shown in SEQ ID NO:20 below (1 letter code, shown in the direction from N-terminus to C-terminus).

[0098] Folate receptor α is naturally anchored to the cell membrane via a GPI anchor. The signal sequence of the GPI anchor is not shown in SEQ ID NO:20. According to one embodiment, folate receptor α derived from or including SEQ ID NO:20 contains a GPI anchor signal at the C-terminus. Any suitable GPI anchor signal can be used. The natural GPI anchor signal sequence of human folate receptor α is shown in SEQ ID NO:21 (1-letter code, shown in N-terminal to C-terminal direction).

[0099] Membrane anchoring can be further achieved using membrane anchors, such as transmembrane anchors. In this embodiment, the folic acid receptor includes a C-terminal membrane anchor. Suitable anchors are known in the prior art. Folic acid receptor α derived from or including SEQ ID NO:20 may include an N-terminal leader sequence. Any suitable leader sequence can be used to ensure functional expression of the folic acid receptor.

[0100] The complete amino acid sequence of the natural leader sequence (N-terminus) and natural GPI anchor signal sequence (C-terminus) of wild-type human folate receptor α is shown in SEQ ID NO:22 (1 letter code, shown in the direction from N-terminus to C-terminus).

[0101] According to one embodiment, the membrane-bound folic acid receptor has or includes the amino acid sequence of SEQ ID NO:20 or 22, or a functional variant thereof, having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% homology or identity with SEQ ID NO:20 or 22, and is membrane-bound and capable of taking folic acid uptake into cells.

[0102] When using eukaryotic cells that depend on folate uptake, such as mammalian host cells, and said cells include heterologous polynucleotides encoding folate transporters (preferably folate receptors), stage (b) includes a selection step in which these host cells are cultured in a selective medium containing a limiting concentration of folate. As used herein, “limiting concentration of folate” specifically refers to the concentration of folate (salt) in a selective medium that exerts selective pressure on the host cells. Under such selection conditions, only host cells incorporating expression vectors and thus expressing folate transporters as selection markers grow and proliferate. Therefore, the selective medium does not contain abundant folate, and the folate in the medium limits the selective pressure exerted on the host cells. The limiting concentration of folate contained in the selective medium can be absorbed and processed by the host cells, especially host cells incorporating folate transporters as selection markers. Folate that is not or cannot be processed by the host cells, and especially folate derivatives, do not affect the selective pressure applied to select host cells incorporating folate transporters as selection markers, and therefore do not affect the limiting concentration of folate. However, if the following DHFR combination selection is performed, the corresponding folate substance, such as a folate antagonist, may be present, and even preferably present. The limiting concentration of folate substance present in the selective medium can be, for example, an oxidized folate substance or a reduced folate substance or a derivative thereof. Oxidized folate substances, such as folic acid and folate reduced derivatives called reduced folate or tetrahydrofolate (THF), are vitamin B9 vitamins, which are essential cofactors and / or coenzymes for the biosynthesis of purines, thymidine, and certain amino acids in folate-dependent eukaryotic cells such as mammalian cells. THF cofactors are particularly critical for DNA replication and therefore for cell proliferation. Preferably, the limiting concentration of folate substance contained in the selective medium is folic acid. Suitable concentration ranges for providing the limiting concentration of folate substance are described below.

[0103] Folic acid transporter-based selection systems are based on the limited availability of folic acid (preferably folic acid) in cell culture media. Under selective culture conditions, host cells that fail to incorporate expression vectors and therefore cannot express sufficient amounts of folic acid transporters (preferably folic acid receptors) will die or exhibit growth defects compared to host cells that successfully incorporate expression vectors. As illustrated in the examples, combining folic acid receptor-based selection with the novel cell line described herein can accelerate the selection, screening, and establishment of cell clones that stably overexpress high levels of recombinant products of interest, such as peptides.

[0104] The selective culture medium used in stage (b), and in the sub-steps of stage (b), for selecting folate receptors as selection markers, may include folate substances, especially folate, at concentrations selected from:

[0105] (a) Approximately 5000 nM - 0.1 nM;

[0106] (b) Approximately 2500 nM - 0.1 nM;

[0107] (c) Approximately 1500 nM - 0.1 nM;

[0108] (d) Approximately 1000 nM - 0.1 nM;

[0109] (e) Approximately 750 nM - 0.1 nM;

[0110] (f) Approximately 500 nM - 0.1 nM;

[0111] (g) about 250 nM to 0.2 nM; preferably about 250 nM to 1 nM or about 250 nM to 2.5 nM;

[0112] (h) Approximately 150 nM - 0.3 nM; preferably approximately 150 nM - 1 nM or approximately 150 nM - 2.5 nM;

[0113] (i) Approximately 100 nM - 0.5 nM; preferably approximately 100 nM - 1 nM or approximately 100 nM - 2.5 nM;

[0114] (j) about 75 nM-0.6 nM, preferably about 75 nM-1 nM or about 75 nM-2.5 nM;

[0115] (k) Approximately 50 nM to 1 nM; preferably approximately 50 nM to 2.5 nM or approximately 50 nM to 5 nM;

[0116] (l) Approximately 35 nM - 0.75 nM; and

[0117] (m) Approximately 25nM-1nM or approximately 25nM-2.5nM, approximately 20nM-3nM, approximately 15nM-4nM or 10nM-5nM.

[0118] The concentrations and ranges described above are particularly suitable for rapidly growing mammalian cell suspensions such as CHO cells, which are preferred embodiments for commercially produced cell lines. However, different cell lines may have different folic acid consumption characteristics. Suitable concentrations, however, can be easily determined experimentally by a technician. The folic acid contained in the selective culture medium is preferably folic acid, and according to one embodiment, folic acid is the only folic acid contained in the selective culture medium that affects the limiting concentration of folic acid.

[0119] According to one embodiment, the host cells provided in stage (a) comprise a heteropolynucleotide encoding a folate transporter as a first selectable marker and a heteropolynucleotide encoding a second selectable marker, the second selectable marker being processed by substrates such as folate, folate derivatives, and / or products obtainable by folate treatment. For example, the second selectable marker may be dihydrofolate reductase (DHFR) or enzymes such as thymidine synthase (TS) and serine hydroxymethyltransferase (SHMT) that operate downstream of or in conjunction with DHFR. Preferably, a membrane-bound folate receptor is used as the first selectable marker and the second selectable marker is dihydrofolate reductase (DHFR). According to this embodiment, stage (b) comprises culturing the host cells in a selective medium comprising a limiting concentration of folate, preferably folate, and comprising at least one DHFR inhibitor such as MTX. As illustrated in the examples, when using the novel cell lines described herein, the number of highly and stably expressing cells in the library is significantly increased, simplifying the acquisition of stable cell clones from the cell library for large-scale production. Fewer cell clones need to be prepared, reducing screening efforts. Suitable embodiments of the folic acid receptor and DHFR, as well as suitable selection conditions and concentrations, are described above and refer to the above disclosures, which are equally applicable herein. The concentrations and concentration ranges of the aforementioned folic acid substance and folic acid antagonist can be combined with each other. In one embodiment, a folic acid substance concentration of about 0.1 nM-150 nM, 1 nM-125 nM, 5 nM-100 nM, or 7.5 nM-75 nM is used in combination with a folic acid antagonist concentration of 0.1 nM-150 nM, 1 nM-125 nM, 2.5 nM-100 nM, 5 nM-75 nM, or 7.5 nM-50 nM in a selective culture medium. As described, folic acid is preferably used as the folic acid substance and MTX is used as the folic acid antagonist.

[0120] Using a combination of folate receptor and DHFR as selection markers and applying selection conditions targeting both markers simultaneously in stage (b) with a suitable selective culture medium, a very rigorous selection system can be formed that efficiently enriches high-producing cells from a transfected host cell population. If both selection markers are strongly expressed, host cell viability increases significantly under the selection conditions. Therefore, eukaryotic cells, such as mammalian cells, exhibiting increased expression of the product of interest and dependent on folate uptake can be selected. The concept of combining the folate receptor as a selection marker with another selection marker involved in folate metabolism (such as preferably DHFR) is disclosed in WO 2010 / 097240, which is incorporated herein by reference. As shown in the examples, the high rigor of the selection system described in this embodiment can be advantageously combined with the novel cells described herein, especially when using mammalian cells. This combination further reduces the number of low-producing cells and results in a more uniform high-producing cell population after selection. This particularly simplifies single-cell cloning of stable-producing cells. Furthermore, this combination significantly reduces the MTX concentration required for DHFR selection.

[0121] According to one embodiment, two or more selection steps are performed in stage (b), wherein the two or more selection steps are based on the same or different selection principles. For example, if an additional selection marker is used in addition to the folate receptor and / or DHFR, the selection conditions for the additional selection marker can be applied before (e.g., in a pre-selection step) or concurrently with the application of the selection conditions for the folate receptor and / or DHFR. For example, in the case where the neomycin phosphotransferase gene (neo) is used as an additional selection marker, stage (b) may include first growing cells in a medium, for example, containing G418, to select cells for inclusion of an expression vector or a combination of at least two expression vectors, followed by a selection step with a selective medium containing a limiting concentration of folate and an inhibitor of the second selection marker, such as MTX when DHFR is used as the second selection marker.

[0122] According to one implementation, flow cytometry-based selection is performed in stage (b). The selection step using flow cytometry, particularly fluorescence-activated cell sorting (FACS), has the advantage of rapidly screening large numbers of cells for the desired characteristic expression yield.

[0123] According to one embodiment, in addition to one or more selection steps targeting one or more selection markers, the flow cytometry-based selection is preferably performed thereafter. Therefore, highly expressing cell clones can be identified and isolated from successfully transfected cell populations.

[0124] According to one embodiment, highly expressed cells are identified by detecting the expression of co-expressed reporter peptides such as green fluorescent protein (GFP), CFP, YFP, luciferase, or other common reporter peptides detectable by flow cytometry. According to this embodiment, stage (a) includes providing a plurality of host cells containing at least one heteropolynucleotide encoding a reporter, and stage (b) includes identifying the host cells expressing the reporter peptide using flow cytometry based on at least one characteristic of the reporter peptide. In this reporter-based selection, the expression of the reporter gene is associated with the expression of the product of interest. The reporter peptide may be located intracellularly, thereby labeling the expressing cells. According to one embodiment, the expression of the reporter peptide is closely linked to the expression of the product of interest, which is a polypeptide. For example, the reporter peptide and the peptide of interest may be expressed as separate polypeptides, but from the same expression cassette, separated by an IRES element (internal ribosome entry site). Furthermore, the reporter peptide and the peptide of interest may be expressed as a fusion protein. According to one embodiment, in the expression cassette expressing the peptide of interest, the polynucleotide encoding the peptide of interest is separated from the polynucleotide encoding the reporter by at least one stop codon. The fusion protein containing the reporter peptide is expressed only when the stop codon is read through. Since stop codon reading only occurs to a certain extent, which can be influenced by the number and design of the stop codons and culture conditions, a certain proportion of the peptide of interest is produced as a reporter peptide-containing fusion protein detectable by flow cytometry. Appropriate strategies can tightly link reporter peptide expression with the expression of the peptide of interest. The principle of obtaining the fusion protein by stop codon reading is explained below with reference to embodiments in which the fusion protein (not necessarily containing a reporter) is displayed on the cell surface and stained, for example, with a detection compound. To express the secretory peptide of interest, a polynucleotide encoding a membrane anchor may be additionally incorporated between the stop codon and the polynucleotide encoding the reporter or downstream of the polynucleotide encoding the reporter. The membrane anchor ensures that the reporter peptide remains bound to the expressing cell. Therefore, the reporter peptide contained in the fusion protein provides the expressing cell with properties selectable by flow cytometry. The peptide of interest is expressed in the culture medium. The higher the reporter peptide (e.g., its fluorescence), the more fusion protein is produced, and correspondingly, the higher the expression rate of the peptide of interest. For example, WO 03 / 014361 discloses a corresponding method.

[0125] According to one implementation, stage (b) includes:

[0126] (i) at least one selection is performed under selective conditions targeting one or more selection markers expressed by transfected host cells; and

[0127] (ii) Make selections based on flow cytometry.

[0128] Optionally, one or more other optional steps may be performed before or after step (i) and / or step (ii).

[0129] According to one embodiment, flow cytometry-based selection involves selecting multiple host cells expressing a polypeptide of interest at a desired yield, based on the presence or amount of the polypeptide of interest. The polypeptide of interest is preferably a secreted polypeptide. According to one embodiment, the polypeptide of interest is detected on the cell surface using a detection compound that binds to the polypeptide of interest. According to one embodiment, the secreted polypeptide of interest is detected when it crosses the cell membrane and thus briefly binds to the plasma membrane during polypeptide secretion. For example, a corresponding flow cytometry-based selection system is disclosed in cited WO03 / 099996.

[0130] According to one embodiment, a portion of the peptide of interest is fused to a membrane anchor and expressed as a membrane-bound fusion peptide. Thus, a portion of said peptide is displayed as a fusion peptide on the cell surface and can be stained with a detection compound. This type of selection does not require a report peptide, even if it is additionally available. Due to the presence of the membrane anchor, the peptide of interest is tightly anchored to the expressing cell. Since the amount of fusion peptide produced is related to the total expression rate of the expressing cell, host cells can be selected by flow cytometry based on the amount of fusion peptide displayed by the membrane anchor on the cell surface. This allows for rapid selection of high-yielding host cells. For efficient selection by flow cytometry (preferably FACS), it is advantageous to employ a specially designed expression cassette for expressing the peptide of interest. Therefore, according to one embodiment, a polynucleotide encoding the peptide of interest is included in the expression cassette, which is designed such that a portion of the expressed peptide of interest includes the membrane anchor. The peptide of interest with the fused membrane anchor is also referred to as a fusion peptide or fusion protein. Several options exist to achieve this result.

[0131] According to one implementation, the host cell provided in stage (a) includes

[0132] (i) Heterologous expression cassettes, including

[0133] aa) A polynucleotide encoding the polypeptide of interest.

[0134] bb) at least one stop codon downstream of the polynucleotide encoding the polypeptide of interest, and

[0135] cc) another polynucleotide downstream of the stop codon that encodes the membrane anchor and / or the membrane anchor signal;

[0136] and

[0137] (ii) at least one heterologous expression cassette, comprising a polynucleotide encoding a selection marker;

[0138] And the choice of stage (b) includes

[0139] (i) Host cells are cultured under selective conditions for at least one selectable marker and allowed to express a polypeptide of interest, wherein at least a portion of the polypeptide of interest is expressed as a membrane-anchored fusion polypeptide, wherein the fusion polypeptide is displayed on the surface of the host cells;

[0140] (ii) Perform flow cytometry-based selection, including selecting multiple host cells expressing the desired peptide at the desired yield based on the presence or amount of the fusion peptide displayed on the cell surface.

[0141] Transcription of the polynucleotide encoding the polypeptide of interest contained in the above expression cassette produces a transcript, which includes, in sequential order, at least

[0142] aa) a polynucleotide, wherein the translation of the polynucleotide produces a polypeptide of interest;

[0143] bb) at least one stop codon downstream of the polynucleotide;

[0144] cc) The polynucleotide downstream of the stop codon encodes membrane anchors and / or membrane anchor signals.

[0145] By translating through at least one stop codon, at least a portion of the transcript is translated into a fusion polypeptide containing the polypeptide of interest and a membrane anchor. The expression cassette design used in this embodiment has the effect that, through the translation readout process (stop codon "leakage"), a portion of the polypeptide of interest is produced as a fusion polypeptide containing a membrane anchor. Therefore, by translating through at least one stop codon, at least a portion of the transcript is translated into a fusion polypeptide containing the polypeptide of interest and a membrane anchor. Translation readout can occur naturally due to the selection of the stop codon / design of the translation termination signal, or it can be induced by changing culture conditions, for example, using a termination inhibitor. This readout level produces a certain proportion of fusion polypeptides. These fusion polypeptides include a membrane anchor that tightly anchors the fusion polypeptide to the cell surface. Therefore, the fusion polypeptide is displayed on the cell surface, and cells exhibiting high levels of membrane-anchored fusion polypeptides can be selected by flow cytometry, preferably FACS. Thus, host cells expressing the polypeptide of interest in high yields are selected. For details and preferred implementations of this technique based on stop codon readout, see WO2005 / 073375 and WO2010 / 022961, which are referenced herein.

[0146] According to one embodiment, the expression cassette further includes (iv) a polynucleotide encoding a reporter polypeptide such as GFP. The polynucleotide encoding the reporter polypeptide is located downstream of a stop codon. After readout of the stop codon, a reporter-containing fusion polypeptide is obtained, which can then be selected by flow cytometry based on reporter polypeptide characteristics (e.g., its fluorescence). Details of the embodiment are as described above and with reference to the disclosure above. Preferably, the polynucleotide encoding the reporter polypeptide is located downstream of a polynucleotide encoding a membrane anchor.

[0147] According to another embodiment, using the technique described in WO2007 / 131774, a portion of the polypeptide of interest is expressed as a fusion polypeptide displayed on the cell surface. Here, at least two different mature mRNAs (mRNA-polypeptide of interest) and (mRNA-polypeptide of interest-anchor) are obtained from the expression cassette encoding the polypeptide of interest through transcription and transcript processing. Translation of the mRNA-polypeptide of interest produces the polypeptide of interest. Translation of the mRNA-polypeptide of interest-anchor produces a fusion polypeptide containing both the polypeptide of interest and the membrane anchor. Thus, this fusion polypeptide is again displayed on the cell surface, and cells exhibiting high levels of the membrane-anchored fusion polypeptide can be selected by flow cytometry, preferably FACS. This also allows selection of host cells with high expression rates. According to one embodiment, the expression cassette additionally includes a polynucleotide encoding a reporter polypeptide such as GFP. The polynucleotide encoding the reporter polypeptide is located downstream of an intron. Thus, a fusion polypeptide containing a reporter polypeptide is obtained, which can then be selected by flow cytometry based on the reporter polypeptide's characteristics (e.g., its fluorescence). Preferably, the polynucleotide encoding the reporter polypeptide is located downstream of the polynucleotide encoding the membrane anchor. Therefore, the reporter is located within the host cell.

[0148] Both exemplary embodiments described above enable a subset of the polypeptide of interest to be expressed as a fusion polypeptide displayed on the surface of the host cell, and cells exhibiting high levels of membrane-anchored fusion polypeptides (indicating high levels of secreted polypeptides) can be selected, for example, by flow cytometry, particularly fluorescence-activated cell sorting (FACS). Different embodiments are possible. For example, if the reporter polypeptide is included in the fusion polypeptide, host cells with high expression can be selected based on the reporter polypeptide's characteristics (e.g., its fluorescence). Furthermore, as briefly described below, appropriately labeled detection compounds can be used.

[0149] According to one embodiment, stage (b) includes selecting multiple eukaryotic host cells expressing the polypeptide of interest at a desired yield using flow cytometry by contacting host cells with a detection compound that binds to the fusion polypeptide displayed on the cell surface, based on the presence or amount of the fusion polypeptide displayed on the cell surface, and selecting multiple host cells expressing the polypeptide of interest at a desired yield using flow cytometry based on the presence or amount of the bound detection compound. Thus, cells can be contacted with a detection compound appropriately labeled to bind the fusion protein (e.g., a portion corresponding to the polypeptide of interest). The detection compound for binding the fusion polypeptide may have at least one of the following characteristics: the compound may be labeled, especially fluorescently labeled; it may be an antigen; it may be an immunoglobulin molecule or its binding fragment; or it may be a protein-A,-G, or-L. For example, the detection compound for binding the fusion polypeptide on the cell surface may be an immunoglobulin molecule or its fragment, such as an antibody or antibody fragment that recognizes the fusion polypeptide. Almost all accessible portions of the fusion polypeptide can be detected, thereby also detecting portions of the polypeptide of interest secreted in parallel with the fusion polypeptide in a soluble form. The detection compound for binding the fusion polypeptide may be labeled for detection and selection. Therefore, labeled detection compounds that bind to the fusion peptides displayed on the cell surface can label and stain the cell surface accordingly. The higher the amount of fusion peptide expressed by the host cell, the more labeled detection compounds bind and the stronger the staining. This has the advantages that flow cytometry-based host cell selection is easy because the presence and amount of the bound detection compounds can be measured. To select high-yielding host cells, these host cells can be selected from the host cell population that is most effective and most strongly labeled by the detection compounds. The labeling is suitable for flow cytometry-based selection, especially FACS selection. Fluorescent labeling is preferred because it can be easily detected by flow cytometry.

[0150] According to one embodiment, an expression cassette is constructed to obtain approximately ≤50%, ≤25%, ≤15%, ≤10%, ≤5%, ≤2.5%, ≤1.5%, ≤1%, or less than ≤0.5% of the fusion polypeptide. The remaining portion is produced as a secretory polypeptide without a membrane anchor.

[0151] The membrane anchor can be of any type, as long as it anchors the peptide of interest to the cell membrane and thus allows the fusion peptide to be displayed on the cell surface. Suitable embodiments include, but are not limited to, GPI anchors or transmembrane anchors. Transmembrane anchors are preferred to ensure that the fusion peptide binds tightly to the cell surface and prevents the fusion protein from detaching. Immunoglobulin transmembrane anchors are particularly preferred, especially when the antibody expresses the peptide of interest. Preferred embodiments of other membrane anchors and immunoglobulin transmembrane anchors are described in WO2007 / 131774, WO2005 / 073375, and WO 2010 / 022961.

[0152] According to one embodiment, a host cell expresses an immunoglobulin molecule (such as an antibody) as a polypeptide of interest. As described above in conjunction with the first aspect, the polynucleotide encoding the heavy chain of the immunoglobulin molecule and the polynucleotide encoding the light chain of the immunoglobulin molecule may be included in the same expression cassette, or preferably in separate expression cassettes. When using the expression cassette designed as described above, a portion of the polypeptide of interest is produced as a membrane-anchored fusion polypeptide by translational readthrough or alternative splicing; this type of design is used for expressing the antibody heavy chain.

[0153] According to one implementation, two or more flow cytometry-based selection cycles may be performed in phase (b) to select and enrich highly expressed host cells.

[0154] In one embodiment, host cells expressing high levels of the polypeptide of interest and correspondingly exhibiting high signal intensity are sorted using fluorescence activated cell sorting (FACS). FACS sorting is advantageous because it allows for rapid screening of large numbers of host cells to identify and enrich those expressing the polypeptide of interest in high yields. This embodiment is particularly suitable if cells are selected based on the expression of the aforementioned fusion protein. Cells exhibiting the highest fluorescence intensity can be identified and isolated by FACS. A positive and statistically significant correlation was found between the fluorescence measured by FACS and the amount of polypeptide produced. Therefore, FACS sorting can not only be used for qualitative analysis to identify cells expressing the polypeptide of interest, but also quantitatively to identify host cells expressing high levels of the polypeptide of interest. Thus, the optimal producing cells can be selected / enriched in stage (b).

[0155] According to one implementation, cells expressing the polypeptide of interest at a desired yield are selected as a library, for example, host cells with yields above a certain threshold and / or in the top 15%, top 10%, top 5%, or top 2%. For example, several highly expressive cells can be selected and sorted into the cell library in stage (b): at least 10, at least 20, at least 30, at least 50, at least 100, at least 200, at least 300, at least 500, at least 1000, or at least 5000 highly expressive cells. A cell library containing multiple different highly expressive cells is also referred to as a highly expressive cell library. The cell library containing highly expressive cells from different individuals can then be used to obtain individual cell clones for large-scale production of the polypeptide of interest.

[0156] According to one embodiment, the eukaryotic cells provided in stage (a) are mammalian cells, preferably rodent cells, and more preferably hamster cells such as CHO cells. Suitable and preferred embodiments are as described above in conjunction with the first aspect and with reference to the above disclosure. As described above, according to one embodiment, the CHO cells have lost a portion of the chromosome 8 telomere region, wherein the lost portion includes the gene FAM60A. Alternative embodiments are also as described above. These cells have particularly advantageous characteristics in terms of yield and stability. According to one embodiment, the method of the second aspect includes the step of analyzing whether the expression of the gene FAM60A is reduced or eliminated. This analysis can be performed after selection, especially DHFR selection. Details of this analytical method are as described above in conjunction with the first aspect of this disclosure, and also as described below in conjunction with the method of the fifth aspect and with reference to the corresponding disclosure.

[0157] Other preferred embodiments specifically relating to the eukaryotic cells, preferably mammalian cells, expression vectors, or combinations thereof described in the first aspect are detailed above. Refer to the disclosure above.

[0158] Cells obtained through the selection method described in the second aspect can be isolated and cultured into individual cells. However, enriched populations of different host cells, i.e., cell banks, can also be used in downstream processes. The resulting host cells can also undergo additional qualitative or quantitative analysis, or can be used, for example, to develop clonal cell lines for protein production. Clonal cell lines can be established from selected host cells that stably express products of interest in high yields.

[0159] Therefore, according to one embodiment, selected cells are cultured to provide cell clones, particularly in the form of clonal cell cultures. A clonal cell culture is a cell culture derived from a single progenitor cell. In a clonal cell culture, all cells are clones of each other. Preferably, all cells in the cell culture contain the same or substantially the same genetic information. In some embodiments, the amount or concentration of the polypeptide of interest in the cell culture is determined to determine productivity. For example, titer can be measured by analyzing the culture supernatant. According to one embodiment, after determining the productivity performance of the respective individual clones, titer ranking is performed to select the best producing clone as the producing clone. Furthermore, stability studies can be performed using the resulting cell clones. However, as shown in the examples, using the novel cells described herein as host cells can provide recombinant cell clones showing significantly improved stability after selection. Therefore, loss of expression stability is rare when using the corresponding host cells, and if it occurs, it typically results only in a less drastic decrease in productivity compared to cells where the functional expression of genes C12orf35 and FAM60A is not reduced or eliminated. As a result, stability analysis can be shortened or even skipped, which is an important advantage because it reduces the time required to obtain stable cell clones that can be used for large-scale production of the product of interest.

[0160] C. Methods for producing products of interest

[0161] According to the third aspect, a method for producing a recombinant product of interest is provided, comprising using the eukaryotic cells described in the first aspect as host cells to recombinantly express the product of interest.

[0162] As described above, the novel eukaryotic cells provided herein are particularly suitable as production host cells for the recombinant production of products of interest, such as peptides of interest. Suitable and preferred embodiments of the eukaryotic cells and suitable and preferred embodiments of the products of interest are detailed above and referenced to the corresponding disclosures, which are equally applicable herein, wherein the effect of protein FAM60A in the cells is impaired, preferably by reducing or eliminating the functional expression of gene FAM60A. As described above, the eukaryotic cells are preferably vertebrate cells, more preferably mammalian cells. It is particularly advantageous that, in addition to FAM60A, the effect of gene C12orf35 expression products is also impaired, for example, by reducing or eliminating the functional expression of gene C12orf35, as productivity has been found to be significantly improved thereby. By weakening the effects of proteins FAM60A and C12orf35, mammalian host cells exhibiting improved characteristics involving two properties—long-term stability and productivity—can be provided, which are therefore key characteristics important for the large-scale production of products of interest, especially peptides of interest.

[0163] Preferably, the eukaryotic host cell is a mammalian cell containing a polynucleotide encoding a product of interest that is stably integrated into the genome. As described above, the introduction of the polynucleotide can be achieved through stable transfection. Selection of successfully transfected cells can be accomplished using the method described in the second aspect.

[0164] According to one embodiment, the method includes

[0165] (a) Culture the host cells described in the first aspect under conditions that allow for the expression of the product of interest;

[0166] (b) Isolating the product of interest from the cell culture medium and / or the host cells; and

[0167] (c) The separated product of interest may be optionally processed.

[0168] According to one embodiment, the host cells are cultured under serum-free conditions. The expressed product of interest can be obtained by disrupting the host cells. The product of interest is preferably a polypeptide. The polypeptide is preferably expressed, for example, secreted into a culture medium, and obtainable therefrom. For this purpose, a suitable leader peptide is provided in the polypeptide of interest. Leader sequences and expression cassette designs for achieving secretion are well known in the art. Combinations of corresponding methods are also feasible. Thus, polypeptides, such as proteins, can be efficiently produced and obtained / isolated in high yields.

[0169] The produced product of interest (preferably a polypeptide) can be recovered, further purified, separated, processed, and / or modified using methods known in the art. For example, the polypeptide can be recovered from a nutrient medium using routine procedures, including but not limited to centrifugation, filtration, ultrafiltration, extraction, or precipitation. Other processing steps, such as purification steps, can be performed using a variety of processes known in the art, including but not limited to chromatography (e.g., ion exchange, affinity, hydrophobicity, chromatographic focusing, and size exclusion), electrophoresis (e.g., preparative isoelectric focusing), differential solubility (e.g., ammonium sulfate precipitation), or extraction. Furthermore, the separated and purified product of interest can be further processed, for example, formulated into compositions such as pharmaceutical compositions.

[0170] D. Methods for producing eukaryotic cell lines

[0171] According to the fourth aspect, a method for producing eukaryotic cells suitable for recombinant production of a product of interest is provided, comprising attenuating the effect of the protein FAM60A in eukaryotic cells by altering the cell genome and stably transfecting the cells with at least one expression vector comprising a polynucleotide encoding the product of interest. Suitable and preferred embodiments for achieving this result are as described above in conjunction with the eukaryotic cells of the first aspect, and reference is made to the above disclosure, which is equally applicable herein. Non-limiting embodiments are also briefly described below.

[0172] According to one embodiment, the method includes altering the eukaryotic cell genome to reduce or eliminate the functional expression of the gene FAM60A in the cell, thereby weakening the effect of the protein FAM60A in the cell. Suitable methods are described above, in conjunction with and referring to the eukaryotic cells described in the first aspect of this disclosure.

[0173] For example, gene knockout can be introduced into the FAM60A gene. According to one embodiment, if more than one copy exists, this gene knockout is introduced into all copies of the FAM60A gene. According to one embodiment, the FAM60A gene is deleted. If more than one copy exists, all copies of the FAM60A gene can be deleted from the genome. According to one embodiment, the method includes deleting a portion of the chromosome, wherein the deleted portion includes the FAM60A gene. The deleted portion may correspond to a telomere region. However, due to gene rearrangement, the region may also be located in a different region of the chromosome. This deletion can be induced, for example, by using an agent that induces chromosome breakage. Here, the cells can be repeatedly treated with this agent to obtain cells in which the functional expression of the FAM60A gene is reduced or eliminated, for example because all copies of the gene are deleted due to induced chromosome breakage.

[0174] According to one embodiment, the eukaryotic cell is a metazoan cell, preferably a vertebrate cell, and more preferably a mammalian cell. According to one embodiment, the mammalian cell is a rodent cell. Preferably, the rodent cell is a Chinese hamster cell, such as a CHO cell, or a CHO cell derived from CHO-K1. According to one embodiment, the method includes deleting at least a portion of the telomere region of chromosome 8 in a hamster cell, wherein the deleted portion includes the FAM60A gene. As illustrated in the examples, CHO cells containing the corresponding deletion in the telomere region of chromosome 8 (here, the q-arm) have particularly advantageous expression characteristics and are therefore particularly suitable as host cells for recombinant production. According to one embodiment, the deleted telomere region includes the FAM60A gene and one or more genes selected from Caprin2, Ipo8, and RPS4Y2. According to one embodiment, the deleted region additionally includes at least a portion or all of the Tmtc1 gene. According to one embodiment, the method includes deleting at least a corresponding portion of the telomere region of the two chromosomes of chromosome pair 8. The unrestricted sex designations of the aforementioned individual genes and / or encoded proteins are also shown in Table 1 above, and they, along with homologs and orthologs, are all covered within the scope of the terminology used above for individual genes.

[0175] As mentioned above, the telomere region of mouse chromosome 6 corresponds to the telomere region of Chinese hamster chromosome 8. Therefore, the above disclosure regarding the telomere region of hamster chromosome 8 applies accordingly to the telomere region of mouse chromosome 6.

[0176] According to one embodiment, the method includes inducing chromosome breakage in the telomere region of chromosome 8 in the hamster genome (or chromosome 6 in the mouse genome), wherein the breakpoint on chromosome 8 (or chromosome 6 in the mouse genome) is located at the centromere of the FAM60A gene, the Caprin2 gene, the Ipo8 gene, or the RPS4Y2 gene. Therefore, all genes present at their telomere ends, i.e., all genes further located in the telomere terminal direction, are deleted. The aforementioned individual genes, as well as the non-restricted sex designations of homologs and orthologs, are also shown in Table 1 above, and the terminology used above for individual genes and / or proteins encompasses the corresponding genes and their encoded proteins. According to one embodiment, the resulting cells containing telomere chromosome breaks have one or more of the following characteristics:

[0177] a) The breakpoint is located at the centromere of the Ipo8 gene;

[0178] b) The breakpoint is located within the Tmtc1 gene.

[0179] As described above, all genes located at the breakpoint at the telomere terminus, i.e., further into the telomere end, are deleted. This includes the gene FAM60A. Methods for identifying corresponding mammalian cells with such breakpoints are as described above and are further described below in conjunction with the fifth aspect of this disclosure. According to one embodiment, the Ergic2 gene is not deleted.

[0180] According to one embodiment, a modified mammalian cell line (preferably derived from cell line K1) is used to impair the production of protein FAM60A (preferably by reducing or eliminating the functional expression of gene FAM60A). According to one embodiment, the telomere region of chromosome 8q arm containing gene FAM60A is missing. Details regarding how to achieve this result are known to those skilled in the art, and suitable embodiments are also described herein and referenced to the disclosures. Particularly advantageous are embodiments in which the effect of gene C12orf35 expression product in the cells is further impaired, for example, by reducing or eliminating the functional expression of gene C12orf35, because productivity has been found to be significantly improved as a result. Therefore, according to one embodiment, the method of the fourth aspect additionally includes weakening the effect of gene C12orf35 expression product in the cells. Methods preferably achieved by reducing or eliminating the functional expression of gene C12orf35 are as described above and referenced to the corresponding disclosures. Mammalian host cells altered to impair the effects of both FAM60A and C12orf35 in the cells have particularly advantageous expression characteristics. Therefore, providing mammalian host cells exhibits improved characteristics involving two properties: long-term stability and productivity, which are thus key properties important for the large-scale production of products of interest, especially peptides of interest.

[0181] According to one embodiment, the method of the fourth aspect includes introducing at least one polynucleotide encoding a product of interest and preferably at least one polynucleotide encoding a selection marker into eukaryotic cells in which the expression of the gene FAM60A is reduced or eliminated. According to one embodiment, the polynucleotide encoding the product of interest and the polynucleotide encoding the selection marker are located in the same or separate expression vectors. Suitable and preferred embodiments are described above and refer to the corresponding disclosures that are equally applicable herein. The expression vector is integrated into the host cell genome, thereby providing stably transfected cells. Host cells successfully transfected and expressing the product of interest can be selected using the method of the second aspect. Refer to the above disclosures.

[0182] E. Methods for analyzing eukaryotic cells

[0183] According to the fifth aspect, methods are provided to analyze the suitability of eukaryotic cells as host cells for recombinant expression of a product of interest, including directly or indirectly analyzing whether the function of the FAM60A gene expression product is impaired in the cells. As mentioned above, the eukaryotic cells are preferably mammalian cells.

[0184] This analytical method can be advantageously used, for example, in conjunction with the method described in the fourth aspect of this disclosure, to identify eukaryotic cells with impaired FAM60A protein production. Furthermore, the method can be used to distinguish between stable and unstable clones during selection / screening. In several embodiments, this method can also be used to distinguish between high-yielding and low-yielding clones. By using this analytical method, clones with advantageous expression characteristics can be identified early in the selection process. This increases the probability of selecting stable and high-yielding clones, resulting in a higher proportion of high-yielding and stable-producing clones. Therefore, this analytical method has important applications and further improves recombinant expression technology because it reduces the time required to identify suitable producing clones.

[0185] According to a preferred embodiment, the method includes analyzing whether the functional expression of gene FAM60A in the cells is reduced or eliminated. The analysis regarding whether the functional expression of gene FAM60A is reduced or eliminated can be performed directly or indirectly. Non-limiting embodiments are described below. The appropriate analytical method also depends on how the cells are altered to achieve a reduction or elimination of the functional expression of the endogenous gene FAM60A.

[0186] For example, when knocking out the FAM60A gene to reduce or eliminate its expression, the corresponding DNA segment can be amplified and the amplified DNA sequenced to confirm that the gene knockout has been introduced into the FAM60A gene. If the functional expression of the FAM60A gene is reduced or eliminated by complete or partial deletion of the gene, the deletion can be detected at the DNA level, for example using appropriate amplification-based detection methods (such methods are known to those skilled in the art).

[0187] According to one implementation, the expression distribution in eukaryotic cells is analyzed to determine whether the functional expression of the gene FAM60A is reduced or eliminated. For example, the analysis may include performing qualitative or quantitative RT (reverse transcription) PCR to detect the presence, deletion, amount, or length of FAM60A mRNA. This would be an example of a direct analysis, as it directly involves the transcript of the gene FAM60A. Indirect analysis, in which the expression status of the gene FAM60A is indirectly determined by analyzing the expression distribution of genes other than FAM60A and where this analysis therefore does not directly involve analyzing the gene FAM60A or its transcript, is also suitable and is therefore covered by the term "analysis of whether the functional expression of the gene FAM60A is reduced or eliminated." For example, if a chromosomal portion containing the gene FAM60A (and other genes) is missing due to chromosome breakage, this indirect analysis is suitable and will be described subsequently. For quantitative analysis, comparison with a reference (such as an unaltered corresponding cell) is possible.

[0188] According to one embodiment, the effects of the endogenous gene C12orf35 expression product in the cells are further analyzed, either directly or indirectly. This can be analyzed by determining whether the functional expression of gene C12orf35 in the cells is reduced or eliminated. This analysis can be performed in comparison to that described for gene FAM60A. Refer to the above discussion.

[0189] According to one embodiment, prior to analysis, cells are treated with a chromosome-breaking agent to delete the chromosomal portion containing the FAM60A gene. As described above, all copies of the FAM60A gene can thus be deleted. The analysis can then include analyzing whether treatment with the agent results in the deletion of the chromosomal portion containing the FAM60A gene. Cells are treated with a chromosome-breaking agent at an appropriate concentration, thereby causing chromosome breakage. Here, several rounds of treatment may be performed. Chromosomal breakage can be induced during a selection process if the selection involves using a chromosome-breaking agent at a sufficiently high concentration. A non-limiting example of a suitable agent is, for example, MTX. In this case, in order to survive under MTX treatment, the cells may include a heteropolynucleotide encoding DHFR as a selection marker. However, as discussed above, other agents such as hygromycin can also be used, and this has been confirmed by examples.

[0190] After cells are treated to induce chromosome breakage, the resulting cells can be analyzed using the method described in the fifth aspect to determine whether treatment with the reagent resulted in the deletion of a chromosomal portion containing the gene FAM60A. Different implementations are suitable for this purpose. According to one implementation, the expression distribution of the treated cells is analyzed. For example, the expression of the gene FAM60A or one or more genes located at the centromere of the gene FAM60A (i.e., the telomere segment within the chromosome) can be analyzed. For example, in the case of mouse or Chinese hamster cells, the expression of the gene FAM60A can be analyzed, and accordingly, if its mRNA is detectable (an example of direct analysis), and or further, whether one or more genes selected from Caprin2, Ipo8, Tmtc1 or genes located at the telomeres of the aforementioned genes are expressed by the cells (an example of indirect analysis). The non-restrictive sex designations of the aforementioned individual genes are also shown in Table 1 above, and the terminology used above for individual genes and coding products encompasses the corresponding genes. If the induced breakpoint is located at the centromere of the corresponding gene, the deletion of the gene eliminates or reduces its expression (if other expressed gene copies are present elsewhere). Figure 1As observed, the gene FAM60A is located at the telomere end of the aforementioned gene. Therefore, if the aforementioned gene is deleted, the deleted region also includes the gene FAM60A. Thus, the aforementioned gene can be effectively used as a marker to substantially indirectly determine whether induced chromosome breakage causes the deletion of the gene FAM60A and thus leads to a reduction or elimination of FAM60A expression. Therefore, analyzing whether the expression of the gene FAM60A is reduced or eliminated does not necessarily rely on, for example, direct analysis of FAM60A mRNA, and the method in the fifth aspect also covers such indirect methods. Furthermore, it was found that even at the telomere end of the gene FAM60A (i.e., further down towards the telomere terminus), genes such as C12orf35 and Bicd1 can be used as markers to determine whether chromosome breakage causing the deletion of the gene FAM60A is induced. Combined with analysis of Chinese hamster cells such as CHO cells, it was found that if the genes Bicd1 or C12orf35 are deleted due to chromosome breakage, the deleted telomere region usually also includes FAM60A. Analysis of the expression characteristics of hundreds of clones confirmed that the above genes can be effectively used as markers to distinguish cell clones with high and stable expression characteristics from cell clones with low and unstable expression characteristics. Figure 2 This shows the relative expression of the above genes in CHO cells.

[0191] According to one embodiment, the method of the fifth aspect is used to analyze hamster cells, preferably CHO cells, and the method includes analyzing whether the expression of the gene FAM60A in the cells is reduced by analyzing whether the expression of one or more genes located in the telomere region of chromosome 8 and selected from the Tmtc1 gene and genes located at the telomere end of the Tmtc1 gene is reduced or eliminated in the cells. As described above, after treatment with a reagent that introduces chromosome breakage, the corresponding cells that no longer express the Tmtc1 gene and / or genes located at the telomere end of the Tmtc1 gene typically include a deletion in the telomere region of chromosome 8, which includes the gene and, in particular, the FAM60A gene. Loss of genetic material at the telomere end of the breakpoint.

[0192] According to one embodiment, selected host cells having the above-described characteristics are transfected with an expression vector comprising at least one polynucleotide encoding a product of interest and preferably comprising at least one selection marker. Suitable embodiments are as described above in conjunction with other aspects and with reference to the foregoing disclosure.

[0193] According to one embodiment, prior to analysis using the method described in the fifth aspect, the eukaryotic cells are transfected with at least one heteropolynucleotide encoding a product of interest and at least one heteropolynucleotide encoding a selection marker, and at least one selection step is performed prior to analysis to identify successfully transfected host cells. Suitable embodiments are detailed above. According to one embodiment, selection involves the use of a screening agent that induces chromosome breakage. In this embodiment, the selection marker may be DHFR, and the screening agent may be MTX. Alternatively, the screening agent may be hygromycin, and the selection marker may be a gene conferring resistance to hygromycin, such as the hph gene. In these applications of the method performed during or after the selection process, the method described in the fifth aspect can be used as an analytical tool to identify cells within a selected cell population where the functional expression of the gene FAM60A is reduced or eliminated. As described, such reduction or elimination may be caused or supported by selection conditions, such as if induced chromosome breakage results in the deletion of the gene FAM60A, and the method described in the fifth aspect can identify these cells, for example, based on their expression distribution. This allows for the identification of cells or cell clones particularly suitable for establishing recombinant production cell lines due to their expression distribution, especially due to reduced or eliminated functional expression of the FAM60A gene, as high expression of the product of interest can be expected to remain stable. This is especially true because if the FAM60A gene is lost, the C12orf35 gene is also lost, and as described herein, this significantly increases expression yield. As described, in the case of hamster cells such as CHO cells, where the FAM60A gene is located in the telomere region of chromosome 8, cells preferably lose the telomere region of chromosome 8 (preferably the q-arm), thereby reducing or eliminating the expression of the FAM60A gene. The aforementioned analytical method can be performed after cell clones are generated from cells contained in the high-expressing cell population. According to one embodiment, multiple cell clones are analyzed to distinguish between stable and unstable and / or high-yielding and low-yielding cell clones.

[0194] According to one embodiment, the method of the fifth aspect includes selecting at least one cell for recombinant expression of a product of interest, preferably a polypeptide of interest, wherein the selected cell has impaired function of the gene FAM60A expression product, preferably impaired by reduced or eliminated functional expression of the gene FAM60A. As illustrated in the examples, cells with the corresponding characteristics are particularly suitable for recombinant expression. Other embodiments of the corresponding cells are also detailed above. As stated, vertebrate cells are preferred as eukaryotic host cells, such as mammalian cells being the most preferred.

[0195] F. Using altered eukaryotic cells to recombinantly produce products of interest

[0196] According to a sixth aspect, this disclosure relates to the use of isolated eukaryotic cells for recombinant expression of a product of interest, wherein the eukaryotic cell genome is altered, thereby impairing the effect of the protein FAM60A in the cells. Details regarding the corresponding altered eukaryotic host cells and implementation methods are detailed above and refer to the foregoing disclosure, which is equally applicable herein, and the implementation methods are adapted to achieve impaired effect of the gene FAM60A in the cells, preferably by reducing or eliminating the functional expression of the gene FAM60A. Non-limiting embodiments are briefly described below.

[0197] The eukaryotic cells may be selected from metazoan, vertebrate, or mammalian cells. The eukaryotic cells are preferably mammalian cells, such as rodent cells. CHO cells are preferred. As detailed above, the eukaryotic cell genome can be altered. According to one embodiment, additionally, the effect of the gene C12orf35 expression product in the cells is impaired, preferably by reducing or eliminating the functional expression of the endogenous gene C12orf35. Details and related advantages of this embodiment are detailed above and refer to the disclosure above.

[0198] According to one embodiment, the product of interest is a polypeptide. Preferably, the polypeptide of interest is expressed in eukaryotic cells and then secreted into a cell culture medium. Details regarding the polypeptide of interest are as described above and with reference to the corresponding disclosures. To express the product of interest, the eukaryotic host cell can be stably transfected with an expression vector comprising a polynucleotide encoding the polypeptide of interest. Details are as described above and with reference to the disclosures above. Preferably, the eukaryotic host cell described in the first aspect is used as a eukaryotic host cell. The cell is as detailed above and with reference to the disclosures above.

[0199] The numerical ranges described herein include the numbers that define the ranges. The headings provided herein do not limit the various aspects or embodiments of this disclosure, which should be understood in its entirety with reference to the specification. According to one embodiment, the subject matter described herein as containing certain elements also refers to the subject matter composed of those elements. In particular, the polynucleotides described herein as containing certain sequences may also be composed of those sequences. Preferred embodiments described herein are preferably selected and combined, and specific subject matter resulting from combinations of corresponding preferred embodiments also falls under this disclosure.

[0200] This application claims priority to a prior U.S. Provisional Application filed on December 20, 2013 (application number US61 / 919340), the full disclosure of which is incorporated herein by reference.

[0201] Example

[0202] The following examples are used to illustrate the invention and are not intended to limit its scope in any way. The examples specifically relate to preferred embodiments of the invention.

[0203] Example 1: Knockout of FAM60A in CHO cells using TALEN technology

[0204] Two cell clones containing a knockout mutation of the FAM60A gene were prepared based on CHO cells derived from the CHO-K1 cell line. TALEN (transcription activator-like effector nuclease) technology was used to generate the FAM60A mutant cells. The coding region of the FAM60A gene (presumed exon 1) was targeted to knock out FAM60A. The CHO-K1 cells used as parental cells contain only one copy of FAM60A. Therefore, a single knockout in each cell was sufficient to attenuate the effect of FAM60A in the cells.

[0205] 1. Design, production, and application of FAM60A specific TALEN

[0206] Genomic DNA exon sequences targeting the following CHO parental cell line gene FAM60A:

[0207] atgtttggttttcacaagccaaagatgtaccgaagtatagagggctgctgtatctgcagagccaagtcctccagctctcggttcacggacagtaaacgttatgaaaaggacttccagagctgttttgg (SEQ ID NO: 23)

[0208] Nucleotides at the TALEN binding sites are marked in bold. Two TALENs targeting the FAM60 coding sequence (SEQ ID NO:23) were designed. As shown in SEQ ID NO:23 above (and also in Table 2, which further shows the primer sequences used for subsequent identification of the knockout), TALEN TAL-L targets and binds to 25 labeled nucleotides on the 5' (forward) DNA strand of the FAM60A gene, and TALEN TAL-R targets and binds to 25 labeled nucleotides on the 3' (reverse) DNA strand. The two binding sites are separated by 16 nucleotides at the cleavage site. Plasmids encoding two TALENs (TAL-L and TAL-R) were obtained.

[0209] Table 2: TALEN target sequences and primer sequences for FAM60A gene knockout

[0210]

[0211] The partial genomic DNA sequence of gene FAM60A covers the targeted coding sequence shown in SEQ ID NO:23 and extends to the primer binding sites of primers 1, 2 and 4, which are located within the intronic region shown in SEQ ID NO:30.

[0212] 2. Transfection with TALEN plasmid

[0213] Parental CHO cells in the exponential growth phase with viability exceeding 95% and 5 μg of the corresponding TALEN plasmid were used for transfection, which was performed using standard transfection procedures involving electroporation.

[0214] 3. Cel-I assay and cell sorting

[0215] The Cel-I assay was performed according to the SAFC Bioscience manual. The Cel-I assay is a standard assay for determining cleavage efficiency. In short, after several days of culture, genomic DNA was isolated from the cells and PCR was performed using primers 1 and 2 (see Table 2). The amplification products were denatured and annealed. Subsequently, nuclease S and nuclease S enhancer were added and incubated. The digestion products were analyzed. The presence of two smaller bands indicates TALEN activity within the genomic region if TALEN activity is observed, thus supporting the presence of FAM60A gene knockout cells in the analyzed cell bank. From the positive cell bank, single cells were sorted in 96-well plates by limiting dilution.

[0216] 4. Screening Strategy

[0217] Genomic DNA (gDNA) was extracted from each clone in a 96-well plate. gDNA was analyzed using standard procedures to identify knockout clones via PCR analysis. Primers 3 and 4 (see Table 2) were used for this purpose. In cases of cleavage region mutations, primer 3 did not bind, thus producing no PCR product. The PCR products obtained from sequencing PCR using positive clone gDNA with primers 1 and 2 (see above) were sequenced to analyze the introduced mutations.

[0218] Two cell clones with knockout mutations were obtained: FAM60A_ko_s16 (s16) with a 14-nucleotide deletion and FAM60A-ko_s23 (s23) with a 5-nucleotide deletion. The mutated sequences of the cell clones are shown in Table 11. Each deletion caused a frameshift. Due to the frameshift within the FAM60A target sequence, a stop codon was provided within the reading frame (highlighted in Table 3 by italics and underlined nucleotides). Therefore, the resulting FAM60A knockout clones are expected to express abnormally short and less functional or nonfunctional FAM60A expression products.

[0219] Table 3: DNA sequences of FAM60A speculative exon 1 in CHO wild-type (WT-derived from CHO-K1) and two knockout cell clones (s16 and s23) derived from the aforementioned WT. Nucleotides at TALEN binding sites are highlighted in bold, while nucleotides at premature stop codons are highlighted in italics and underlines.

[0220]

[0221] 5. Stability Analysis

[0222] The parental WT cell line from which the FAM60A knockout clone was obtained and the resulting FAM60A knockout cells were stably transfected with expression vectors encoding antibodies as peptides of interest. The transfected expression vectors comprised expression cassettes containing polynucleotides encoding neomycin phosphotransferase as a selectable marker, expression cassettes encoding DHFR as a selectable marker, expression cassettes containing polynucleotides encoding the antibody light chain, and expression cassettes containing polynucleotides encoding the antibody heavy chain, thereby expressing the complete antibody from the expression vectors. All expression cassettes in the expression vectors were oriented in the same direction. The expression cassette for the heavy chain was designed so that a portion of the heavy chain was expressed as a membrane-anchored fusion peptide due to stop codon readthrough. The fusion protein was displayed on the cell surface, thus simplifying FACS analysis (see description). Cells transfected for recombinant expression were selected using G418 and MTX (1 μM). Cell clones expressing the product of interest in good yield were obtained from selected libraries of stable transfected cell lines (CHO WT, s16, and s23) and cultured for several weeks (7 weeks for the WT CHO parental cell line (45 clones) and 8 weeks for FAM60A knockout cells (13 clones of s16 and 18 clones of s23)) to analyze their expression stability during long-term culture. To ensure that the production cell lines could be scaled up to high-capacity bioreactors, a 12-week stability study was also performed, with additional analysis of expression stability during the 12-week culture period. Clones that lost more than 25% of their initial volumetric expression titer during the stability analysis period were classified as unstable. Within the typical range of variation, some clones were exactly at or below the 25% threshold. For the parental cell lines, the proportion of unstable clones was higher at 7 / 8 weeks than at 12 weeks, which can be explained by the change in clone productivity testing approaching the 25% threshold.

[0223] Table 4 compares the stability results obtained using cell lines. It is evident that the percentage of clones with stable volume titers in the FAM60A knockout cell lines was significantly higher than that in clones derived from wild-type cell lines. This demonstrates that weakening the effect of endogenous FAM60A in cells (here, by introducing gene knockout) can significantly improve stability results during long-term culture. When using the cells of the present invention, the ratio of stable to unstable clones is significantly increased, resulting in more stable clones that maintain their advantageous high expression characteristics during long-term culture. In this example, the recombinantly expressed antibody is non-codon optimized and exhibits extremely high instability in the parental cell line. This significant instability was chosen as the comparative example because it demonstrates that the present invention can still achieve significant benefits even in challenging cases with high instability rates using unmodified wild-type cells. However, as discussed above, the instability rate of the parental CHO wild-type cell line was less high in other cases. However, in all analyzed cases, the host cells described in this disclosure achieved a significant increase in stable cell numbers compared to unmodified wild-type cells, where the effect of FAM60A in these cells was impaired. Stability rates can reach as high as 60% or higher, 70% or higher, 80% or higher, 85% or higher, or even 90% or higher, depending on the project. Using cells described in this disclosure, which, for example, include gene knockout in the FAM60A gene or where a portion of the telomere region containing the FAM60A gene is lost due to chromosome breakage, the frequency of unstable clones is significantly lower, regardless of the project analyzed; even if they do occur, the loss in volumetric productivity is less pronounced compared to corresponding cells where the effect of FAM60A in the cell is not impaired. Therefore, due to the increased percentage of stable clones obtained after transfection and selection, cells described in this disclosure can significantly shorten or even skip long-term stability studies. Stability studies of FAM60A knockout clones confirm the beneficial results achieved using the techniques of this disclosure.

[0224] Table 4: Results of the stability study

[0225]

[0226] The results are also shown in Figure 3 And demonstrated the significant advantages achieved when the effects of FAM60A in cells were weakened (here, through gene knockout).

[0227] Example 2: Reducing C12orf35 gene expression through RNA interference (RNAi) can increase expression yield.

[0228] As described above, it is particularly preferred to further attenuate the effect of the C12orf35 gene expression product in eukaryotic cells where the FAM60A protein effect is impaired. Suitable methods for achieving attenuation are as described above, including but not limited to reducing or eliminating the functional expression of the endogenous C12orf35 gene. It has been found that attenuating the effect of the C12orf35 gene expression product in eukaryotic cells, preferably mammalian cells, unexpectedly and significantly increases the expression yield of the recombinant polypeptide of interest expressed from the corresponding cells. This beneficial effect of reducing the expression yield obtained when the functional expression of the C12orf35 gene is reduced is demonstrated in this Example 2.

[0229] To demonstrate that reducing the expression of the C12orf35 gene can increase volumetric or specific productivity, siRNAs were designed targeting different genes located in the telomere region of chromosome 8 of the analyzed Chinese hamster genome (CHO-K1). siRNAs targeting the genes listed in Table 5 below were designed:

[0230] Table 5: siRNAs targeting different genes

[0231]

[0232] The siRNAs used were validated by real-time RT-PCR to confirm their ability to reduce target gene expression through gene silencing. Gene expression was normalized based on 18S RNA. The observed gene expression was set at 100% when the siRNA negative control was transfected. The relative reduction in target gene expression for two different siRNAs targeting the C12orf35 is shown in Table 6 below:

[0233] Table 6

[0234] concentration Gene expression (siRNA 1) Gene expression (siRNA 2) 100 pmol Approximately 28% Approximately 37% 125pmol Approximately 25% Approximately 38% 150 pmol Approximately 35% Approximately 30%

[0235] Furthermore, it was confirmed that the target siRNA used in this experiment did not inhibit the growth of transfected cells. Moreover, BLAST (Basic Local Alignment Search) analysis based on available Chinese hamster genome data did not indicate any off-target effects.

[0236] The following cell lines were transfected: CHO cell lines derived from CHO-K1 were used as parental cell lines. These cell lines expressed the following: Figure 2The genes shown above are described. This parental cell line was not transfected with an expression vector and served as a control. CHO cells (clones and libraries) derived from the parental cell line, which included an antibody stably integrated into the genome as an expression vector for the protein of interest, were used to determine the effect of the siRNA. The expression vectors contained in the cell clones included a selectable marker gene, and the antibody heavy and light chains were expressed from different expression cassettes. The expression cassette for the heavy chain was designed such that a portion of the heavy chain was expressed as a membrane-anchored fusion polypeptide due to stop codon readout. The fusion protein was displayed on the cell surface, thereby simplifying FACS analysis (see specification). The CHO cells expressed the above-described siRNA target genes similarly to the parental cell line, as determined by microarray analysis of hundreds of clones and libraries. CHO clones expressing recombinant antibodies were used to determine whether downregulation of one or more of the above-described target genes resulted in an increase in the expression of the polypeptide of interest. If so, an increase in the volumetric antibody productivity of the cell clones was observed, which could be detected by FACS analysis.

[0237] CHO clones of expression vectors stably integrated into the genome were transfected with either a siRNA control (without affecting gene expression) or one of the aforementioned siRNAs targeting the target gene. After siRNA transfection, the decrease in target gene expression was analyzed to determine whether it led to an increase in antibody expression. Transfected cells were stained with a fluorescent detection compound and analyzed by FACS to determine the antibody expression rate. The more antibodies produced, the more fusion proteins can be displayed for staining with the labeling compound, and correspondingly, the higher the fluorescence signal detected by FACS. Therefore, the higher the intensity in the FACS distribution, the more antibodies are expressed.

[0238] The results of testing different siRNAs are shown in Figure 4 AL. The left peak in the figure corresponds to the signal obtained from parental cell lines that do not express the antibody. The other two curves represent the results obtained from antibody-expressing cell clones transfected with either a negative siRNA control (without effect on expression) or a test siRNA that reduces the expression of its target gene. If the test siRNA and the corresponding downregulated target gene have no effect on antibody expression (i.e., no increase in volumetric productivity), the fluorescence curves obtained from the siRNA negative control and the target siRNA overlap and are therefore essentially the same. This is generally true at the clonal level for all test target genes, except for the gene C12orf35. However, for FAM60A, a slight shift was found at the library level, presumably due to increased expression stability (data not shown).

[0239] As shown in the results obtained using siRNA targeting C12orf35 (see...) Figure 4In Figures B and C), the fluorescence peaks obtained from the siRNA negative control and the siRNA targeting the C12orf35 gene were clearly separated after silencing the C12orf35 gene with RNAi. The fluorescence peak of cell clones transfected with the siRNA targeting the C12orf35 gene showed a significant rightward shift (marked with arrows), indicating a significant increase in fluorescence. This observed increase in fluorescence is attributed to higher antibody expression, due to the presence of more fusion protein and thus staining on the cell surface. Therefore, this experiment clearly demonstrates that downregulating the functional expression of the C12orf35 gene can directly lead to a significant upregulation of antibody recombinant expression (antibody yield). The same significant shift in the FACS distribution was observed when using all three concentrations of the described siRNA targeting C12orf35. As described in this specification, a long-term reduction in the expression of the C12orf35 gene can be achieved through RNA interference, for example, if stably integrated into an expression vector expressing an RNAi-induced transcript. Furthermore, as described herein, reducing or eliminating gene C12orf35 expression can be achieved through gene knockout or gene deletion / mutation. According to one implementation, this is achieved in hamster cells, such as CHO cells, by deleting a portion of the telomere region on chromosome 8. Additionally, as described herein, reducing or eliminating the expression product effect is also feasible, for example, by introducing one or more mutations that result in the protein being non-functional or having less function.

[0240] The increased expression of the recombinant peptide of interest was also confirmed by analysis of the mRNA expression levels of the heavy and light chains (expressed from separate expression cassettes, see above). Figure 5 and 6 Results for two different peptides of interest (antibodies 1 and 2) are shown. Data presented are normalized to the siRNA negative control (125 pmol). Decreased expression of the C12orf35 gene resulted in significantly higher mRNA levels in both the heavy and light chains of the antibody-expressing peptide. In contrast, decreased expression of other target genes did not affect heavy and light chain mRNA levels. Therefore, decreased C12orf35 expression led to a significant increase in the mRNA level of the recombinant peptide of interest. Furthermore, it was observed that silencing C12orf35 upregulated other introduced genes, such as selection markers. Experiments measuring gene silencing effects over time starting from day 3 showed that siRNA 1 (see siRNA C12orf35_1 in Table 7) had a longer-lasting effect than siRNA 2 (see siRNA C12orf35_2 in Table 7). Additionally, cell number and titer were determined by time-course assays, showing that downregulation of C12orf35 resulted in significantly higher specific productivity (see...). Figure 7 ).

[0241] Furthermore, the expression of the C12orf35 gene relative to 18S RNA after inhibition by siRNA 1 and 2 was analyzed in antibody-expressing clones and compared with different controls. The results are shown in Table 7 below:

[0242] Table 7

[0243]

[0244]

[0245] Example 3: Generation of CHO cell lines containing deletions of the telomere region of chromosome 8, with deletions of genes FAM60A and C12orf35.

[0246] A novel CHO cell line (C8DEL) was generated, which includes a telomere deletion on the 8q arm of chromosome 8. The deletion was induced by chromosome breakage. The deleted portion includes the gene FAM60A and the gene C12orf35 located at the telomere end of FAM60A (see [link to relevant documentation]). Figure 1 The novel cell line was obtained from the parental cell line derived from CHO-K1. The cell line containing chromosome breakage on chromosome 8 was prepared as follows: Parental CHO cells were passaged at 2E5 cells / ml in a culture medium containing 0.5 μM, 1 μM, or 2 μM MTX. After 6 days, cell viability was approximately 30-40%. Cells were centrifuged at 180 x g for 5 minutes and cultured in MTX-free medium to allow cell recovery until viability was greater than 95% (approximately 21 days later). This process was repeated twice. Single-cell clones were obtained from the cell bank. A total of 561 cell clones were cultured and DNA was isolated using the Extract-N-Amp Blood PCR Kit. PCR screening was performed using primers to detect the Ipo8 gene. Three of the 561 clones were "IPO8 negative," indicating the loss of the telomere region of chromosome 8 containing the Ipo8 gene. The Ipo8 gene is located at the centromere of the FAM60A gene (see...). Figure 1 Therefore, if the Ipo8 gene is lost due to chromosome breakage, all genes located at the telomere end of the Ipo8 gene are also lost (and correspondingly, the C12orf35 and FAM60A genes are also lost). These three clones were amplified and further evaluated. One of these clones was named the “C8DEL” cell line. PCR technology was used to determine the breakpoint in the telomere region of chromosome 8 from the C8DEL cell line. The breakpoint was determined between two PCRs, PCR20 and PCR28:

[0247] PCR20: Positive 5'-ACC AGT GAA TAA TCG TGT TT-3' (SEQ ID NO: 57), reverse 5'-CTA TGAGTC AAT GTC CCA AG-3' (SEQ ID NO: 58);

[0248] PCR28: Positive 5'-CAC ACA CAA CCT CCT AAC AAC CC-3' (SEQ ID NO: 59), reverse 5'-TTCCGC ACC GAC TCA GTT CT-3' (SEQ ID NO: 60)

[0249] The breakpoint is located within the Tmtc1 gene. Furthermore, (by PCR assay) it can be demonstrated that the identified breakpoint in the C8DEL cell line is stable over several weeks of culture. As shown below, transfection of this novel cell line with an expression vector encoding the product of interest increases the likelihood of selecting stable production clones with high expression capacity. As determined by analysis based on transfected clones, transfection and MTX treatment of the C8DELL cell line clearly do not affect the breakpoint (no further loss of genetic material).

[0250] Example 4: Analysis of the characteristics of the C8DEL cell line

[0251] The performance of the C8DEL cell line in recombinant expression of the polypeptide of interest was analyzed and compared with that of the parental cells from which the C8DEL cell line was obtained. As mentioned above, the parental cell line does not include the corresponding deletion of the telomere region of chromosome 8.

[0252] 4.1 Productivity Analysis

[0253] The volumetric productivity of C8DEL was evaluated compared to its parental cell line of origin. Stable and transient transfections were performed.

[0254] Stable transfection

[0255] Cell culture, transfection, and selection were performed in shake flasks using CHO cells grown in suspension in chemically defined media. Cells were transfected via electroporation using different expression vectors encoding various antibodies and therapeutic proteins. The expression vectors used included expression cassettes containing polynucleotides encoding neomycin phosphotransferase as a selectable marker and expression cassettes encoding DHFR as a selectable marker. Expression vectors for antibody expression additionally included expression cassettes containing polynucleotides encoding the antibody light chain and expression cassettes containing polynucleotides encoding the antibody heavy chain, thereby expressing the complete antibody from the expression vector. Expression vectors for non-antibody peptides included expression cassettes containing both the peptide and the selectable marker polynucleotide. All expression cassettes in the expression vectors were aligned. The vectors were suitable for FACS selection, and details of such vectors are as described above.

[0256] Depending on cell viability, the first selection step is initiated 24–48 h post-transfection by adding G418 selective medium to the cells. Once the cells have recovered to a viability greater than 80%, the second selection step is applied by passage the cells into 500 nM MTX or 1 μM MTX.

[0257] Following the G418 and MTX selection steps, the volumetric productivity of selected cell populations was analyzed using overgrowth shake-flask batch cultures in media containing either G418 or MTX. G418 batches were performed in 30 ml (125 ml flasks), and MTX fed-batch cultures were performed in 100 ml (500 ml flasks). G418 batch cultures were seeded at 1E5 vc / ml in shake flasks and cultured in a shake-flask cabinet (unhumidified) at 150 rpm and 10% CO2. Fed-batch cultures were seeded at 4E5 vc / ml. Cell viability must be >90% at the start of the experiment. Titer assays were performed on day 14. Antibody titers in the cell culture supernatant were determined by protein-A HPLC 14 days after the start of culture.

[0258] Following the first selection step (G418 selection), the volumetric titers of the stably transfected C8DEL library were significantly increased (12-35-fold) compared to the stably transfected parental library. As illustrated by the two antibodies (Antibodies 1 and 2), following the second selection step (MTX selection), the C8DEL library expressed 4-7-fold more peptides of interest compared to the transfected parental cells. The volumetric G418 and MTX (feedback) culture titers of C8DEL are exemplarily shown in Tables 8.a and 8.b below for the two antibody items, compared to the parental CHO cell line without chromosome 8 telomere deletion. Tables 8.a and 8.b show the volumetric G418 and MTX fed-batch culture library titers (antibodies) generated in C8DEL compared to the parental library (average of 4 libraries / conditions).

[0259] Table 8.a: Library titer of example antibody 1

[0260]

[0261] Table 8.b: Library titers of example antibody 2

[0262]

[0263] The results support the conclusion that deletion of the chromosome 8 telomere region containing the FAM60A and C12orf35 genes is associated with high volumetric productivity. In terms of volumetric titer, the C8DEL cell line has been shown to outperform parental cell lines lacking the corresponding deletion of the chromosome 8 telomere region. Considering the siRNA results of Example 2, the increased volumetric titer is believed to be due to the loss of the C12orf35 gene located in the missing telomere region.

[0264] Instantaneous transfection

[0265] Triple transient transfections were performed on C8DEL cells and parental cell lines grown in culture medium using plasmids encoding either eGFP or Fc fusion proteins as the model protein of interest. Polyethyleneimine (PEI) was used as the transfection reagent. The titer of the model protein in the culture supernatant was measured by protein A HPLC on days 3 and 6 post-transfection. The expression of the model protein in C8DEL cells was approximately 3-fold higher. The percentage of eGFP-expressing cells was measured by flow cytometry 48 h post-transfection, with untransfected cells used as a negative control. Cells showing fluorescence levels higher than 99% of the negative controls were considered "transfected." Cells showing fluorescence levels 1000 times stronger than the negative controls were considered "high fluorescence." When using the C8DEL cell line, the number of high fluorescence cells was 2-3 times higher than that of the parental C8DEL cell line.

[0266] This example demonstrates that even when using a C8DEL cell line containing a portion of the telomere region of chromosome 8 lost due to chromosome breakage for transient transfection, the advantage of increased volumetric productivity can still be achieved.

[0267] 4.2 Stability Analysis

[0268] Stability was analyzed in 46 C8DEL-derived clones and 37 parental cell line-derived clones (which tested positive for IPO8 and therefore did not lose the telomere region of chromosome 8) after stable transfection. All clones recombinantly expressed the same antibody as the product of interest and were classified as stable if they did not lose more than 25% of their antibody titer (volume) within 12 weeks. 76% of the analyzed clones from parental cell lines lost more than 25% of their antibody titer (volume) within 12 weeks of culture. Only 24% of the analyzed clones were classified as stable. Therefore, the instability rate was high. In contrast, as shown in Table 9, 67% of the C8DEL clones were classified as stable and only 33% were unstable.

[0269] Table 9: Results of the stability study

[0270]

[0271] Using a Yates-corrected χ² test, a p-value of 0.0002 was calculated, supporting a significantly higher tendency for C8DEL-derived clones to become stable producers. Consequently, a significantly higher number of stable-producing clones were found in the C8DEL cell line. This further supports the superior stability of hamster cells, such as CHO cells, which lack a portion of the FAM60A gene telomere region on chromosome 8, especially when combined with the knockout experiments of Example 1. Therefore, using such cell lines for recombinant expression increases the likelihood of identifying highly and stably producing recombinant cells. Furthermore, the volumetric productivity of the clones was analyzed (see 4.3).

[0272] 4.3 Further Analysis of C8DEL Features

[0273] Other experiments analyzed the characteristics of CHO cell lines containing deletions in the telomere region of chromosome 8, demonstrating other advantages of these cell lines, including deletions of genes FAM60A and C12orf35.

[0274] Selecting high-yielding individuals requires fewer single-cell clones.

[0275] A key advantage of the C8DEL cell line is the higher proportion of high-yielding clones after single-cell cloning. Compared to parental cell lines derived from CHO-K1, the C8DEL library contains a significantly higher proportion of high-yielding cells (leading to increased volumetric titer). Using FACS to select single-cell clones from the C8DEL library, a significantly higher proportion of clones expressing large amounts of antibodies were selected compared to libraries derived from WT cell lines. Table 10 shows that most clones derived from parental cell lines have a volumetric titer of 0-20 mg / L (96-well). Conversely, most clones derived from the C8DEL cell line have an average volumetric titer of 80-100 mg / L, a significant improvement. One advantage of using the C8DEL library is the reduced number of clones required to obtain a substantial number of high-yielding clones. This significantly reduces screening workload.

[0276] Table 10

[0277] Potency (mg / L) in 96 wells Parental cell lines C8DEL 0-20 80.3％ 0.8％ 20-40 6.1％ 3.1％ 40-60 5.4％ 5.3％ 60-80 6.1％ 28.2％ 80-100 1.4％ 32.1％ 100-120 0.0％ 17.6％ 120-140 0.7％ 7.6％ 140-160 0.0％ 3.1％ 160-180 0.0％ 1.5％ 180-200 0.0％ 0.8％

[0278] Using the C8DEL cell line as the production cell line not only increased the proportion of high-yield clones, but also resulted in higher volume titers for individual C8DEL clones. Considering the results of Example 2, the increased yield is attributed to the deletion of the C12orf35 gene. Figure 8 The volumetric titers of 45 top-producing clones from both the CHO-K1-derived parental cell lines (all Ipo8-positive) and C8DEL are shown in section 4.2 (stability analysis results of these clones are shown in section 4.2). It is evident that the average volumetric titer of clones derived from C8DEL is higher than that of the parental cell lines; furthermore, the top-producing antibody clones also originated from the C8DEL cell line.

[0279] Bioreactor suitability

[0280] Additional experiments were conducted to evaluate the C8DEL cell line compared to its parental cell line derived from CHO-K1 to determine its suitability for scale-up. Bioreactor operation showed that the C8DEL cell line was suitable for scale-up. The C8DEL cell line cultured in the bioreactor achieved a viable cell density suitable for large-scale production. Furthermore, superior viability was found compared to the parental cell line. Overall, the C8DEL cell line is suitable for scale-up and outperforms its parental cell line in terms of viability. The C8DEL cell line maintained its viability at a higher level for a longer period.

[0281] Improvements to the timeline from transfection to stable storage production

[0282] Another advantage of the C8DEL cell line is its faster recovery from MTX selection. Recovery of the MTX-incubated library is 7-8 days faster than that of the parental cell lines, which do not lack the telomere region of chromosome 8 containing the FAM60A gene. Overall, significantly lower cellular crisis was found when using the cells described in this disclosure.

[0283] Example 5: Using folic acid receptors as selection markers for selection

[0284] The C8DEL cell line, when combined with folate receptors as selectable markers in various contexts, exhibits specific advantages when used with the selection system. Specifically, selection targeting the combination of folate receptors and DHFR as selectable markers is beneficial. Here, transfected cells include human folate receptor α and DHFR as selectable markers and express antibodies. Although selection of parental cell lines with very low amounts of folate (50 nM folate (FA) / 50 nM MTX) is difficult due to selection rigor (cells do not always recover), the combination of C8DEL and folate receptors as selectable markers is extremely strong under such rigor and induces a significant increase in volume titer. Table 11 highlights the difference in volume titer between parental cell lines and C8DEL, and the additional increase in volume titer achieved when folate receptors as selectable markers are combined with a low-amount folate selection step instead of 500 nM MTX. Therefore, eukaryotic cells with reduced or eliminated expression of the genes C12orf35 and FAM60A described herein can be used in conjunction with the folate receptor / DHFR selection system to employ extremely stringent selection conditions that do not require the use of large amounts of toxic agents.

[0285] Table 11

[0286]

[0287] In addition, C8DEL cells were transfected (nuclear transfection) with an expression vector comprising an expression cassette containing a polynucleotide encoding human folate receptor α and an expression cassette containing a polynucleotide encoding DHFR. Thus, the selectable markers FRα and DHFR were on the same expression vector. Furthermore, this expression vector comprised an expression cassette containing a polynucleotide encoding the antibody light chain and an expression cassette containing a polynucleotide encoding the antibody heavy chain. The expression cassette for the antibody heavy chain was designed to facilitate FACS selection by producing a membrane-anchored fusion product from a portion of the heavy chain due to stop codon readthrough (see above). Five different selection conditions were tested using 100 nM folate (FA) and different MTX concentrations. The selective media are summarized in Table 12 below. After selection, the selected cell bank was transferred to complete medium and grown in shake-flask batch cultures. On day 13 of culture, medium samples were collected and antibody content was analyzed by protein-A HPLC. The results are also shown in Table 12.

[0288] Table 12

[0289] Selection criteria Approximate antibody concentration [g / L] 100nM FA / No MTX 0.13 100nM FA / 1nM MTX 0.12 100nM FA / 5nM MTX 0.46 100nM FA / 10nM MTX 1.44 100nM FA / 50nM MTX 1.57

[0290] As can be seen, MTX concentrations as low as 5 nM already provide a selection advantage. Increased selection rigor also improves the volumetric pool titer. Therefore, volumetric antibody production is significantly increased. Furthermore, significantly lower MTX concentrations can be used during selection compared to standard MTX selection. Given that MTX is a toxic agent, this is an important advantage. In addition, analysis of how selection rigor affects volumetric pool titer and selection time revealed that increasing selection rigor by increasing MTX concentration prolongs recovery time. Therefore, selection rigor can be adjusted according to different application requirements (time versus titer).

[0291] Furthermore, analysis of antibody surface expression in the folic acid / MTX-selected library using FACS showed that combining this selection system with the novel cell line significantly increased the abundance of high-yield cells in the cell library, which is evident from... Figure 9 The resulting fluorescence distribution is clearly visible as shown in AE. MTX concentration increases from A to E (A: no MTX; B: 1 nM MTX; C: 5 nM MTX; D: 10 nM MTX; E: 50 nM MTX). As can be inferred from the increasing peak size on the right (higher fluorescence associated with higher antibody expression), increasing MTX concentration leads to an increase in the number of highly expressing cell clones in the cell bank. Combination with 50 nM folic acid and 10 nM MTX (see...) Figure 9 D) A cell bank containing primarily high-yielding cell clones has been obtained (a main peak on the right). Furthermore, when the MTX concentration is increased to 50 nM (see...), Figure 9 E) Essentially, only high-yielding cells were included in the resulting library. These results are significant because, when the C8DEL cell line was used in conjunction with the folate receptor / DHFR selection system, the library distribution obtained after FACS analysis was more similar to cell clones (including genetically identical cells) than to a cell library (including genetically different cells). It appears that the deletion of the C12orf35 gene in the telomere region of the lost C8DEL cell line causes a significant increase in volumetric productivity, thus, based on the FACS distribution, after folate / MTX selection under appropriate conditions, essentially the majority of cells in the resulting cell library are high-yielding.

[0292] Furthermore, stability rates of up to 80% and almost 100% were achieved in the project when stable transfected clones derived from the C8DEL cell line (lacking the FAM60A gene, see above) were cultured in a selective medium (50 nM folic acid, 10 nM MTX). Significantly high stability results were also achieved in a semi-selective medium containing only the maximum concentration of folic acid (50 nM) without MTX. Here, stability rates of up to 87% were achieved using this cell line. In some projects, stability rates of up to almost 100% were obtained.

[0293] Example 6: A validation tool for identifying high- and stable producers based on expression distribution

[0294] A real-time RT-PCR analysis tool was developed to predict clonal productivity and stability early in the development pipeline. Real-time RT-PCR was performed on four genes: C12orf35, Dennd5b, Fam60a, and Ipo8 (all located in the telomere region of chromosome 8q arm). After selection and clone generation, hundreds of clones expressing antibodies as peptides of interest were analyzed for the presence, expression levels, and expression yields of these four genes in the telomere region. A significant correlation was found between stability, volumetric antibody productivity, and loss of the telomere region. Further investigation was conducted to determine whether stability was associated with the presence of the telomere region. Clones that did not lose more than 25% titer (volume) within 12 weeks were classified as stable. A significant correlation was found between loss of the telomere region and clonal stability (p-value: 4.67E-06, according to χ² test). Therefore, loss of the telomere region, including that of gene FAM60A, can be used as a predictive tool for stability. Analyzing the presence or absence of telomeres on chromosome 8 using real-time RT-PCR can increase the probability of selecting a higher proportion of stable clones in pipeline projects.

[0295] Furthermore, analysis of hundreds of clones that lost portions of the telomere region of chromosome 8 revealed several induced breakpoints within this region. In most of the analyzed cases, the breakpoints were located at the centromere of the Ipo8 gene. A breakpoint was also detected between FAM60A and Ipo8. In all cases, the missing regions included the gene C12orf35 (located at the telomere end of the gene encoding methyltransferase-like protein 20), which is associated with increased volumetric productivity.

Claims

1. An isolated mammalian host cell for recombinant production of a product of interest, wherein the genome of the mammalian host cell is altered such that the effect of the FAM60A expression product in the mammalian host cell is impaired due to the elimination of the functional expression of the FAM60A gene by gene knockout, gene mutation, gene deletion, gene silencing, or any combination thereof, and wherein the mammalian host cell includes at least one heteropolynucleotide encoding the product of interest integrated into its genome, the polynucleotide being included within an expression cassette, wherein the product of interest is a polypeptide, the mammalian host cell is a hamster cell, and wherein impaired effect of the FAM60A protein improves the expression stability of the product of interest in the mammalian host cell.

2. The isolated mammalian host cell as described in claim 1, characterized in that, The mammalian host cell has one or more of the following characteristics: a) The FAM60A gene includes one or more mutations in the FAM60A gene as gene mutations that provide non-functional expression products; b) At least one copy of the gene FAM60A is missing or inactivated in the genome of the mammalian host cell; c) A portion of the chromosome is deleted, wherein the deleted portion includes the gene FAM60A.

3. The isolated mammalian host cell as described in claim 1, characterized in that, The mammalian host cell has one or more of the following characteristics: a) The mammalian host cell is a CHO cell; b) The mammalian host cell is provided as a cell clone or cell line; c) The mammalian host cells endogenously express DHFR and folate receptor.

4. The isolated mammalian host cell as described in claim 2a), characterized in that: At least a portion of the telomere region of chromosome 8 in the mammalian host cell is deleted, wherein the deleted portion includes the gene FAM60A.

5. The isolated mammalian host cell as described in claim 4, characterized in that, The isolated mammalian host cell has one or more of the following characteristics: i) The missing telomere region includes the gene FAM60A and includes one or more genes selected from Caprin2 and Ipo8; ii) The deletion is induced by chromosome breakage and the breakpoint is located at the centromere of the Ipo8 gene; iii) The deletion was induced by chromosome breakage and the breakpoint was located in the Tmtc1 gene at the centromere of the Ipo8 gene; iv) At least a portion of the telomere region is missing in both chromosomes of the corresponding chromosome pair, wherein the missing portion includes the gene FAM60A.

6. The isolated mammalian host cell as described in claim 1, having one or more of the following characteristics: a) The amino acid sequence of the FAM60A protein is shown as one or more of SEQ ID NO: 1, 2, 3, 4, 6, 7 and 8; and / or b) The effect of the C12orf35 expression product in the mammalian host cell is further impaired by reducing or eliminating the functional expression of the C12orf35 gene, and the further impairment of the effect of the C12orf35 expression product leads to an increase in the expression of the recombinant product of interest in the mammalian host cell.

7. The isolated mammalian host cell as described in claim 6, wherein, The C12orf35 gene is a gene that encodes a protein with an amino acid sequence as shown in one or more of SEQ ID NO: 10-16 or that encodes a protein as shown in SEQ ID NO 17.

8. The isolated mammalian host cell as described in claim 1, characterized in that, The mammalian host cell comprises at least one heteropolynucleotide encoding a product of interest and at least one heteropolynucleotide encoding a selection marker or reporter polypeptide that are stably integrated into its genome, wherein these heteropolynucleotides are located in the same or different expression vectors.

9. The isolated mammalian host cell as described in claim 1, characterized in that, The mammalian host cell has one or more of the following characteristics: a) The mammalian host cell secretes the polypeptide of interest into the cell culture medium; and / or b) The product of interest is a polypeptide selected from therapeutic polypeptides and diagnostic polypeptides.

10. The isolated mammalian host cell as described in claim 1, having one or more of the following characteristics: a) The gene deletion is a complete deletion of the FAM60A gene; b) Gene mutations are selected from: one or more frameshift mutations in the coding sequence, one or more introduced stop codons in the coding sequence, and / or changes in one or more splice sites; c) Gene silencing is achieved by an antisense molecule produced by the expression of an antisense construct containing an antisense strand as a transcriptional strand within the cell, or by a molecule mediating RNA interference, wherein an RNA interference-inducing compound is expressed by a vector stably transfected into the mammalian host cell.

11. The isolated mammalian host cell according to any one of claims 1-10, wherein the mammalian host cell is derived from the corresponding cell population, characterized in that, On average, at least 40% of cells derived from the corresponding cell populations did not lose more than 30% of their volumetric expression titer over a time period of 8, 10, or 12 weeks.

12. The isolated mammalian host cell as described in claim 11, characterized in that, On average, at least 50% of cells derived from the corresponding cell populations did not lose more than 25% of their volumetric expression titer over time periods of 8, 10, or 12 weeks.

13. A method for selecting mammalian host cells that recombinantly express a product of interest, wherein the product of interest is a polypeptide, the method comprising: (a) Providing a mammalian host cell as described in claim 1 as the host cell; and (b) Select one or more mammalian host cells that express products of interest.

14. The method as described in claim 13, characterized in that, The method has one or more of the following characteristics: a) The mammalian host cell provided in stage (a) is a CHO cell; b) The mammalian host cells provided in phase (a) additionally include at least one heteropolynucleotide encoding a selection marker and phase (b) includes culturing these mammalian host cells under conditions selective for the selection marker; c) The mammalian host cells provided in stage (a) comprise at least two heteropolynucleotides with corresponding self-encoding selectable markers, wherein the first selectable marker is a folate receptor and the second selectable marker is DHFR, wherein stage (b) comprises culturing these mammalian host cells in a selective medium containing a limiting concentration of folate and a DHFR inhibitor. d) Introducing heterologous polynucleotides into mammalian host cells by transfecting one or more expression vectors; e) Stage (b) includes multiple selection steps; f) Phase (b) includes the selection of flow cytometry-based methods; g) The selected mammalian host cells recombinantly express immunoglobulin molecules; and / or h) The amino acid sequence of the FAM60A protein is shown in one or more of SEQ ID NO: 1, 2, 3, 4, 6, 7 and 8.

15. A method for recombinantly producing a product of interest, wherein the product of interest is a polypeptide, the method comprising using a mammalian host cell as described in claim 1 as a host cell to recombinantly express the product of interest, and further comprising: (a) Culture the mammalian host cells as described in claim 1 under conditions that allow for the expression of the product of interest; and (b) Isolate the product of interest from the cell culture medium and / or the mammalian host cell.

16. The method as described in claim 15, characterized in that, The method further includes: (c) Processing the separated product of interest.

17. The method as described in claim 15, characterized in that, The method has one or more of the following characteristics: a) The mammalian host cell is a CHO cell; b) The product of interest is a polypeptide selected from therapeutic and diagnostic polypeptides; c) The product of interest is a polypeptide and the mammalian host cell secretes the polypeptide of interest into the cell culture medium; d) The amino acid sequence of the FAM60A protein is shown as one or more of SEQ ID NO: 1, 2, 3, 4, 6, 7 and 8; and / or e) The mammalian host cell is used to produce, wherein the effect of the gene C12orf35 expression product is additionally impaired by reducing or eliminating the functional expression of the gene C12orf35, and wherein the additional impairment of the effect of the gene C12orf35 expression product causes an increase in the expression of the recombinant product of interest in the mammalian host cell.

18. The method of claim 17, wherein the C12orf35 gene is a gene encoding a protein with an amino acid sequence as shown in one or more of SEQ ID NO:10-16 or encoding a protein encoded by SEQ ID NO 17.

19. A method of producing a mammalian host cell as claimed in claim 1, comprising altering the genome of the mammalian host cell to weaken the effect of the FAM60A protein in the mammalian host cell, and stably transfecting at least one expression vector into the mammalian host cell, the vector comprising a polynucleotide encoding a product of interest contained in an expression cassette, wherein the product of interest is a polypeptide.

20. The method of claim 19, wherein, The amino acid sequence of the FAM60A protein is shown in one or more of SEQ ID NO: 1, 2, 3, 4, 6, 7 and 8.

21. A method comprising analyzing the suitability of said mammalian cells as host cells for recombinant expression of a product of interest by directly or indirectly analyzing whether the effect of FAM60A in mammalian cells is impaired. The method further includes selecting at least one mammalian cell for recombinant expression of the product of interest, wherein the functional expression of the gene FAM60A is impaired by gene knockout, gene mutation, gene deletion, gene silencing or any combination thereof, and wherein the impaired effect of the FAM60A protein improves the expression stability of the product of interest in the mammalian cell, wherein the mammalian cell is a hamster cell.

22. The method as described in claim 21, characterized in that, The method has one or more of the following characteristics: a) Direct analysis includes analyzing whether the functional expression of the gene FAM60A is eliminated in the mammalian cells; b) Prior to the analysis, mammalian cells are treated with a reagent that induces chromosome breakage, and the analysis includes an analysis of whether treatment with the reagent causes partial deletion of chromosomes containing the gene FAM60A. c) Prior to analysis, mammalian cells were transfected with a heteropolynucleotide encoding a product of interest and a heteropolynucleotide encoding a selection marker, wherein at least one selection step was performed prior to analysis to identify successfully transfected host cells. d) The amino acid sequence of the FAM60A protein is shown in one or more of SEQ ID NO: 1, 2, 3, 4, 6, 7 and 8; e) The method includes additionally analyzing, directly or indirectly, whether the effect of the endogenous gene C12orf35 expression product in the mammalian cells is impaired, wherein the effect of the endogenous gene C12orf35 expression product in the selected at least one mammalian cell is additionally impaired due to a reduction or elimination of gene C12orf35 functional expression, and wherein the impaired effect of the gene C12orf35 expression product causes an increase in the expression of the product of interest in the mammalian cells. f) The method includes analyzing whether gene expression of one or more genes located in the telomere region of chromosome 8 and selected from the Tmtc1 gene and those located at the telomere end of the Tmtc1 gene is eliminated, thereby analyzing whether the functional expression of gene FAM60A is eliminated in the mammalian cells. g) Analyze multiple cell clones to distinguish between stable and unstable cell clones, and select cell clones in which the functional expression of one or more genes FAM60A is eliminated as production clones; and / or h) Analyze multiple cell clones to distinguish between stable and unstable cell clones and high-yield and low-yield cell clones, and select cell clones in which the functional expression of one or more genes FAM60A is eliminated as production clones.

23. The method of claim 22, wherein the C12orf35 gene is a gene encoding a protein with an amino acid sequence as shown in one or more of SEQ ID NO: 10-16 or encoding a protein encoded by SEQ ID NO 17.

Images