New lysine decarboxylase and use thereof
By using lysine decarboxylase or its derivative protein with amino acid sequences as shown in SEQ ID NO:1-2, the problem of insufficient pH and temperature stability of existing lysine decarboxylases has been solved, improving the production efficiency and environmental friendliness of 1,5-pentanediamine and achieving more efficient biosynthesis.
Patent Information
- Application Number
- CN201610970315.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2016-11-03
- Publication Date
- 2026-02-13
- Estimated Expiration
- 2036-11-03
AI Technical Summary
Existing lysine decarboxylases are insufficient in terms of pH and temperature stability, resulting in low production efficiency and high cost of 1,5-pentanediamine, which makes it difficult to meet the needs of green and sustainable development.
Using lysine decarboxylase or its derivative protein with an amino acid sequence as shown in SEQ ID NO:1-2, it has excellent pH and temperature stability, and is suitable for maintaining high enzyme activity in the pH range of 5.0-8.5, especially maintaining more than 90% enzyme activity in the pH range of 6.5-7.5, and maintaining high catalytic activity at 37-50℃.
It improves the production efficiency of 1,5-pentanediamine, reduces production costs, realizes a more environmentally friendly biosynthetic route, and has higher specific enzyme activity and thermal stability, making it suitable for practical production.
Smart Images

Figure CN107177641B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology. Specifically, the present application relates to a protein having lysine decarboxylase activity and the use of an expression vector containing the gene encoding the protein and a genetically engineered bacterium capable of expressing the protein in the production of 1,5-pentanediamine. BACKGROUND
[0002] 1,5-pentanediamine, also known as cadaverine, 1,5-diaminopentane, pentamethylene diamine and cadaverin, is a widely existing nitrogen-containing base with biological activity in organisms, which is produced by decarboxylation of lysine under the action of lysine decarboxylase (E.C. 4.1.1.18), and the reaction is L-lysine + H + → CO2 + cadaverine.
[0003] 1,5-pentanediamine has multiple uses. For example, in agriculture, 1,5-pentanediamine can be used to regulate the aging process of plants, promote the development of stamens, improve the development of plant fruits, and increase fruit yield. In medicine, it can be used as an effective drug for treating dysentery and is also an important pharmaceutical intermediate. In industry, 1,5-pentanediamine is an important chemical raw material; the polymerization reaction of 1,5-pentanediamine with diacid can synthesize high-quality high molecular material - a new type of nylon.
[0004] Nylon 66 is polymerized from hexamethylenediamine and adipic acid at a ratio of 1:1, and is one of the two major varieties of nylon along with nylon 6. Currently, the synthesis of hexamethylenediamine still relies on the petrochemical route, and hexamethylenediamine and its precursor adiponitrile mainly rely on imports. With the gradual depletion of petroleum resources, the greenhouse effect and environmental pollution caused by the consumption of petroleum resources are becoming increasingly prominent, and the call for green and sustainable development is rising. People are trying to find a new method to produce hexamethylenediamine or its substitutes by a biological route, and ultimately to replace petroleum raw materials with renewable resources to produce nylon.
[0005] 1,5-pentanediamine and hexamethylenediamine are homologues of each other and are very similar in structure to hexamethylenediamine, and can be copolymerized with diacid to synthesize practical nylon 5X (nylon 54, nylon 56, nylon 510, etc.). For example, nylon 56 is a new type of nylon, which has good mechanical strength, high melting point and resistance to various solvents like nylon 66, and can be used to replace nylon 66. In addition, nylon 56 has a pleasant touch, such as cotton, which is moisture-wicking and breathable, showing the prospect of developing high-comfort clothing. Nylon 54 and nylon 510 and other nylon products made from 1,5-pentanediamine as monomer have special material properties and potential application value. It is very gratifying that 1,5-pentanediamine can be synthesized by a biological synthesis route using renewable biomass as raw material.
[0006] Lysine decarboxylase catalyzes the decarboxylation of lysine to form 1,5-pentanediamine, which is a key enzyme in the biosynthesis pathway of 1,5-pentanediamine. Lysine decarboxylase exists in various microorganisms. At present, lysine decarboxylase genes have been cloned from E. coli, Hafnia alvei, Selenomonas ruminantium, Salmonella typhimurium and Edwardsiella ictaluri, etc.
[0007] At present, two kinds of lysine decarboxylase CadA and LdcC derived from E. coli are mainly used for the production or research of 1,5-pentanediamine. US7189543 of Japan Ajinomoto Co., Inc. regulates the pH by dicarboxylic acid and converts lysine to 1,5-pentanediamine by overexpressing E. coli CadA enzyme, and the highest yield reaches 69 g / L; Shanghai Kaisai modified Hafnia alvei in its patents CN102851307A and CN201410004636.3, overexpressed E. coli CadA enzyme to catalyze lysine to produce 1,5-pentanediamine, the catalytic temperature was 50℃, the lysine hydrochloride concentration was 450 g / kg, the initial pH of lysine substrate was adjusted to 6.0, the cell dosage was 42.75 g / L (dry weight of cells), and 251 g / kg of 1,5-pentanediamine was produced after 48 h of catalysis. Young Hoon et al. used E. coli XL1-Blue engineering bacteria to overexpress ldcC, controlled the initial cell OD 600= 50, the initial concentration of lysine was 200 g / L, the initial pH of the lysine substrate was adjusted to 6.8, the catalytic temperature was 37°C, and after 120 hours of catalysis, 133.75 g / L of pentamethylene diamine was finally obtained (Oh YH et al 2015). Both of the existing enzymes of E. coli have shortcomings. The optimum pH of CadA is about 5.5, and when the pH is higher than 6.5, the activity decreases rapidly, and when the pH is increased to 8.0, its activity is almost completely lost (Lemonnier and Lane 1998). Since 1,5-pentanediamine is a relatively strong basic substance, the pH will rise when lysine is decarboxylated into 1,5-pentanediamine, and a large amount of acid needs to be added to maintain the catalytic activity of lysine decarboxylase, which will increase the cost and ultimately produce inorganic salt waste. At the same time, due to the mixing characteristics of the reactor or the influence of the non-uniform characteristics of the intracellular and extracellular environment, the reaction efficiency will decrease due to the excessive local pH. If a lysine decarboxylase with high pH tolerance is used, the biosynthesis route of 1,5-pentanediamine will be more efficient, more environmentally friendly, and more cost-competitive. On the other hand, although the optimum pH of LdcC is relatively high, about 7.6, and it has high activity between pH 6-8, its thermal stability is poor, and when the temperature exceeds 37°C, the enzyme activity decreases rapidly as the temperature increases (Lemonnier and Lane 1998). Since the stability of the enzyme is directly related to the amount of enzyme used and the process cost, LdcC is also not an ideal enzyme for 1,5-pentanediamine production.
[0008] In summary, there is an urgent need in the art for a lysine decarboxylase with pH stability and temperature stability for the biosynthesis of 1,5-pentanediamine. SUMMARY
[0009] The object of the present application is to provide a method capable of producing 1,5-pentanediamine from lysine and a lysine decarboxylase used in the method, and the lysine decarboxylase can have excellent pH stability and temperature stability.
[0010] In a first aspect, the present application provides a method for producing 1,5-pentanediamine, the method comprising the steps of:
[0011] 1) producing 1,5-pentanediamine using the following protein or a host cell capable of expressing the following protein; and
[0012] 2) obtaining 1,5-pentanediamine from the system of 1);
[0013] The protein is:
[0014] (a) a protein having an amino acid sequence as shown in any of SEQ ID NOs: 1-2; or
[0015] (b) a derivative protein formed from the amino acid sequence shown in any one of SEQ ID NOs: 1-2 by substitution, deletion or addition of one or several amino acid residues and having the function of the protein of (a).
[0016] In a preferred embodiment, the protein or the host cell catalyzes the decarboxylation reaction of lysine, thereby producing 1,5-pentanediamine.
[0017] In a specific embodiment, the derivative protein of (b) is a derivative protein formed from the amino acid sequence shown in any one of SEQ ID NOs: 1-2 by substitution, deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues and having the function of the protein of (a).
[0018] In a specific embodiment, the derivative protein of (b) is a derivative protein formed from the amino acid sequence shown in any one of SEQ ID NOs: 1-2 by substitution, deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues and having the function of the protein of (a).
[0019] In a specific embodiment, the derivative protein of (b) is a derivative protein formed from the amino acid sequence shown in any one of SEQ ID NOs: 1-2 by substitution, deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues and having the function of the protein of (a).
[0020] In a specific embodiment, the protein is a protein with an amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.
[0021] In a preferred embodiment, the host cell is E. coli, Corynebacterium glutamicum, Hafnia alvei, Bacillus subtilis; more preferably, the host cell is E. coli.
[0022] In a specific embodiment, the method is performed at pH 5.0-8.5; preferably, at pH 6-8; more preferably, at pH 6.5-7.5.
[0023] In a preferred embodiment, the protein has an optimal pH at 5.0-8.5; preferably, the protein has an optimal pH at 6-8; more preferably, the protein has an optimal pH at 6.5-7.5.
[0024] In preferred embodiments, the protein can maintain more than 40% of relative enzyme activity at pH ranging from 5.0-8.5; preferably, the protein can maintain more than 70% of relative enzyme activity at pH ranging from 6.0-8.0; most preferably, the protein can maintain more than 90% of relative enzyme activity at pH ranging from 6.5-7.5.
[0025] In preferred embodiments, the protein of the present application has more than 80% of relative specific enzyme activity remaining after incubation at 37°C for 12h; the protein of the present application has more than 45% of relative specific enzyme activity remaining after incubation at 50°C for 12h. In preferred embodiments, the method for producing 1,5-pentanediamine is a method for producing 1,5-pentanediamine using lysine as a precursor.
[0026] In specific embodiments, the method is performed at a temperature ranging from 30-60°C; preferably at a temperature ranging from 37-50°C; more preferably at 37°C.
[0027] In a second aspect, the present application provides the use of a protein, or an expression vector comprising a nucleotide sequence encoding a protein, or a host cell capable of expressing a protein, for producing 1,5-pentanediamine, wherein the protein is:
[0028] (a) a protein having an amino acid sequence as set forth in any of SEQ ID NOs: 1-2; or
[0029] (b) a derivative protein formed by substitution, deletion, or addition of one or several amino acid residues to the amino acid sequence as set forth in any of SEQ ID NOs: 1-2, and having the function of the protein of (a).
[0030] In preferred embodiments, the protein or the expression vector or the host cell is used for catalyzing lysine to produce 1,5-pentanediamine.
[0031] In preferred embodiments, the derivative protein of (b) is a derivative protein formed by substitution, deletion, or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the amino acid sequence as set forth in any of SEQ ID NOs: 1-2, and having the function of the protein of (a).
[0032] In preferred embodiments, the derivative protein of (b) is a derivative protein formed by deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the amino acid sequence as set forth in any of SEQ ID NOs: 1-2, and having the function of the protein of (a).
[0033] In a preferred embodiment, the derivative protein of (b) is a derivative protein formed by addition or deletion of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the C-terminal and / or N-terminal of the amino acid sequence shown in any one of SEQ ID NO: 1-2 and has the function of the protein of (a).
[0034] In a preferred embodiment, the protein is a protein of the amino acid sequence shown in SEQ ID NO: 1.
[0035] In a preferred embodiment, the host cell is E. coli, Corynebacterium glutamicum, Hafnia alvei, Bacillus subtilis; more preferably, the host cell is E. coli.
[0036] In a preferred embodiment, the protein has an optimum pH of 5.0-8.5; preferably, the protein has an optimum pH of 6-8; more preferably, the protein has an optimum pH of 6.5-7.5.
[0037] In a third aspect, the present application provides an expression vector comprising a nucleotide sequence encoding a protein of:
[0038] (a) a protein of the amino acid sequence shown in any one of SEQ ID NO: 1-2; or
[0039] (b) a derivative protein formed by substitution, deletion or addition of one or several amino acid residues to the amino acid sequence shown in any one of SEQ ID NO: 1-2 and having the function of the protein of (a).
[0040] In a preferred embodiment, the derivative protein of (b) is a derivative protein formed by substitution, deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the amino acid sequence shown in any one of SEQ ID NO: 1-2 and having the function of the protein of (a).
[0041] In a preferred embodiment, the derivative protein of (b) is a derivative protein formed by deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the amino acid sequence shown in any one of SEQ ID NO: 1-2 and having the function of the protein of (a).
[0042] In preferred embodiments, the derivative protein of (b) is a derivative protein of the protein of (a) formed by addition or deletion of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the C-terminus and / or N-terminus of the amino acid sequence of any one of SEQ ID NOs: 1-2 and having the function of the protein of (a).
[0043] In preferred embodiments, the protein has an optimum pH of 5.0-8.5; preferably, the protein has an optimum pH of 6-8; more preferably, the protein has an optimum pH of 6.5-7.5.
[0044] In preferred embodiments, the protein is a protein having an amino acid sequence as set forth in SEQ ID NO: 1.
[0045] In a fourth aspect, the present application provides a host cell capable of expressing a protein which is:
[0046] (a) a protein having an amino acid sequence as set forth in any one of SEQ ID NOs: 1-2; or
[0047] (b) a derivative protein of the protein of (a) formed by substitution, deletion or addition of one or several amino acid residues to the amino acid sequence as set forth in any one of SEQ ID NOs: 1-2 and having the function of the protein of (a).
[0048] In preferred embodiments, the derivative protein of (b) is a derivative protein of the protein of (a) formed by substitution, deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the amino acid sequence as set forth in any one of SEQ ID NOs: 1-2 and having the function of the protein of (a).
[0049] In preferred embodiments, the derivative protein of (b) is a derivative protein of the protein of (a) formed by deletion or addition of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the amino acid sequence as set forth in any one of SEQ ID NOs: 1-2 and having the function of the protein of (a).
[0050] In preferred embodiments, the derivative protein of (b) is a derivative protein of the protein of (a) formed by addition or deletion of 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3 amino acid residues to the C-terminus and / or N-terminus of the amino acid sequence as set forth in any one of SEQ ID NOs: 1-2 and having the function of the protein of (a).
[0051] In a preferred embodiment, the optimal pH of the protein is 5.0-8.5; preferably, the optimal pH of the protein is 6-8; more preferably, the optimal pH of the protein is 6.5-7.5.
[0052] In a preferred embodiment, the protein is a protein with an amino acid sequence as shown in SEQ ID NO: 1.
[0053] In a preferred embodiment, the host cell is E. coli, Corynebacterium glutamicum, Hafnia alvei, Bacillus subtilis; more preferably, the host cell is E. coli.
[0054] It should be understood that, within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described hereinafter (e.g. in the examples) can be combined with each other to form a new or preferred technical solution. Due to the limited space, they will not be listed one by one here. BRIEF DESCRIPTION OF DRAWINGS
[0055] Figure 1 The specific enzyme activities of three lysine decarboxylases LDC6, LDC14 and CadA at different pHs are shown. DETAILED DESCRIPTION
[0056] The inventors have made extensive and in-depth research and unexpectedly found two lysine decarboxylases, which have a more suitable optimal pH for actual production, higher thermal stability and higher specific enzyme activity, thereby providing a material basis for developing excellent lysine decarboxylases and further for the production of 1,5-pentanediamine. On this basis, the present application is completed.
[0057] Lysine decarboxylase
[0058] Lysine decarboxylase is a key enzyme in the synthetic pathway of catalyzing lysine decarboxylation to form 1,5-pentanediamine. Lysine decarboxylases exist in a variety of microorganisms, including but not limited to Escherichia coli, Hafnia alvei, Bacillus halodurans, Bacillus cereus, Bacterium cadaveris, Burkholderia vietnamensis, Chromobacterium violaceum, Vibrio cholerae, Streptomyces polosus, etc. At present, lysine decarboxylase genes have been cloned from Escherichia coli, Hafnia alvei, Selenomonas ruminantium, Salmonella typhimurium and Edwardsiella ictaluri, etc.
[0059] Although lysine decarboxylases can be obtained from a variety of microbial sources, the characteristics of various lysine decarboxylases are significantly different. For example, there are two lysine decarboxylases in Escherichia coli: CadA and LdcC, both of which require pyridoxal phosphate as a cofactor. The optimum pH of CadA is 5.5, and it is completely inactivated at pH 8.0; the optimum pH of LdcC is 7.6, and it is active in a wide pH range. The thermal stability of CadA is significantly superior, and it can still maintain high activity at 70°C, while the thermal stability of LdcC decreases significantly as the temperature rises from 37°C. (Lemonnier and Lane 1998) The skilled person in the art cannot know from sequence analysis which lysine decarboxylase can have the desired characteristics, such as high specific activity, thermal stability, pH stability, especially the optimum temperature and the optimum pH suitable for actual production, and thus cannot be used for the actual production of 1,5-pentanediamine. In addition, the deviation of the temperature stability and the pH stability of lysine decarboxylase from the actual production conditions will also greatly increase the production cost.
[0060] In this text, the terms "lysine decarboxylase" or "lysine decarboxylase of the present invention" or "enzyme of the present invention" have the same meaning and can be used interchangeably herein, all referring to a protein having the activity of catalyzing lysine to produce 1,5-pentanediamine.
[0061] In a specific embodiment, the lysine decarboxylase of the present application represents a protein having an amino acid sequence as set forth in any one of SEQ ID NOs: 1-2. In a preferred embodiment, the lysine decarboxylase of the present application represents a protein having an amino acid sequence as set forth in SEQ ID NO: 1.
[0062] As described above, the temperature stability and pH stability of the lysine decarboxylase are important for practical production. The lysine decarboxylase of the present application can have excellent pH stability and temperature stability.
[0063] In a specific embodiment, the lysine decarboxylase of the present application can maintain a relative enzyme activity of 40% or more at a pH ranging from 5.0-8.5; preferably, a relative enzyme activity of 70% or more at a pH ranging from 6.0-8.0; most preferably, a relative enzyme activity of 90% or more at a pH ranging from 6.5-7.5.
[0064] The lysine decarboxylase of the present application can retain a high specific enzyme activity after incubation at a certain temperature for a certain time. In a specific embodiment, the protein of the present application can retain a relative specific enzyme activity of 80% or more after incubation at 37°C for 12 h; and a relative specific enzyme activity of 45% or more after incubation at 50°C for 12 h. In contrast, the reported LdcC rapidly loses activity as the temperature increases above 37°C (Lemonnier and Lane 1998).
[0065] The term "specific enzyme activity" as used herein has the meaning commonly understood by those skilled in the art, and refers to the number of enzyme activity units per unit weight (mg) of protein under a certain condition. In general, the higher the specific activity for the same enzyme, the better the catalytic performance of the enzyme.
[0066] The term "isolated" as used herein refers to a substance that has been separated from its original environment (if the substance is natural, the original environment is the natural environment). For example, a polynucleotide and a polypeptide in a natural state in a living cell are not isolated, but the same polynucleotide or polypeptide is isolated if it is separated from other substances present in the natural state. Therefore, the term "isolated and purified lysine decarboxylase" as used herein refers to a protein that is substantially free of other proteins, lipids, carbohydrates, or other substances naturally associated therewith. Those skilled in the art can purify the lysine decarboxylase of the present application using standard protein purification techniques. A substantially pure protein produces a single band on a non-reducing polyacrylamide gel.
[0067] In view of the teachings of the present application and the prior art, those skilled in the art will further appreciate that "lysine decarboxylase" also includes variants of the protein that have the same or similar function as "lysine decarboxylase of the present application" but have a small number of differences in amino acid sequence from the amino acid sequence of any one of SEQ ID NO: 1-2. These variants include, but are not limited to, deletions from, insertions into, and / or substitutions of one or more (usually 1-30, preferably 1-10, more preferably 1-6, most preferably 1-3) amino acids, as well as the addition of one or more (usually 20 or fewer, preferably 10 or fewer, more preferably 6 or 3 or fewer) amino acids to the C-terminus and / or the N-terminus of the protein. For example, it is well within the skill of the art to make substitutions of amino acids with similar or identical properties (e.g., isoleucine for leucine) without changing the functional properties of the resulting protein. Also, for example, the addition of one or more amino acids to the C-terminus and / or the N-terminus (e.g., a tag for ease of purification) will not change the functional properties of the resulting protein. For example, the proteins in Examples 1-4 herein are all proteins with a 6his tag at the C-terminus.
[0068] Variants of the polypeptides include homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, and proteins encoded by DNA that hybridizes to the DNA encoding "lysine decarboxylase of the present application" under conditions of high or low stringency. The present application also includes other polypeptides, such as fusion proteins comprising "lysine decarboxylase of the present application" or fragments thereof. In addition to the nearly full-length polypeptides, the present application also includes active fragments of "lysine decarboxylase of the present application". Typically, the fragments have at least about 20 contiguous amino acids, usually at least about 30 contiguous amino acids, preferably at least about 50 contiguous amino acids, more preferably at least about 80 contiguous amino acids, and most preferably at least about 100 contiguous amino acids of the amino acid sequence of "lysine decarboxylase of the present application".
[0069] The present application also provides analogs of "lysine decarboxylase". These analogs can differ from the naturally occurring "lysine decarboxylase of the present application" by differences in amino acid sequence, by modifications that do not affect the sequence, or by both. These polypeptides include naturally or induced genetic variants. Induced variants can be produced by a variety of techniques, such as random mutagenesis by radiation or exposure to mutagens, by site-directed mutagenesis, or by other known molecular biology techniques. Analogues also include those with residues other than naturally occurring L-amino acids, such as D-amino acids, and those with non-naturally occurring or synthetic amino acids such as β, γ-amino acids. It is understood that the proteins of the present application are not limited to the representative proteins exemplified above.
[0070] Modifications (which generally do not alter the primary structure) include: chemical derivatization of a polypeptide in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation. Modified forms also include sequences with phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Proteins modified to increase their resistance to proteolytic degradation or to optimize solubility are also included.
[0071] In the present application, the conservative variant polypeptide of "lysine decarboxylase" refers to a polypeptide in which up to 20, preferably up to 10, more preferably up to 5, most preferably up to 3 amino acids are replaced by amino acids of similar or analogous properties as compared with the amino acid sequence shown in any one of SEQ ID NO: 1-2, but the conservative variant polypeptide still has the same or similar activity as the protein with the amino acid sequence shown in any one of SEQ ID NO: 1-2, i.e., the activity of catalyzing lysine to produce 1,5-pentanediamine.
[0072] Therefore, in view of the teachings of the present application and the prior art, those skilled in the art can make amino acid substitutions to produce conservative variants according to, for example, the following table.
[0073]
[0074]
[0075] Therefore, as used herein, "comprising", "having", "including", "containing", "characterized by", "characterized in that", "characterized by comprising", "characterized by having", "characterized by including", "characterized by containing", "characterized by", "consisting essentially of", and "consisting of" include "including", "consisting essentially of" and "consisting of".
[0076] The protein of the present application can be a recombinant protein, a natural protein, a synthetic protein, preferably a recombinant protein. The protein of the present application can be a naturally purified product, or a chemically synthesized product, or produced using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacterial, yeast, higher plant, insect, and mammalian cells). Depending on the host used for recombinant production, the protein of the present application can be glycosylated, or can be non-glycosylated. The protein of the present application can or can not include the initial methionine residue.
[0077] As will be understood by those skilled in the art, "lysine decarboxylase" of the present application also includes fragments, derivatives, and analogs of "lysine decarboxylase". As used herein, the terms "fragment", "derivative", and "analog" refer to a polypeptide that substantially retains the same biological function or activity of "lysine decarboxylase" of the present application. A polypeptide fragment, derivative, or analog of the present application can be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues can or can not be encoded by the genetic code, or (ii) a polypeptide having a substituent group at one or more amino acid residues, or (iii) a polypeptide formed by fusing the mature polypeptide with another compound such as a compound that increases the half-life of the polypeptide, for example, a polyethylene glycol, or (iv) a polypeptide formed by adding an additional amino acid sequence to the polypeptide sequence (such as a leader or secretory sequence, or a sequence for purification of the polypeptide, or a proprotein sequence, or a fusion protein). Such fragments, derivatives, and analogs are within the scope of those of ordinary skill in the art in light of the disclosure herein.
[0078] As will be understood by those skilled in the art in light of the present teachings and the state of the art, active fragments of the lysine decarboxylase of the present application are readily available. For example, as used herein, an "active fragment" of "lysine decarboxylase" refers to a fragment of "lysine decarboxylase" that retains all or a portion of the function of the full-length "lysine decarboxylase". Typically, the active fragment retains at least 50% of the activity of the full-length "lysine decarboxylase". In more preferred embodiments, the active fragment retains 60%, 70%, 80%, 90%, 95%, 99%, or 100% of the activity of the full-length "lysine decarboxylase".
[0079] As will be understood by those skilled in the art in light of the present teachings and the state of the art, the lysine decarboxylase of the present application can also be prepared in other useful forms, such as an immobilized enzyme.
[0080] Based on the lysine decarboxylase of the present application, the present application also provides polynucleotide sequences encoding the "lysine decarboxylase" of the present application or a conservative variant polypeptide thereof. The polynucleotide of the present application can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA, or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide can be identical to the nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NO: 1-2 or a degenerate variant thereof. As used herein, "degenerate variant" refers to a nucleic acid sequence that encodes a protein having the amino acid sequence of any one of SEQ ID NO: 1-2, but differs in the sequence of the coding nucleotides from the nucleotide sequence encoding the amino acid sequence of any one of SEQ ID NO: 1-2.
[0081] In the present application, the coding polynucleotide sequence of "lysine decarboxylase" can be inserted into a recombinant expression vector or genome. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector well known in the art. In general, any plasmid and vector can be used as long as it can replicate and be stable in the host. An important feature of the expression vector is that it usually contains a replication origin, a promoter, a marker gene, and a translation control element.
[0082] Those skilled in the art can use well-known methods to construct an expression vector containing the "lysine decarboxylase" coding DNA sequence and appropriate transcription / translation control signals, including in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The DNA sequence can be effectively connected to the appropriate promoter in the expression vector to direct mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.
[0083] In addition, the expression vector preferably contains one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance, and green fluorescent protein (GFP), or kanamycin or ampicillin resistance for E. coli.
[0084] The vector containing the appropriate DNA sequence described above and the appropriate promoter or control sequence can be used to transform the appropriate host cells to enable them to express proteins.
[0085] The host cells described herein include host cells containing the expression vector or genome described above, which integrates the coding nucleotide sequence of "lysine decarboxylase" of the present application, preferably the amino acid sequence shown in any one of SEQ ID NO: 1-2. The host cells or strains of the present application can efficiently express a novel lysine decarboxylase with high catalytic performance, thereby improving the production level of 1,5-pentanediamine.
[0086] The host cells of the present application can be prokaryotic cells, such as bacterial cells, or lower eukaryotic cells, such as yeast cells. In a specific embodiment, the strains include, but are not limited to, E. coli, Corynebacterium glutamicum, Hafnia alvei, Bacillus subtilis. In a preferred embodiment, the strain is E. coli.
[0087] Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote, such as E. coli, the transformation of the host cell can be effected by the use of techniques such as calcium chloride precipitation. Another method is the use of MgCl2. If necessary, the transformation can be performed by electroporation. When the host is a eukaryote, transformation can be effected by the use of techniques such as calcium phosphate precipitation, conventional mechanical procedures such as microinjection, electroporation, lipofection, etc.
[0088] The transformants obtained can be cultured in conventional nutrient media using standard procedures known in the art. The culture conditions, such as temperature, pH and the like, are those previously determined to be appropriate for the host cell to grow. The recombinant polypeptides in the above methods can be expressed constitutively or conditionally, for example, when the host cell has reached an appropriate cell density, the selected promoter is induced by a suitable method (e.g. temperature shift or chemical induction) and the cells are cultured for an additional period.
[0089] The recombinant polypeptides in the above methods can be expressed intracellularly, on the cell membrane or secreted extracellularly. If desired, the recombinant proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to, conventional renaturation treatment, treatment with protein precipitants (salting-out method), centrifugation, osmotic lysis, ultrasonication, high pressure homogenization, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, affinity chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.
[0090] In a preferred embodiment, the "lysine decarboxylase" is: (a) a protein having the amino acid sequence of any one of SEQ ID NO: 1-2; or (b) a protein derived from (a) by substitution, deletion or addition of one or several amino acid residues in the amino acid sequence of any one of SEQ ID NO: 1-2 and having the function of "lysine decarboxylase"; or (c) a derivative protein of (a) formed by deletion or addition of one or several, preferably 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3, amino acid residues in the amino acid sequence of any one of SEQ ID NO: 1-2 and having the function of the protein of (a); or (d) a derivative protein formed by addition or deletion of one or several, preferably 1-30, more preferably 1-10, still more preferably 1-6, most preferably 1-3, amino acid residues at the C-terminal and / or N-terminal end of the amino acid sequence of any one of SEQ ID NO: 1-2 and having the function of the protein of (a).
[0091] In view of the teachings of the present application and the prior art, a person of ordinary skill in the art will understand that the lysine decarboxylase and the coding sequence thereof, the expression vector, and the host cell of the present application can be used to catalyze lysine decarboxylation to produce 1,5-pentanediamine.
[0092] On this basis, the present application further provides a method for catalyzing lysine decarboxylation to produce 1,5-pentanediamine by using the expression vector or the host cell of the present application. For example, in a specific embodiment, 1,5-pentanediamine can be produced by catalyzing lysine by culturing a host cell comprising the expression vector of the present application or the genome of which is integrated with the coding sequence of the protein of the present application or by using the lysine decarboxylase of the present application; and then obtaining the produced 1,5-pentanediamine from the catalytic system. In a preferred embodiment, the method is carried out at a pH of 6-8, more preferably at a pH of 6.5-7.5.
[0093] The lysine used for catalysis in the present application can be lysine produced by the host cell itself or exogenously added lysine.
[0094] Advantages of the present application:
[0095] 1. Compared with the lysine decarboxylase with the best effect in the prior art, the lysine decarboxylase of the present application has excellent pH stability and temperature stability;
[0096] 2. Since the pH stability and temperature stability of the lysine decarboxylase of the present application are more suitable for actual production, the production cost can be significantly reduced and the pollution to the environment can be reduced; and
[0097] 3. The lysine decarboxylase of the present application provides a material basis for further optimizing the production of 1,5-pentanediamine.
[0098] The present application will be further described in conjunction with specific examples. It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. The experimental methods in the following examples, if not specified, are generally carried out according to the conventional conditions, such as the conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.
[0099] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described herein.
[0100] Example 1. Construction of expression plasmid and strain of lysine decarboxylase
[0101] The lysine decarboxylase sequence of the present application is shown in SEQ ID NOs: 1-2 below:
[0102] SEQ ID NO: 1 (named Ldc6) - MNIFAILNHSGVFFKEEPVRELHASLEKAGYKVVYPVDAQDLYKMVEMNPRICGVLFDWDKYSLDLCTEINVLNEKLPLYAFANQHSTLDISLTDLRLNLHFFEYALGMADDIALKINQATEEYIDQIMPPFTKALFKYVEEGKYTFCTPGHMGGTAFQKSPAGSIFYDFYGPNAFKADVSISMPELGSLLDHSGPHKEAEEYIARTFNADSSYIVTNGTSTSNKIVGMFSAPAGSTVLVDRNCHKSLTHMMMMSDVTPIYFRPTRNAYGILGGIPQSEFTREVIEAKVAATPNATMPGYAVITNSTYDGLLYNTQYIKETLDTKFIHFDSAWVPYTNFNSIYEGKCGMSGEAMPGKVFYETQSTHKLLAAFSQASMIHVKGEFDKESFNEAFMMHTSTSPQYGIVASTEIAAAMMRGNTGKKLIQDSIDRAIRFRKEIKRLESESDSWFFDVWQPENIDTTECWKLDPKDTWHGFKDIDDDHMYLDPIKVTLLTPGMNENSEMSETGIPASIVAKYLDEHGIVVEKTGPYNLLFLFSIGIDKSKAMQLLRALTDFKRGYDLNLTVKNFLPSLYNEDPSFYEGMRIQELAQGIHDLTRQYRLPELMFKAFDVLPELKVTPHAAWQEELRGNVEEVKLEEMVGRVSANMILPYPPGVPLVLPGEMVTTESRPVLDFLEMLCAIGAHYPGFETDIHGVYAQKDGSYTVKVLKED;
[0103] SEQ ID NO: 2 (named Ldc14) - MKDILFLCNPSPTFKRIPLEELYAQLRDRGFNIIESTSVDDLLDLVRNNAQLAGVVFDWDSYSLDLCKHITALNEMLPLYAFANTHSTLDVSLGDLRMNIQFFEYTLGGAADIADKIRQGTDDYIDTIMPPLTKALFHYVKEGKYTFCTPGHMGGTAFQKSPVGSLFYDFFGANTMKSDISISVSELGSLLDHSGPHKEAEEYIARTFNADRSYMVTNGTSTANKIVGMYAAPAGSTILIDRNCHKSLTHLMMMSDVIPIYLRPTRNAYGILGGIPQREFTHDTIEARVKNTPNATWPVHAVVTNSTYDGLFYNAEYIKKTLDVKSIHFDSAWVPYTNFSPIYQGLCGMSGERVEGKVIYETQSTHKLLAAFSQASMIHVKGDFNQETFNEAYMMHTSTSPHYGIVASIETAAAMMKGHAGKRLINDSIARAIRFRKEIKRLRSESDGWFFDVWQPDNIDQVACWKLDPKESWHGFKGIDDNHMYLDPIKVTLLTPGMNPDGTMADDGIPAAIVAKYLDEHGIIVEKTGPYNLLFLFSIGIDKTKALSLLRALTDFKRAYDLNLRVKNMLPSLYREDPEFYEHMRIQALAQGIHALILHHNLPDLMYRAFEVLPTMVLNPHDAFQQELRGQAEEVYLDEMIGKVNANMILPYPPGVPLVMPGEMLTEESRPVLEFLQMLCEIGAHYPGFETDIHGAYRQADGRYTVKVLKQ.
[0104] The DNA sequences of lysine decarboxylase Ldc6 (SEQ ID NO: 3) and Ldc14 (SEQ ID NO: 4) genes were synthesized, and cloned into the vector pET-21a (+) (purchased from Suzhou Kingfisher Biotech Co., Ltd.) through 5 'NdeI and 3 'XhoI, to obtain two expression plasmids, named pSKP1 and pSKP2, respectively; at the same time, the currently produced E. coli CadA with better performance was used as a control, the gene sequence was Gene ID 948643 in NCBI, and the expression plasmid was named pSKP3. Then the control empty plasmid pET-21a (+), pSKP1, pSKP2 and pSKP3 plasmids were transformed into E. coli BL21 (DE3) competent cells (purchased from Beijing Allwinbio Technology Co., Ltd.) to obtain expression strains SKEcC1, SKEcC2, SKEcC3 and SKEcC4.
[0105] Example 2. Isolation and purification of enzymes
[0106] The recombinant bacteria SKEcC2, SKEcC3 and SKEcC4 were inoculated into 5 mL LB liquid medium containing 100 μg / mL ampicillin, 37°C, 200 r / min, and cultured for about 10 h. 0.5 mL of seed liquid was inoculated into 50 mL of LB liquid medium containing 100 μg / mL ampicillin in a 500 mL flask, 37°C, 200 r / min, and cultured. When the growth reached OD 600 0.6-0.8, ITPG was added to a final concentration of 0.1 mM, 20°C, 200 r / min, and induced for 20 h. The bacteria were collected by centrifugation at 4°C, the induced cells were resuspended with 4°C pre-cooled resuspension Buffer (20 mM potassium phosphate, 20 mM imidazole, 0.1 mM pyridoxal phosphate, 1 mM DTT, 100 mM NaCl, pH 7.4), washed 3 times, and broken by ultrasonic. The broken liquid was centrifuged at 12,000 rpm for 20 min, and the obtained soluble supernatant was purified by nickel column using His tag on AKTA instrument, and finally the target protein was eluted by elution Buffer (20 mM potassium phosphate, 500 mM imidazole, 0.1 mM pyridoxal phosphate, 1 mM DTT, 100 mM NaCl, pH 7.4), and then desalted by 10 KD ultrafiltration tube, to obtain pure enzyme dissolved in storage Buffer (20 mM potassium phosphate, 0.1 mM pyridoxal phosphate, 100 mM NaCl, 5% glycerol, pH 7.4). The obtained enzyme was lysine decarboxylase after isolation and purification, and was stored at -80°C for various enzyme characterization.
[0107] Example 3. Enzyme activity determination under different pH conditions
[0108] In 100 ul of enzyme reaction system (100 mM potassium phosphate, 0.1 mM pyridoxal phosphate, 1 mM DTT, 100 mM NaCl) LDC pure enzyme dosage was 0.5 ug, the substrate L-lysine concentration was 15 mM, the buffer pH was adjusted to 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, respectively, and reacted at 37°C for 3 min. 30 ul of reaction solution was taken and added to 70 ul of 1 M sodium carbonate termination solution to terminate the reaction, 50 ul of 10 mM TNBS was added to the reaction termination solution, color development was performed at 42°C for 5 min, finally 500 ul of toluene was extracted, 200 μL of supernatant was taken and the absorbance at 340 nm was read on the enzyme marker. The enzyme activity unit U was defined as: under the above enzyme reaction conditions, the amount of enzyme required to catalyze 1 μmol of 1,5-pentanediamine per minute was defined as one enzyme activity unit.
[0109] The specific enzyme activity of Ldc6 and Ldc14 under different pH conditions is shown in Figure 1 As shown in the table, the pH tolerance range of Ldc6 and Ldc14 is wide, and they can still maintain more than 40% relative enzyme activity in the pH range of 5.0-8.5, more than 70% relative enzyme activity in the pH range of 6.0-8.0, and more than 90% relative enzyme activity in the pH range of 6.5-7.5; the optimum pH values are 7.5 and 7.0, respectively, and the specific enzyme activities at the optimum pH are 205.1 and 141.9 U.mg -1 The optimum pH of CadA of E. coli is 5.5, and the specific enzyme activity at the optimum pH is 171.6 U.mg -1 When the pH is increased to 6.5 or more, the specific enzyme activity of CadA begins to decrease significantly, which is consistent with the literature report (Lemonnier and Lane 1998). The catalytic reaction is carried out in slightly alkaline conditions, which is close to the growth pH of strains such as E. coli, and can reduce the amount of neutralizing acid and the pollution of waste inorganic salts to the environment, so Ldc6 and Ldc14 are more suitable for the actual production of 1,5-pentanediamine.
[0110] Example 4. Determination of thermal stability
[0111] Ldc6, Ldc14 and CadA were respectively prepared into a concentration of 10 μg / mL with buffer at the optimum pH value of each, and were incubated at 37°C and 50°C, respectively. After 12 hours of incubation, the residual enzyme activity was determined and compared with the enzyme activity before incubation, and the residual relative specific enzyme activity was calculated.
[0112] The results are shown in Table 1. After incubation at 37°C for 12 hours, the relative specific enzyme activities of Ldc6, Ldc14 and CadA all exceeded 80%, and after incubation at 50°C for 12 hours, the relative specific enzyme activities of Ldc6, Ldc14 and CadA all exceeded 45%, wherein the residual enzyme activity of Ldc6 was the highest, and the residual enzyme activities of CadA and Ldc14 were basically equivalent. The literature reported that the activity of LdcC rapidly decreased with increasing temperature when the temperature exceeded 37°C (Lemonnier and Lane 1998). This indicates that Ldc6 and Ldc14 have good thermal stability as well as CadA.
[0113] Table 1. Temperature stability determination of LDC
[0114]
[0115] As can be seen from the results of Examples 3 and 4, the lysine decarboxylase of the present application not only has high enzyme activity at neutral and alkaline pH, but also has good thermal stability, and has good application prospects for 1,5-pentanediamine production.
[0116] Example 5. Whole-cell catalysis of lysine decarboxylase
[0117] The present inventors further obtained expression bacterial liquids of SKEcC1, SKEcC2 and SKEcC3 strains using the induction expression conditions shown in Example 2, and centrifuged and collected the bacterial bodies of SKEcC1 as a control. The lysine whole-cell conversion reaction was carried out in the following system: 100 mM potassium phosphate buffer, 0.1 mM PLP, initial lysine hydrochloride concentration 35 g / L, initial bacterial body OD600 3.0, reaction temperature 37°C, stirring speed 200 r / min, and the pH of the three catalytic systems of SKEcC1, SKEcC2 and SKEcC3 was controlled to be constant at 7.0, 7.5 and 7.0 respectively, and the catalytic reaction time was 5 hours. The results are shown in Table 2. As can be seen from Table 2, the SKEcC2 and SKEcC3 strains capable of expressing the lysine decarboxylase of the present application can all realize whole-cell catalysis of lysine conversion into 1,5-pentanediamine under relatively high pH conditions.
[0118] Table 2. Whole-cell catalysis of different lysine decarboxylases to produce 1,5-pentanediamine
[0119] Strains 1,5-pentanediamine (g / L) produced from 5h SKEcC1 0.5 SKEcC2 17.6 SKEcC3 5.9
[0120] Discussion:
[0121] The present inventors, through careful research, unexpectedly found several lysine decarboxylases with the activity of catalyzing lysine decarboxylation to produce 1,5-pentanediamine. These lysine decarboxylases (especially Ldc6) are significantly superior to the best lysine decarboxylases in the prior art as a whole, especially in reaction pH, thermal stability and other aspects; thereby providing a new material basis for further optimizing the production of 1,5-pentanediamine.
[0122] All the documents mentioned in the present application are cited as references in the present application, as if each document is cited as a reference individually. In addition, it should be understood that, after reading the above teaching of the present application, those skilled in the art can make various modifications or amendments to the present application, and these equivalent forms also fall within the scope defined by the claims attached to the present application. SEQUENCE LISTING <110> TIANJIN INSTITUTE OF INDUSTRIAL BIOTECHNOLOGY, CHINESE ACADEMY OF SCIENCES <120> New lysine decarboxylase and application thereof <130> P2015-1664 <160> 4 <170> PatentIn version 3.5 <210> 1 <211> 712 <212> PRT <213> Artificial Sequence <220> <223> Lysine decarboxylase Ldc6 <400> 1 Met Asn Ile Phe Ala Ile Leu Asn His Ser Gly Val Phe Phe Lys Glu 1 5 10 15 Glu Pro Val Arg Glu Leu His Ala Ser Leu Glu Lys Ala Gly Tyr Lys 20 25 30 Val Val Tyr Pro Val Asp Ala Gln Asp Leu Tyr Lys Met Val Glu Met 35 40 45 Asn Pro Arg Ile Cys Gly Val Leu Phe Asp Trp Asp Lys Tyr Ser Leu 50 55 60 Asp Leu Cys Thr Glu Ile Asn Val Leu Asn Glu Lys Leu Pro Leu Tyr 65 70 75 80 Ala Phe Ala Asn Gln His Ser Thr Leu Asp Ile Ser Leu Thr Asp Leu 85 90 95 Arg Leu Asn Leu His Phe Phe Glu Tyr Ala Leu Gly Met Ala Asp Asp 100 105 110 Ile Ala Leu Lys Ile Asn Gln Ala Thr Glu Glu Tyr Ile Asp Gln Ile 115 120 125 Met Pro Pro Phe Thr Lys Ala Leu Phe Lys Tyr Val Glu Glu Gly Lys 130 135 140 Tyr Thr Phe Cys Thr Pro Gly His Met Gly Gly Thr Ala Phe Gln Lys 145 150 155 160 Ser Pro Ala Gly Ser Ile Phe Tyr Asp Phe Tyr Gly Pro Asn Ala Phe 165 170 175 Lys Ala Asp Val Ser Ile Ser Met Pro Glu Leu Gly Ser Leu Leu Asp 180 185 190 His Ser Gly Pro His Lys Glu Ala Glu Glu Tyr Ile Ala Arg Thr Phe 195 200 205 Asn Ala Asp Ser Ser Tyr Ile Val Thr Asn Gly Thr Ser Thr Ser Asn 210 215 220 Lys Ile Val Gly Met Phe Ser Ala Pro Ala Gly Ser Thr Val Leu Val 225 230 235 240 Asp Arg Asn Cys His Lys Ser Leu Thr His Met Met Met Met Ser Asp 245 250 255 Val Thr Pro Ile Tyr Phe Arg Pro Thr Arg Asn Ala Tyr Gly Ile Leu 260 265 270 Gly Gly Ile Pro Gln Ser Glu Phe Thr Arg Glu Val Ile Glu Ala Lys 275 280 285 Val Ala Ala Thr Pro Asn Ala Thr Met Pro Gly Tyr Ala Val Ile Thr 290 295 300 Asn Ser Thr Tyr Asp Gly Leu Leu Tyr Asn Thr Gln Tyr Ile Lys Glu 305 310 315 320 Thr Leu Asp Thr Lys Phe Ile His Phe Asp Ser Ala Trp Val Pro Tyr 325 330 335 Thr Asn Phe Asn Ser Ile Tyr Glu Gly Lys Cys Gly Met Ser Gly Glu 340 345 350 Ala Met Pro Gly Lys Val Phe Tyr Glu Thr Gln Ser Thr His Lys Leu 355 360 365 Leu Ala Ala Phe Ser Gln Ala Ser Met Ile His Val Lys Gly Glu Phe 370 375 380 Asp Lys Glu Ser Phe Asn Glu Ala Phe Met Met His Thr Ser Thr Ser 385 390 395 400 Pro Gln Tyr Gly Ile Val Ala Ser Thr Glu Ile Ala Ala Ala Met Met 405 410 415 Arg Gly Asn Thr Gly Lys Lys Leu Ile Gln Asp Ser Ile Asp Arg Ala 420 425 430 Ile Arg Phe Arg Lys Glu Ile Lys Arg Leu Glu Ser Glu Ser Asp Ser 435 440 445 Trp Phe Phe Asp Val Trp Gln Pro Glu Asn Ile Asp Thr Thr Glu Cys 450 455 460 Trp Lys Leu Asp Pro Lys Asp Thr Trp His Gly Phe Lys Asp Ile Asp 465 470 475 480 Asp Asp His Met Tyr Leu Asp Pro Ile Lys Val Thr Leu Leu Thr Pro 485 490 495 Gly Met Asn Glu Asn Ser Glu Met Ser Glu Thr Gly Ile Pro Ala Ser 500 505 510 Ile Val Ala Lys Tyr Leu Asp Glu His Gly Ile Val Val Glu Lys Thr 515 520 525 Gly Pro Tyr Asn Leu Leu Phe Leu Phe Ser Ile Gly Ile Asp Lys Ser 530 535 540 Lys Ala Met Gln Leu Leu Arg Ala Leu Thr Asp Phe Lys Arg Gly Tyr 545 550 555 560 Asp Leu Asn Leu Thr Val Lys Asn Phe Leu Pro Ser Leu Tyr Asn Glu 565 570 575 Asp Pro Ser Phe Tyr Glu Gly Met Arg Ile Gln Glu Leu Ala Gln Gly 580 585 590 Ile His Asp Leu Thr Arg Gln Tyr Arg Leu Pro Glu Leu Met Phe Lys 595 600 605 Ala Phe Asp Val Leu Pro Glu Leu Lys Val Thr Pro His Ala Ala Trp 610 615 620 Gln Glu Glu Leu Arg Gly Asn Val Glu Glu Val Lys Leu Glu Glu Met 625 630 635 640 Val Gly Arg Val Ser Ala Asn Met Ile Leu Pro Tyr Pro Pro Gly Val 645 650 655 Pro Leu Val Leu Pro Gly Glu Met Val Thr Thr Glu Ser Arg Pro Val 660 665 670 Leu Asp Phe Leu Glu Met Leu Cys Ala Ile Gly Ala His Tyr Pro Gly 675 680 685 Phe Glu Thr Asp Ile His Gly Val Tyr Ala Gln Lys Asp Gly Ser Tyr 690 695 700 Thr Val Lys Val Leu Lys Glu Asp 705 710 <210> 2 <211> 711 <212> PRT <213> Artificial Sequence <220> <223> Lysine decarboxylase Ldc14 <400> 2 Met Lys Asp Ile Leu Phe Leu Cys Asn Pro Ser Pro Thr Phe Lys Arg 1 5 10 15 Ile Pro Leu Glu Glu Leu Tyr Ala Gln Leu Arg Asp Arg Gly Phe Asn 20 25 30 Ile Ile Glu Ser Thr Ser Val Asp Asp Leu Leu Asp Leu Val Arg Asn 35 40 45 Asn Ala Gln Leu Ala Gly Val Val Phe Asp Trp Asp Ser Tyr Ser Leu 50 55 60 Asp Leu Cys Lys His Ile Thr Ala Leu Asn Glu Met Leu Pro Leu Tyr 65 70 75 80 Ala Phe Ala Asn Thr His Ser Thr Leu Asp Val Ser Leu Gly Asp Leu 85 90 95 Arg Met Asn Ile Gln Phe Phe Glu Tyr Thr Leu Gly Gly Ala Ala Asp 100 105 110 Ile Ala Asp Lys Ile Arg Gin Gly Thr Asp Asp Tyr Ile Asp Thr Ile 115 120 125 Met Pro Pro Leu Thr Lys Ala Leu Phe His Tyr Val Lys Glu Gly Lys 130 135 140 Tyr Thr Phe Cys Thr Pro Gly His Met Gly Gly Thr Ala Phe Gin Lys 145 150 155 160 Ser Pro Val Gly Ser Leu Phe Tyr Asp Phe Phe Gly Ala Asn Thr Met 165 170 175 Lys Ser Asp Ile Ser Ile Ser Val Ser Glu Leu Gly Ser Leu Leu Asp 180 185 190 His Ser Gly Pro His Lys Glu Ala Glu Glu Tyr Ile Ala Arg Thr Phe 195 200 205 Asn Ala Asp Arg Ser Tyr Met Val Thr Asn Gly Thr Ser Thr Ala Asn 210 215 220 Lys Ile Val Gly Met Tyr Ala Ala Pro Ala Gly Ser Thr Ile Leu Ile 225 230 235 240 Asp Arg Asn Cys His Lys Ser Leu Thr His Leu Met Met Met Ser Asp 245 250 255 Val lie Pro lie Tyr Leu Arg Pro Thr Arg Asn Ala Tyr Gly lie Leu 260 265 270 Gly Gly lie Pro Gin Arg Glu Phe Thr His Asp Thr lie Glu Ala Arg 275 280 285 Val Lys Asn Thr Pro Asn Ala Thr Trp Pro Val His Ala Val Val Thr 290 295 300 Asn Ser Thr Tyr Asp Gly Leu Phe Tyr Asn Ala Glu Tyr lie Lys Lys 305 310 315 320 Thr Leu Asp Val Lys Ser lie His Phe Asp Ser Ala Trp Val Pro Tyr 325 330 335 Thr Asn Phe Ser Pro lie Tyr Gin Gly Leu Cys Gly Met Ser Gly Glu 340 345 350 Arg Val Glu Gly Lys Val lie Tyr Glu Thr Gin Ser Thr His Lys Leu 355 360 365 Leu Ala Ala Phe Ser Gin Ala Ser Met lie His Val Lys Gly Asp Phe 370 375 380 Asn Gin Glu Thr Phe Asn Glu Ala Tyr Met Met His Thr Ser Thr Ser 385 390 395 400 Pro His Tyr Gly lie Val Ala Ser lie Glu Thr Ala Ala Ala Met Met 405 410 415 Lys Gly His Ala Gly Lys Arg Leu Ile Asn Asp Ser Ile Ala Arg Ala 420 425 430 Ile Arg Phe Arg Lys Glu Ile Lys Arg Leu Arg Ser Glu Ser Asp Gly 435 440 445 Trp Phe Phe Asp Val Trp Gln Pro Asp Asn Ile Asp Gln Val Ala Cys 450 455 460 Trp Lys Leu Asp Pro Lys Glu Ser Trp His Gly Phe Lys Gly Ile Asp 465 470 475 480 Asp Asn His Met Tyr Leu Asp Pro Ile Lys Val Thr Leu Leu Thr Pro 485 490 495 Gly Met Asn Pro Asp Gly Thr Met Ala Asp Asp Gly Ile Pro Ala Ala 500 505 510 Ile Val Ala Lys Tyr Leu Asp Glu His Gly Ile Ile Val Glu Lys Thr 515 520 525 Gly Pro Tyr Asn Leu Leu Phe Leu Phe Ser Ile Gly Ile Asp Lys Thr 530 535 540 Lys Ala Leu Ser Leu Leu Arg Ala Leu Thr Asp Phe Lys Arg Ala Tyr 545 550 555 560 Asp Leu Asn Leu Arg Val Lys Asn Met Leu Pro Ser Leu Tyr Arg Glu 565 570 575 Asp Pro Glu Phe Tyr Glu His Met Arg Ile Gln Ala Leu Ala Gln Gly 580 585 590 Ile His Ala Leu Ile Leu His His Asn Leu Pro Asp Leu Met Tyr Arg 595 600 605 Ala Phe Glu Val Leu Pro Thr Met Val Leu Asn Pro His Asp Ala Phe 610 615 620 Gln Gln Glu Leu Arg Gly Gln Ala Glu Glu Val Tyr Leu Asp Glu Met 625 630 635 640 Ile Gly Lys Val Asn Ala Asn Met Ile Leu Pro Tyr Pro Pro Gly Val 645 650 655 Pro Leu Val Met Pro Gly Glu Met Leu Thr Glu Glu Ser Arg Pro Val 660 665 670 Leu Glu Phe Leu Gln Met Leu Cys Glu Ile Gly Ala His Tyr Pro Gly 675 680 685 Phe Glu Thr Asp Ile His Gly Ala Tyr Arg Gln Ala Asp Gly Arg Tyr 690 695 700 Thr Val Lys Val Leu Lys Gln 705 710 <210> 3 <211> 2136 <212> DNA <213> Artificial Sequence <220> <223> lysine decarboxylase Ldc6 coding sequence <400> 3 atgaatattt ttgctatcct aaaccactca ggtgttttct ttaaagaaga gccagttcgc 60 gaacttcatg cttctttaga aaaagcaggc tacaaagttg tttacccagt agacgcacaa 120 gatttgtata aaatggttga aatgaaccca cgtatttgtg gtgtgttatt tgactgggat 180 aaatactcat tagacttatg tactgaaatt aatgtcttga atgaaaaatt gcctttgtat 240 gcctttgcaa accaacattc aacgttagat atttcattaa cggatttacg tctaaatctt 300 catttcttcg aatatgcatt aggcatggcc gatgatatcg ctctgaaaat taatcaagcg 360 actgaagaat acatagatca aatcatgcct ccttttacta aggcactatt caaatatgta 420 gaagaaggta aatatacgtt ctgtactccg ggtcacatgg gcggtactgc tttccaaaaa 480 agtccagcag gcagcatctt ctatgatttc tacggtccaa acgcatttaa agcggatgtc 540 tcaatttcaa tgcctgaact aggttcattg cttgatcact ctggtcctca taaagaagca 600 gaagagtata ttgctcgcac gtttaatgca gacagctctt acatcgtaac gaacggtacg 660 TCTACTTCAA ATAAAATTGT AGGTATGTTT TCTGCACCAA CAGGCAGCAC AGTACTTGTT 720 GACC GTA ACT GTCACAAATC TTTGACTCAC ATGATGATGA TGAGTGATGT AACCCCTATC 780 TATTTCCTC TCAACGCGTA ACCTTACGGT ATTTTAGGTG GCATTCCCTA AAGTGAA TTC 840 ACTCGTGAAG TGATTGAAGC AAAAGTAGCA GCAACACCAA ACGCAACTAT GCCTGGTTAT 900 GCGGTTATAC TAAC TCTACTTAC GATGGCTGTG TTGTAACACT CAATACATCAA GAA 960 ACGCTAGACAC TAAATT CAT CC ACTTCGAC AGTGCTTGGG TTCCTTACAC TAAC TTC AAC 1020 TCTATTTACG AAGGTAATGT GGTATGAGTG GTAAAGCGAT GCCGGGTAAA GTGTTC TAT 1080 GAAACACAAT CAAC T CAT AAATTATTGGCT GC GTTCTCTC AAGCATCAAT GATCCACGTG 1140 AAAGGTGAGT TTGATAAAGA ATCTTTCAAC GAAGCCTTCA TGATGCACAC ATCAACATCA 1200 CCTCAATACG GTATTGTTGCA TCAACAGAA ATTGCTGCGG CGATGATGCG CGGTAATACA 1260 GGTAAGAAAC TGATCCAAGA CTCTATTGAC CGTGC GATT CGTTTCCGTA AAGAGATCAA A 1320 CGTCTAGAAA GTGAAAGTGA CAGCTGGTTC TTCGATGTAT GGCAACCAGA AAATATCGAT 1380 acaacagaat gttggaaact ggatcctaaa gatacatggc atggttttaa agacatcgat 1440 gatgaccaca tgtaccttga tccaatcaaa gtaacgctat taactccagg aatgaacgaa 1500 aatagcgaaa tgagtgaaac aggtatccct gcttctatcg ttgctaaata cttagatgaa 1560 cacggtattg tagtagagaa aacaggtcca tataacctat tattcttgtt ctctatcggt 1620 attgataaat caaaagcaat gcaattactg cgtgcgttaa ctgactttaa acgtggctat 1680 gatctaaact taacagtgaa aaacttctta ccttcactgt acaacgaaga tccaagcttc 1740 tacgaaggca tgcgcattca agaactggca caaggcattc acgatcttac tcgtcaatac 1800 cgtttaccag aattgatgtt caaagcgttt gatgtattac ctgaactaaa agtaacgcca 1860 cacgcagcat ggcaagaaga gctacgcggc aatgtggaag aagtgaaact ggaagaaatg 1920 gttggtcgcg taagtgccaa tatgatcctt ccttatcctc caggtgttcc actagtactt 1980 cctggtgaaa tggtaacaac agaatctcgt ccagtacttg atttcttaga gatgctatgt 2040 gcaatcggcg ctcattaccc aggttttgaa acggatattc acggtgtata tgctcaaaaa 2100 gatggcagtt acacagtgaa agtattaaaa gaagat 2136 <210> 4 <211> 2133 <212> DNA <213> Artificial Sequence <220> <223> Lysine decarboxylase Ldc14 coding sequence <400> 4 atgaaagaca ttctgttcct gtgtaacccc tcgccgacct tcaagcggat tccgctggag 60 gagctgtacg cccagctgcg cgatcggggg tttaacatca tcgaaagcac ctcggtcgac 120 gatctgctgg atctggtgcg caacaacgcc cagctggccg gggtcgtctt cgactgggat 180 agctacagtc tggatctgtg caagcacatc acggcgctga acgaaatgct gccgctgtat 240 gccttcgcca acacccactc cacgctggac gtcagcctgg gcgacctgcg catgaacatt 300 cagttctttg agtatacgct gggtggcgcg gccgacatcg ccgacaagat ccgccaggga 360 accgacgact acatcgatac catcatgccg ccgctgacca aggcgctgtt ccactacgtc 420 [[ID=....]] agcccggtcg gcagcctgtt ctatgacttc tttggcgcca acaccatgaa gtccgacatc 540 TCCATCTCCG TATCCGAGCT GGGCTCCCTG CTGGACCACT CCGGCCCGCA CAAAGAGGCG 600 GAAGAGTACA TCGCCCACA CTTCAACGCC GATCGCAGCT ACATGGTGAC CAACGGCACC 660 TCGACCGCCA ACAAAGATCG TCGGCGTGT ACGCCGCGCC GGCCGGCAGC ATATCCTGAT 720 GACC GTAAC TGTCAAAATCGCTGACCCACCTGATGATGATGAGCGACGTTATCCCGATC 780 TACCTGCGGCCGACCCGCAACGCCTACGGCATTCTGGGGGGATTCCCCAGCGCGAGTTC 840 ACCCACGACACCATCGAAGCGGCGTGAAAAATCCCCCGAACGCCACCTGGCCGGTGCA 900 GCGGTGGTCA CCAACTCCAC CTATGACGGC CTGTTCTACA ACgcGGAGTAC ATCAAGAAA 960 ACCCTGGACG TAAAATCCAT CCACCTTGAC TCCGCCTGGG TGCCCTACAC CAACTTCAGC 1020 CCGATCTACC AGGGGCTGTG CGGTATGAGC GGCgAGCgcGTCGAGGGCAAGGTTATCTAC 1080 GAAACCCAGT CCACCCACAA ACTGCTGGCG GCgtTCTCgc AGGCgtCcat GATCCACGTG 1140 AAAGGCGACT TCAACCAAGA AACCTTCAAC GAAGCCTACA TGATGCACAC CTCCACCTCA 1200 CCGCAC TATGGCATC GTGGCCTCC ATCGAAACCGC GGCggCGATGATGAAGGGTCACGCC 1260 ggtaaacgcc tgatcaatga ctctatcgcg cgagccatcc gcttccgtaa ggagatcaag 1320 cgcctgcgca gcgagtccga cggctggttc ttcgacgtct ggcagccgga caatattgac 1380 caggtcgcct gctggaagct ggatccgaaa gagtcctggc acggctttaa gggcatcgat 1440 gacaaccaca tgtaccttga cccgatcaag gtcaccctgc tgaccccggg gatgaacccg 1500 gacggcacga tggcggatga cggtatcccg gccgccatcg tggccaagta cctggacgag 1560 cacggcatca tcgtcgagaa gaccggcccg tacaacctgc tgttcctgtt cagcatcggc 1620 atcgacaaga ccaaggccct gagcctgctg cgcgcgctga ccgacttcaa gcgggcctat 1680 gacctgaacc tgcgcgtgaa gaacatgctg ccgtcgctgt accgcgaaga tccggagttc 1740 tatgagcaca tgcggatcca ggcgctggcc cagggcatcc acgcgctgat cctacaccat 1800 aacctgccgg atctgatgta ccgcgccttc gaggtgctac cgaccatggt gctgaacccg 1860 cacgacgcct tccaacagga gctgcgcggc caggccgaag aggtctacct cgacgagatg 1920 atcggcaagg tcaacgccaa catgatcctg ccgtacccgc cgggcgtgcc gctggtgatg 1980 ccgggcgaaa tgctgacgga ggagagccgg ccggtgctgg agtttctgca gatgctgtgc 2040 gaaatcggcg cccactatcc gggcttcgaa accgacatcc acggcgccta tcgtcaggcc 2100 gacgggcgct atacggtgaa agtgctcaag cag 2133
Claims
1. A method for producing 1,5-pentanediamine, the method comprising the following steps: 1) Utilize the following protein or host cells capable of expressing the following protein to produce 1,5-pentanediamine; and 2) Obtain 1,5-pentanediamine from the system in 1); The protein is an amino acid sequence as shown in SEQ ID NO:1; the method is performed at pH 7.0-7.5 and at a temperature range of 30-60°C.
2. The method as described in claim 1, characterized in that, The protein or the host cell catalyzes the decarboxylation of lysine to produce 1,5-pentanediamine.
3. The method as described in claim 1 or 2, characterized in that, The host cells are Escherichia coli, Corynebacterium glutamicum, Hafnia alvei, and Bacillus subtilis.
4. The method as described in claim 3, characterized in that, The host cell is Escherichia coli (E. coli).
5. The method as described in claim 1, characterized in that, After incubation at 37°C for 12 hours, the protein retains a relative enzyme activity of over 80%; after incubation at 50°C for 12 hours, the protein retains a relative enzyme activity of over 45%.
6. The method as described in claim 1 or 2, characterized in that, The method for producing 1,5-pentanediamine uses lysine as a precursor.
7. The method as described in claim 1, characterized in that, The method is performed in a temperature range of 37-50℃.
8. The method as described in claim 7, characterized in that, The method is performed at 37°C.
Citation Information
Patent Citations
Recombinant expression plasmid vector stable in Hafnia alvei, and application thereof
CN102851307A
Method for producing cadaverine dicarboxylate
US7189543B2
Recombinant expression vector and application thereof
CN104498519A
Method for preparing 1,5-pentanediamine
CN104762336A
Engineered escherichia coli for producing 1,5-pentanediamine by whole-cell catalysis and application thereof
WO2015197014A1