Gene editing system for correcting point mutations in the leptin gene of ob / ob mice and its application
By using dual sgRNA and homologous recombination technology in the CRISPR-Cas9 system, the shortcomings in the off-target rate and cleavage efficiency of the existing system were solved, and efficient correction of the leptin gene in ob/ob mice and partial recovery of leptin protein were achieved.
Patent Information
- Application Number
- CN201910752482.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2019-08-15
- Publication Date
- 2025-07-25
- Estimated Expiration
- 2039-08-15
AI Technical Summary
The existing CRISPR-Cas9 system has shortcomings in off-target rate and cleavage efficiency, and it is difficult to effectively correct the point mutation of the leptin gene in ob/ob mice.
Using the CRISPR-Cas9 system containing sgRNA1 and sgRNA2, sgRNA1 and sgRNA2 target both sides of the sites to be edited, and homologous recombination was carried out by combining donor fragments to optimize the donor sequence to avoid off-target effects and improve cleavage efficiency.
A DNA cleavage efficiency of up to 75% was achieved, and the point mutation of the leptin gene in ob/ob mice was successfully corrected, and some cells restored the expression of leptin protein.
Smart Images

Figure CN110468156B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine. More particularly, it relates to a CRISPR-Cas9 system that can be used to correct the point mutation of the leptin gene in preadipocytes of ob / ob mice and its application. Background Art
[0002] Obesity is a chronic metabolic disease caused by multiple factors such as genetics and environment, and is closely related to eating habits and lifestyle. In recent years, the incidence of obesity has increased at an alarming rate, becoming a global public health problem. Data shows that one-third of the global population is facing the crisis of overweight and obesity. The highest adult obesity incidence rate in the world is in Egypt, about 35%, the highest adolescent obesity rate is in the United States, about 13%, and the country with the largest number of overweight and obese people is China, which has exceeded 300 million.
[0003] More than 600 genes related to obesity have been discovered so far. Genes that have been studied more include the FTO gene, leptin, orexin genes (Orexin A, B), peptide tyrosine tyrosine (PYY), SECL6B, melanocortin 4 receptor (Mc4R), neuropeptide Y gene (NPY2R), gamma-aminobutyric acid 2 (GAD2), etc.
[0004] Homozygous mutation of the leptin gene leads to congenital leptin deficiency, and humans or other mammals show loss of satiety, overeating, and extremely early-onset obesity, accompanied by various symptoms such as metabolic, hormonal, and immune abnormalities. The most ideal treatment method is to correct the mutant gene into a normal leptin gene by gene editing.
[0005] Gene editing is based on specific artificial nuclease technology to perform specific deletions, insertions, or modifications on the target genomic DNA sequence to change specific genetic information within biological materials.
[0006] Currently, the commonly used gene editing technology is mainly the type II CRISPR-Cas9 system. This system contains the Cas9 protein and sgRNA. Among them, the Cas9 protein is an endonuclease containing two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-complementary DNA strand, while the HNH domain cleaves the complementary DNA strand. The sgRNA is composed of trans-activating crRNA (tracrRNA) and CRISPR RNA (crRNA). The crRNA consists of a 20-nt protospacer element and an additional sequence complementary to the tracrRNA. The crRNA is usually engineered into a single-stranded sgRNA containing two key segments: a double-stranded RNA structure that binds to Cas9 at the 3' end and a guide sequence that binds to the target DNA sequence at the 5' end.
[0007] However, the existing CRISPR-Cas9 systems have always had deficiencies in off-target rate and cleavage efficiency. Summary of the Invention
[0008] To solve the above problems, the present invention provides a CRISPR-Cas9 system, which includes an sgRNA1 expression cassette, an sgRNA2 expression cassette and a Cas9 expression cassette. The sgRNA1 and sgRNA2 respectively have different guide sequences targeting the site to be edited.
[0009] In a specific embodiment, the sgRNA1 expression cassette, the sgRNA2 expression cassette and the Cas9 expression cassette are respectively in different operons.
[0010] In a preferred embodiment, the guide sequence of sgRNA1 is located on one side of the site to be edited, and the guide sequence of sgRNA2 is located on the other side of the site to be edited.
[0011] In a specific embodiment, the CRISPR-Cas9 system further includes an expression cassette of a donor fragment homologous to the mutation site and its adjacent sequences. For example, in one embodiment, the donor sequence can be a homologous recombination sequence for correcting the point mutation of the leptin gene.
[0012] In a preferred embodiment, the donor fragment has undergone partial or all base mutations at positions corresponding to the sgRNA1 guide sequence and / or the sgRNA2 guide sequence.
[0013] In a specific embodiment, the guide sequence of sgRNA1 is as shown in SEQ ID NO:1, and the guide sequence of sgRNA2 is as shown in SEQ ID NO:3.
[0014] In a specific embodiment, the sequence of the donor fragment is as shown in SEQ ID NO:4.
[0015] The present invention also provides a non-therapeutic application of the above CRISPR-Cas9 system in gene editing.
[0016] The present invention also provides an application of the above CRISPR-Cas9 system in the preparation of a drug for treating genetic diseases caused by single gene mutations.
[0017] In a specific embodiment, the genetic disease is congenital leptin deficiency caused by Leptin gene mutation. For example, for correcting the mutation of C to T in the codon of the 105th arginine residue of the leptin gene in ob / ob mice,
[0018] The CRISPR-Cas9 system containing dual sgRNAs of the present invention greatly improves the efficiency of cleaving double-stranded DNA. The cleavage efficiency can be as high as 75%, and no off-target effect is detected for both sgRNAs. According to the sgRNA positions, the donor sequence is codon-optimized based on codon degeneracy to avoid being cleaved by the crispr-cas9 system. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 It is a schematic diagram of the relative positions of Y6712, Y6713, and Y6714 with the mutation site in the Leptin gene;
[0020] Figure 2 It is a fluorescence microscope photograph of primary preadipocytes of ob / ob mice transfected with three kinds of Cas9-sgRNAs;
[0021] Figure 3 It is a schematic diagram of the structure of Cas9-sgRNAs;
[0022] Figure 4 It is an agarose electrophoresis diagram of the T7E1 enzyme product of the target fragment amplified from the genomic DNA of primary preadipocytes transfected with AdvCas9-sgRNAs;
[0023] Figure 5 It is a fluorescence microscope photograph of primary preadipocytes of ob / ob mice co-transfected with AdvCas9-sgRNAs and AdvDonor;
[0024] Figure 6 It is a Sanger sequencing peak diagram of the Leptin gene of primary preadipocytes of ob / ob mice co-transfected with AdvCas9-sgRNAs and AdvDonor;
[0025] Figure 7 It is an electrophoresis diagram of T7E1 digestion of 9 off-target sites of sgRNA1;
[0026] Figure 8 It is an electrophoresis diagram of T7E1 digestion of 10 off-target sites of sgRNA2
[0027] Figure 9 It is a statistical chart of the leptin content in the cell supernatant after the induction and differentiation of primary preadipocytes into mature cells ( compared with the ob+Adv control group, p < 0.001);
[0028] Figure 10Immunocytochemical detection of leptin protein after the induction and differentiation of primary preadipocytes into mature cells, where: A / D: Immunocytochemistry of leptin protein after the induction and differentiation of primary preadipocytes from c57 mice; B / E: Immunocytochemistry of leptin protein after the induction and differentiation of primary preadipocytes in the ob+Adv control group; C / F: Immunocytochemistry of leptin protein after the induction and differentiation of preadipocytes in the ob+Adv (Cas9+T / C) group. Detailed implementation mode
[0029] 1. ob / ob mice
[0030] The ob / ob mouse is an obesity syndrome model caused by a point mutation in the Leptin gene, which helps to better understand the related metabolic changes of human obesity, and explore the effects and mechanisms of drugs on obesity syndrome. There is a C>T point mutation (g.10797 C>T, c.372 C>T, p.R105X) in the Leptin gene of ob / ob mice. The 105th arginine residue (Arginine, Arg, R) of the leptin protein mutates into a stop codon, and the leptin protein with the original 167 amino acids lacks 63 amino acids, and cannot exert the biological functions of suppressing appetite and increasing energy consumption, resulting in a systemic and cellular high-calorie obesity state. ob / ob mice show the above obesity syndrome at 3-4 weeks of age, and the condition gradually deteriorates with age, manifested as progressive weight gain, hyperglycemia, hyperinsulinemia, hypertriglyceridemia and early cellular lipolysis, including skeletal osteopenia and chronic osteoporosis. Some studies have shown that there are the same point mutations as those in ob / ob mice in the types of Leptin gene mutations in human monogenic obesity.
[0031] 2. Design of sgRNA targeting the Leptin gene mutation site in ob / ob mice and vector construction
[0032] Design the guiding sequences of three sgRNAs, named Y6712 - Y6714 respectively, and their positions in the Leptin gene are as Figure 1 shown, and the sequences are as follows:
[0033] Y6712: AGTCGGTATCCGCCAAGCAGAGG (SEQ ID NO:1);
[0034] Y6713: AGCCTCACTCTACTCCACAGAGG (SEQ ID NO:2);
[0035] Y6714: GCAGGCCACTGGTCTGAGGCAGG (SEQ ID NO:3).
[0036] The above three sgRNA guide sequences were respectively inserted into the plasmid vector pAdeno-U6-spgRNA-CMV-sfGFP-P2A-3Flag-spCas9 to obtain: plasmid pAdeno-U6-spgRNA(Y6712)-CMV-sfGFP-P2A-3Flag-spCas9 (abbreviated as Cas9-sgRNA(Y6712)), plasmid pAdeno-U6-spgRNA(Y6713)-CMV-sfGFP-P2A-3Flag-spCas9 (abbreviated as Cas9-sgRNA(Y6713)), and plasmid pAdeno-U6-spgRNA(Y6714)-CMV-sfGFP-P2A-3Flag-spCas9 (abbreviated as Cas9-sgRNA(Y6714)).
[0037] The above three Cas9-sgRNA plasmids were transfected into mouse tool cells B16F10 to obtain transfected cells, which were then cultured. As Figure 2 shown, the transfected cells had green fluorescence after 48 h of culture, and there was no obvious change in cell morphology. It can be seen that the transfection efficiency of the three plasmids was relatively high, and the plasmids were normally expressed in the cells, which could be used for the next experiment.
[0038] The transfected cells were collected, and genomic DNA was extracted. Primers were designed to amplify the fragment containing the mutation site by nested PCR and sequenced. The results showed that Sanger sequencing of the corresponding fragments of the transfected cell genomes all showed overlapping peaks, and the positions where the overlapping peaks began were all at the third base upstream of the PAM of the sgRNA, indicating that all three sgRNAs could correctly recognize the Leptin gene and the Cas9 protein had cleavage activity.
[0039] 3. Construction of the AdvCas9-sgRNA plasmid
[0040] We designed a new sgRNA+Cas9 system, which includes two sgRNA sequences, in order to improve the efficiency of cleaving double-stranded DNA. In this example, we used the two guide sequences Y6712 and Y6714 to construct a plasmid, and constructed two sgRNA expression cassettes ( Figure 3 ) in pAdeno-U6-spgRNA-CMV-sfGFP-P2A-3Flag-spCas9 to express the two sgRNAs respectively. The guide sequence of one sgRNA was Y6712, and the other was Y6714, named Cas9-sgRNAs, which were packaged into adenovirus and named Adv Cas9-sgRNAs, with the adenovirus packaged with the plasmid without sgRNA as the control.
[0041] The preadipocytes were transfected with AdvCas9-sgRNAs. After culturing the transfected cells for 48 h, the cells were collected to extract genomic DNA, and the target fragment was amplified. T7E1 endonuclease was used to detect the effectiveness of AdvCas9-sgRNAs. T7E1 endonuclease recognizes and cleaves incompletely matched DNA, cruciform DNA structures, Holliday structures, or DNA fork points, as well as heterodimer DNA, and can also cleave double-stranded DNA with cleavage sites.
[0042] The results are as Figure 4 shown. Since the control virus has no sgRNA but only Cas9, and normally, double-stranded DNA is completely paired and there are no hairpin or cruciform DNA structures, etc., therefore, when the DNA of primary preadipocytes transfected with the control virus (Control) was amplified by PCR, no heterologous bands appeared after digestion with T7E1 enzyme (all 3 replicate wells in the Control group showed a single band). The sgRNA of AdvCas9-sgRNAs can specifically recognize exon 2 of the Leptin gene, Cas9 exerts its cleavage function, the DNA double strand is cut open, and under the NHEJ mechanism, bases are randomly inserted or deleted, resulting in mutations. When such DNA is subjected to PCR, during gradient annealing of the PCR products, due to different templates, heterodimer DNA is formed, which is recognized and cleaved by T7E1, generating DNA fragments of different lengths. In this experiment, the length of the PCR product was 892 bp. Due to the presence of two sgRNAs, the PCR product could form DNA fragments with sizes of about 300 bp, 500 bp, and 650 bp after digestion with T7E1 enzyme. This indicates that the AdvCas9-sgRNAs adenovirus can correctly recognize exon 2 of the Leptin gene and can cleave double-stranded DNA at the corresponding site. The cleavage of genomic DNA by the AdvCas9-sgRNAs adenovirus at the target site is a key step in correcting point mutations in the Leptin gene in this study. The T7E1 digestion results showed that the efficiency of the AdvCas9-sgRNAs adenovirus in cleaving the Leptin gene of primary preadipocytes was as high as 74.8 ± 5.3%, providing a prerequisite for homologous recombination.
[0043] 4. Homologous recombination experiment
[0044] Design the donor sequence according to the target sequence. To avoid cleavage of the donor by sgRNA, mutate some bases at the two sgRNA positions to prevent sgRNA from cleaving the donor that exists freely and has been integrated into the genome, thereby improving the knock-in efficiency. Synthesize the designed donor sequence (SEQ ID NO: 4) and construct it into the vector pAdeno-MCMV-mcherry-P2A-Neo-HA to form the plasmid pAdeno-lep donor-MCMV-mcherry-P2A-Neo-HA, and package it into adenovirus, named AdvDonor.
[0045] Co-transfect primary preadipocytes with AdvCas9-sgRNAs and AdvDonor. Replace the complete medium containing 20 μmol / L Scr7 after 12 h, and take pictures under a confocal fluorescence microscope after 48 h. The results are as Figure 5 shown. The adenovirus has a high infection efficiency and has no effect on cell status. The green fluorescence and red fluorescence are basically co-localized, indicating that the infection efficiencies of AdvCas9-sgRNAs and AdvDonor adenoviruses on primary preadipocytes are similar.
[0046] The primary preadipocytes of ob / ob mice transfected with AdvCas9-sgRNAs and AdvDonor adenoviruses are labeled as the ob+Adv(Cas9+T / C) group, and the preadipocytes transfected with the control virus are labeled as the ob+Adv control group. After 48 h of virus transfection, add 0.5 mg / mL G418 for screening. After all the cells in the ob+Adv control group die, extract the DNA of the cells in the ob+Adv(Cas9+T / C) group and perform Sanger sequencing. The results are as Figure 6 shown. Sanger sequencing of the DNA of primary preadipocytes in the ob+Adv(Cas9+T / C) group found that the point mutation of C>T originally present in the Leptin gene was corrected (indicated by the arrow). Due to the limited number of passages of primary preadipocytes and poor monoclonal formation ability, we did not obtain its monoclonal strain, and the sequenced DNA was mixed clone DNA, so there were overlapping peaks in Sanger sequencing. However, we could still find a relatively high proportion of base C at the mutation site, indicating that the CRISPR-Cas9 system targeting the Leptin gene point mutation can function in primary preadipocytes and can perform single-base knock-in.
[0047] 5. Efficiency analysis of homologous recombination mediated by the CRISPR-Cas9 system
[0048] 1) Analysis of homologous recombination ratio
[0049] Using the mixed cloned genomic DNA as a template, the DNA fragment near the target sequence of the Leptin gene was amplified by PCR. The PCR product was subjected to agarose gel electrophoresis to recover the corresponding fragment, and TA cloning and sequencing were performed using a TA cloning kit. A total of 109 clones were picked, and the results are shown in Table 1.
[0050] Table 1 Sequencing analysis results
[0051]
[0052]
[0053] 2) Detection of off-target of sgRNA by T7E1 enzyme digestion reaction
[0054] Nine off-target sites of sgRNA1 ( Figure 7 ) and the first 10 off-target sites of sgRNA2 ( Figure 8 ) were detected by the T7E1 enzyme digestion method. The group numbered 1 was the ob / ob primary preadipocytes transfected with the control adenovirus (ob+Adv control), and the No. 2 was the experimental group of ob / ob primary preadipocytes (ob+Adv(Cas9+T / C)). The results showed that the sizes of the PCR products of all off-target sites were the same as the predicted product sizes. No additional bands other than the bands of sample No. 1 were observed in sample No. 2 at the off-target sites. Although visible small bands appeared after the amplification products of six off-target sites, namely Wdr7, Cdc14a, Sun1, Cnksr3, Tekt3, and Sult5al, were digested with T7EI enzyme, it was found that the bands that appeared after the digestion of the above 6 off-target sites also existed in the control group compared with the amplification products of the ob+Adv control group, indicating that the appearance of the small bands was caused by non-specific cleavage of T7EI. The above results indicate that the CRISPR-Cas9 system we constructed did not show off-target effects.
[0055] 6. Detection of leptin protein in transformants
[0056] After the primary preadipocytes after G418 resistance screening were induced to differentiate and mature, the cell culture supernatant was collected, concentrated by an ultrafiltration tube (the concentration multiples of the cell supernatants of the control group and the experimental group were the same), and the leptin protein was detected using a Leptin-Elisa kit. The results are as Figure 9 shown. Almost no leptin protein was detected in the cell supernatant of the control group, and the concentration of leptin protein measured in the concentrated cell supernatant of the experimental group was 573.4±51.3 pg / mL. This indicates that after the Leptin gene point mutation in the primary preadipocytes of ob / ob mice was corrected, mature adipocytes could produce leptin protein and secrete it into the cell culture supernatant.
[0057] Further cell immunochemistry verification was carried out. A leptin polyclonal antibody recognizing amino acids 101 - 154 of mouse leptin protein was used for immunostaining of differentiated and mature adipocytes. The results are as Figure 10 shown. After induction of differentiation and maturation of cells in the ob + Adv control and ob + Adv(Cas9 + T / C) groups, lipid droplets of different sizes could be seen in the cytoplasm, the cells became larger and irregular in shape. After induction of differentiation and maturation of primary preadipocytes of c57 mice, yellowish-brown granular substances in the cytoplasm indicated rich expression of leptin protein. No yellowish-brown granular substances appeared in the cytoplasm of cells in the ob + Adv control group, indicating no leptin protein expression. Yellowish-brown granules appeared in the cytoplasm of cells in the ob + Adv(Cas9 + T / C) group, indicating normal expression of leptin protein by the cells. However, there were also some cells without yellowish-brown granules in the cytoplasm, indicating that the point mutation of the Leptin gene mediated by AdvCas9-sgRNAs+ and AdvDonor adenovirus did not occur in all cells, and only some cells underwent homologous recombination to introduce the point mutation of T > C, which is related to the homologous recombination efficiency of primary mammalian cells.
[0058] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention. Sequence Listing <110> Liyuan Hospital Affiliated to Tongji Medical College of Huazhong University of Science and Technology <120> Gene Editing System for Correcting Point Mutation of Leptin Gene in ob / ob Mice and Its Application <141> 2019-08-14 <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 23 <212> DNA <213> Artificial Sequence <400> 1 agtcggtatc cgccaagcag agg 23 <210> 2 <211> 23 <212> DNA <213> Artificial Sequence <400> 2 agcctcactc tactccacag agg 23 <210> 3 <211> 23 <212> DNA <213> Artificial Sequence <400> 3 gcaggccact ggtctgaggc agg 23 <210> 4 <211> 1042 <212> DNA <213> Artificial Sequence <400> 4 ggagaaccac agaagagtat gactaggagg gagagatctg ataagggcag gaggctagag 60 agaatataag gaataaagag ctatggctgg ttcttcacgg atatcattgg agaaaggaat 120 tactcaagac taatcagaag tgaagggtgg agtggctcgg aatgaacaga aagtccggga 180 gaccagctcc gtggctccca gtcagctgat gacaggaagt aagggcctgg accaggaagg 240 tgagaaggaa ggaggtagcc caggttcaca gatgtaatga agggctctgg agaccgatct 300 ccctgccact tgctaaagca cctcttgttc ttcttcctcc tgcatagcag tcggtatccg 360 ccaagcaaag agtcactggc ttggacttca ttcctgggct tcaccccatt ctgagtttgt 420 ccaagatgga ccagactctg gcagtctatc aacaggtcct caccagcctg ccttcccaaa 480 atgtgctgca gatagccaat gacctggaga atctccgaga cctcctccat ctgctggcct 540 tctccaagag ctgctctctg ccacagacca gtggcctgca gaagccagag agcctggatg 600 gcgtcctgga agcctcactc tactccacag aggtggtggc tttgagcagg ctgcagggct 660 ctctgcagga cattcttcaa cagttggatg ttagccctga atgctgaagt ttcaaaggcc 720 accaggctcc caagaatcat gtagagggaa gaaaccttgg cttccagggg tcttcaggag 780 aagagagcca tgtgcacaca tccatcattc atttctctcc ctcctgtaga ccacccatcc 840 aaaggcatga ctccacaatg cttgactcaa gttatccaca caacttcatg agcacaagga 900 ggggccagcc tgcagagggg actctcacct agttcttcag caagtagaga taagagccat 960 cccatcccct ccatgtccca cctgctccgg gtacatgttc ctccgtgggt acacgcttcg 1020 ctgcggccca ggagaggtga gg 1042
Claims
1. A CRISPR-Cas9 system, characterized in that, It includes an sgRNA1 expression cassette, an sgRNA2 expression cassette, a Cas9 expression cassette, and an expression cassette of a donor fragment homologous to the mutation site and its adjacent sequences. The sgRNA1 and sgRNA2 have different guide sequences targeting the DNA sequences near the site to be edited. The guide sequence of sgRNA1 is located on one side of the site to be edited, and the guide sequence of sgRNA2 is located on the other side of the site to be edited. The donor fragment has partial base mutations at positions corresponding to the sgRNA1 guide sequence and / or the sgRNA2 guide sequence. The guide sequence of sgRNA1 is as shown in SEQ ID NO:1, and the guide sequence of sgRNA2 is as shown in SEQ ID NO:
3. The sequence of the donor fragment is as shown in SEQ ID NO:
4.
2. The CRISPR-Cas9 system according to claim 1, wherein The sgRNA1 expression cassette, the sgRNA2 expression cassette, and the Cas9 expression cassette are respectively in different operons.
3. Non-therapeutic use of the CRISPR-Cas9 system according to claim 1 or 2 in gene editing, wherein the CRISPR-Cas9 system reverts the Leptin mutation sites of the gene in mice, and the mutation sites are g.10797 C>T, c.372C>T, p.R105X.
4. Use of the CRISPR-Cas9 system according to claim 1 in the preparation of a medicament for treating genetic diseases caused by single-gene mutations, wherein the genetic disease is congenital leptin deficiency caused by a Leptin gene mutation, and the mutation site is located in the Leptin gene, g.10797 C>T, c.372 C>T, p.R105X.
Citation Information
Patent Citations
Site specific repairing carrier system and method of blood coagulation factor genetic mutation
CN105567735A
CRISPR single-base restoration system and application thereof
CN109517845A