Recombinant host cells with altered membrane lipid composition

Abstract

The present invention belongs to the field of recombinant biotechnology, in particular to the field of protein expression. The present invention generally relates to a method for expressing a protein of interest (POI) from a host cell. The present invention particularly relates to improving the ability of a host cell to express and / or secrete a protein of interest, and the use of a host cell for protein expression. The present invention also relates to cell culture technology, more specifically to culturing cells to produce desired molecules for medical purposes or food.

Description

Technical Field

[0001] The present invention belongs to the field of recombinant biotechnology, particularly to the field of protein expression. The present invention generally relates to a method for expressing a protein of interest (POI) from a host cell by overexpressing or underexpressing a polynucleotide encoding a protein involved in lipid metabolism. The present invention particularly relates to improving the ability of a host cell to express and / or secrete a protein of interest, and the use of host cells for protein expression. The present invention also relates to cell culture techniques, and more specifically to culturing cells to produce desired molecules for medical purposes or food or feed products. Background Art

[0002] Successful production of proteins of interest (POI) has been achieved using both prokaryotic and eukaryotic hosts. The most prominent examples are bacteria such as Escherichia coli, yeasts such as Saccharomyces cerevisiae, Pichia pastoris or Hansenula polymorpha, filamentous fungi such as Aspergillus awamori or Trichoderma reesei, or mammalian cells such as CHO cells. While the production of certain proteins is readily achieved with high efficiency, many other proteins are produced only at relatively low levels.

[0003] In general, heterologous protein synthesis can be limited at various levels. Possible limitations are transcription and translation of the target protein, protein folding and, if applicable, secretion, disulfide bond formation and glycosylation, as well as aggregation and degradation. Transcription can be enhanced by utilizing a strong promoter or increasing the copy number of the heterologous gene. However, these measures clearly plateau, suggesting that other bottlenecks downstream of transcription are limiting expression.

[0004] High levels of protein production in host cells can be limited at one or more different steps, such as folding, disulfide bond formation, glycosylation, intracellular transport, or release from the cell. Based on the current state of the art, even when the DNA sequence of the entire genome of the host organism is available, many of the mechanisms involved are still not fully understood and cannot be predicted. In addition, the phenotype of cells producing recombinant proteins in high yields can be a reduced growth rate, reduced biomass formation, and an overall reduced cell fitness.

[0005] Various attempts have been made in the art to improve the yield of target proteins, such as overexpression of molecular chaperones that promote protein folding, external supplementation of amino acids, etc.

[0006] However, there is still a need for methods to improve the ability of host cells to produce and / or secrete target proteins. The technical problem to be solved by the present invention is to meet this need.

[0007] The solution to the above technical problem is to provide means (such as engineered host cells), methods and uses of the means for increasing the production of a target non-membrane protein of interest in a eukaryotic host cell by overexpressing or underexpressing at least one polynucleotide encoding a protein involved in lipid metabolism. These means, methods and uses are described in detail herein, listed in the claims, exemplified in the examples, and illustrated in the accompanying drawings.

[0008] Therefore, the present invention provides a novel method and use for increasing the production of recombinant proteins in host cells, which is simple and effective and suitable for use in industrial processes. The present invention also provides a host cell for achieving the above-mentioned object.

[0009] ***

[0010] It must be noted that, unless the context clearly indicates otherwise, as used herein, the singular forms "a," "an," and "the" include the plural and vice versa. Thus, for example, reference to "a host cell" or "a method" includes one or more such host cells or methods, respectively, and reference to "the method" includes equivalent steps and methods known to those of ordinary skill in the art that can be modified or substituted. Similarly, for example, reference to "methods" or "host cells" includes "a host cell" or "a method," respectively.

[0011] Unless otherwise indicated, the term "at least" preceding a series of elements will be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using routine experimentation, many equivalents to the specific embodiments of the invention described herein. The present invention is intended to encompass such equivalents.

[0012] The term "and / or" wherever used herein includes the meanings of "and," "or," and "all or any other combination of elements connected by the terms." For example, A, B, and / or C means A, B, C, A+B, A+C, B+C, and A+B+C.

[0013] As used herein, the term "about" or "approximately" means within 20%, preferably within 10%, and more preferably within 5% of a given value or range. It also includes specific numbers, such as, about 20 includes 20.

[0014] The terms "less than," "more than," or "greater than" include specific numbers. For example, less than 20 means ≤ 20, and more than 20 means ≥ 20.

[0015] Throughout this specification and claims or items, unless the context requires otherwise, the word "comprise" and variations such as "comprises" and "comprising" will be understood to mean including the stated integers (or steps), or sets of integers (or steps). It does not exclude any other integers (or steps), or sets of integers (or steps). When used herein, the term "comprising" can be replaced by the terms "containing," "composed of," "including," "having," or "carrying," and vice versa, for example, the term "having" can be replaced by the term "comprising." When used herein, "consisting of" excludes any integer or step not specified in the claim / item. When used herein, "consisting essentially of" does not exclude integers or steps that do not materially affect the basic and novel features of the claim / item. In each instance herein, any one of the terms "comprising," "consisting essentially of," and "consisting of" may be replaced with either of the other two terms.

[0016] In addition, when describing representative embodiments of the present invention, this specification may embody the method and / or process of the present invention as a specific sequence of steps. However, insofar as the method or process does not rely on the specific sequence of steps set forth herein, the method or process should not be limited to the specific sequence of steps described. One of ordinary skill in the art will appreciate that other sequences of steps are also possible. Therefore, the specific sequence of steps described in this specification should not be interpreted as a limitation on the claims. Furthermore, claims relating to the method and / or process of the present invention should not be limited to the operation of its steps in the order described, and one of ordinary skill in the art will readily appreciate that these sequences can be varied and still be included within the spirit and scope of the present invention.

[0017] It should be understood that the present invention is not limited to the specific methodology, protocols, materials, reagents and substances described herein. The terms used herein are only used to describe the purpose of specific embodiments and are not intended to limit the scope of the present invention, which is limited only by the claims / items.

[0018] All publications and patents cited throughout this specification (including all patents, patent applications, scientific publications, manufacturer's specifications, instructions, etc.), whether preceding or following, are hereby incorporated by reference in their entirety. Nothing herein should be construed as an admission that the present invention does not antedate such disclosure by virtue of prior invention. To the extent that material incorporated by reference is inconsistent or inconsistent with this specification, the present specification supersedes any such material. SUMMARY OF THE INVENTION

[0020] The present invention is based on the surprising discovery that the expression, preferably overexpression, of a polynucleotide sequence ("polynucleotide of the present invention") encoding a protein involved in lipid metabolism ("auxiliary protein of the present invention") results in an increase in the production of a target protein (POI). Methods and materials for improving the production of POI are provided herein by engineering host cells so that these cells are able to overexpress at least one, i.e., one or more, proteins involved in lipid metabolism. Preferred polynucleotides encode an auxiliary protein (involved in lipid metabolism), the auxiliary protein comprising an amino acid sequence shown in any one of SEQ ID NOs: 1-15, such as SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15, respectively.

[0021] The present invention is also based on the surprising discovery that a polynucleotide sequence ("polynucleotide of the present invention") encoding a protein involved in lipid metabolism ("auxiliary protein of the present invention") results in an increased production of a target protein (POI). In this article, such auxiliary proteins are sometimes referred to as "KO proteins" or "KO auxiliary proteins". Therefore, even if the terms used in the text of this application are only "auxiliary proteins" or "auxiliary genes" or "auxiliary factors", etc., if technically meaningful (i.e., if low expression results in an increase in POI production), the terms "auxiliary proteins" or "auxiliary genes" or "auxiliary factors" also include "KO auxiliary proteins" or "KO auxiliary genes" or "KO auxiliary factors". This article also provides methods and materials that can be used to improve the production of POI by engineering host cells so that these cells can low-express at least one, i.e., one or more, proteins involved in lipid metabolism. Preferred polynucleotides encode a KO protein (involved in lipid metabolism) comprising the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in either SEQ ID NO: 16 or 17, respectively.

[0022] The inventors' discovery is quite surprising, as prior to this invention, the only known association between lipid metabolism and increased production of target proteins in eukaryotic host cells, particularly fungal host cells, was that lipid metabolism was not involved. Without being bound by theory, modifications in lipid metabolism alter the lipid composition of biological membranes in eukaryotic host cells, particularly fungal host cells, thereby positively impacting recombinant protein production.

[0023] It is assumed that overexpression of at least one protein involved in lipid metabolism, preferably at least one auxiliary protein described herein, changes the lipid composition of the membrane of the host cell described herein (particularly the cell membrane or the endoplasmic reticulum membrane), thereby leading to an increased production of the target protein.

[0024] In particular, it is assumed that overexpression of at least one protein involved in lipid metabolism, preferably at least one auxiliary protein as described herein, preferably by increasing the amount of C26 fatty acyl moieties of ceramides and / or inositol-containing phosphoceramides (such as inositolphosphoceramide (IPC), mannose-inositolphosphoceramide (MIPC), mannose-dioinositol-phosphoceramide (M(IP)2C)) and / or reducing the amount of C24 fatty acyl groups of ceramides and / or inositol-containing phosphoceramides (such as inositolphosphoceramide (IPC), mannose-inositolphosphoceramide (MIPC), mannose-dioinositol-phosphoceramide (M(IP)2C)), changes the molecular species pattern of sphingolipids, thereby leading to an increased production of the target protein.

[0025] Preferably, the relative amount of fatty acyl groups with a chain length of 26 carbons (C26) introduced into ceramides such as IPC, MIPC and (M(IP)2C) is increased by at least 100%, while the relative amount of fatty acyl groups with a chain length of 24 carbons (C24) is decreased by at least 70%.

[0026] Preferably, overexpression of at least one protein involved in lipid metabolism, preferably at least one auxiliary protein as described herein, results in a change in the molecular species pattern of most sphingolipids, i.e., the fatty acyl moiety of ceramides and IPC-type inositol-containing phosphoceramides (IPC, MIPC, M(IP)2C) preferentially contains C26 over C24. The amount of C26, depending on the sphingolipid species (ceramide, IPC, MIPC and M(IP)2C), is enhanced by at least 100% compared to the empty vector.

[0027] It is also assumed that overexpression of at least one protein involved in lipid metabolism, preferably at least one auxiliary protein as described herein, reduces the amount of IPC and MIPC (about 230%) and or increases the formation of the mature form of inositol-containing phosphoceramide M(IP)2C by at least 6 times (600%), thereby resulting in an increased production of the target protein.

[0028] It is further hypothesized that low expression of at least one protein involved in lipid metabolism, preferably at least one accessory protein described herein (herein KO accessory protein), depletes the non-polar storage lipid triacylglycerol (TG), thereby leading to increased production of the target protein.

[0029] The term "yield" refers to the amount of a POI or model protein described herein, particularly SDZ-Fab (heavy chain SEQ ID NO: 37 and light chain SEQ ID NO: 38) and HyHEL-Fab (heavy chain SEQ ID NO: 39 and light chain SEQ ID NO: 40), respectively, harvested, for example, from an engineered host cell, and the increased yield can be attributed to an increased amount of POI produced or secreted by the host cell. Yield can be expressed as mg POI / g host cell biomass (measured as dry cell weight or wet cell weight). As used herein, the term "titer" similarly refers to the amount of POI or model protein produced, expressed as mg POI / L culture supernatant. Increased yield can be measured when the yield obtained from an engineered host cell is compared to the yield obtained from a host cell prior to engineering (i.e., from an unengineered host cell). Preferably, when "yield" is used in the context of a model protein described herein, it is determined as described in Example 4c. Therefore, when the term "yield" is used in the context of the model proteins described herein, it also refers to "Fab yield" or "Fab titer." Fab titer is expressed in mg / L and Fab yield is expressed in mg / g biomass (measured as dry cell weight or wet cell weight). SDZ-Fab and HyHEL-Fab are encoded by the nucleotide sequences shown in SEQ ID NOs: 41 and 42 and 43 and 44, respectively.

[0030] Briefly, the Pichia pastoris strain CBS7435mut was engineered to express the model proteins HyHEL-Fab and SDZ-Fab, respectively, using polynucleotides encoding the accessory proteins described herein or their functional homologs. S pPM2d_pAOX HyHEL and / or CBS7435mut SpPM2d_pAOX SDZ (see Example 1 for their production). For co-overexpression, the genes encoding the auxiliary proteins are cloned under the control of the Pichia pastoris GAP promoter and then transformed into the Fab-producing strains described in Example 3b and Example 4. The genes can also be under the control of the Pichia pastoris AOX promoter. For low expression, the gene encoding the KO protein or its functional homolog is knocked out from the genome of the Fab-producing strain (see Example 5). The engineered cells are grown overnight at 25°C in YP-medium containing 10 g / L glycerol and 50 μg / mL Zeocin (see Example 4a). An aliquot of this culture (corresponding to the final OD 600 The culture was washed and resuspended in synthetic medium M2, and an aliquot (corresponding to the final OD 600 4.0) was transferred to a synthetic culture medium M2 supplemented with 5g / L methanol. Methanol (5g / L) was added every 12 hours. After 48 hours, the cells were harvested by centrifugation. Biomass was determined by measuring the weight of the cell pellet derived from 1mL cell suspension. The supernatant was used for the quantification of SDZ-Fab or HyHEL-Fab by ELISA (described in Example 4c). Specifically, anti-human IgG antibodies (such as ab7497, Abcam) were used as coating antibodies, and goat anti-human IgG (Fab specificity) antibodies (such as SigmaA8542 conjugated with alkaline phosphatase) were used as detection antibodies. Commercial human Fab / κ, IgG fragments were used as standard substances with a starting concentration of 100ng / mL, and supernatant samples were diluted accordingly. Based on the comparison of POI output before and after cells were engineered to overexpress polypeptides, the increase in output could be determined. The standard test relating to model proteins SDZ-Fab and / or HyHEL-Fab shown in the examples can be used to measure yield differences.

[0031] Therefore, the present invention relates to one or more newly discovered polypeptides involved in lipid metabolism (also referred to herein as "auxiliary proteins") and their use for increasing POI production. The present invention is based on, but is not limited to, an auxiliary protein or a functional homologue thereof as shown in any one of SEQ ID NOs: 1 to 17. The meaning of functional homologues is defined in the latter part of this application. The nucleotide sequences of the auxiliary proteins of the present invention are listed in SEQ ID NOs: 19 to 35, respectively. As used herein, these proteins refer to proteins whose plural or singular forms are interchangeable in the present invention, but should be understood as singular forms unless otherwise expressly specified. Auxiliary proteins involved in lipid metabolism comprising the amino acid sequence shown in any one of SEQ ID NOs: 1-15 are preferably overexpressed in eukaryotic host cells, while auxiliary proteins involved in lipid metabolism comprising the amino acid sequence shown in SEQ ID NOs: 16 or 17 are preferably underexpressed in eukaryotic host cells.

[0032] The present invention also relates to polynucleotides encoding the auxiliary proteins (hereinafter referred to as "polynucleotides of the present invention") and their use alone or in combination to increase POI production. The polynucleotides can be introduced into a host cell, or if already present in the cell, they can be manipulated in such a way that the polynucleotides are overexpressed. The polynucleotides of the present invention for auxiliary protein overexpression encode SEQ ID NOs: 1 to 15, such as SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 or any one of their functional homologs. Examples of the polynucleotide sequences are shown in SEQ ID NOs: 19 to 33, such as SEQ ID NOs: 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32 or 33. A polynucleotide encoding an auxiliary protein involved in lipid metabolism comprising the nucleotide sequence shown in any one of SEQ ID NOs: 19-33 is preferably overexpressed in a eukaryotic host cell, whereas a polynucleotide encoding an auxiliary protein involved in lipid metabolism comprising the nucleotide sequence shown in SEQ ID NO: 34 or 35 is preferably underexpressed in a eukaryotic host cell.

[0033] Therefore, the present invention provides a method for increasing the yield of a target protein in a eukaryotic host cell, the method comprising overexpressing in the host cell at least one polynucleotide encoding an auxiliary protein involved in lipid metabolism, thereby increasing the yield of the target protein compared to a host cell that does not overexpress a polynucleotide encoding a protein involved in lipid metabolism. Preferably, the auxiliary protein involved in lipid metabolism is not a transcription factor. Preferably, the auxiliary protein involved in lipid metabolism comprises an amino acid sequence shown in any one of SEQ ID NOs: 1-15, such as SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15.

[0034] Preferably, in the context of overexpression of the auxiliary protein, lipid metabolism is sphingolipid biosynthesis, phospholipid biosynthesis, lipid transport or ergosterol biosynthesis. Modifying lipid metabolism by making the auxiliary protein overexpression of the present invention can change the biological membrane lipid composition in the eukaryotic host cell, particularly in the fungal host cell, thereby actively affecting the production of recombinant protein. Therefore, when used in this article, the term "lipid metabolism" in the context of overexpression can be replaced by the term "modification of biological membrane lipid composition", preferably replaced by the modification of the biological membrane lipid composition in the eukaryotic host cell, particularly in the fungal host cell. The modification of biological membrane lipid composition can be affected by sphingolipid biosynthesis, phospholipid biosynthesis, lipid transport or ergosterol biosynthesis.

[0035] The present invention also provides a method for increasing the yield of a target protein in a eukaryotic host cell, the method comprising:

[0036] - engineering the host cell to overexpress a polynucleotide encoding a protein involved in lipid metabolism and comprising an amino acid sequence as shown in any one of SEQ ID NOs: 1-15, such as SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, preferably an amino acid sequence as shown in any one of SEQ ID NOs: 1-9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NOs: 12-15, or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence as shown in any one of SEQ ID NOs: 1-15;

[0037] - engineering the host cell to contain a heterologous polynucleotide encoding the protein of interest,

[0038] - culturing the host cell under suitable conditions to express the target protein, and optionally

[0039] - isolating the target protein from the cell culture.

[0040] In addition, the present invention provides a method for increasing the production of a target protein in a eukaryotic host cell, the method comprising:

[0041] - providing a host cell, which is engineered to overexpress a polynucleotide encoding a protein involved in lipid metabolism and comprising an amino acid sequence as shown in any one of SEQ ID NOs: 1-15, such as SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, preferably an amino acid sequence as shown in any one of SEQ ID NOs: 1-9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NOs: 12-15, or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence as shown in any one of SEQ ID NOs: 1-15, wherein the host cell comprises a heterologous polynucleotide encoding the target protein;

[0042] - culturing the host cell under suitable conditions to overexpress the protein involved in lipid metabolism or its functional homologue and express the target protein, and optionally

[0043] - isolating the target protein from the cell culture.

[0044] In the context of a method for increasing the production of a protein of interest, the order of the "step of engineering to overexpress / underexpress a polynucleotide encoding an accessory protein" and the "step of engineering to include a heterologous polynucleotide encoding the protein of interest" can alternatively be reversed so that the "step of engineering to include a heterologous polynucleotide encoding the protein of interest" precedes the "step of engineering to overexpress / underexpress a polynucleotide encoding an accessory protein." Notably, as described herein, when the accessory protein is overexpressed and / or the KO protein is underexpressed, the production of the protein of interest is increased.

[0045] The present invention also provides a recombinant eukaryotic host cell for preparing a target protein, wherein the host cell is engineered to overexpress a polynucleotide encoding a protein involved in lipid metabolism.

[0046] Preferably, the present invention provides a recombinant host cell for preparing a target protein, wherein the host cell is engineered to overexpress a polynucleotide encoding an auxiliary protein, the auxiliary protein comprising any one of SEQ ID NO: 1-15, such as SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, preferably any one of SEQ ID NO: 1-9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NO: 12-15 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NO: 1-15, respectively.

[0047] In a preferred embodiment, the accessory protein, preferably when overexpressed, can increase the expression of the model protein SDZ-Fab (heavy chain SEQ ID NO: 37 and light chain SEQ ID NO: 38) in the host cell compared to the host cell before being engineered to overexpress the accessory protein. Figure 2 ) or HyHEL-Fab (heavy chain SEQ ID NO: 39 and light chain SEQ ID NO: 40; Figure 2 ) is increased by at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or at least 200%, and preferably at least 10%. The host cell before through engineering approaches will not overexpress the accessory protein of the present invention, while the host cell after through engineering approaches can overexpress the accessory protein under suitable culture conditions. It has been surprisingly found that the exemplary recombinant cells described in the examples are all able to increase the output of the model protein SDZ-Fab or HyHEL-Fab by at least 20% (1.2-fold change).

[0048] The present invention also relates to a method for increasing the production of a target protein in a eukaryotic host cell, the method comprising underexpressing at least one polynucleotide encoding an auxiliary protein involved in lipid metabolism in the host cell, thereby increasing the production of the target protein compared to a host cell that does not underexpress the polynucleotide encoding the protein involved in lipid metabolism. Preferably, the auxiliary protein involved in lipid metabolism comprises the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17, respectively.

[0049] Therefore, the present invention provides a method for increasing the production of a target protein in a eukaryotic host cell, the method comprising:

[0050] - engineering the host cell to underexpress a polynucleotide encoding a protein involved in lipid metabolism and comprising the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17,

[0051] - engineering the host cell to contain a heterologous polynucleotide encoding the protein of interest,

[0052] - culturing the host cell under suitable conditions to express the target protein, and optionally

[0053] - isolating the target protein from the cell culture.

[0054] In addition, the present invention provides a method for increasing the production of a target protein in a eukaryotic host cell, the method comprising:

[0055] - providing a host cell, wherein the host cell is engineered to low-express a polynucleotide encoding a protein involved in lipid metabolism and comprising the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17, wherein the host cell comprises a heterologous polynucleotide encoding the target protein;

[0056] - culturing the host cell under suitable conditions to low-express the protein involved in lipid metabolism or its functional homologue and express the target protein, and optionally

[0057] - isolating the target protein from the cell culture.

[0058] In the context of the method for increasing protein production, the order of the "step of engineering to overexpress / underexpress a polynucleotide encoding an accessory protein" and the "step of engineering to include a heterologous polynucleotide encoding the target protein" can alternatively be reversed so that the "step of engineering to include a heterologous polynucleotide encoding the target protein" precedes the "step of engineering to overexpress / underexpress a polynucleotide encoding an accessory protein." Notably, as described herein, when the accessory protein is overexpressed and / or the KO protein is underexpressed, the production of the target protein is increased.

[0059] The present invention also provides a recombinant eukaryotic host cell for producing a target protein, wherein the host cell is engineered to underexpress a polynucleotide encoding a protein involved in lipid metabolism. Preferably, the protein involved in lipid metabolism comprises the amino acid sequence shown in SEQ ID NO: 16 or 17, or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17.

[0060] Preferably, in the context of low expression of the auxiliary protein, the lipid metabolism that the auxiliary protein participates in is lipid storage. Preferably, in the context of low expression of the auxiliary protein, the auxiliary protein is not a transcription factor. Modifying lipid metabolism by making the auxiliary protein of the present invention low expression can change the biomembrane lipid composition in eukaryotic host cells, particularly fungal host cells, thereby actively affecting the production of recombinant protein. Therefore, when used in this article, the term "lipid metabolism" in the context of low expression can be replaced by the term "modification of biomembrane lipid composition", preferably replaced by the modification of biomembrane lipid composition in eukaryotic host cells, particularly fungal host cells. The modification of biomembrane lipid composition can be affected by non-polar storage lipid biosynthesis or phospholipid metabolism.

[0061] In a preferred embodiment, the accessory protein, preferably when underexpressed, can increase the production of the model protein SDZ-Fab (heavy chain SEQ ID NO: 37 and light chain SEQ ID NO: 38) or HyHEL-Fab (heavy chain SEQ ID NO: 39 and light chain SEQ ID NO: 40) in the host cell by at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or at least 200%, and preferably at least 10%, compared to the host cell before being engineered to underexpress the accessory protein. Host cells before through engineering approaches will not low-express the accessory protein of the present invention, while host cells after through engineering approaches can low-express the accessory protein under suitable culture conditions. Surprisingly, it has been found that the exemplary recombinant cells described in the Examples can increase the output of the model protein SDZ-Fab or HyHEL-Fab by at least 20% (1.2-fold change). In some cases, the output increases by 80%, as shown in Example 6b.

[0062] The present invention also provides the use of the host cells described herein for producing a protein of interest (POI). The host cells can be advantageously used to introduce a polynucleotide encoding one or more POIs, which can then be cultured under suitable conditions to express the POIs, through which the accessory proteins of the present invention are overexpressed or underexpressed.

[0063] The present invention also provides an isolated polynucleotide encoding an auxiliary protein involved in lipid metabolism and comprising an amino acid sequence as shown in any one of SEQ ID NOs: 1-17, such as SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17, or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence as shown in any one of SEQ ID NOs: 1-17. Preferably, the present invention also provides an isolated polynucleotide encoding an auxiliary protein involved in lipid metabolism and comprising an amino acid sequence as shown in any one of SEQ ID NOs: 1-15, such as SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15, or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence as shown in any one of SEQ ID NOs: 1-15.

[0064] Similarly, the present invention also provides an isolated polynucleotide encoding an auxiliary protein, the polynucleotide comprising a nucleotide sequence shown in any one of SEQ ID NOs: 19-36. The polynucleotide for integration into a host cell or for producing a target protein preferably comprises a nucleotide sequence shown in any one of SEQ ID NOs: 19-33 or 36. Similarly, the isolated auxiliary protein as described herein is used to produce the target protein. This polynucleotide encodes an auxiliary protein comprising an amino acid sequence shown in any one of SEQ ID NOs: 1-15.

[0065] The present invention also relates to a composition comprising at least 0.25%, 0.5%, 1%, 2%, 3%, 4%, 5% or 10% of a target protein and a polynucleotide encoding an auxiliary protein of the present invention, wherein the polynucleotide is operably linked to a heterologous promoter. Sequence Listing <110> Bellinger Ingelheim RCV GmbH & Co. KG Valley Dogan Co., Ltd. Lonza Co., Ltd. <120> Recombinant host cells with altered membrane lipid composition <130> LC19310010P <150> 17163588.1 <151> 2017-03-29 <160> 103 <170> SIPOSequenceListing 1.0 <210> 1 <211> 330 <212> PRT <213> Pichia pastoris <400> 1 Met Ser Asp Ile Asn Thr Leu Ser Gln Lys Ile Pro Ser Tyr Val Gln 1 5 10 15 Tyr Gly Ile Pro Ser Ile Asp His Pro Phe Gly Ile Arg Leu Trp Pro 20 25 30 Ile Phe Ser His Phe Phe Glu Ala Val Val Gly Tyr Pro Ala Glu Asp 35 40 45 Phe Arg Phe Ile Gln Gly Leu Thr Thr Met Ala Asn Leu Lys Asp Ala 50 55 60 Leu Gly Val Ile Ala Val Tyr Tyr Phe Val Ile Phe Gly Gly Gln Trp 65 70 75 80 Leu Met Arg Thr Leu Asn Ala Arg Pro Phe Lys Leu Asn Phe Leu Phe 85 90 95 Gln Leu His Asn Leu Val Leu Thr Gly Ala Ser Phe Thr Leu Leu Ile 100 105 110 Leu Ile Val Glu Gln Leu Ile Pro Gly Ile Tyr Arg His Gly Ile Phe 115 120 125 Trp Ala Ile Cys His Lys Asp Ser Phe Thr Asn Glu Leu Val Thr Leu 130 135 140 Tyr Tyr Leu Asn Tyr Leu Ile Lys Tyr Val Glu Leu Ile Asp Thr Val 145 150 155 160 Phe Leu Val Leu Lys Arg Lys Lys Leu Leu Phe Leu His Thr Tyr His 165 170 175 His Gly Ala Thr Ala Leu Leu Cys Tyr Thr Gln Leu Leu Gly His Thr 180 185 190 Ala Val Glu Trp Val Pro Ile Ala Leu Asn Leu Ala Val His Val Val 195 200 205 Leu Tyr Trp Tyr Tyr Phe Leu Ser Ala Arg Gly Ile Arg Val Trp Trp 210 215 220 Lys Gln Trp Val Thr Arg Phe Gln Ile Ile Gln Phe Leu Ile Asp Leu 225 230 235 240 Gly Phe Val Tyr Phe Ala Thr Tyr Thr Phe Tyr Ala Asp Lys Tyr Phe 245 250 255 Pro Glu Leu Pro Asn Met Gly Thr Cys Tyr Gly Thr Glu Glu Ala Ala 260 265 270 Ala Phe Gly Tyr Leu Ile Leu Thr Ser Tyr Leu Val Leu Phe Ile Leu 275 280 285 Phe Tyr Ile Arg Val Tyr Lys Ser Gly Pro Thr Thr Ser Lys Gly Lys 290,295,300 Ser Lys Ala Ala Ala Thr Thr Gly Gln Lys Thr Glu Thr Ala Ser Pro 305 310 315 320 Ser Gly Lys Ser Thr Ser Val Arg Arg Ala 325 330 <210> 2 <211> 334 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 2 Met Ser Ile Leu Ser Phe Asp Lys Pro Phe Gly Ile Glu Leu Trp Pro 1 5 10 15 Ile Phe Asp Thr Phe Ala Ser Lys Ala Thr His Gly Ala Phe Val Pro 20 25 30 Ser Glu Phe Glu Phe Val Ala Gly Lys Leu Pro Leu Ser Thr Leu Glu 35 40 45 Pro Val Leu Tyr Ser Ile Ala Ala Tyr Tyr Phe Ile Val Phe Gly Gly 50 55 60 Tyr Tyr Phe Ile Lys Lew Glu Lew Lys Pro Lew Val Lew Asn Ala 65 70 75 80 Leu Phe Ser Ala His Asn Leu Phe Leu Thr Thr Ala Ser Leu Val Leu 85 90 95 Leu Thr Leu Met Val Glu Gln Leu Val Pro Ile Ile Tyr His His Gly 100 105 110 Leu Phe Tyr Ala Ile Cys Asn Thr Arg Ala Trp Thr Gln Glu Leu Val 115 120 125 Thr Leu Tyr Tyr Leu Asn Tyr Leu Ile Lys Phe Val Glu Phe Ile Asp 130 135 140 Thr Phe Phe Leu Val Val Lys Gln Lys Lys Leu Thr Phe Leu His Thr 145 150 155 160 Tyr His His Gly Ala Thr Ala Leu Leu Cys Tyr Thr Gln Leu Val Gly 165 170 175 Val Thr Ser Ile Ser Trp Val Pro Ile Ser Leu Asn Leu Gly Val His 180 185 190 Val Val Met Tyr Trp Tyr Tyr Phe Leu Ala Ser Arg Gly Ile Arg Val 195 200 205 Trp Trp Lys Glu Trp Val Thr Arg Phe Gln Ile Met Gln Phe Ile Leu 210 215 220 Asp Leu Gly Phe Val Tyr Phe Ala Ser Tyr Gln Lys Phe Ala Tyr Thr 225 230 235 240 Tyr Phe Lys Asp Val Leu Pro Tyr Cys Gly Asp Cys Ala Gly Thr Met 245 250 255 Will Wing Wing Will Be Gly Cys Wing Ile Leu Will Be Tyr Leu Val Leu 260 265 270 Gln Gly Lys Ser 275 280 285 Arg Tyr Val Lys Lys Val Arg Gly Gly Val Ala Ala Lys Val Asn Glu 290,295,300 Tyr Val Leu Glu Asp Lys Gln Leu Alpha Ser Gly Allele Ser Arg 305 310 315 320 Ser Ser Ser Pro Val Thr Arg Asn Leu Arg Ser Arg Lys Ala 325 330 <210> 3 <211> 403 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 3 Met Ser Lys Glu Glu Lys Thr Arg Arg Arg Arg Ala Ser Ser Ile Gly 1 5 10 15 Asn Ile Asn Leu Gly Asn Ala Val Pro Ser Leu Thr Thr Arg Lys 20 25 30 Serve Asn With Gln Gln Arg Lys Serve Serve Only Arg With Asn With Leu 35 40 45 Asn Lys Lys Gly Ser Ser Asp Trp Gly Leu Val Lys Lys Ile Gly Leu 50 55 60 Ser Leu Val Glu Leu Ser Ser Arg His Thr Trp Leu Pro Phe Leu Val 65 70 75 80 Ser Leu Val Ala Ile His Gly Ser Tyr Leu Leu Ser Asn Asn His Thr 85 90 95 Pro Ser Asn Pro Leu His Lys Phe Val Asp Leu Ser Tyr Lys Ile Glu 100 105 110 Gly Thr Asn Pro Pro Met Tyr Gly Lys Gly Trp Lys Asp Phe Cys Phe 115 120 125 Val Phe Tyr Phe Met Ile Phe Phe Ser Phe Tyr Arg Glu Phe Leu Met 130 135 140 Gln Ala Leu Leu Lys Pro Leu Ala Ser Lys Leu Gly Ile Thr Arg Glu 145 150 155 160 Ser Lys Val Arg Arg Phe Met Glu Gln Ser Tyr Ser Met Cys Tyr Tyr 165 170 175 Gly Phe Ser Gly Pro Leu Gly Leu Tyr Ile Met Ala Gly Met Pro Leu 180 185 190 Trp Tyr Phe Asn Thr Thr Glu Phe Tyr Ile Thr Tyr Pro His Lys Ser 195 200 205 His Glu Tyr Leu Phe Lys Tyr Tyr Tyr Leu Gly Gln Ala Ala Phe Trp 210 215 220 Ser Gln Gln Ala Val Val Leu Met Leu Gln Leu Glu Lys Pro Arg Lys 225 230 235 240 Asp Phe Lys Glu Leu Val Ile His His Ile Ile Thr Ile Ala Leu Ile 245 250 255 Tyr Cys Ser Tyr Arg Phe His Phe Thr Trp Met Gly Leu Ala Val Tyr 260 265 270 Ile Thr Met Asp Ile Ser Asp Phe Phe Leu Ala Leu Ser Lys Thr Leu 275 280 285 Asn Tyr Val Asp Ser Ala Tyr Thr Gly Pro Ala Phe Met Phe Phe Val 290 295 300 Gly Val Trp Phe Tyr Leu Arg His Trp Leu Asn Val Lys Ile Leu Trp 305 310 315 320 Ser Val Leu Thr Glu Phe Arg Thr Val Gly Pro Phe Glu Leu Asn Trp 325 330 335 Ile Thr Gln Gln Tyr Lys Cys Trp Ile Ser Gln Pro Ile Val Phe Ser 340 345 350 Leu Ile Phe Ala Leu Gln Leu Val Asn Leu Tyr Trp Phe Val Leu Ile 355 360 365 Arg with Tyr Arg His Phe with Thr Lys Asp Glu 370 375 380 Arg Ser Asp Asp Glu Ser Glu Glu Glu Ala Gln Val Glu Pro Ser Lys 385 390 395 400 Lys Glu Glu <210> 4 <211> 378 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 4 Met Gly Val Glu Thr Ser Ser Ser Gly Thr Gln His Phe Ser Asp Asp 1 5 10 15 Gly Cys Val Ser Arg Lys Pro Asn Ala Thr Val Ser Phe Glu Lys 20 25 30 Pro Glue Arg Ala Asn Glue Leu Lys Asn His Lys Ile Tyr Lys Ser 35 40 45 Lys Only Trp Ser Leu Gln Arg Asn Gln Ile Leu Ser on Leu 50 55 60 Leu Asn Ala Leu Phe Ile Leu Lys Gln Ile Pro Ser Phe Gln Ser Leu 65 70 75 80 Val Asn Lys PhE His Leu Gln Tyr Lys Asn Leu Asp Gly Thr Tyr 85 90 95 Asp With Gly Lys Asp Asp With Tyr Phe Phe Val With Tyr Trp With Asn 100 105 110 You Thr I Have Arg Ser You Will Met Asp Trp You Will Glu Pro You 115 120 125 Only Lys Only Val Gly Only Asn Asn Arg Only Only Leu Thr Arg Phe 130 135 140 Lys Glu Gln Gly Trp Ser Leu Phe Tyr Tyr Thr Thr Ser Trp Thr Val 145 150 155 160 Gly Phe Tyr Leu Tyr Tyr Lys Ser Asp Tyr Phe Phe Asn Cys Asp His 165 170 175 Ile Phe Ile Gly Trp Pro Asn Asn Lys Leu Asp Phe Tyr Phe Lys Ser 180 185 190 Tyr Tyr Leu Ile Gln Met Ser Cys Trp Leu Green Green Ile Val Val Leu 195 200 205 Asn Ile Glu Glu Arg Arg Lys Asp Tyr Val Gln Met Phe 210 215 220 The Thr Cys Leu and the Gly Ser Tyr Tyr Tyr Phe Leu 225 230 235 240 Gln Ile Gly His Val Ile Leu Val Met Met Asp Ile Val Asp Val Phe 245 250 255 Leu Ser Leu Ala Lys Met Leu Lys Tyr Cys Gly Tyr Ser Thr Leu Cys 260 265 270 Asp Will Met Phe Phe Ile Phe Leu Will Be Trp Ile Ala Ile Arg His 275 280 285 How To Tyr And How To Get His Thr Thr Lys Ser Arg Asp 290,295,300 Leu Met Asn Ala Asp Cys Ser Arg Tyr Ala Ile Tyr Gly Gly Pro Leu 305 310 315 320 Asp Val Thr Pro Val Arg Cys Tyr Thr Asp Ser Thr Ile Arg Tyr Phe 325 330 335 Your Gly Your Gly Your Gln Your Thr Your Trp Met Tyr 340 345 350 Leu Ile Leu Lys Val Phe Ile Gly Val Ile Thr Gly Lys Gly Ala Glu 355 360 365 Asp Val Arg Server Asp Asp Glu Glu Server 370,375 <210> 5 <211> 396 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 5 Met Ser Gln Arg Glu Glu Thr Lys Asp Ala Ala Lys Lys Gln Ile Ala 1 5 10 15 Phe Ser Gly Ile Gly Ala Cys Gly Pro Pro Asn Phe Tyr Gly Thr Gln 20 25 30 Asp Ala His Ala Arg Leu Glu Glu Asp Leu Ala Arg Phe Leu Gly Ala 35 40 45 Glu Arg Ala Ile Leu Tyr Ser Gln Asp Phe Cys Thr Val Pro Ser Val 50 55 60 Ile Ala Cys Phe Leu Lys Arg Gly Asp Ile Val Val Tyr Asp Ser Gly 65 70 75 80 Ile Ala Leu Ala Thr Gln Lys Gly Ile Glu Leu Ser Arg Cys Thr Ala 85 90 95 Tyr His Phe Asn His Asn Asp Met Asp Asn Leu Glu Lys Val Leu Ala 100 105 110 Asp Leu Lys Pro Met Leu Asp Glu Gly Pro Leu Thr Arg Arg Phe Ile 115 120 125 Ile Thr Glu Gly Leu Phe Gln Asn Phe Gly Asp Ser Pro Asp Leu Arg 130 135 140 Arg Ile Cys Glu Leu Lys Lys Lys Phe Lys Tyr Arg Leu Phe Leu Asp 145 150 155 160 Glu Thr Leu Ser Ile Gly Val Leu Gly Ala Thr Gly Arg Gly Leu Pro 165 170 175 Glu Leu Tyr Gly Ile Pro Arg Thr Asp Val Glu Val Thr Thr Gly Ala 180 185 190 Leu Ser Tyr Ala Leu Gly Ser Ser Gly Gly Phe Cys Val Gly Glu Asn 195 200 205 Ala Met Val His His Gln Leu Ile Ser Ser Ser Ala Tyr Val Phe Ser 210 215 220 Ala Ala Ile Pro Pro Tyr Phe Ala Arg Val Ala Ser Val Ser Leu Arg 225 230 235 240 Leu Leu Gln Glu Asp Asp Ser Val Ser Arg Leu Gln Ser Ser Ile Asn 245 250 255 Phe Leu Tyr Ser Lys Phe Lys Glu Cys Gln Lys Leu Lys Lys Leu Val 260 265 270 Ile Ile Thr Ser Ser Asp Val Ser Pro Ile Leu His Leu Arg Leu His 275 280 285 Arg Asp Leu Arg Ser Arg Leu Asp Leu Pro Val Ser Tyr Gly Gly Pro 290 295 300 Gly Ser Ala Met Glu Lys Ile Val Gln Arg Gly Asp Glu His Gly Tyr 305 310 315 320 Phe Asp Glu Asn Tyr Asn Arg Glu Ser Gln Ile Leu Gln Gln Ile Val 325 330 335 Asp Arg Val Leu Asn Asn His Asn Ile Leu Ile Thr Arg Cys Lys Arg 340 345 350 Ile Leu His His Glu Lys Leu Pro Leu Leu Pro Glu Leu Met Ile His 355 360 365 Ile Asn Val Ala Phe Ser Glu Ser Glu Leu Ser Glu Ala Phe Glu Ala 370 375 380 Val Ser Ser Glu Ile Tyr Asn Val Leu Gln Gln Leu 385 390 395 <210> 6 <211> 561 <212> PRT <213> Pichia pastoris <400> 6 Met Ser Lys Thr Ile Pro Asp Ala Leu Ile Asp Asn Asp Ser Pro Gln 1 5 10 15 Glu Lys Ala Glu Lys Glu Phe Gly Ser Leu Thr Ser Lys Glu Trp Leu 20 25 30 Phe Val Ser Lys His Asn Pro Gly Glu Pro Leu Pro Val Pro Ile Glu 35 40 45 Asp Glu Pro Pro Tyr Phe Ile Leu Ile Ala Thr Tyr Leu Asn Tyr Leu 50 55 60 Ile Leu Ile Ile Ile Gly His Ile Arg Asp Phe Phe Gly Lys Leu Phe 65 70 75 80 His Pro Glu Leu Phe Arg Asp Val Met Val Lys Asp Gly Ile Ala Pro 85 90 95 Trp Tyr Ala Asn Phe Glu Ser Phe Tyr Thr Arg Arg Leu Lys Thr Arg 100 105 110 Leu Asp Asp Cys Phe Ala Arg Pro Ile Cys Gly Val Pro Gly Arg Tyr 115 120 125 Ile Lys Cys Tyr Asp Arg Thr Ser Asp Asp Tyr Asn Asn Thr Tyr Asn 130 135 140 Tyr Ser Gly Thr Val Thr Glu Arg Leu Asn Leu Ser Ser Tyr Asn Tyr 145 150 155 160 Leu Gly Phe Ala Gln Ser Ser Gly Leu Cys Thr Ser Glu Ser Ile Lys 165 170 175 Thr Val Glu Lys Tyr Gly Thr Asn Ser Ala Gly Pro Arg Val Ser Val 180 185 190 Gly Thr Thr Asp Leu His Leu Glu Cys Glu Asp Val Val Ala Lys Phe 195 200 205 Thr Gly Lys Asp Asn Ala Leu Val Phe Ser Met Gly Tyr Gly Thr Asn 210 215 220 Ala Asn Leu Phe Thr Ser Leu Val Asp Ser Lys Cys Cys Val Ile Ser 225 230 235 240 Asp Ser Leu Asn His Gly Ser Ile Arg Thr Gly Val Arg Leu Ser Gly 245 250 255 Ala Ser Val Lys Thr Phe Ala His Asn Asp Met Ala Ala Leu Glu Arg 260 265 270 Thr Leu Arg Ser Val Ile Ser Gln Gly Gln Pro Lys Thr His Arg Pro 275 280 285 Trp Lys Lys Ile Phe Val Ala Val Glu Gly Leu Tyr Ser Met Glu Gly 290 295 300 Thr Leu Cys Asn Leu Pro Lys Leu Val Glu Leu Arg Lys Arg Tyr Lys 305 310 315 320 Phe Tyr Leu Phe Val Asp Glu Ala His Ser Ile Gly Ala Met Gly Pro 325 330 335 Asn Gly Lys Gly Val Cys Asp Tyr Phe Gly Ile Ser Ser Ser Asn Ile 340 345 350 Asp Ile Met Met Gly Thr Phe Thr Lys Ser Phe Gly Ala Thr Gly Gly 355 360 365 Tyr Ile Ala Ala Asp Lys Ala Ile Ile Asp Arg Leu Lys Leu Asp Leu 370 375 380 Thr Thr Asn Thr Tyr Gly Glu Ser Met Ser Pro Ala Val Leu Thr Gln 385 390 395 400 Ile Ile Thr Ser Leu Lys Ile Ile Asp Gly Gln Leu Asn Gly Asn Glu 405 410 415 Gly Lys Glu Arg Leu Gln Arg Ile Ala Phe Asn Ser Arg Tyr Leu Arg 420 425 430 Leu Gly Leu Lys Arg Leu Gly Phe Ile Val Tyr Gly Ala Asp Asp Ser 435 440 445 Pro Val Ile Pro Leu Leu Leu Tyr Leu Pro Pro Lys Met Pro Ala Phe 450 455 460 Ser Arg Met Met Tyr Asp Arg Lys Val Ala Val Val Val Val Gly Tyr 465 470 475 480 Pro Ala Thr Asp Ile Thr Ser Ser Arg Ile Arg Phe Cys Val Ser Ser 485 490 495 Ser Leu Lys Lys Glu Asp Ile Asp Tyr Leu Leu Lys Cys Cys Asp Glu 500 505 510 Ile Gly Asp Thr Leu Phe Leu Lys Phe Ser Thr Gly Ile Ala Gly Gly 515 520 525 Glu Lys His Pro Gly Asp Tyr Lys Lys Gly Ile Ala Pro Arg Trp Thr 530 535 540 Leu Glu Glu Val Leu Glu Lys Thr Pro Glu Asp Cys Lys Ala Met 545 550 555 560 Tyr <210> 7 <211> 320 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 7 Met Val Lys Leu Ile Val Asn Pro Arg Ser Glu Thr Leu Arg Gln Ile 1 5 10 15 Asn Val Asp Thr Thr Pro Asn Thr Arg Val Arg Asp Ile Val Val Ala 20 25 30 Tyr Gly Lys Ala Asn Asn Ser Leu Ser Ser Arg Ile Arg Phe Thr 35 40 45 Lys Leu Glu Glu Asp Ala Ser Lys Pro Lys His Val Thr Leu 50 55 60 Asp Tyr Glu Lys Ser Leu Ala Gln Asn Gly Ile Val Phe Thr Asp Asp 65 70 75 80 Ser Asp Ser Lys Glu Val Tyr Ala Lys Asp Leu Gly Pro Gln Ile Ser 85 90 95 Trp Lys Leu Val Phe Leu Ile Glu Tyr Val Gly Pro Leu Ile Ile His 100 105 110 Pro Leu Tyr Tyr Gly Trp Phe Lys Pro Asp Tyr Asn Thr Leu Thr 115 120 125 Gln Lys Val Ser Phe Ile Leu Val Met Leu His Phe Leu Lys Arg Glu 130 135 140 Tyr Glu Thr Thr Phe Val His Leu Phe Ser Ser Asp Thr Met Pro Leu 145 150 155 160 Phe Asn Val Phe Lys Asn Ser Ala His Tyr Trp Ile Leu Ser Gly Leu 165 170 175 Ser Leu Ala Val Thr Ile Tyr Ala Pro Asp Ser Tyr Arg Asn Lys Phe 180 185 190 Ala Pro Thr Trp Lys Gln Phe Phe Phe His Val Ser Asp His Glu Asp 195 200 205 Ser Thr Val Leu Ala Leu Ile Gly Leu Trp Val Phe Ala Glu Leu Ser 210 215 220 Asn Phe Ile Thr His Gln Lys Leu Ala Ser Leu Arg Ala Asp Gly Ser 225 230 235 240 Arg Glu His Lys Ile Pro Tyr Gly Tyr Gly Phe Asn Leu Val Ser Phe 245 250 255 Pro Asn Tyr Phe Phe Glu Ser Val Ala Trp Leu Ala Phe Ala Leu Leu 260 265 270 Asn Asn Asn Trp Ser Ser Trp Val Phe Leu Thr Ile Ala Ser Ile Gln 275 280 285 Met Tyr Ile Trp Ala Ala Lys Lys His Lys Arg Tyr Leu Lys Glu Phe 290 295 300 Gly Asp Gln Tyr Pro Lys Asn Arg Lys Ala Met Ile Pro Phe Leu Leu 305 310 315 320 <210> 8 <211> 150 <212> PRT <213> Saccharomyces cerevisiae <400> 8 Met Ser Gln Pro Thr Pro Ile Ile Thr Thr Lys Ser Ala Ala Lys Pro 1 5 10 15 Lys Pro Lys Ile Phe Asn Leu Phe Arg Val Cys Phe Ile Ser Leu Leu 20 25 30 Leu Ile Ala Ala Val Glu Tyr Phe Lys Tyr Gly Thr Arg Ile Asn Tyr 35 40 45 Glu Trp Phe His Cys Thr Pro Ile Lys Glu Pro Gln Ser Gly Ser Val 50 55 60 Ile Lys Leu Trp Ala Arg Gly Gly Pro Ser Cys Asp Lys Arg Gly Glu 65 70 75 80 Tyr Lys Thr Ile Val Lys Arg Ile Thr Arg Asp Tyr Glu Pro Asn Asp 85 90 95 Glu His Leu Ser Phe Cys Ile Ile Glu Asn Asp Asn Val Pro Pro Val 100 105 110 His Tyr Pro Ile His Glu Asp Lys Gly Glu Pro Gly Tyr Val Ala Tyr 115 120 125 Val Gly Tyr Asp Thr Asp Ser Glu Leu Val Gln Glu Leu Cys Ala Asp 130 135 140 Ser Thr Ile Tyr His Met 145 150 <210> 9 <211> 80 <212> PRT <213> Saccharomyces cerevisiae <400> 9 Met Thr Gln His Lys Ser Ser Met Val Tyr Ile Pro Thr Thr Lys Glu 1 5 10 15 Ala Lys Arg Arg Asn Gly Lys Ser Glu Gly Ile Leu Asn Thr Ile Glu 20 25 30 Glu Val Val Glu Lys Leu Tyr Trp Thr Tyr Tyr Ile His Leu Pro Phe 35 40 45 Tyr Leu Met Ala Ser Phe Asp Ser Phe Phe Leu His Val Phe Phe Leu 50 55 60 Thr Ile Phe Ser Leu Ser Phe Phe Gly Ile Leu Lys Tyr Cys Phe Leu 65 70 75 80 <210> 10 <211> 775 <212> PRT <213> Pichia pastoris <400> 10 Met Gln Tyr Val Gly Arg Ala Ile Gly Ser Val Ser Lys Thr Trp Ser 1 5 10 15 Ser Ile Asn Pro Ala Thr Leu Ser Gly Ala Ile Asp Ile Ile Val Val 20 25 30 Glu Gln Glu Asn Gly Asp Leu Ala Cys Ser Pro Phe His Val Arg Phe 35 40 45 Gly Lys Phe Gln Leu Leu Arg Pro Ser Gln Lys Lys Val Asp Phe Ile 50 55 60 Val Asn Gly Glu Lys Thr Asp Leu Pro Met Lys Leu Gly Asp Gly Gly 65 70 75 80 Glu Ala Phe Phe Val Phe Glu Thr Asp Ala Ala Ile Pro Ser Glu Leu 85 90 95 Gln Thr Ser Pro Val Ile Ser Pro Val Ser Ser Pro Glu Pro Ala Ser 100 105 110 Pro Leu Ser Thr Pro Ser Arg Pro Asn Ser Glu Pro Asp Tyr Leu Glu 115 120 125 Leu Gly Asp Gly Glu Ser Thr Thr Ser Glu Leu Glu Asn Phe Lys Leu 130 135 140 Asn Arg Tyr Pro Tyr Leu Ser Thr Glu Val Ser His Ser Asp Pro Gly 145 150 155 160 Val Gly Ser Val Ser Ser Ser Pro Glu Asn Thr Lys Ile Ile Gln Lys 165 170 175 Ile Ser Arg Lys Leu Asn Thr Lys Asn Ile Pro Ser Lys Val Asp Asn 180 185 190 Asn Gly Asn Leu Val Leu Asp Ile Gln Gly Tyr Lys Ser Asp Asp Leu 195 200 205 Asp Asp Asn Ser Lys Ser Leu Lys Gln Leu Leu Leu Ala Glu Leu Gly 210 215 220 Glu Asp Val Asp Leu Asp Lys Val Ile Glu Lys Asp His Glu Gly Asn 225 230 235 240 Ile Met Ile Asn Gly Ala Ile Ser Leu Leu Ser Gly Glu Asp Asp Leu 245 250 255 Glu Ser Phe Pro Gln Thr Asp Asp Gln Ala Glu Ser Leu Lys Leu Asp 260 265 270 Leu Glu Ser Asp Lys Ser Asp Ile Glu Ser Asp Thr Asn His Glu Leu 275 280 285 Ser Arg Tyr Phe Lys Thr Leu Arg Leu Thr Ser Asp Gln Leu Lys Cys 290 295 300 Leu Thr Leu Lys Lys Gly Ile Asn Glu Leu Lys Phe Ser Val Asn Lys 305 310 315 320 Gly Lys Ser Val Val Thr Ala Asn Leu Tyr Phe Trp Asp Tyr Tyr Asp 325 330 335 Pro Ile Val Ile Ser Asp Ile Asp Gly Thr Ile Thr Lys Ser Asp Ala 340 345 350 Leu Gly His Val Phe Thr Met Ile Gly Arg Asp Trp Thr His Lys Gly 355 360 365 Val Ala Lys Leu Phe Ser Asp Ile Lys Ser Asn Gly Tyr Asn Ile Met 370 375 380 Tyr Leu Thr Ala Arg Ser Val Gly Gln Ala Asp Ser Thr Arg Tyr Tyr 385 390 395 400 Leu Asn Asn Ile Glu Gln Glu Gly Leu Arg Leu Pro Gln Gly Pro Val 405 410 415 Ile Leu Ser Pro Asp Arg Thr Met Ala Ala Leu Arg Arg Glu Val Ile 420 425 430 Leu Lys Lys Pro Glu Val Phe Lys Met Ala Cys Leu Asn Asp Ile Lys 435 440 445 Lys Leu Tyr Leu Thr Asn Thr Lys Asp Leu Asn Pro Asn Thr Asp Ser 450 455 460 Ala Asp Phe Thr Asp Ile Asn Thr Asn Thr Leu Arg Ser Ser Ser Leu 465 470 475 480 Thr Glu Asp Val Gln Thr Pro Phe Tyr Ala Gly Phe Gly Asn Arg Ile 485 490 495 Thr Asp Ala Leu Ser Tyr Arg Ser Val Gly Ile Pro Ser Ser Arg Ile 500 505 510 Phe Thr Ile Asn Pro Asp Gly Asp Val His Met Glu Leu Leu Glu Leu 515 520 525 Ala Gly Tyr Arg Ser Ser Tyr Val His Ile Ser Glu Leu Val Asp His 530 535 540 Phe Phe Pro Pro Val Asn Thr Glu Leu Phe Lys Ser Met Pro Ser Asp 545 550 555 560 Thr Tyr Arg Asn Thr Ala Lys Phe Ser Asp Val Asn Tyr Trp Lys Glu 565 570 575 Pro Leu Tyr Asn Phe Glu Glu Leu Ser Asp Glu Asp Ser Ser Glu Asp 580 585 590 Glu Leu Arg Arg Arg Lys Glu Glu Glu Arg Leu Gln Ser Ala Pro Arg 595 600 605 Ser Pro Ile Leu Ala Ala Gly Ala Ser Phe Phe Lys Gly Ser Ser Ser 610 615 620 Leu Leu Gly Ser Pro Glu Arg Met Thr Leu Ser Asp Pro Lys Pro Thr 625 630 635 640 Glu Val Ala Pro Ser Thr Ile Lys Pro Pro Lys Ser Val Gly Ser Val 645 650 655 Ser Ser Asp Glu Glu Lys Leu Lys Asp His Asp Asp Phe Ile Asp Val 660 665 670 Asp His Glu Asp Glu Thr Leu Asp Asp Asp Asp Asp Pro Phe Asp Tyr 675 680 685 Asp Tyr Glu Tyr Glu Asp Glu Glu Glu Glu Asn Asp Asp Val Asp Glu 690 695 700 Val Asp Asp Gly Glu Glu Tyr Ser Asp Asp Tyr Tyr Asp Glu Glu Asp 705 710 715 720 Asp Tyr Asp Glu Glu Leu Asp His Thr Leu Glu Pro Asp Gln Lys Lys 725 730 735 Glu Leu Asp Gln Thr Ala Glu Ala Asn Gln Leu Pro Pro Ser Gly Pro 740 745 750 Asp Glu Met Glu Ser Lys Ser Phe Lys Lys Ala Ser Asp Leu Ile Ser 755 760 765 Lys Met Arg Ile Asp Asp Ser 770 775 <210> 11 <211> 313 <212> PRT <213> Pichia pastoris <400> 11 Met Lys Leu Ser Thr Asn Leu Ile Leu Ala Ile Ala Ala Ala Ser Ala 1 5 10 15 Val Val Ser Ala Ala Pro Val Ala Pro Ala Glu Glu Ala Ala Asn His 20 25 30 Leu His Lys Arg Ala Tyr Tyr Thr Asp Thr Thr Lys Thr His Thr Phe 35 40 45 Thr Glu Val Val Thr Val Tyr Arg Thr Leu Lys Pro Gly Glu Ser Ile 50 55 60 Pro Thr Asp Ser Pro Ser His Gly Gly Lys Ser Thr Lys Lys Gly Lys 65 70 75 80 Gly Ser Thr Thr His Ser Gly Ala Pro Gly Ala Thr Ser Gly Ala Pro 85 90 95 Thr Asp Asp Thr Thr Ser Thr Ser Gly Ser Val Gly Leu Pro Thr Ser 100 105 110 Ala Thr Ser Val Thr Ser Ser Thr Ser Ser Ala Ser Thr Thr Ser Ser 115 120 125 Gly Thr Ser Ala Thr Ser Thr Gly Thr Gly Thr Ser Thr Ser Thr Ser 130 135 140 Thr Gly Thr Gly Thr Gly Thr Thr Gly Thr Gly Thr Thr Ser Ser Ser 145 150 155 160 Thr Ser Ser Ser Ala Thr Ser Thr Pro Thr Gly Ser Ile Asp Ala Ile 165 170 175 Ser Gln Thr Leu Leu Asp Thr His Asn Asp Lys Arg Ala Leu His Gly 180 185 190 Val Pro Asp Leu Thr Trp Ser Thr Glu Leu Ala Asp Tyr Ala Gln Gly 195 200 205 Tyr Ala Asp Ser Tyr Thr Cys Gly Ser Ser Leu Glu His Thr Gly Gly 210 215 220 Pro Tyr Gly Glu Asn Leu Ala Ser Gly Tyr Ser Pro Ala Gly Ser Val 225 230 235 240 Glu Ala Trp Tyr Asn Glu Ile Ser Asp Tyr Asp Phe Ser Asn Pro Gly 245 250 255 Tyr Ser Ala Gly Thr Gly His Phe Thr Gln Val Val Trp Lys Ser Thr 260 265 270 Thr Gln Leu Gly Cys Gly Tyr Lys Glu Cys Ser Thr Asp Arg Tyr Tyr 275 280 285 They Have Cys Glu Tyr Only Pro Arg Gly Asn Only They Have Only Gly Tyr 290,295,300 Phe Glu Asp Asn Val Leu Pro Pro Val 305 310 <210> 12 <211> 515 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 12 Met Ser Leu Val Gln Leu Glu Ile Gln Lys Ser Ser Leu Glu Glu 1 5 10 15 Thr Leu Val Glu Lys Leu Ser Ile Leu Phe Val Ala Pro Phe Leu Leu 20 25 30 Asn Ala Leu Trp Gln Phe Ile Tyr Ser Phe Arg Lys Asp Arg Val Pro 35 40 45 Leu Val Phe His Trp Val Pro Trp Val Gly Ser Ala Val Thr Tyr Gly 50 55 60 Met Gln Pro Tyr Glu Phe Phe Ala Asp Cys Gln Arg Lys Tyr Gly Asp 65 70 75 80 Val Phe Ala Phe Val Leu Leu Gly Lys Val Met Thr Val Tyr Leu Gly 85 90 95 Pro Lys Gly His Glu Phe Ile Leu Asn Ala Lys Leu Asn Asp Val Cys 100 105 110 Ala Glu Asp Ala Tyr Lys His Leu Thr Thr Pro Val Phe Gly Glu Gly 115 120 125 Val Ile Tyr Asp Cys Pro Asn Trp Lys Leu Met Asp Gln Lys Lys Phe 130 135 140 Val Lys Gly Ser Leu Thr Lys Glu Ser Phe Arg Ser Tyr Val Pro Lys 145 150 155 160 Ile Arg Asp Glu Val Leu Asp Tyr Ile Asn Asn Asp Pro Asn Phe Met 165 170 175 Gly Gly Asp Ser Lys Lys Lys Thr Gly Lys Thr Asn Val Leu Asn Ser 180 185 190 Gln Ser Glu Leu Thr Ile Leu Thr Ala Ser Arg Ser Leu Leu Gly Asp 195 200 205 Asp Met Arg Lys Leu Leu Thr Lys Lys Trp Ala Lys Leu Phe Ser Asp 210 215 220 Leu Asp Lys Gly Phe Thr Pro Leu Asn Phe Ile Phe Ser His Leu Pro 225 230 235 240 Leu Pro Ser Tyr Trp Thr Arg Asp His Ala Gln Lys Thr Ile Ser Glu 245 250 255 Thr Tyr Leu Ser Leu Ile Asn Lys Arg Arg Ala Thr Asn Asp Ile Gly 260 265 270 Asp Arg Asp Leu Ile Asp Ser Leu Met Lys Ser Ser Thr Tyr Lys Asp 275 280 285 Gly Ser Lys Met Thr Asp Glu Glu Ile Ser His Leu Leu Ile Gly Val 290 295 300 Leu Met Gly Gly Gln His Thr Ser Ala Ser Thr Ser Ser Trp Phe Leu 305 310 315 320 Leu His Leu Gly Glu Lys Pro Glu Leu Gln Glu Glu Leu Phe Glu Glu 325 330 335 Gln Glu Arg Val Leu Gln Gly Arg Glu Leu Thr Tyr Asp Asp Leu Ala 340 345 350 Asn Met Pro Leu His Asn Gln Val Ile Lys Glu Thr Leu Arg Met His 355 360 365 Met Pro Leu His Ser Ile Phe Arg Lys Val Thr Arg Pro Leu Pro Val 370 375 380 Pro Asn Ser Lys Tyr Val Val Pro Lys Gly His Tyr Val Leu Val Ser 385 390 395 400 Pro Gly Phe Ala Met Thr Asn Asp Ala Tyr Phe Pro Asn Ala Ser Asp 405 410 415 Phe Gln Pro His Arg Trp Asp Glu Thr Val Glu Pro Val Ser Ala Asp 420 425 430 Ala Lys Glu Thr Val Asp Tyr Gly Phe Gly Lys Val Ser Lys Gly Val 435 440 445 Ser Ser Pro Tyr Leu Pro Phe Gly Gly Gly Arg His Arg Cys Ile Gly 450 455 460 Glu His Phe Ala Tyr Cys Gln Leu Gly Thr Ile Leu Asn Thr Phe Val 465 470 475 480 Arg Thr Phe Lys Trp Lys Ala Val Val Pro Gln Pro Asp Tyr Thr Ser 485 490 495 Met Val Thr Leu Pro Glu Pro Asn Leu Ser Thr Ile Thr Trp Glu Arg 500 505 510 Arg Asp Asn 515 <210> 13 <211> 986 <212> PRT <213> Pichia pastoris <400> 13 Met Leu Thr Gly Leu Ser Lys Ile Cys Ala His Arg Pro Ile His Thr 1 5 10 15 Ile Val Val Thr Ala Leu Leu Val Ser Leu Ala Tyr Leu Thr Ile Val 20 25 30 Glu Glu Tyr Thr Ser Arg Ser Ser Leu Ser Asn Pro Phe Ile Ser Phe 35 40 45 Tyr His Pro Pro Gly Asn Ser Asp Tyr Gln Asn Trp Ile Pro Val Asp 50 55 60 Asp Ser Val Lys Leu Lys Ser Lys Ser Ala Gln His Leu Ser Val Cys 65 70 75 80 Ala Leu Lys Phe Lys Arg Val Asn Gly His Gln Ile Pro Asp Leu Ala 85 90 95 Gly Ser Phe Gln Ser Ala Asp Pro Thr Glu Ile Phe Val Val Gln Asp 100 105 110 Phe Asp Lys Ser Phe Asp Tyr Phe Asp Ser Ile Ser Thr Ile Glu Gly 115 120 125 Lys Asp Gly Ile Gln Trp Lys Val Arg His Pro Asn Arg Leu Gly Arg 130 135 140 Tyr Ser Glu Tyr Phe Arg Ser Val Phe Ser Lys Thr Leu Arg Leu Val 145 150 155 160 Gln Gly Ala Glu Pro Phe Asp Ile Val Leu Ile Ala Phe Ala Tyr Val 165 170 175 Ala Met Trp Tyr Thr Phe Leu Gln Leu Tyr Tyr Glu Met Lys Thr Lys 180 185 190 Ala Asn Ser Asn Phe Trp Leu Thr Phe Gly Ser Leu Leu Ser Ser Gly 195 200 205 Cys Ala Phe Val Phe Ala Leu Ala Val Thr Val Lys Val Tyr Gly Ile 210 215 220 Lys Val Pro Leu Thr Ser Leu Thr Glu Gly Val Pro Phe Leu Val Ala 225 230 235 240 Thr Ile Gly Phe Lys His Lys Val Ala Phe Thr Val Pro Ile Leu Gln 245 250 255 Ala Ser Arg Ser Lys Lys Ala Lys Glu Ile Pro Asp Thr Ile Ile Ser 260 265 270 Val Ile Glu Gln Thr Thr Gly Trp Pro Leu Ile Lys Asp His Leu Ile 275 280 285 Met Ile Ser Ala Phe Leu Ala Cys Ser Phe Tyr Ala Pro Arg Met Glu 290 295 300 Gly Leu Lys Asn Phe Cys Ile Leu Ser Ala Asn Ile Leu Thr Phe Asp 305 310 315 320 Leu Ile Met Ile Phe Thr Phe Phe Thr Ala Val Leu Ser Leu Lys Ala 325 330 335 Gln Ile Asn Lys Val His Glu Thr Thr Ala Leu Gln Gln Val Leu Glu 340 345 350 Glu Asp Gly Ile Ala Glu Asp Val Ala Glu Arg Ile Ala Ala Ser Asn 355 360 365 Arg Asn Met Phe Ser Arg Ser Thr Ser Val Val Ser Phe Lys Val Ile 370 375 380 Met Ile Ala Gly Phe Leu Gly Phe His Leu Phe Val Leu Gly Thr Ser 385 390 395 400 Trp Leu Tyr Asp Ser Asp Val Ser Ser Ser Ser Ile Phe Gly Lys Ser 405 410 415 Asn Val Ser Ala Leu Ser Lys Ala Ala Ala Lys His Ile Pro Ile Gly 420 425 430 Ser Glu Gly Thr Ile Val Thr Ile Met Pro Thr Arg Val Tyr Met Pro 435 440 445 Val Asp Leu Leu Leu Lys Leu Glu Asp Asp Phe Leu Asn Ile Phe Ser 450 455 460 Lys Ile Ser Ala Ser Ile Thr Asp Pro Leu Ile Ser Lys Leu Leu Phe 465 470 475 480 Ile Ile Thr Gly Ile Ser Ala Thr Ile Asn Val Tyr Leu Leu Asn Ala 485 490 495 Ala Arg Phe His Ser Ser Arg Glu Ile Ala Val Ser Thr Ile Ala Lys 500 505 510 Pro Gln Thr Pro Asp Val Val Pro Thr Val Glu Pro Leu Pro Asn Glu 515 520 525 Asn Asp Thr Ser Ile Arg Pro Leu Glu Glu Met Val Ser Leu Leu Lys 530 535 540 Glu Gly Lys Thr Arg Glu Leu Asn Asn Asp Glu Val Ser Ser Leu Val 545 550 555 560 Val Gln Gly Lys Leu Pro Leu Tyr Ala Leu Glu Lys Gln Leu Val Asp 565 570 575 Lys Thr Arg Ala Val Ile Val Arg Arg Lys Ala Ile Ala Ser Leu Ala 580 585 590 Asp Ala Pro Val Leu Arg Thr Glu Lys Leu Pro Tyr Lys Asp Tyr Asp 595 600 605 Tyr Asp Arg Val Phe Gly Ala Cys Cys Glu Asn Val Ile Gly Phe Met 610 615 620 Pro Leu Pro Val Gly Val Ala Gly Pro Leu Ile Ile Asp Gly Lys Pro 625 630 635 640 Tyr His Ile Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Thr 645 650 655 Met Arg Gly Cys Lys Ala Ile Asn Ser Gly Gly Gly Val Glu Thr Val 660 665 670 Leu Thr Ala Asp Gly Met Thr Arg Gly Pro Cys Val Ser Phe Pro Ser 675 680 685 Leu Ser Arg Ala Gly Ala Ala Lys Met Trp Leu Asp Ser Glu Glu Gly 690 695 700 Gln Lys Thr Ile Lys Gly Ala Phe Asn Ser Thr Ser Arg Phe Ala Arg 705 710 715 720 Leu Gln His Val Lys Thr Thr Leu Ala Gly Thr Leu Leu Phe Ile Arg 725 730 735 Phe Lys Thr Thr Thr Gly Asp Ala Met Gly Met Asn Met Ile Ser Lys 740 745 750 Gly Val Glu Tyr Ser Leu Lys Phe Met Ser Glu Glu Cys Asp Trp Pro 755 760 765 Asp Met Glu Val Ile Ser Val Ser Gly Asn Tyr Cys Thr Asp Lys Lys 770 775 780 Val Ala Ala Ile Asn Trp Ile Glu Gly Arg Gly Lys Ser Val Val Ala 785 790 795 800 Glu Ala Arg Ile Pro Ala Asp Val Val Arg Ser Val Leu Lys Ser Asp 805 810 815 Val Glu Ala Leu Val Glu Leu Asn Val Ser Lys Asn Leu Ile Gly Ser 820 825 830 Ala Met Ala Gly Ser Ile Gly Gly Phe Asn Ala Gln Ala Ala Asn Leu 835 840 845 Val Thr Ala Val Tyr Leu Ala Thr Gly Gln Asp Pro Ala Gln Asn Val 850 855 860 Glu Ser Ser Asn Cys Ile Thr Leu Met Asn Lys Leu Pro Asn Gly Asp 865 870 875 880 Leu Gln Ile Ser Val Ser Met Pro Ser Ile Glu Val Gly Thr Ile Gly 885 890 895 Gly Gly Thr Val Leu Glu Pro Gln Gly Ser Met Leu Glu Leu Leu Gly 900 905 910 Val Lys Gly Pro His Pro Thr Asn Pro Gly Ala Asn Ser Arg Gln Leu 915 920 925 Ala Lys Ile Val Ala Ser Ala Val Leu Ala Ala Glu Leu Ser Leu Cys 930 935 940 Ser Ala Leu Ala Ala Gly His Leu Val Gln Ser His Met Thr His Asn 945 950 955 960 Arg Lys Gln Ala Pro Val Lys Glu Val Asn Gly Thr Ala Ala Arg Leu 965 970 975 Ala Glu Gln Ser Lys Ile Cys Ile Lys Ser 980 985 <210> 14 <211> 471 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 14 Met Thr Pro Asp Val Val Pro Thr Val Glu Pro Leu Pro Asn Glu Asn 1 5 10 15 Asp Thr Ser Ile Arg Pro Leu Glu Glu Met Val Ser Leu Leu Lys Glu 20 25 30 Gly Lys Thr Arg Glu Leu Asn Asn Asp Glu Val Ser Ser Leu Val Val 35 40 45 Gln Gly Lys Pro Leu Tyr Ala Glu Lys Gln Leu Val Asp Lys 50 55 60 Thr Arg Ala Val Ile Val Arg Lys Ala Ile Ala Ser Leu Ala Asp 65 70 75 80 Ala Pro Val Leu Arg Thr Glu Lys Leu Pro Tyr Lys Asp Tyr Asp Tyr 85 90 95 Asp Arg Val Phe Gly Ala Cys Cys Glu Asn Val Ile Gly Phe Met Pro 100 105 110 Leu Pro Val Gly Val Ala Gly Pro Leu Ile Ile Asp Gly Lys Pro Tyr 115 120 125 His Ile Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Thr Met 130 135 140 Arg Gly Cys Lys Ala Ile Asn Ser Gly Gly Gly Val Glu Thr Val Leu 145 150 155 160 Thr Ala Asp Gly Met Thr Arg Gly Pro Cys Val Ser Phe Pro Ser Leu 165 170 175 Ser Arg Ala Gly Ala Ala Lys Met Trp Leu Asp Ser Glu Glu Gly Gln 180 185 190 Lys Thr Ile Lys Gly Ala Phe Asn Ser Thr Ser Arg Phe Ala Arg Leu 195 200 205 Gln His Val Lys Thr Thr Leu Ala Gly Thr Leu Leu Phe Ile Arg Phe 210 215 220 Lys Thr Thr Thr Gly Asp Ala Met Gly Met Asn Met Ile Ser Lys Gly 225 230 235 240 Val Glu Tyr Ser Leu Lys Phe Met Ser Glu Glu Cys Asp Trp Pro Asp 245 250 255 Met Glu Val Ile Ser Val Ser Gly Asn Tyr Cys Thr Asp Lys Lys Val 260 265 270 Ala Ala Ile Asn Trp Ile Glu Gly Arg Gly Lys Ser Val Val Ala Glu 275 280 285 Ala Arg Ile Pro Ala Asp Val Val Arg Ser Val Leu Lys Ser Asp Val 290 295 300 Glu Ala Leu Val Glu Leu Asn Val Ser Lys Asn Leu Ile Gly Ser Ala 305 310 315 320 Met Ala Gly Ser Ile Gly Gly Phe Asn Ala Gln Ala Ala Asn Leu Val 325 330 335 Thr Ala Val Tyr Leu Ala Thr Gly Gln Asp Pro Ala Gln Asn Val Glu 340 345 350 Ser Ser Asn Cys Ile Thr Leu Met Asn Lys Leu Pro Asn Gly Asp Leu 355 360 365 Gln Ile Ser Val Ser Met Pro Ser Ile Glu Val Gly Thr Ile Gly Gly 370 375 380 Gly Thr Val Leu Glu Pro Gln Gly Ser Met Leu Glu Leu Leu Gly Val 385 390 395 400 Lys Gly Pro His Pro Thr Asn Pro Gly Ala Asn Ser Arg Gln Leu Ala 405 410 415 Lys Ile Val Ala Ser Ala Val Leu Ala Ala Glu Leu Ser Leu Cys Ser 420 425 430 Ala Leu Ala Ala Gly His Leu Val Gln Ser His Met Thr His Asn Arg 435 440 445 Lys Gln Ala Pro Val Lys Glu Val Asn Gly Thr Ala Ala Arg Leu Ala 450 455 460 Glu Gln Ser Lys Ile Cys Ile 465,470 <210> 15 <211> 504 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 15 Met Gly Ile Ser Only Thr Ile Asn Val Tyr Leu Leu Asn Only Only Arg 1 5 10 15 Phe His Ser Arg Glu Ile Val Ser Thr Ile Ala Lys Pro Gln 20 25 30 Thr Pro Asp Val Val Pro Thr Val Glu Pro Leu Pro Asn Glu Asn Asp 35 40 45 Thr Ser Ile Arg Pro Leu Glu Glu Met Val Ser Leu Leu Lys Glu Gly 50 55 60 Lys Thr Arg Glu Leu Asn Asn Asp Glu Will Be Ser Leu Will Be Gln 65 70 75 80 Gly Lys Pro Leu Tyr Ala Glu Lys Gln Leu Val Asp Lys Thr 85 90 95 Arg Ala Val Ile Val Arg Lys Ala Ile Ala Ser Leu Ala Asp Ala 100 105 110 Pro Val Leu Arg Thr Glu Lys Leu Pro Tyr Lys Asp Tyr Asp Tyr Asp 115 120 125 Arg Val Phe Gly Ala Cys Cys Glu Asn Val Ile Gly Phe Met Pro Leu 130 135 140 Pro Val Gly Val Ala Gly Pro Leu Ile Ile Asp Gly Lys Pro Tyr His 145 150 155 160 Ile Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Thr Met Arg 165 170 175 Gly Cys Lys Ala Ile Asn Ser Gly Gly Gly Val Glu Thr Val Leu Thr 180 185 190 Ala Asp Gly Met Thr Arg Gly Pro Cys Val Ser Phe Pro Ser Leu Ser 195 200 205 Arg Ala Gly Ala Ala Lys Met Trp Leu Asp Ser Glu Glu Gly Gln Lys 210 215 220 Thr Ile Lys Gly Ala Phe Asn Ser Thr Ser Arg Phe Ala Arg Leu Gln 225 230 235 240 His Val Lys Thr Thr Leu Ala Gly Thr Leu Leu Phe Ile Arg Phe Lys 245 250 255 Thr Thr Thr Gly Asp Ala Met Gly Met Asn Met Ile Ser Lys Gly Val 260 265 270 Glu Tyr Ser Leu Lys Phe Met Ser Glu Glu Cys Asp Trp Pro Asp Met 275 280 285 Glu Val Ile Ser Val Ser Gly Asn Tyr Cys Thr Asp Lys Lys Val Ala 290 295 300 Ala Ile Asn Trp Ile Glu Gly Arg Gly Lys Ser Val Val Ala Glu Ala 305 310 315 320 Arg Ile Pro Ala Asp Val Val Arg Ser Val Leu Lys Ser Asp Val Glu 325 330 335 Ala Leu Val Glu Leu Asn Val Ser Lys Asn Leu Ile Gly Ser Ala Met 340 345 350 Ala Gly Ser Ile Gly Gly Phe Asn Ala Gln Ala Ala Asn Leu Val Thr 355 360 365 Ala Val Tyr Leu Ala Thr Gly Gln Asp Pro Ala Gln Asn Val Glu Ser 370 375 380 Ser Asn Cys Ile Thr Leu Met Asn Lys Leu Pro Asn Gly Asp Leu Gln 385 390 395 400 Ile Ser Val Ser Met Pro Ser Ile Glu Val Gly Thr Ile Gly Gly Gly 405 410 415 Thr Val Leu Glu Pro Gln Gly Ser Met Leu Glu Leu Leu Gly Val Lys 420 425 430 Gly Pro His Pro Thr Asn Pro Gly Ala Asn Ser Arg Gln Leu Ala Lys 435 440 445 Ile Val Ala Ser Ala Val Leu Ala Ala Glu Leu Ser Leu Cys Ser Ala 450 455 460 Leu Ala Ala Gly His Leu Val Gln Ser His Met Thr His Asn Arg Lys 465 470 475 480 Gln Ala Pro Val Lys Glu Val Asn Gly Thr Ala Ala Arg Leu Ala Glu 485 490 495 Gln Ser Lys Ile Cys Ile Lys Ser 500 <210> 16 <211> 460 <212> PRT <213> Pichia pastoris <400> 16 Met Pro Glu Lys Lys Asn Ser Arg Ser Ala Asp Glu Ala Leu Ser Phe 1 5 10 15 Leu Ala Lys Thr Asn Val Glu Arg Pro Met His Tyr Ser Lys Thr Gly 20 25 30 Asn Ile Thr Pro Asp Thr Val Ser Ser Arg Glu Asp His Tyr Gln Asp 35 40 45 Tyr Asp Asp Ser Gln Asp Asp Ile Ile Asn Asn Lys Leu Leu Gln Arg 50 55 60 Arg Gln Gly Gly Pro His Asn Lys Ile Glu Lys Gln Arg Arg Phe Ala 65 70 75 80 Leu Leu Arg Ser Ser Leu Asn Arg Arg Leu Glu Thr Leu Val Ile Leu 85 90 95 Trp His Thr Ile Thr Ile Pro Phe Leu Ala Ser Leu Phe Phe Val Leu 100 105 110 Cys Thr Ile Pro Met Leu Trp Pro Leu Ile Ile Val Tyr Leu Val Tyr 115 120 125 Phe Tyr Ile Asp Ala Asn Thr Pro Ser Asn Gly Lys Ser Ala Asp Arg 130 135 140 Arg Val Glu Trp Phe Arg Ser Leu His Ile Trp Lys His Phe Val Asn 145 150 155 160 Tyr Tyr Pro Ile Ser Val Tyr Lys Thr Val Asp Leu Glu Pro Thr Phe 165 170 175 Lys Thr Lys Lys Ile Glu Ile Ile Leu Pro Lys Tyr His Gln Val Thr 180 185 190 Thr Tyr Leu Pro Ser Ser Val Arg Lys Tyr Ile Pro Thr His Arg Val 195 200 205 Leu Ile Glu Lys Glu Ile Lys Thr Gly Pro Arg Tyr Ile Phe Gly Tyr 210 215 220 His Pro His Gly Val Val Ser Leu Gly Ile Thr Gly Ala Phe Gly Thr 225 230 235 240 Asn Gly Cys Asn Ile Gly Glu Leu Leu Pro Gly Ile Arg Ile Tyr Leu 245 250 255 Leu Thr Leu Ile Thr Gln Phe Lys Leu Pro Leu Leu Arg Asp Tyr Leu 260 265 270 Met Ala Leu Gly Ile Ser Ser Val Ser Lys Arg Asn Val Thr Ala Leu 275 280 285 Ile Lys Arg Asn Gln Ser Val Cys Ile Val Ile Gly Gly Ala Ser Glu 290 295 300 Ser Leu Leu Ser Lys Pro His Thr Ile Asp Ile Val Leu Lys Lys Arg 305 310 315 320 Lys Gly Phe Val Lys Val Ala Leu Glu Leu Gly Asp Thr Glu Leu Val 325 330 335 Pro Val Phe Gly Phe Gly Glu Asn Thr Ala Tyr Asn Val Phe Asp Pro 340 345 350 Ser Val Ser Gly Lys Ser Cys Ser Val Leu Asn Tyr Val Arg Lys Gln 355 360 365 Met Cys Gly Phe Gln Leu Trp Leu Lys Gln His Phe Gly Phe Thr Phe 370 375 380 Pro Phe Phe His Ala Arg Gly Val Phe Asn His Asp Phe Gly Leu Leu 385 390 395 400 Pro Tyr Arg Lys Pro Ile Asn Leu Val Ile Gly Arg Pro Ile Pro Val 405 410 415 Pro Tyr Ile His Ser Pro Thr Gln Glu Gln Ile Asp His Tyr His Ser 420 425 430 Leu Tyr Val Glu Glu Leu Lys Arg Val Phe Glu Gln Asn Lys Glu Arg 435 440 445 Phe Asn Ala Gly Ser Leu Glu Leu Arg Ile Val Glu 450 455 460 <210> 17 <211> 652 <212> PRT <213> Pichia pastoris <400> 17 Met Gln Leu Arg Lys Arg Gly Asn Glu Arg Ser Arg Leu Glu Ser His 1 5 10 15 Ile Gly Asp Ser Asp Thr Val Ile Asp Leu Asp Asp Ser Ser Val Asn 20 25 30 Asp Thr Leu Pro Asp Glu Asp Asn Ile Ala Lys Pro Arg Lys Ala Ser 35 40 45 Thr His Arg Arg Pro Ser Leu Arg Lys Ile His Ser Ala Glu Thr Val 50 55 60 Arg Arg Phe Tyr Glu Ser Lys Asn Val Ile Phe Ile Phe Gly Ala Phe 65 70 75 80 Ile Gly Ile Ala Val Ala Leu Tyr Phe Gly Ala Thr Ser Ser Glu Tyr 85 90 95 Pro Ile Pro Asp Ile Asp Gln Leu Val Asn Phe Asp Ser Leu Ser Thr 100 105 110 Tyr Phe Asp Asp Trp Lys Asp Val Leu Pro Lys Ser Leu Gln Ser Ile 115 120 125 Val Glu Ser Thr Gln Phe Asn Gln Asn Ser Lys Ile Leu Ser Ser Glu 130 135 140 Ser Phe Ala Val Gly Lys Gln Leu Lys Ser Lys Ser Met Ile Glu Ala 145 150 155 160 Asn His Ser Ile Val Leu Val Pro Gly Val Ile Ser Thr Gly Leu Glu 165 170 175 Ser Trp Gly Leu Glu Gly Thr Pro Asp Cys Pro Ser Glu Gly His Phe 180 185 190 Arg Lys Arg Leu Trp Gly Ser Phe Tyr Met Leu Arg Thr Met Phe Leu 195 200 205 Asp Lys Ala Cys Trp Leu Lys His Ile Met Leu Asp Thr Thr Thr Gly 210 215 220 Leu Asp Pro Pro Gly Ile Ser Leu Arg Ala Ala Gln Gly Phe Glu Ala 225 230 235 240 Ala Asp Phe Phe Ile Ala Gly Tyr Trp Ile Trp Asn Lys Ile Leu Gln 245 250 255 Asn Leu Ala Val Ile Gly Tyr Asn Pro Asn Asn Met Val Ser Ala Ala 260 265 270 Tyr Asp Trp Arg Leu Ala Phe Leu Asp Leu Glu Leu Arg Asp Ala Tyr 275 280 285 Phe Ser Lys Leu Lys Gly Phe Val Glu Leu Gln Lys His Gln Ser Gly 290 295 300 Lys Lys Ser Val Leu Val Gly His Ser Met Gly Ser Gln Val Ile Tyr 305 310 315 320 Tyr Phe Met Lys Trp Val Glu Ala Asp Gly Tyr Gly Asn Gly Gly Pro 325 330 335 Asn Trp Val Asn Asp His Val Asp Ser Phe Val Asp Ile Ser Gly Cys 340 345 350 Met Leu Gly Thr Pro Lys Ala Ile Pro Ala Leu Leu Ser Gly Glu Met 355 360 365 Lys Asp Thr Val Gln Leu Asn Ala Leu Ala Val Glu Gly Leu Glu Lys 370 375 380 Phe Leu Ser Arg Arg Glu Arg Ala Asp Met Ile Arg Ser Phe Gly Gly 385 390 395 400 Ile Ala Ser Met Ile Pro Lys Gly Gly Asp Leu Ile Trp Gly Asn Leu 405 410 415 Glu Ser Ser Pro Asp Asp Ala Thr Ser Ile Gly Asp Leu Gly Asn Asp 420 425 430 Thr Tyr Gly Asn Phe Ile Arg Phe Lys Glu Pro Val Gly Lys Tyr Ser 435 440 445 Gln Lys Asn Leu Thr Val Thr Asp Ser Ile Gln Phe Leu Met Glu Gln 450 455 460 Thr Pro Ala Trp Phe Gln Asp Arg Met Leu Arg Ala Tyr Ser Tyr Gly 465 470 475 480 Phe Thr Asn Ser Ala Lys Gln Leu Lys Lys Asn Asn Lys Asp His Thr 485 490 495 Lys Trp Ser Asn Pro Leu Glu Ala Ser Leu Pro Asn Ala Pro Asp Leu 500 505 510 Lys Val Phe Cys Phe Tyr Gly Phe Gly Asn Pro Thr Glu Arg Ala Tyr 515 520 525 Tyr Tyr Arg Glu Glu Val Asp Pro Ala Lys Thr Lys Leu Asn Val Thr 530 535 540 Ile Glu Lys Asn Tyr Asp Ser Val Leu Met Ala Asp Gly Asp Gly Thr 545 550 555 560 Val Ser Leu Met Thr His Ser Met Cys His Ile Trp Lys Gln Ala Asn 565 570 575 Ser Val Tyr Asn Pro Gly Asn Ser Lys Val Lys Ile Val Glu Ile Asp 580 585 590 His Glu Pro Asp Arg Phe Asp Ile Arg Gly Gly Ala Lys Thr Ala Glu 595 600 605 His Val Asp Ile Leu Gly Ser Ala Glu Leu Asn Glu Leu Val Leu Leu 610 615 620 Val Ala Ala Gly Lys Gly Asp Gln Ile Lys Glu Lys Ile Val Ser Asn 625 630 635 640 Leu Lys Glu Ile Val Asp Asn Leu Glu Leu Asp Leu 645 650 <210> 18 <211> 678 <212> PRT <213> Pichia pastoris <400> 18 Met Leu Ser Leu Lys Pro Ser Trp Leu Thr Leu Ala Ala Leu Met Tyr 1 5 10 15 Ala Met Leu Leu Val Val Val Pro Phe Ala Lys Pro Val Arg Ala Asp 20 25 30 Asp Val Glu Ser Tyr Gly Thr Val Ile Gly Ile Asp Leu Gly Thr Thr 35 40 45 Tyr Ser Cys Val Gly Val Met Lys Ser Gly Arg Val Glu Ile Leu Ala 50 55 60 Asn Asp Gln Gly Asn Arg Ile Thr Pro Ser Tyr Val Ser Phe Thr Glu 65 70 75 80 Asp Glu Arg Leu Val Gly Asp Ala Ala Lys Asn Leu Ala Ala Ser Asn 85 90 95 Pro Lys Asn Thr Ile Phe Asp Ile Lys Arg Leu Ile Gly Met Lys Tyr 100 105 110 Asp Ala Pro Glu Val Gln Arg Asp Leu Lys Arg Leu Pro Tyr Thr Val 115 120 125 Lys Ser Lys Asn Gly Gln Pro Val Val Ser Val Glu Tyr Lys Gly Glu 130 135 140 Glu Lys Ser Phe Thr Pro Glu Glu Ile Ser Ala Met Val Leu Gly Lys 145 150 155 160 Met Lys Leu Ile Ala Glu Asp Tyr Leu Gly Lys Lys Val Thr His Ala 165 170 175 Val Val Thr Val Pro Ala Tyr Phe Asn Asp Ala Gln Arg Gln Ala Thr 180 185 190 Lys Asp Ala Gly Leu Ile Ala Gly Leu Thr Val Leu Arg Ile Val Asn 195 200 205 Glu Pro Thr Ala Ala Ala Leu Ala Tyr Gly Leu Asp Lys Thr Gly Glu 210 215 220 Glu Arg Gln Ile Ile Val Tyr Asp Leu Gly Gly Gly Thr Phe Asp Val 225 230 235 240 Ser Leu Leu Ser Ile Glu Gly Gly Ala Phe Glu Val Leu Ala Thr Ala 245 250 255 Gly Asp Thr His Leu Gly Gly Glu Asp Phe Asp Tyr Arg Val Val Arg 260 265 270 His Phe Val Lys Ile Phe Lys Lys Lys His Asn Ile Asp Ile Ser Asn 275 280 285 Asn Asp Lys Ala Leu Gly Lys Leu Lys Arg Glu Val Glu Lys Ala Lys 290 295 300 Arg Thr Leu Ser Ser Gln Met Thr Thr Arg Ile Glu Ile Asp Ser Phe 305 310 315 320 Val Asp Gly Ile Asp Phe Ser Glu Gln Leu Ser Arg Ala Lys Phe Glu 325 330 335 Glu Ile Asn Ile Glu Leu Phe Lys Lys Thr Leu Lys Pro Val Glu Gln 340 345 350 Val Leu Lys Asp Ala Gly Val Lys Lys Ser Glu Ile Asp Asp Ile Val 355 360 365 Leu Val Gly Gly Ser Thr Arg Ile Pro Lys Val Gln Gln Leu Leu Glu 370 375 380 Asp Tyr Phe Asp Gly Lys Lys Ala Ser Lys Gly Ile Asn Pro Asp Glu 385 390 395 400 Ala Val Ala Tyr Gly Ala Ala Val Gln Ala Gly Val Leu Ser Gly Glu 405 410 415 Glu Gly Val Asp Asp Ile Val Leu Leu Asp Val Asn Pro Leu Thr Leu 420 425 430 Gly Ile Glu Thr Thr Gly Gly Val Met Thr Thr Leu Ile Asn Arg Asn 435 440 445 Thr Ala Ile Pro Thr Lys Lys Ser Gln Ile Phe Ser Thr Ala Ala Asp 450 455 460 Asn Gln Pro Thr Val Leu Ile Gln Val Tyr Glu Gly Glu Arg Ala Leu 465 470 475 480 Ala Lys Asp Asn Asn Leu Leu Gly Lys Phe Glu Leu Thr Gly Ile Pro 485 490 495 Pro Ala Pro Arg Gly Thr Pro Gln Val Glu Val Thr Phe Val Leu Asp 500 505 510 Ala Asn Gly Ile Leu Lys Val Ser Ala Thr Asp Lys Gly Thr Gly Lys 515 520 525 Ser Glu Ser Ile Thr Ile Asn Asn Asp Arg Gly Arg Leu Ser Lys Glu 530 535 540 Glu Val Asp Arg Met Val Glu Glu Ala Glu Lys Tyr Ala Ala Glu Asp 545 550 555 560 Ala Ala Leu Arg Glu Lys Ile Glu Ala Arg Asn Ala Leu Glu Asn Tyr 565 570 575 Ala His Ser Leu Arg Asn Gln Val Thr Asp Asp Ser Glu Thr Gly Leu 580 585 590 Gly Ser Lys Leu Asp Glu Asp Asp Lys Glu Thr Leu Thr Asp Ala Ile 595 600 605 Lys Asp Thr Leu Glu Phe Leu Glu Asp Asn Phe Asp Thr Ala Thr Lys 610 615 620 Glu Glu Leu Asp Glu Gln Arg Glu Lys Leu Ser Lys Ile Ala Tyr Pro 625 630 635 640 Ile Thr Ser Lys Leu Tyr Gly Ala Pro Glu Gly Gly Thr Pro Pro Gly 645 650 655 Gly Gln Gly Phe Asp Asp Asp Asp Gly Asp Phe Asp Tyr Asp Tyr Asp 660 665 670 Tyr Asp His Asp Glu Leu 675 <210> 19 <211> 993 <212> DNA <213> Pichia pastoris <400> 19 atgagtgaca ttaatactct gtcgcagaag attccgtcgt atgttcaata cggtattccc 60 agtattgatc atccttttgg aatccgttta tggccaattt tcagtcattt ctttgaagcg 120 gttgttggat acccggctga agatttccgc tttattcagg gtctgactac catggccaat 180 ctaaaagacg ccctcggtgt tattgctgtt tattactttg tgatttttgg tggacaatgg 240 ttgatgagga ccctgaacgc tcgtcctttc aagttgaatt tcttgtttca attgcacaat 300 ttggttttga ccggggcgtc gtttaccttg ttgatattga tcgtggaaca gttaatccca 360 ggtatttatc gccatggaat attttgggct atttgccaca aggattcttt caccaacgaa 420 cttgtcacgc tatattacct gaactacttg atcaagtacg tggagttgat cgataccgtg 480 tttttggtcc tgaaacgcaa aaagttactt ttcttgcaca cttaccacca tggtgccact 540 gcattactat gctacaccca gctactcgga cacactgccg tcgaatgggt cccaattgcc 600 ctgaatctgg ctgttcacgt cgtcttgtac tggtactact tcctctctgc acgtggaatt 660 cgtgtatggt ggaagcaatg ggtgaccaga ttccaaatta ttcagttctt gatcgaccta 720 gggtttgtct actttgctac ctataccttc tacgctgaca aatacttccc cgagctaccc 780 aacatgggaa catgttatgg gactgaggaa gctgctgctt tcggatactt gatcctcaca 840 tcgtatttgg tcctattcat tctcttttac attcgtgtct acaagtccgg gcccacaaca 900 agcaagggga aatcaaaggc agctgctact accggtcaaa aaactgagac tgcctcccct 960 tctggcaaaa gcactagtgt ccgtcgtgcc taa 993 <210> 20 <211> 1005 <212> DNA <213> Pichia pastoris[[ID=!]] <400> 20 atgtccattc tctcatttga taagcccttt ggcatcgaac tatggcccat tttcgatact 60 tttgcctcta aagccaccca cggtgctttt gttccttccg agtttgagtt tgttgctgga 120 aaactgcctt tatccactct ggaaccagta ttgtacagca ttgccgcgta ctactttatc 180 gtcttcggtg gctattattt tattaagaag ctggagctaa agccactagt tttaaatgcg 240 ttgttttctg ctcacaactt gtttttaact actgcttctt tggtgctgtt aactttgatg 300 gttgaacagc tcgttcctat tatttaccac catggacttt tctatgctat ttgcaacact 360 agggcttgga ctcaagagct tgtcactttg tactacctga attacctgat caagttcgta 420 gagtttattg acacattctt tttggttgtc aaacagaaaa agctgacatt tttacacact 480 taccaccacg gtgctactgc tttgctatgt tacactcagt tggttggtgt cacttccatc 540 tcttgggtcc caatctccct gaatctgggt gtccacgttg tcatgtactg gtattacttt 600 ctggcttcga gaggtatccg tgtatggtgg aaggaatggg tcactagatt tcaaattatg 660 caatttattt tggatcttgg atttgtttat tttgccagtt accaaaagtt tgcctacact 720 tatttcaagg acgttctgcc atactgtggt gactgtgctg gaaccatggt agccgctgtg 780 tctggttgtg ccattctgtc gtcctacttg gtccttttca ttgccttcta cattgaagtc 840 tacagaaaac aaggtaaaaa gtccagatac gttaaaaagg tcagaggtgg tgttgctgcc 900 aaggtcaacg agtatgttct tttggaagac aaacagttgg catccggtgc ttcctctcgt 960 tccagctccc ctgtgaccag aaatttgcgc tctcgcaagg cctga 1005 <210> 21 <211> 1212 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 21 atgtctaaag aggaaaagac aagacgtcga agagcgtcat ccattggaaa cataaaccta 60 ggtgacaatg cagttccttc tttgactacc cgaaagtcga atgctcagca gagaaagtct 120 agctccgccc gtattaattt aatcaacaag aagggaagtt ccgattgggg tttagttaaa 180 aaaattggac tttccttggt cgaactgagc tcgcgtcaca catggttgcc atttttggtt 240 tctttggttg ccatacatgg ctcgtatctg ttatctaata accacactcc atccaatcca 300 ttgcacaagt tcgttgatct ttcatataaa atcgaaggaa ctaaccctcc catgtatggc 360 aaaggatgga aagacttctg ctttgtgttt tacttcatga ttttcttcag tttctaccgt 420 gaatttttga tgcaagcgtt actgaaacct ttggccagta agttgggtat cacaagagag 480 tctaaagtca gaagattcat ggaacagtct tattcaatgt gctactatgg attttctggg 540 cccttgggtc tatatatcat ggcaggtatg cccttgtggt acttcaacac gacagaattc 600 tatattactt accctcacaa aagtcatgaa tatctgttca agtactatta tttgggtcaa 660 gccgctttct ggtctcaaca agctgttgtc ttgatgctac aattggaaaa gccgagaaaa 720 gatttcaagg agctggttat tcaccacatt atcaccattg cactgattta ctgtagttac 780 agatttcatt tcacttggat ggggcttgca gtctacatta ccatggacat ctctgacttc 840 ttcctggctc tttccaagac cctgaactat gttgattcag cttacactgg tcccgcgttc 900 atgttctttg tgggtgtctg gttctacttg cgccattggc tcaatgtcaa gatcctttgg 960 tctgtattga ctgaattccg taccgtaggt ccatttgaat tgaactggat cacacagcaa 1020 tacaaatgtt ggatttcaca accaattgta ttttcattga tttttgcctt gcagctggtg 1080 aatctgtact ggtttgtgtt aattctccgg attttgtacc gtcacatctt tttagatgtt 1140 accaagacg aagatccga cgatgaagc gagagaag cccaagtaga accctccaag 1200 No Ag 1212 <210> 22 <211> 1137 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 22 atgggtgttg aaacatctc ctctggaact caacatttca gtgatgacgg tgtgtatct 60 tcaggaagc caatgctac tgtaagcttt gagaagcctg agcgtgctaa cgagctgaag 120 aatcacaaaa tcttaaaaa gtccaaggct tcatggttac agagaatca attttacta 180 gcatcttcat tgttgaacgc gttgttcatc ttaaagcaaa ttccctcatt tcaatcactc 240 gttataaat tctttcattt acagtacaag aacttagatg gtacttatga tattggtaaa 300 gacgactatt ttttcgttat ttactggata atcaacttga ctattattcg cagtgtcttg 360 atggattggg tcctagaacc cttggcaatt agatagttg ggattaaca tagaaagct 420 cttaccagat ttaagaaca gggttggtct ttattctact acaccacgtc atggactgtg 480 ggcttctatt tatactaca gtccgactat tttcatt gtgatcatat ttcatcggc 540 tggcccaaca ataagctgga tttctacttc aaatcttact acttgattca aatgtcatgt 600 tggctccagc agatcgttgt tttgaacata gaggagagaa gaaaagatta tgttcaaatg 660 ttctcgcatc atataataac ctgtttgctg attattggct cttactacta ttacttttta 720 cagattggac acgtcatttt ggttatgatg gacattgttg acgtttttct cagtcttgcc 780 aaaatgttaa aatactgtgg ttacagcact ctctgcgacg tgatgttttt catattcttg 840 gtttcatgga tagctataag acacgtgtgt tacaactacg tgttctggca cacatgcacc 900 aagtctaggg atctaatgaa cgcagattgt tccaggtacg caatctacgg aggtcccttg 960 gacgttactc cagtacgatg ctatacagat agtaccatta gatacttcat tttccttctt 1020 ggaggtctcc aaattatcac actaatctgg atgtacctca ttctaaaagt tttcataggg 1080 gtaataacgg gcaaaggtgc tgaagacgtt agaagtgatg atgaggagag ttcttga 1137 <210> 23 <211> 1191 <212> DNA <213> Pichia pastoris <400> 23 atgagccaac gtgaagaaac aaaagatgct gcaaagaaac agatcgcctt ttcggggaatt 60 ggagcctgcg gtcctccaaa cttctatggt acacaggatg ctcacgctag attggaagaa 120 gatctagccc gatttcttgg tgctgaacgt gccatattgt attcccagga tttctgtact 180 gtgccgtcag ttatagcatg ttttttgaaa agaggtgata ttgttgtgta tgactctggt 240 attgctttgg caacccaaaa gggaatcgaa ttatccagat gtaccgccta ccatttcaac 300 cataatgaca tggataacct ggagaaagtg ttagctgatc tgaagcccat gttagatgaa 360 ggacctttaa ctaggagatt tattatcaca gaaggtcttt ttcaaaactt tggagactct 420 ccagacttgc gtcgtatatg tgagctgaag aaaaagttca agtacagact gttcttagat 480 gaaactcttt caattggtgt tctaggtgct actggtagag gattgccaga attatacgga 540 atccctcgca cagacgttga ggtgaccacc ggcgctttat cctacgccct gggttcttct 600 ggaggattct gcgtcggtga aaacgccatg gtacatcacc agctaatttc ctctagtgcc 660 tatgtgtttt ctgcagctat tccaccttat ttgccagag ttgcatcggt atctcttcga 720 ttactccaag aagatgactc cgtgtcaaga ttacaatcca gtattaattt cctttactca 780 aagtttaaag aatgccagaa actcaaag ctgtataata tcactcatc tgacgtatct 840 ccaatcctac atcgatt gcatcgtgac tgagagca gactcgatct tccggtgagt 900 tatggtggtc ccggatctgc tatggagaa atagtacaga ggggagatga acacggttac 960 ttcgacgaaa attacacag ggagtctcag atcttacaac aaattgtaga cagagtttta 1020 aacaaccata atatcctaat aacgagatgt aagaggatac ttcaccatga aaagctacca 1080 ttactgcctg agcttatgat ccatattaat gttgcatttt cggaatctga gctttcagaa 1140 gcatttgagg ccgtctcctc tgagatttac atgttttgc aacagctttg a 1191 <210> 24 <211> 1686 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 24 atgtcaaaa ctatcccaga tgctctcata gatagatt caccacaga gaaggccgag 60 aaagaatttg ggtccttgac cagtaagaa tggctcttg tctctaagca taaccctgc 120 gagccgcttc cagttcccat cgaggacgaa cctccatatt tcatcctgat tgcaacatac 180 cttaattacc ttattttgat cataataggc catattagag acttctttgg gaagttgttt 240 caccctgaac tattcagaga tgtgatggtg aaagatggta ttgctccatg gtatgccaat 300 tttgaaagtt tctacacgcg tcgtttgaaa acaagattag atgactgttt tgcaaggccc 360 atatgtggag ttcccggtag gtacatcaaa tgttacgaca gaaccagtga cgattacaac 420 aatacctata attattccgg caccgtcaca gagcgcttga atttgagttc atacaactat 480 ttagggttcg cacaatcctc tggtctgtgc acctcagaaa gtatcaagac ggtggagaag 540 tatggtacca acagtgctgg tcctcgagtt agtgtgggaa ctactgatct ccatcttgaa 600 tgtgaggacg tcgttgccaa atttactggc aaggacaatg ctttggtatt ttccatgggt 660 tatgggacca atgcaaatct cttcacctct ttggtggact ctaagtgttg tgttatctca 720 gattctttaa accacggatc tatcaggaca ggtgttcgtt tgtctggcgc ctcagtcaaa 780 acttttgctc acaacgacat ggcagcgctg gaaagaactt tgagaagtgt catttcccaa 840 ggtcagccaa agactcatag accctggaag aagatttttg ttgctgtaga gggactttat 900 tccatggaag gaaccctttg taatttgcca aaactggtag aattgcgtaa gcgttacaag 960 tttttttat ttgttgacga ggcacattct attggtgcta tgggacccaa tggtaagggt 1020 gtttgtgact attttggcat ttcttcttcc aatattgata ttatgatggg tacttttacc 1080 aaatcatttg gagccacagg cggttacatc gctgccgaca aagccatcat agacagattg 1140 aagttagatc tcacaacaaa tacttatgga gaatcaatgt cacctgctgt gctcacacaa 1200 atcattactt ctttgaaaat tatagatgga caactcaatg gtaatgaagg taagagagg 1260 ctacaaagga ttgccttcaa ttctaggtat ctgcgattag gactaaagcg attaggattt 1320 attgtttatg gtgctgatga ttctcctgtt atcccccttt tactgtatct tccccccaag 1380 atgcctgcat ttagccgaat gatgtacgat agaaaggttg ctgtcgttgt tgtgggatat 1440 cctgcaacgg atataacgtc ttctcgtatt cgattctgcg tttcctcttc tttgaagaag 1500 gaggatagat attatttgct caaatgttgt gatgagatag gagatacttt gtttttgaag 1560 ttcagcacag ggattgctgg tggtgagaag cacccgggag actataagaa gggcattgct 1620 cctaggtgga cattggagga ggttctggag agacaccgg aggattgcaa gaagccatg 1680 tact 1686 <210> 25 <211> 962 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 25 atggttaaac tcattgttaa tccaggtct gagaccctga gataatca cgtagacact 60 accccaata caagtcag agacattgtg gtagcttacg gaaggcaaacagtttta 120 tccagctcca gatcagatt cactaactg gagaagacg cagtttccaa gaaccaaag 180 catgtcactc tggactacga gaatcctta gctcaatg ggatagtctt cacagatgat 240 tcagattcca aagaagtcta tgcgaagat ttgggacccc agatcagttg gaaattagtg 300 ttcctgatcg atacgtggg cccgctgatttcatccat tgctctatta cggctggttc 360 aaacctgact atacactct tacacagaaa gttctttca ttttggtgat gctgcactc 420 ctgaaacgtg atacgaaac aactttgtg cacctgtttt catctgatac aatgccctt 480 ttcaacgttt tcaagaactc agctcattat tggattctta gtggattgag ccttgctgtc 540 actatttatg ctccggattc ataccgaaat aagtttgcac ccacttggaa acagtttttt 600 tccatgtatc tgaccatgaa gactccacag ttctagcact gattggactg tgggtatttg 660 ctgaattgtc caacttcatc actcaccaga aattggccag tctcagagcc gatggctcca 720 gagaacataa aattccctat ggatatggct tcaacctggt ctctttcccc aactatttct 780 ttgaatctgt agcttggttg gcatttgccc ttctcaacaa taactggtca tcttgggtgt 840 tccttaccat tgcctccatt cagatgtata tttgggccgc taagaaacac aaaagatatc 900 tcaaggagtt tggggaccaa tatcccaaga acaggaaagc aatgattcca ttccttttgt 960<{0001501}>ag 962 <210> 26 <211> 453 <212> DNA <213> Saccharomyces cerevisiae <400> 26 atgtctcaac ccactcccat cataactaca aaatcagctg ctaagccaaa accaaaaatt 60 tttaatttat tccgcgtttg cttcatttca ttattgctga tcgctgcggt tgaatacttc 120 aagtatggta caagaattaa ctatgaatgg ttccattgta ccccaatcaa agaaccccag 180 tctggctcag taatcaagct ttgggcacgt ggtgggccaa gttgtgacaa aagaggcgaa 240 tataaaacta tagtaaagag aatcactaga gattatgaac caaatgatga acatctctcg 300 ttctgtatca tcgagaatga taatgttcca cccgtccact acccaattca cgaagataaa 360 ggtgaacctg gctacgtagc ttatgtcggg tacgacacag actctgagct ggttcaagaa 420 ctatgtgctg attccacaat ttatcacatg tga 453 <210> 27 <211> 243 <212> DNA <213> Saccharomyces cerevisiae <400> 27 atgacacaac ataaaagctc gatggtgtac atacccacca ctaaggaagc taaaagacgt 60 aatgggaaat cagaaggcat actaaatact attgaagaag tggtggaaaa gctttattgg 120 acctactaca tacatttacc cttttattta atggcctctt ttgattcatt cttcctccat 180 gttttttttc tcacaatttt cagtttgagt ttcttcggta tactaaagta ttgcttcctt 240 tga 243 <210> 28 <211> 2328 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 28 atgcagtacg taggtagagc cattggatca gtatccaaa cctggtcgtc cattaacccg 60 gccacactga gtgtgctat tgatatcatc gtggtggac aagaaaatgg tgatctggct 120 tgctctccct tccatgttcg gtttggaag ttcattat tgaggccttc ccaaagaaa 180 gtggattca tcgtcaatgg agaaaagaca gacttaccaa tgaaactggg cgatgggggc 240 gaagctttct ttgtgtttga aaccgatgct gccatcccga gtgagcttca aacttccccc 300 gtcatctcac ctgtatccag cccagaacca gcctctccac tgagtactcc ttccagacca 360 aactctgaac cagattttt agaattaggg catgagaat ctacaaccag tgattagag 420 aacttcaagt taatcgata tcctatta tcactgagg tatcgcattc agatcctggt 480 gttgggtctg tgagctcaag tcctgagaat acgagatta ttcaagat ctctcggaaa 540 ctcaatacga aaatattcc ttccaaggtt gataatacg gaatcttgt attggatata 600 caggttaca aaagtgatga tctagacgac aattccaat ctttgaaca gttgttattg 660 gctgaactcg gagagatgt agatttggac aaggttattg aaaaagatca cgaaggaaac 720 attatgatca atggtgccat atctttgttg agcggagaag atgatctgga atcatttcct 780 cagaccgacg accaagctga gagtctcaaa ttggatctgg agtcagataa atctgacatt 840 900 caattgaaat gtcttacact gaagaggga attaacgagc tgaaattcag tgtcaacaag 960 ggcaaatctg tggtgacggc aaatctatac ttctgggact attatgaccc catagtcata 1020 tcggatatag atggaaccat tactaaatct gatgccttag gccatgtatt taccatgatt 1080 ggccgtgatt ggactcacaa aggtgtagcc aaattatttt cagatatcaa atccaatgga 1140 tacaatatca tgtatttgac tgcaaggtct gttggtcaag ccgattcgac ccgctactat 1200 aggcttgagg cttctctcaag ggccggtgat cctttctccg 1260 1320 atggcatgtt taaacgacat aaagaaactg tatctcacca ataccaaaga cctaaatccg 1380 aacacagatt ctgcagattt cacggatatc aatacgaaca ctttgagatc ttcaagtctt 1440 acagaggatg tacaaacgcc attttacgcc ggttttggta atagaattac cgatgctttg 1500 tcctataggt cagtagggat accatcatca agaattttta ccataaaccc agacggtgat 1560 gttcacatgg agctactcga attggctggg tatagaagtt cttatgtaca tattagtgag 1620 ctggtagatc atttctttcc accagtgaac actgaactat ttaagtcgat gccttctgat 1680 acctatcgga acacggcaaa gttctctgat gtcaattatt ggaaagagcc tttgtacaat 1740 tttgaggagc tcagtgatga agattctagt gaagatgagc taagaagaag aaaggaggag 1800 gaacgtttac agtctgctcc tcgtagtcca atattggcag caggagcatc gtttttcaaa 1860 ggaagtagta gccttttagg ttcaccagaa cggatgactt tgagtgaccc aaagccaact 1920 gaagttgccc ctagcacaat caaacccccca aaatcagttg gttctgtatc atccgatgaa 1980 gaaaagctga aagatcatga tgatttcatt gacgttgatc acgaagatga aaccttggat 2040 gatgatgacg atccctttga ctacgattac gagtatgaag atgaagaaga ggaaaatgac 2100 gacgtagatg aagttgatga tggggaagag tattcagatg attattatga cgaagaagac 2160 gactacgatg aagaattaga tcatacttta gaaccagacc aaaagaaaga actggaccaa 2220 acagctgaag ccaaccagtt acccccttca ggacccgatg aaatggaatc aaaatctttc 2280 aagaaagcca gtgatttaat aagcaaaatg agaatcgatg acagctga 2328 <210> 29 <211> 942 <212> DNA <213> Pichia pastoris <400> 29 atgaagctct ccaccaattt gattctagct attgcagcag cttccgccgt tgtctcagct 60 gctccagttg ctccagccga agaggcagca aaccacttgc acaagcgtgc ttactacacc 120 gacacaacca agactcacac tttcactgag gttgttactg tctaccgaac tttgaaaccg 180 ggcgaaagta tcccaactga ctctccaagc cacggtggta aaagtactaa aaagggtaag 240 ggtagtacca ctcactctgg tgctccagga gctacctctg gtgctccaac tgacgacacc 300 acttcgacta gtggctcagt agggttacca actagcgcaa cttcagttac ctcttctacc 360 tcctctgcaa gtacaacaag cagtggaact tcagccacta gcactggtac cggtactagc 420 actagcacta gcactggtac tggtactggt actacaggca caggaaccac tagttccagc 480 actagctctt ctgctacttc gactccaacc ggttctatcg acgctatcag ccagacactt 540 ctggatactc acaatgataa gcgtgctttg cacggcgtcc cagaccttac ttggtctacc 600 gaactcgctg actacgccca aggttacgcc gattcataca cttgtggctc ttcattagaa 660 cacacaggtg gaccatacgg tgaaaatttg gcctctggat actctcctgc tggcagtgta 720 gaagcatggt acaacgagat cagcgactac gatttctcta acccaggtta ttctgctggt 780 accggtcact tcacccaagt tgtctggaaa tcaactacac agctgggctg tggatacaag 840 gagtgcagta ccgacagata ctacatcatc tgcgaatacg cacctcgtgg aaatattgtt 900 tctgccggct acttcgaaga caacgtcctg cctcctgttt ga 942 <210> 30 <211> 1548 <212> DNA <213> Pichia pastoris <400> 30 atgagtctgg tccaggagtt gattcaaaag ataagctctt tggagctcac cttggtggaa 60 aagctttcca tcctgttcgt agctcccttc ttgttgaacg cgctatggca gtttatctac 120 agtttcagaa aggagagagt tcctttggta ttccactggg ttccatgggt aggctcagca 180 gtcacatatg gaatgcaacc atatgaattt tttgcagact gtcaaaaa atacggagac 240 gtgtttgcct ttgttttgtt gggtaaagtt atgacagtgt acctcggacc aaaaggccat 300 360 accactcctg tatttggtga aggtgttat tacgattgtc ccaactggaa gttgatggac 420 cagaagaagt ttgttaaagg atctttaacc aaggagtcct tcagatctta tgtccctaag 480 attagagatg aagtcctgga ttacatcaat aatgacccta acttcatggg aggtgattct 540 aaaaagaaaa ctggaaagac caatgtcctg aactctcagt ccgagcttac gatcttgacc 600 gcttccagat ctctactggg agatgatatg agaaaactac tgactaagaa atgggctaaa 660 ctgtttagtg acctagacaa aggatttact cctttaaact tcattttctc tcatcttcct 720 ctaccaagtt actggactcg tgatcatgct caaaagacca tttctgagac ttatttatct 780 ttgattaca agagagagc tacaacgac attggtgaca gagatttgat cgattcatta 840 atgaaatctt ctacatacaa agatggtagc aagatgaccg acgaggagat ttcccacttg 900 ttaatcggag ttcttatggg tggccagcac acttctgcct ccactcatc gtggttttg 960 ttgcatctcg gagagaacc agagctgcag gaggaattat ttgagaca ggaaagggta 1020 cttcaagggc gtgagttgac ttatgacgat cttgctata tgcctttaca caatcaagtc 1080 atcaggaaa ctttgcgcat gcacatgcct ctacactcaa tctttagaaa ggtcactcgt 1140 cctctcccg ttcctactc aaagtatgtg gttcctagg gtcatgt attggttca 1200 cctggattg ccatgaccaa cgatgcgtac ttcccaacg ctagtgactt ccagccacac 1260 agatgggatg aaactgttga accagctca gctgacgcaa aggaactgt tgactacgga 1320 1380 agatgtattg gcgaacattt tgcgtactgt cagttaggaa ccatcttgaa cacattcgtt 1440 agaaccttca agtggaggc cgtagtccct cagccggact atacctcaat ggttactctt 1500 cctgaaccta atttgtctac tattacatgg gaaagacgcg ataattag 1548 <210> 31 <211> 2961 <212> DNA <213> Pichia pastoris <400> 31 atgcttactg ggttgtccaa gatatgtgcg catagaccaa tccataccat agtggtgacc 60 gctctcttag tttccttagc atacctaacc attgtggagg agtacacatc gagatcttca 120 ttatccaatc cttttatatc gttttaccac ccaccaggaa acagtgatta ccaaaattgg 180 attccagtgg atgactctgt gaagctcaaa agcaagtcag cccagcatct ctctgtatgc 240 gctttgaagt ttaaaagggt taatggacat cagattcccg atctggcagg aagttttcag 300 agcgcagacc caactgaaat atttgtcgtt caggattttg acaaatcatt tgactatttt 360 gattcaattt caaccattga gggtaaggat ggcatccaat ggaaagtcag acaccccaat 420 aggttgggac gttattctga gtacttcaga tctgtttttt caaaaacttt gagactggtt 480 cagggtgctg aaccattcga cattgtgctt attgcttttg cttacgttgc tatgtggtac 540 acatttttgc agctctatta tgaaatgaaa acaaaggcca actctaactt ttggctgact 600 ttcggctctc tgctgtcttc aggttgtgca tttgtgtttg cattggccgt cactgtaaaa 660 gtatacggta tcaaggttcc actcacatct ttaactgaag gtgtcccatt tttggtagct 720 accattggtt tcaaacacaa agttgcattc actgttccta ttctccaagc ttcccgttca 780 aaaaaagcca aagaaattcc tgacaccatt atttcagtga ttgaacaaac cacagggtgg 840 cctctgatta aggatcatct cattatgatt tccgccttct tagcatgttc tttttatgcc 900 ccccgtatgg aaggactcaa aaacttttgc attctctccg ctaatatctt aacgtttgac 960 cttataatga ttttcacatt ttttaccgct gtattatctt taaaagctca gattaataag 1020 gttcacgaaa caactgcttt gcagcaagtt ctggaggaag atggaattgc tgaagatgtt 1080 gctgaacgca ttgctgcttc aaaccgaaat atgttttccc gtagtaccag cgtcgtcagc 1140 ttcaaagtga taatgatcgc tgggttcctt ggattccatt tatttgtgtt gggaacttca 1200 tggctctatg actctgacgt ttcaagctct tctatatttg gtaagagcaa tgtatctgcc 1260 ttatccaaag ctgctgccaa acatattcct attggatccg aaggaactat tgtgaccatt 1320 atgcctacga gggtttacat gcctgttgat ttacttctaa agttggaaga tgattttctg 1380 aacattttt ccaagatatc ggctagcata actgatcctt tgattagcaa acttcttttc 1440 ataattaccg gaataagtgc cacaatcaac gttactttgt tgaatgctgc tcgattccac 1500 tcgtctagag aaattgctgt ctctacaatt gcaaagcctc aaacgccaga cgttgttccc 1560 acagtagaac cgcttccaaa tgaaaatgac acaagcattc gaccattgga ggagatggtt 1620 tcattgctga aggaaggtaa aacacgagag ctgaacaatg atgaggtatc atctctcgtt 1680 gttcaaggaa aacttccctt gtacgcccta gaaaaacaac ttgttgataa gacccgcgca 1740 gttattgtaa gaaggaaggc aattgcttc ttagcagatg ctccggtctt gagaaccgaa 1800 aagctgcctt acaaagatta tgattatgac cgtgtatttg gcgcttgttg tgagaatgtt 1860 atcggattca tgcccttacc agtcggcgtt gctggtccct tgatcattga cggtaaacct 1920 tatcacattc ccatggctac tactgaaggc tgcttagtag cctcaaccat gagaggttgt 1980 aaagctatca attctggagg cggtgtagaa actgttctga cagccgacgg aatgacaaga 2040 ggaccatgcg tttctttccc atctctttct cgtgcaggtg cagctaagat gtggctagat 2100 agtgaagaag ggcaaaagac cattaagggt gcgtttaact ccacctctag atttgcccgt 2160 ttgcagcatg ttaagacaac ccttgctggt acattattgt tcatccgatt caagactact 2220 actggtgatg cgatgggtat gaacatgatt tctaagggtg tggagtattc actaaagttt 2280 atgtcggaag aatgtgactg gcctgacatg gaagttatt ctgtttcagg taattactgt 2340 acagacaaaa aagttgctgc aatcaactgg atcgaaggtc gtggtaagtc tgtcgttgct 2400 gaagctcgta ttccagccga tgttgtcaga agcgttctga agtccgatgt tgaggcattg 2460 gtagaattga atgttagcaa gaacttgatt ggatccgcaa tggcaggatc aattggtggt 2520 ttcaacgcac aagctgccaa tctagttaca gcagtatact tagctacagg acaggatcca 2580 gcccagaatg tcgaaagttc caactgtatt accttgatga acaagctccc aaatggagat 2640 ttacaaattt cagtctctat gccatctatc gaagttggaa ccattggtgg aggaaccgtt 2700 ttggaacctc aaggatcaat gttggaacta ttaggagtta aaggtcctca cccaactaat 2760 ccaggtgcaa actcaaggca gttggctaag atcgttgctt ctgctgtctt ggctgcagag 2820 ctgtccttgt gctctgccct tgcagctggt cacttagtcc aaagtcatat gacccataac 2880 agaaagcaag ctccagtcaa ggaggtaaac ggcactgccg ctaggctagc ggaacaatct 2940 aagatttgca ttaaatcttg a 2961 <210> 32 <211> 1422 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 32 atgacgccag acgttgttcc cacagtagaa ccgcttccaa atgaaaatga cacaagcatt 60 cgaccattgg aggagatggt ttcattgctg aaggaaggta aaacacgaga gctgaacaat 120 gatgaggtat catctctcgt tgttcaagga aaacttccct tgtacgccct agaaaaacaa 180 cttgttgata agacccgcgc agttattgta agaaggaagg caattgcttc cttagcagat 240 gctccggtct tgagaaccga aaagctgcct tacaaagatt atgattatga ccgtgtattt 300 ggcgcttgtt gtgagaatgt tatcggattc atgcccttac cagtcggcgt tgctggtccc 360 ttgatcattg acggtaaacc ttatcacatt cccatggcta ctactgaagg ctgcttagta 420 gcctcaacca tgagaggttg taaagctatc aattctggag gcggtgtaga aactgttctg 480 acagccgacg gaatgacaag aggaccatgc gtttctttcc catctctttc tcgtgcaggt 540 gcagctaaga tgtggctaga tagtgaagaa gggcaaaaga ccattaaggg tgcgtttaac 600 tccacctcta gatttgcccg tttgcagcat gttaagacaa cccttgctgg tacattattg 660 ttcatccgat tcaagactac tactggtgat gcgatgggta tgaacatgat ttctaagggt 720 gtggagtatt cactaaagtt tatgtcggaa gaatgtgact ggcctgacat ggaagttatt 780 tctgtttcag gtaattactg tacagacaaa aaagttgctg caatcaactg gatcgaaggt 840 cgtggtaagt ctgtcgttgc tgaagctcgt attccagccg atgttgtcag aagcgttctg 900 aagtccgatg ttgaggcatt ggtagaattg aatgttagca agaacttgat tggatccgca 960 atggcaggat caattggtgg tttcaacgca caagctgcca atctagttac agcagtatac 1020 ttagctacag gacaggatcc agcccagaat gtcgaaagtt ccaactgtat taccttgatg 1080 aacaagctcc caaatggaga tttacaatt tcagtctcta tgccatct cgaagttgga 1140 accattggtg gaggaaccgt ttggaacct caagatca tgttgact attaggatt 1200 aaaggtccctc acccacta tccaggtgca aactcaggc agttggctaa gatcgttgct 1260 1320 caaagtcata tgacccataa cagaagcaa gctccagtca agggaggtaaa cggcactgcc 1380 gctaggctag cggaacatc windowttgc attaaatctt ga 1422 <210> 33 <211> 1515 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 33 atgggaataa gtgccacaat caacgtttac ttgttgaatg ctgctcgatt ccactcgtct 60 agagaaattg ctgtctctac aattgcaag cctcaaacgc cagacgttgt tcccacagta 120 gaaccgcttc caaatgaaaa tgacacaagc attcgaccat tggagat ggtttcattg 180 ctgaaggaag gtaaaacacg agagctgaac atgatgagg tatcatctct cgttgttcaa 240 ggaaaacttc ccttgtacgc cctagaaaaa caacttgttg ataagacccg cgcagttatt 300 gtaagaagga aggcaattgc ttccttagca gatgctccgg tcttgagaac cgaaaagctg 360 ccttacaaag attatgatta tgaccgtgta tttggcgctt gttgtgagaa tgttatcgga 420 ttcatgccct taccagtcgg cgttgctggt cccttgatca ttgacggtaa accttatcac 480 attcccatgg ctactactga aggctgctta gtagcctcaa ccatgagagg ttgtaaagct 540 atcaattctg gaggcggtgt agaaactgtt ctgacagccg acggaatgac aagaggacca 600 tgcgtttctt tcccatctct ttctcgtgca ggtgcagcta agatgtggct agatagtgaa 660 gaagggcaaa agaccattaa gggtgcgttt aactccacct ctagatttgc ccgtttgcag 720 catgttaaga caacccttgc tggtacatta ttgttcatcc gattcaagac tactactggt 780 gatgcgatgg gtatgaacat gatttctaag ggtgtggagt attcactaaa gtttatgtcg 840 gaagaatgtg actggcctga catggaagtt atttctgttt caggtaatta ctgtacagac 900 aaaaaagttg ctgcaatcaa ctggatcgaa ggtcgtggta agtctgtcgt tgctgaagct 960 cgtattccag ccgatgttgt cagaagcgtt ctgaagtccg atgttgaggc attggtagaa 1020 ttgaatgtta gcaagaactt gattggatcc gcaatggcag gatcaattgg tggtttcaac 1080 gcacaagctg ccaatctagt tacagcagta tacttagcta caggacagga tccagcccag 1140 aatgtcgaaa gttccaactg tattaccttg atgaacaagc tcccaaatgg agatttacaa 1200 atttcagtct ctatgccatc tatcgaagtt ggaaccattg gtggaggaac cgttttggaa 1260 cctcaaggat caatgttgga actattagga gttaaaggtc ctcacccaac taatccaggt 1320 gcaaactcaa ggcagttggc taagatcgtt gcttctgctg tcttggctgc agagctgtcc 1380 ttgtgctctg cccttgcagc tggtcactta gtccaaagtc atatgaccca taacagaaag 1440 caagctccag tcaaggaggt aaacggcact gccgctaggc tagcggaaca atctaagatt 1500 tgcattaaat cttga 1515 <210> 34 <211> 1383 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 34 atgcctgaaa agaagaacag tcgttccgct gacgaagctc ttagctttct tgctaaaacg 60 aacgtagagc gcccgatgca ttactctaag acaggaaca taacgcccga cacggtatct 120 tcagagag atcactacca agattacgac tcacacag multiplied aaatacaaa 180 ctattacaa gagacagggg tgggccacac aacagatag agaagcaag gaggtttgct 240 ttgttgagga gttccctaaa caggattg gaactctag taatattgtg gcatactatc 300 acgattccat tttagcatc actatttttc gttctgtgta caatcccat gttgtggcct 360 cttataatag tttacttggt ttattttac atcgatgcca attackccaag caatggaaag 420 tctgctgacc gaagagtgga atggttcaga agttttgcata tttggaaca ttttgtcaat 480 tattacccta tatctgtgta caaactgtt gacctggaac cgacgttca gactagaag 540 attgaaatta ttctccgaa gtatcaccaa gtaaccactt atttgccaag ttctgttaga 600 aagtacatac cgacacacag agttctcata gaaaggaga tcaaacagg gccaagatac 660 atatttggtt atcacctca tggggtagtt tccctgggga tcactggagc ttttggcacc 720 aatggttgta acatggcga gttactacca ggaatcagaa tatattatt aaccctcatc 780 actcaattca aacttcctct attgagagat tacttaatgg cattgggtat ttcttctgtt 840 tcgaaacgta atgtgactgc actgataaaa cgaaatcagt ctgtctgtat tgtcattgga 900 ggtgcttcgg agtccctatt atccaaacca catactattg atattgtcct gaaaaaaagg 960 aaaggctttg tgaaagtcgc actagagctg ggtgacactg agttagttcc agtatttggt 1020 tttggagaaa acactgccta taatgttttt gacccaagtg tatctggcaa gtcttgctct 1080 gtcctaaatt acgtgcggaa gcaaatgtgt gggtttcaat tatggttaaa acaacacttt 1140 ggcttacct ttccattttt tcatgctagg ggtgttttca atcacgactt tggccttcta 1200 ccatatcgga aacctatcaa cttggtcatc ggtagaccca tcccggttcc ttacattcat 1260 tcaccaaccc aagaacagat tgaccattac cattccctat atgtcgaaga actgaaacga 1320 gttttgagc agaataagga gaggtttaat gctggatcct tggagctacg aattgtcgag 1380 is 1383 <210> 35 <211> 1959 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 35 atgcaactac ggaaaagagg aaacgagaga tccagacttg aatcgcacat cggcgattcg 60 gacacggtta ttgacttgga tgactcttca gtaaacgaca cgcttccgga tgaagacaac 120 atcgctaaac caagaaaagc gtcaacgcac agaagaccat cacttcgaaa aatccacagc 180 gctgagactg tccgtcgttt ctatgagtca aagaatgtaa ttttatttt tggagccttc 240 ataggaatcg ctgttgcttt gtactttgga gctaccagtt ctgagtaccc tattccagac 300 atagatcaac tggtcaactt tgactctctt tccacctatt ttgacgattg gaaggatgtc 360 ttaccaaagt cccttcaaag tattgttgag agtactcagt tcaatcagaa ttctaagata 420 ttgagctctg aatcatttgc agtaggtaag caattgaaga gtaagtcaat gattgaagct 480 aatcattcca ttgttcttgt tcctggtgtg atcagcaccg ggctggaaag ttggggcttg 540 gaaggaactc ctgactgccc ctccgaaggt cattttagaa aacgtctatg gggatcattt 600 tacatgttgc ggacaatgtt tttggataag gcgtgttggc tgaaacatat tatgctagat 660 acaacaacgg gattagaccc tccaggaata agcctcagag cagctcaggg gtttgaagct 720 gctgatttct ttatagcagg ttactggatt tggaataaaa tccttcagaa cttggcagtt 780 attggatata atccaaacaa catggtgagc gctgcttatg attggagact tgcttttctg 840 gatttagaat tacgggatgc atacttttca aaattaaaag gtttcgttga acttcaaaag 900 catcagagtg ggaaaaaatc ggttttggta ggtcattcaa tggggtcaca agtgatttac 960 tattttatga agtgggttga agctgacgga tacggaaacg gaggccctaa ctgggtgaat 1020 gatcatgtag attcttttgt ggacatatcc ggctgtatgc tgggtactcc taaggctata 1080 cctgctcttt tatccggaga aatgaaggat acagttcaat taaacgccct cgccgtggag 1140 ggcttagaaa agtttctgtc tagagaagaa cgtgctgata tgatccgttc ttttggtgga 1200 atagccagca tgattcccaa aggcggagat ctaatctggg gaaatctcga gagttctcct 1260 gatgacgcca cgtcaattgg agatttggga aacgacactt atggtaattt cattaggttc 1320 aaggagccgg tgggggaagta ctcccaaaag aacttaacgg tgactgatag tattcagttt 1380 ttgatggagc agactcccgc ctggttccaa gacaggatgt tgagggctta ctcttatggg 1440 ttcaccaatt ctgctaagca gctgaaaaaa aataataaag atcatacaaa atggtccaat 1500 ccccttgagg catcacttcc aaatgcacct gatctgaaag tgttttgctt ttatgggttt 1560 ggaaatccta cagaaagagc ttactactac cgagaagaag ttgatccggc taagaccaaa 1620 ttgaacgtca ctattgaaaa gaactatgat tcggttctta tggcagatgg tgacggtacg 1680 gtcagtctaa tgactcactc aatgtgccac atatggaagc aagctaatag tgtttacaac 1740 ccaggaaata gcaaggtcaa gattgttgag attgatcatg aacctgatcg gtttgacatt 1800 cgaggaggtg ccaaaactgc tgaacatgta gacattctgg gatctgcaga gttaaacgag 1860 ctagtgttac tggtggccgc tggaaaggga gaccaaatta aggaaaagat tgttagtaat 1920 ctgaaggaaa tagttgataa tcttgaacta gatctttaa 1959 <210> 36 <211> 2037 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 36 atgctgtcgt taaaaccatc ttggctgact ttggcggcat taatgtatgc catgctattg 60 gtcgtagtgc catttgctaa acctgttaga gctgacgatg tcgaatctta tggaacagtg attggtatcg atttgggtac cacgtactct tgtgtcggtg tgatgaagtc gggtcgtgta 180 gaaattcttg ctaatgacca aggtaacaga atcactcctt cctacgttag tttcactgaa 300. gacgagagac tggttggtga tgctgctaag aacttagctg cttctaaccc aaaaaacacc atctttgata ttaagagatt gatcggtatg aagtatgatg ccccagaggt ccaaagagac ttgaagcgtc ttccttacac tgtcaagagc aagaacggcc aacctgtcgt ttctgtcgag 420 tacaagggtg aggagaagtc tttcactcct gaggagattt ccgccatggt cttgggtaag 480 atgaagttga tcgctgagga ctacttagga aagaaagtca ctcatgctgt cgttaccgtt ccagcctact tcaacgacgc tcaacgtcaa gccactaagg atgccggtct catcgccggt 600 ttgactgttc tgagaattgt gaacgagcct accgccgctg cccttgctta cggtttggac 660 aagactggtg aggaagaca gatcatcgtc tacgacttgg gtggaggac cttcgatgtt tctctgcttt ctattgaggg tggtgctttc gaggttcttg ctaccgccgg tgacacccac 780 ttgggtggtg aggactttga ctacagagtt gttcgccact tcgttaagat tttcaagaag 840 aagcataaca ttgacatcag caacaatgat aaggctttag gtaagctgaa gagagaggtc 900 gaaaaggcca agcgtacttt gtcttcccag atgactacca gaattgagat tgactctttc 960 gtcgacggta tcgacttctc tgagcaactg tctagagcta agtttgagga gatcaacatt 1020 gaattattca agaagacact gaaaccagtt gaacaagtcc tcaaagacgc tggtgtcaag 1080 aaatctgaaa ttgatgacat tgtcttggtt ggtggttcta ccagaattcc aaaggttcaa 1140 caattattgg aggattactt tgacggaaag aaggcttcta agggaattaa cccagatgaa 1200 gctgtcgcat acggtgctgc tgttcaggct ggtgttttgt ctggtgagga aggtgtcgat 1260 gacatcgtct tgcttgatgt gaacccccta actctgggta tcgagactac tggtggcgtt 1320 atgactacct taatcaacag aaacactgct atcccaacta agaaatctca aattttctcc 1380 actgctgctg acaaccagcc aactgtgttg attcaagttt atgagggtga gagagccttg 1440 gctaaggaca acaacttgct tggtaaattc gagctgactg gtattccacc agctccaaga 1500 ggtactcctc aagttgaggt tacttttgtt ttagacgcta acggaatttt gaaggtctct 1560 gccaccgata agggaactgg aaaatccgag tccatcacca tcaacaatga tcgtggtaga 1620 ttgtccaagg aggaggttga ccgtatggtt gaagaggccg agaagtacgc cgctgaggat 1680 gctgcactaa gagaaaagat tgaggctaga aacgctctgg agaactacgc tcattccctt 1740 aggaaccaag ttactgatga ctctgaaacc gggcttggtt ctaaattgga cgaggacgac 1800 aaagagacat tgacagatgc catcaaagat accctagagt tcttggaaga caacttcgac 1860 accgcaacca aggaagaatt agacgaacaa agagaaaagc tttccaagat tgcttaccca 1920 atcacttcta agctatacgg tgctccagag ggtggtactc cacctggtgg tcaaggtttt 1980 gacgatgatg atggagactt tgactacgac tatgactatg atcatgatga gttgtag 2037 <210> 37 <211> 312 <212> PRT <213> Pichia pastoris[[ID=z5]] <400> 37 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20 25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 40 45 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu Lys Arg Glu Val Gln Leu Val Gln Ser Gly Gly Gly Leu 85 90 95 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe 100 105 110 Thr Phe Ser His Tyr Trp Met Ser Trp Val Arg Gln Ala Pro Gly Lys 115 120 125 Gly Leu Glu Trp Val Ala Asn Ile Glu Gln Asp Gly Ser Glu Lys Tyr 130 135 140 Tyr Val Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala 145 150 155 160 Lys Asn Ser Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 165 170 175 Ala Val Tyr Phe Cys Ala Arg Asp Leu Glu Gly Leu His Gly Asp Gly 180 185 190 Tyr Phe Asp Leu Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser Ala 195 200 205 Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg Ser 210 215 220 Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe 225 230 235 240 Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly 245 250 255 Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu 260 265 270 Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr Tyr 275 280 285 Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys Arg 290 295 300 Val Glu Ser Lys Tyr Gly Pro Pro 305 310 <210> 38 <211> 299 <212> PRT <213> Pichia pastoris <400> 38 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20 25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 40 45 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu Lys Arg Ala Ile Gln Leu Thr Gln Ser Pro Ser Ser Leu 85 90 95 Ser Ala Ser Val Gly Asp Arg Val Ile Leu Thr Cys Arg Ala Ser Gln 100 105 110 Gly Val Ser Ser Ala Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala 115 120 125 Pro Lys Leu Leu Ile Tyr Asp Ala Ser Ser Leu Glu Ser Gly Val Pro 130 135 140 Ser Arg Phe Ser Gly Ser Gly Ser Gly Pro Asp Phe Thr Leu Thr Ile 145 150 155 160 Ser Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Phe 165 170 175 Asn Ser Tyr Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 180 185 190 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 195 200 205 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 210 215 220 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Ala Ala Leu Gln 225 230 235 240 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Serve Lys Asp Ser 245 250 255 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Server Lys Ala Asp Tyr Glu 260 265 270 His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 275 280 285 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 290,295 <210> 39 <211> 303 <212> PRT <213> Pichia pastoris (Pichia pastoris) <400> 39 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20 25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 40 45 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu Lys Arg Asp Val Gln Leu Gln Glu Ser Gly Pro Ser Leu 85 90 95 Val Lys Pro Ser Gln Thr Leu Ser Leu Thr Cys Ser Val Thr Gly Asp 100 105 110 Ser Ile Thr Ser Asp Tyr Trp Ser Trp Ile Arg Lys Phe Pro Gly Asn 115 120 125 Arg Leu Glu Tyr Met Gly Tyr Val Ser Tyr Ser Gly Ser Thr Tyr Tyr 130 135 140 Asn Pro Ser Leu Lys Ser Arg Ile Ser Ile Thr Arg Asp Thr Ser Lys 145 150 155 160 Asn Gln Tyr Tyr Leu Asp Leu Asn Ser Val Thr Thr Glu Asp Thr Ala 165 170 175 Thr Tyr Tyr Cys Ala Asn Trp Asp Gly Asp Tyr Trp Gly Gln Gly Thr 180 185 190 Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro 195 200 205 Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly 210 215 220 >Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn 225 230 235 240 Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln 245 250 255 Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser 260 265 270 Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser 275 280 285 Asn Thr Lys Val Asp Lys Arg Val Glu Pro Lys Ser Cys Asp Lys 290 295 300 <210> 40 <211> 299 <212> PRT <213> Pichia pastoris <400> 40 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20 25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 40 45 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu Lys Arg Asp Ile Val Leu Thr Gln Ser Pro Ala Thr Leu 85 90 95 Ser Val Thr Pro Gly Asn Ser Val Ser Leu Ser Cys Arg Ala Ser Gln 100 105 110 Ser Ile Gly Asn Asn Leu His Trp Tyr Gln Gln Lys Ser His Glu Ser 115 120 125 Pro Arg Leu Leu Ile Lys Tyr Ala Ser Gln Ser Ile Ser Gly Ile Pro 130 135 140 Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile 145 150 155 160 Asn Ser Val Glu Thr Glu Asp Phe Gly Met Tyr Phe Cys Gln Gln Ser 165 170 175 Asn Ser Trp Pro Tyr Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 180 185 190 Arg Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu 195 200 205 Gln Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe 210 215 220 Tyr Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln 225 230 235 240 Ser Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser 245 250 255 Thr Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu 260 265 270 Lys His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser 275 280 285 Pro Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 290 295 <210> 41 <211> 939 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 41 atgagattcc catctatttt caccgctgtc ttgttcgctg cctcctctgc attggctgcc 60 cctgttaaca ctaccactga agacgagact gctcaaattc cagctgaagc agttatcggt 120 tactctgacc ttgagggtga ttcgacgtc gctgttttgc cttctctaa ctccactaac 180 aacggttgtgt tgttcattaa caccactatc gcttccattg ctgctaagga agagggtgtc 240 tctctcgaga agagagaggt ccaattggtc caatctggtg gaggattggt tcaaccaggt 300 ggatctctga gattgtcttg tgctgcttct ggtttcacct tctctcacta ctggatgtca 360 tgggttagac aagctcctgg taagggtttg gaatgggttg ctaacatcga gcaagatgga 420 tcagagaagt actacgttga ctctgttaag ggaagattca ctatttcccg tgataacgcc 480 aagaactcct tgtacctgca aatgaactcc cttagagctg aggatactgc tgtctacttc 540 tgtgctagag acttggaagg tttgcatggt gatggttact tcgacttatg gggtagaggt 600 actcttgtca ccgtttcatc tgcctctacc aaaggacctt ctgtgttccc attagctcca 660 tgttccagat ccacctccga atctactgca gctttgggtt gtttggtgaa ggactacttt 720 cctgaaccag tgactgtctc ttggaactct ggtgctttga cttctggtgt tcacaccttt 780 cctgcagttt tgcagtcatc tggtctgtac tctctgtcct cagttgtcac tgttccttcc 840 tcatctcttg gtaccaagac ctacacttgc aacgttgacc ataagccatc caataccaag 900 gttgacaaga gagttgagtc caagtatggt ccaccttaa 939 <210> 42 <211> 900 <212> DNA <213> Pichia pastoris <400> 42 atgagattcc catctatttt caccgctgtc ttgttcgctg cctcctctgc attggctgcc 60 cctgttaaca ctaccactga agacgagact gctcaaattc cagctgaagc agttatcggt 120 tactctgacc ttgagggtga tttcgacgtc gctgttttgc ctttctctaa ctccactaac 180 aacggtttgt tgttcattaa caccactatc gcttccattg ctgctaagga agagggtgtc 240 tctctcgaga agagagctat ccagttgact caatcaccat cctctttgtc tgcttctgtt 300 ggtgatagag tcatcctgac ttgtcgtgca tctcaaggtg tttcctcagc tttagcttgg 360 taccaacaaa agccaggtaa agctccaaag ttgctgatct acgacgcttc atcccttgaa 420 tctggtgttc cttcacgttt ctctggatct ggatcaggtc ctgattcac tctgactatc 480 tcatcccttc aaccagaaga ctttgctacc tacttctgtc aacagttcaa ctcttaccct 540 ttgaccttg gaggtggaac taagttggag atcaagagaa ctgttgctgc accatcagtg 600 ttcatctttc ctccatctga tgagcaactg aagtctggta ctgcatctgt tgtctgctta 660 ctgaacaact tctacccaag agaagctaag gtccaatgga aggttgacaa tgccttgcaa 720 tctggtaact ctcaagagtc tgttactgag caagactcta aggactctac ttactccctt 780 tcttccacct tgactttgtc taaggctgat tacgagaagc acaaggttta cgcttgtgag 840 gttactcacc aaggtttgtc ttctcctgtt accaagtctt tcaacagagg tgaatgctaa 900 <210> 43 <211> 915 <212> DNA <213> Pichia pastoris (Pichia pastoris) <400> 43 atgagattcc catctatttt caccgctgtc ttgttcgctg cctcctctgc attggctgcc 60 cctgttaaca ctaccactga agacgagact gctcaaattc cagctgaagc agttatcggt 120 tactctgacc ttgagggtga tttcgacgtc gctgttttgc ctttctctaa ctccactaac 180 aacggtttgt tgttcattaa caccactatc gcttccattg ctgctaagga agagggtgtc 240 tctctcgaga agagagacgt tcaattgcaa gaatctggtc catccttggt taagccatcc 300 cagactttgt ccttgacttg ttccgttact ggtgactcca tcacttctga ctactggtcc 360 tggatcagaa agttcccagg taacagattg gagtacatgg gttacgtttc ttactccggt 420 tccacttact acaacccatc cttgaagtcc agaatctcca tcactagaga cacttccaag 480 aaccagtact acttggactt gaactccgtt actactgagg acactgctac ttactactgt 540 gctaactggg acggtgacta ttggggtcaa ggtactttgg ttactgtttc ctccgcttcc 600 actaagggtc catctgtttt tccattggct ccatcctcca agtctacttc aggtggtact 660 gctgctttgg gttgtttggt taaggactac ttcccagagc cagttactgt ttcttggaac 720 tccggtgctt tgacttccgg tgttcacact ttcccagctg tcttgcaatc ctccggtctg 780 tactccttgt cctccgttgt tactgttcct tcttcctcct tgggtactca aacttacatc 840 tgtaacgtta accacaagcc atccaacact aaggttgaca agagagttga gccaaagtcc 900 tgtgacaagt aatag 915 <210> 44 <211> 903 <212> DNA <213> Pichia pastoris <400> 44 atgagattcc catctatttt caccgctgtc ttgttcgctg cctcctctgc attggctgcc 60 cctgttaaca ctaccactga agacgagact gctcaaattc cagctgaagc agttatcggt 120 tactctgacc ttgagggtga tttcgacgtc gctgttttgc ctttctctaa ctccactaac 180 aacggtttgt tgttcattaa caccactatc gcttccattg ctgctaagga agagggtgtc 240 tctctcgaga agagagacat cgttttgact caatccccag ctactttgtc cgttactcca 300 ggtaactccg tttccttgtc ctgtagagct tcccagtcca tcggtaacaa cttgcactgg 360 tatcagcaga agtctcacga gtccccaaga ctgttgatca agtacgcttc ccaatccatc 420 tccggtatcc catctagatt ctctggttct ggttccggta ctgacttcac tttgtccatc 480 aactccgttg agactgagga cttcggtatg tacttctgtc agcaatccaa ctcctggcca 540 tacacttttg gtggtggtac taagttggag atcaagagaa ctgttgctgc tccatccgtt 600 ttcatcttcc caccatctga cgagcagttg aagtctggta ctgcttccgt tgtttgtttg 660 ttgaacaact tctacccaag agaagctaag gttcagtgga aggttgacaa cgccttgcaa 720 tccggtaact cccaagagtc cgttactgaa caagactcca aggactctac ttactccttg 780 tcctccactt tgactttgtc caaggctgac tacgagaagc acaaggttta cgcttgtgag 840 gttactcacc agggtttgtc ctccccagtt actaagtcct tcaacagagg tgagtgttaa 900 tag 903 <210> 45 <211> 85 <212> PRT <213> Saccharomyces cerevisiae <400> 45 Met Arg Phe Pro Ser Ile Phe Thr Ala Val Leu Phe Ala Ala Ser Ser 1 5 10 15 Ala Leu Ala Ala Pro Val Asn Thr Thr Thr Glu Asp Glu Thr Ala Gln 20 25 30 Ile Pro Ala Glu Ala Val Ile Gly Tyr Ser Asp Leu Glu Gly Asp Phe 35 40 45 Asp Val Ala Val Leu Pro Phe Ser Asn Ser Thr Asn Asn Gly Leu Leu 50 55 60 Phe Ile Asn Thr Thr Ile Ala Ser Ile Ala Ala Lys Glu Glu Gly Val 65 70 75 80 Ser Leu Glu Lys Arg 85 <210> 46 <211> 255 <212> DNA <213> Saccharomyces cerevisae <400> 46 atgagattcc catctatttt caccgctgtc ttgttcgctg cctcctctgc attggctgcc 60 cctgttaaca ctaccactga agacgagact gctcaaattc cagctgaagc agttatcggt 120 tactctgacc ttgagggtga tttcgacgtc gctgttttgc ctttctctaa ctccactaac 180 aacggtttgt tgttcattaa caccactatc gcttccattg ctgctaagga agagggtgtc 240 tctctcgaga agaga 255 <210> 47 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 47 ctcgcctgca ggaccatgag tgacattaat actctgtcgc 40 <210> 48 <211> 37 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 48 acggccgagg cggccagtta ggcacgacgg acactag 37 <210> 49 <211> 35 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 49 tctacctgca ggaacgatgt ccattctctc atttg 35 <210> 50 <211> 42 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 50 tatggccgag gcggcctcag gccttgcgag agcgcaaatt tc 42 <210> 51 <211> 37 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 51 atacctgcag gacaatgtct aaagaggaaa agacaag 37 <210> 52 <211> 36 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 52 attggccgag gcggccctat tcttccttct tggagg 36 <210> 53 <211> 34 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 53 atacctgcag gacaatgggt gttgaaacat cttc 34 <210> 54 <211> 37 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 54 attggccgag gcggcctcaa gaactctcct catcatc 37 <210> 55 <211> 30 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 55 atacctgcag gacaatgagc caacgtgaag 30 <210> 56 <211> 34 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 56 attggccgag gcggcctcaa agctgttgca aaac 34 <210> 57 <211> 36 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 57 atacctgcag gacaatgtca aaaactatcc cagatg 36 <210> 58 <211> 36 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 58 attggccgag gcggccttag tacatggctt tcttgc 36 <210> 59 <211> 33 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 59 ataccctgca ggcaccaatg gttaaactca ttg 33 <210> 60 <211> 31 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 60 ataggccgag gcggccctac aaaaggaatg g 31 <210> 61 <211> 30 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 61 ttccctgcag gaccatgtct caacccactc 30 <210> 62 <211> 34 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 62 acggccgagg cggcctcaca tgtgataaat tgtg 34 <210> 63 <211> 39 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 63 ttccctgcag ggaaatgaca caacataaaa gctcgatgg 39 <210> 64 <211> 36 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 64 acggccgagg cggcctcaaa ggaagcaata ctttag 36 <210> 65 <211> 31 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 65 ttccctgcag gaccatgcag tacgtaggta g 31 <210> 66 <211> 33 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 66 tatggccgag gcggcctcag ctgtcatcga ttc 33 <210> 67 <211> 19 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 67 gaagctctcc accaatttg 19 <210> 68 <211> 20 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 68 cgtcaaacag gaggcaggac 20 <210> 69 <211> 31 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 69 tctcctgcag gcaaacatga gtctggtcca g 31 <210> 70 <211> 36 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 70 tatggccgag gcggccaact aattatcgcg tctttc 36 <210> 71 <211> 31 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 71 ttccctgcag gacgatgctt actgggttgt c 31 <210> 72 <211> 37 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 72 aggccgaggc ggcctcaaga tttaatgcaa atcttag 37 <210> 73 <211> 35 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 73 taccctgcag gacgatggga ataagtgcca caatc 35 <210> 74 <211> 37 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 74 aggccgaggc ggcctcaaga tttaatgcaa atcttag 37 <210> 75 <211> 34 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 75 ttccctgcag gacgatgacg ccagacgttg ttcc 34 <210> 76 <211> 37 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 76 aggccgaggc ggcctcaaga tttaatgcaa atcttag 37 <210> 77 <211> 34 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 77 atacctgcag gacaatgctg tcgttaaaac catc 34 <210> 78 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 78 ataggccgag gcggccctac aactcatcat gatcatagtc 40 <210> 79 <211> 38 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 79 agatatagtt ctgttttattccattagagg aggatccg 38 <210> 80 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 80 gttgtcgacc tgcagcgtac tagatactgg cacataacac 40 <210> 81 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 81 gtgttatgtg ccagtatcta gtacgctgca ggtcgacaac 40 <210> 82 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 82 cggtgagaat ggcaaaagct tatg 24 <210> 83 <211> twenty one <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 83 aagcccgatg cgccagagtt g 21 <210> 84 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 84 acctcctttg cttctctatc agtggatctg atatcaccta 40 <210> 85 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 85 taggtgatat cagatccact gatagagaag caaaggaggt 40 <210> 86 <211> twenty three <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 86 actaactcag tgtcacccag ctc 23 <210> 87 <211> twenty one <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 87 tcttgccatc ctatggaact g 21 <210> 88 <211> 19 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 88 acagagcaag acttgccag 19 <210> 89 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 89 actctagctg ttgtccgcca gttc 24 <210> 90 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 90 gttgtcgacc tgcagcgtac tatcaattgt gaacataatg 40 <210> 91 <211> 40 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 91 cattatgttc acaattgata gtacgctgca ggtcgacaac 40 <210> 92 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 92 cggtgagaat ggcaaaagct tatg 24 <210> 93 <211> twenty one <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 93 aagcccgatg cgccagagtt g 21 <210> 94 <211> 39 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 94 gactcataga aacgacggaa gtggatctga tatcaccta 39 <210> 95 <211> 39 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 95 taggtgatat cagatccact tccgtcgttt ctatgagtc 39 <210> 96 <211> twenty two <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 96 attcacccag ttagggcctc cg 22 <210> 97 <211> twenty one <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 97 tcttgccatc ctatggaact g 21 <210> 98 <211> 20 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 98 taggagtacc cagcatacag 20 <210> 99 <211> 33 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 99 actacctgca ggcgaaacga tgagattccc atc 33 <210> 100 <211> 44 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 100 tcatggccga ggcggcccta ttacttgtca caggactttg gctc 44 <210> 101 <211> 39 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 101 ctatggccga ggcggcccta ttaacactca cctctgttg 39 <210> 102 <211> 39 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 102 tatcggccga ggcggcccta ttactttacct ggggacaag 39 <210> 103 <211> 39 <212> DNA <213> Artificial sequence <220> <221> gene <222> ()..() <223> Oligonucleotides for nucleic acid amplification <400> 103 ctatggccga ggcggcccta ttaacactca cctctgttg 39 BRIEF DESCRIPTION OF THE DRAWINGS

[0066] Figure 1 The amino acid and polynucleotide sequences of the accessory proteins of the present invention are shown.

[0067] Figure 2 The amino acid and polynucleotide sequences of the heavy and light chains of the model proteins SDZ-Fab and HyHEL-Fab, respectively, and the Saccharomyces cerevisiae α mating factor signal leader sequence are shown. The underlined sequence portion represents the leader sequence of SEQ ID NO. 45 or 46 fused to the model protein sequence.

[0068] Project of the present invention

[0069] 1. A method for increasing the production of a target protein in a eukaryotic host cell, the method comprising overexpressing in the host cell at least one polynucleotide encoding at least one protein involved in lipid metabolism, thereby increasing the production of the target protein compared to a host cell that does not overexpress the polynucleotide encoding the protein involved in lipid metabolism.

[0070] 2. The method of item 1, wherein the protein involved in lipid metabolism is involved in sphingolipid biosynthesis, phospholipid biosynthesis, lipid transport, lipid storage, ergosterol biosynthesis, fatty acid biosynthesis, phosphatidic acid biosynthesis and / or phospholipid metabolism.

[0071] 3. The method of item 1 or 2, wherein the protein involved in lipid metabolism is not a transcription factor.

[0072] 4. The method of any one of items 1-3, wherein the at least one protein involved in lipid metabolism comprises the amino acid sequence shown in any one of SEQ ID NOs: 1-15 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15.

[0073] 5. The method of any one of items 1 to 4, wherein the at least one protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in any one of SEQ ID NOs: 1 to 9 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1 to 9.

[0074] 6. The method of any one of items 1 to 4, wherein the at least one protein involved in phospholipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 10 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 10.

[0075] 7. The method of any one of items 1 to 4, wherein the at least one protein involved in lipid transport comprises the amino acid sequence shown in SEQ ID NO: 11 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 11.

[0076] 8. The method of any one of items 1 to 4, wherein the at least one protein involved in ergosterol biosynthesis comprises the amino acid sequence shown in any one of SEQ ID NOs: 12 to 15 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 12 to 15.

[0077] 9. The method of any one of items 1 to 4, wherein the protein involved in lipid storage comprises the amino acid sequence shown between PP7435_Chr4-0493 and PP7435_Chr4-0494 (ARV1) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown between PP7435_Chr4-0493 and PP7435_Chr4-0494.

[0078] 10. The method according to any one of items 1 to 9, comprising:

[0079] - engineering the host cell to overexpress a polynucleotide encoding a protein involved in lipid metabolism and comprising an amino acid sequence as shown in any one of SEQ ID NOs: 1-15, preferably any one of SEQ ID NOs: 1-9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NOs: 12-15, or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence as shown in any one of SEQ ID NOs: 1-1529;

[0080] - engineering the host cell to contain a heterologous polynucleotide encoding a protein of interest,

[0081] - culturing the host cell under suitable conditions to express the target protein, and optionally

[0082] - isolating the target protein from the cell culture.

[0083] 11. A method for preparing a target protein according to any one of items 1 to 9, the method comprising:

[0084] - providing a host cell, said host cell being engineered to overexpress at least one polynucleotide encoding at least one protein involved in lipid metabolism and comprising an amino acid sequence shown in any one of SEQ ID NOs: 1-15, preferably any one of SEQ ID NOs: 1-9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NOs: 12-15, or a functional homolog thereof, wherein said functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15, wherein said host cell comprises a heterologous polynucleotide encoding a protein of interest;

[0085] - culturing the host cell under suitable conditions to overexpress the protein involved in lipid metabolism or its functional homologue and express the target protein, and optionally

[0086] - isolating the target protein from the cell culture.

[0087] 12. The method of any one of items 1 to 11, wherein the overexpression is achieved by having 1, 2, 3, 4 or more copies of the polynucleotide encoding the protein involved in lipid metabolism or its functional homolog in the host cell.

[0088] 13. The method according to any one of items 1 to 12, wherein the polynucleotide encoding the protein involved in lipid metabolism or a functional homolog thereof is integrated into at least one chromosome of the host cell.

[0089] 14. The method of claim 13, wherein the integration is ectopic and / or at a native locus.

[0090] 15. The method of item 14, wherein the polynucleotide encoding the protein involved in lipid metabolism or its functional homolog is integrated into the AOX1, GAP, ENO1, TEF, HIS4, TYR1, HIS3, LEU2, URA3, LYS2, ADE2, TRP1, GAL1 or ADH1 locus of the host cell genome.

[0091] 16. The method according to any one of items 1 to 12, wherein the polynucleotide encoding the protein involved in lipid metabolism or a functional homologue thereof is contained in a vector or a plasmid.

[0092] 17. The method of item 15, wherein the vector is a YIp-type vector, a YEp-type vector, a YRp-type vector, a YCp-type vector, pGPD-2, pAO815, pGAPZ, pGAPZα, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, pPICZ, pPICZα, pPIC3K, pHWO10, pPUZZLE or a 2μm plasmid.

[0093] 18. The method according to any one of items 1 to 17, wherein the overexpression of the polynucleotide encoding the protein involved in lipid metabolism or a functional homologue thereof is achieved by using a recombinant promoter driving the expression of the polynucleotide.

[0094] 19. The method of any one of items 1 to 17, wherein the overexpression of the polynucleotide encoding the protein involved in lipid metabolism or its functional homolog is achieved by modifying the regulatory sequence operably linked to the endogenous polynucleotide encoding the protein involved in lipid metabolism or its functional homolog.

[0095] 20. The method of item 18, wherein the promoter is PAOX1, PTPI, PPGK, PGAPDH, PLAC, PGAL, PPGI, PGAP, PTEF, PENO1, PTPI, PRPS2, PRPS7, PRPS31, PRPL1, PFLD, PICL, PTHI, PSSA1, PHSP90, PKAR2, PGND1, PGPM1, PTKL1, PPIS1, PFET3, PFTR1, PPHO8, PNMT1, PMCM1, PUBI4, PRAD2, PPET9, PFMD, PGAL1, PADH1, PADH2 / GAP, PCUP1 or PMAL.

[0096] 21. The method according to any one of items 1 to 17, wherein the overexpression of the polynucleotide encoding the protein involved in lipid metabolism or a functional homologue thereof is achieved by using an enhancer to increase the activity of the promoter.

[0097] 22. The method of item 21, wherein the enhancer is the yeast upstream activation sequence UAS / GAL.

[0098] 23. The method of any one of items 1 to 22, wherein the eukaryotic host cell is a non-mammalian eukaryotic host cell.

[0099] 24. The method of claim 23, wherein the non-mammalian eukaryotic host cell is a fungal host cell.

[0100] 25. The method of claim 24, wherein the fungal host cell is Pichia pastoris, Hansenula polymorpha, Trichoderma reesei, Saccharomyces cerevisiae, Kluyveromyces lactis, Yarrowia lipolytica, Pichia methanolica, Candida boidinii, Komagataella sp., Aspergillus sp., or Schizosaccharomyces pombe.

[0101] 26. The method of any one of items 1 to 25, wherein 1, 2, 3, 4, 5, 6, 7, 8 or more proteins involved in lipid metabolism are overexpressed, wherein the proteins involved in lipid metabolism are selected from SEQ ID NO: 1-15, PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (PRY2), PP7435_Chr4-0963 (FAD12) and PP7435_Chr1-0794 (PSD1), or a functional homolog thereof.

[0102] 27. The method of claim 26, wherein at least one of the following proteins involved in sphingolipid biosynthesis is overexpressed:

[0103] (a) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1;

[0104] (b) a protein comprising the amino acid sequence shown in SEQ ID NO: 2 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 2;

[0105] (c) a protein comprising the amino acid sequence shown in SEQ ID NO: 3 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 3;

[0106] (d) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 2 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 2, respectively;

[0107] (e) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 3 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 3, respectively;

[0108] (f) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1, 3 and 4 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1, 3 and 4, respectively;

[0109] (g) a protein comprising the amino acid sequence shown in SEQ ID NO: 1, 3, 4 and 8 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, 3, 4 and 8, respectively;

[0110] (h) a protein comprising the amino acid sequences shown in SEQ ID NOs: 5 and 6 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 5 and 6, respectively;

[0111] (i) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 7 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 7, respectively;

[0112] (j) a protein comprising the amino acid sequences shown in SEQ ID NOs: 5, 6 and 9 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 5, 6 and 9, respectively;

[0113] (k) a protein comprising the amino acid sequence shown in SEQ ID NO: 1, 5, 6 and 9 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, 5, 6 and 9, respectively;

[0114] (1) a protein comprising the amino acid sequence shown in SEQ ID NO: 4 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 4;

[0115] (m) a protein comprising the amino acid sequence shown in SEQ ID NO: 5 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 5;

[0116] (n) a protein comprising the amino acid sequence shown in SEQ ID NO: 6 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 6;

[0117] (o) a protein comprising the amino acid sequence shown in SEQ ID NO: 7 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 7;

[0118] (p) a protein comprising the amino acid sequence shown in SEQ ID NO: 8 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 8;

[0119] (q) a protein comprising the amino acid sequence shown in SEQ ID NO: 9 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 9;

[0120] (r) a protein comprising the amino acid sequence shown in PP7435_Chr3-0788 (SUR2) or a functional homologue thereof, wherein said functional homologue has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr3-0788;

[0121] (s) a protein comprising the amino acid sequence shown in PP7435_Chr3-1005 (PHS1) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr3-1005;

[0122] (t) a protein comprising the amino acid sequence shown in PP7435_Chr2-0350 (AUR1) or a functional homolog thereof, wherein said functional homolog has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr2-0350;

[0123] (u) a protein comprising the amino acid sequence shown in PP7435_Chr4-0626 (IFA38) or a functional homologue thereof, wherein said functional homologue has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr4-0626;

[0124] (v) a protein comprising the amino acid sequence shown in PP7435_Chr3-0669 (SCS7) or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr3-0669;

[0125] (w) a protein comprising the amino acid sequences shown in SEQ ID NOs: 3 and 4 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 3 and 4, respectively;

[0126] (x) a protein comprising the amino acid sequence shown in SEQ ID NOs: 3, 4 and 8 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NOs: 3, 4 and 8, respectively;

[0127] (y) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 5 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 5, respectively;

[0128] (z) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1, 5 and 6 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1, 5 and 6, respectively;

[0129] (aa) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-0788 (SUR1) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-0788, respectively;

[0130] (bb) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-1005 (PHS1) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-1005, respectively;

[0131] (cc) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 8 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 8, respectively;

[0132] (dd) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr2-0350 (AUR1) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr2-0350, respectively;

[0133] (ee) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr4-0626 (IFA38) or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr4-0626, respectively; or

[0134] (ff) A protein comprising the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-0669 (SCS7) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-0669, respectively.

[0135] 28. The method of claim 26, wherein the following proteins involved in phospholipid biosynthesis are overexpressed:

[0136] (a) a protein comprising the amino acid sequence shown in SEQ ID NO: 10 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 10;

[0137] (b) a protein comprising the amino acid sequence shown in PP7435_Chr3-0636 (CRD1) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr3-0636;

[0138] (c) a protein comprising the amino acid sequence shown in PP7435_Chr3-0950 (SLC4) or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr3-0950;

[0139] (d) A protein comprising the amino acid sequence shown in PP7435_Chr2-0585 (PIS1) or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr2-0585.

[0140] 29. The method of claim 26, wherein the following proteins involved in lipid transport are overexpressed:

[0141] (a) a protein comprising the amino acid sequence shown in SEQ ID NO: 11 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 11;

[0142] (b) a protein comprising the amino acid sequence shown in PP7435_Chr1-0934 (PRY1) or a functional homolog thereof, wherein said functional homolog has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr1-0934;

[0143] (c) A protein comprising the amino acid sequence shown in SEQ ID NO: 11 and PP7435_Chr1-0934 (PRY1) or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 11 and PP7435_Chr1-0934, respectively.

[0144] 30. The method of claim 26, wherein the following proteins involved in fatty acid biosynthesis are overexpressed:

[0145] (a) A protein comprising the amino acid sequence shown in PP7435_Chr4-0963 (FAD12) or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr4-0963.

[0146] 31. The method of claim 26, wherein at least one protein involved in sphingolipid biosynthesis and at least one protein involved in lipid transport are overexpressed.

[0147] 32. The method of item 31, wherein the protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 1 or a functional homolog thereof, and the protein involved in lipid transport comprises the amino acid sequence shown in SEQ ID NO: 11 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 11, respectively.

[0148] 33. The method of claim 26, wherein at least one protein involved in phospholipid biosynthesis and at least one protein involved in lipid transport are overexpressed.

[0149] 34. The method of item 33, wherein the protein involved in phospholipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 10 or PP7435_Chr1-0794 (PSD1), and the protein involved in lipid transport comprises the amino acid sequence shown in SEQ ID NO: 11.

[0150] 35. The method of claim 34, wherein the following proteins involved in phospholipid biosynthesis or lipid transport are overexpressed:

[0151] a) a protein comprising the amino acid sequences shown in SEQ ID NOs: 10 and 11 or functional homologues thereof, wherein the functional homologues have at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 10 and 11, respectively;

[0152] b) A protein comprising the amino acid sequence shown in PP7435_Chr1-0794 (PSD1) and SEQ ID NO: 11 or a functional homologue thereof, wherein said functional homologue has at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr1-0794 and SEQ ID NO: 11, respectively.

[0153] 36. The method of claim 26, wherein at least one protein involved in sphingolipid biosynthesis and at least one protein involved in phospholipid biosynthesis are overexpressed.

[0154] 37. The method of item 36, wherein the protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 1, and the protein involved in phospholipid biosynthesis comprises the amino acid sequence shown in PP7435_Chr2-0585 (PIS1), PP7435_Chr3-0636 (CRD1) or SEQ ID NO: 10.

[0155] 38. The method of claim 37, wherein the following proteins involved in sphingolipid biosynthesis or involved in phospholipid biosynthesis are overexpressed:

[0156] a) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr2-0585 (PIS1) or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr2-0585, respectively;

[0157] b) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 10 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 10, respectively;

[0158] c) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-0636 (CRD1) or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1 and PP7435_Chr3-0636, respectively.

[0159] 39. The method of claim 26, wherein at least one protein involved in sphingolipid biosynthesis and at least one protein involved in phospholipid biosynthesis are overexpressed.

[0160] 40. The method of claim 26, wherein at least one protein involved in sphingolipid biosynthesis and at least one protein involved in ergosterol biosynthesis are overexpressed.

[0161] 41. The method of item 40, wherein the protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 1, and the protein involved in ergosterol biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 12.

[0162] 42. The method of claim 26, wherein at least one protein involved in ergosterol biosynthesis and at least one protein involved in lipid transport are overexpressed.

[0163] 43. The method of item 42, wherein the protein involved in ergosterol biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 12 or 13, and the protein involved in lipid transport comprises the amino acid sequence shown in SEQ ID NO: 11.

[0164] 44. The method of claim 37, wherein the following proteins involved in ergosterol biosynthesis or lipid transport are overexpressed:

[0165] a) a protein comprising the amino acid sequences shown in SEQ ID NOs: 12 and 11 or functional homologues thereof, wherein the functional homologues have at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 12 and 11, respectively;

[0166] b) a protein comprising the amino acid sequences shown in SEQ ID NOs: 13 and 11 or functional homologues thereof, wherein the functional homologues have at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 13 and 11, respectively.

[0167] 45. The method of claim 26, wherein at least one protein involved in sphingolipid biosynthesis and at least one protein involved in lipid storage are overexpressed.

[0168] 46. ​​The method of item 45, wherein the protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 1, and the protein involved in lipid storage is ARV1, which comprises the amino acid sequence located between PP7435_Chr4-0493 and PP7435_Chr4-0493.

[0169] 47. The method of any one of items 1-46, further comprising overexpressing a molecular chaperone.

[0170] 48. The method of item 47, wherein the molecular chaperone comprises the amino acid sequence shown in SEQ ID NO: 18 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 18.

[0171] 49. The method of item 47 or 48, wherein at least one protein involved in sphingolipid biosynthesis and at least one molecular chaperone are overexpressed.

[0172] 50. The method of item 49, wherein the protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 1 or a functional homolog thereof, and the molecular chaperone comprises the amino acid sequence shown in SEQ ID NO: 18 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 18, respectively.

[0173] 51. The method of item 47 or 48, wherein at least one protein involved in ergosterol biosynthesis and at least one molecular chaperone are overexpressed.

[0174] 52. The method of item 51, wherein the protein involved in ergosterol biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15 or a functional homolog thereof, and the molecular chaperone comprises the amino acid sequence shown in SEQ ID NO: 18 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NO: 13 and SEQ ID NO: 18, respectively.

[0175] 53. The method of any one of items 1 to 52, wherein the overexpression of at least one polynucleotide encoding a protein involved in lipid metabolism changes the lipid composition of the membrane of the host cell, wherein preferably the membrane of the host cell is a cell membrane or an endoplasmic reticulum membrane.

[0176] 54. The method of any one of items 1 to 53, wherein the target protein is a target non-membrane protein.

[0177] 55. The method of item 54, wherein the target non-membrane protein is an enzyme, a therapeutic protein, a food additive or a feed additive.

[0178] 56. The method of claim 55, wherein the therapeutic protein comprises an antibody or an antibody fragment that still has the activity to bind to its antigen.

[0179] 57. The method of any one of items 1-56, wherein the protein involved in lipid metabolism or its functional homolog increases the production of the model protein HyHEL (heavy chain SEQ ID NO: 39 and light chain SEQ ID NO: 40) by at least 10%, at least 15%, at least 20%, at least 25%, or at least 30% compared to the host cell before engineering.

[0180] 58. A recombinant eukaryotic host cell for producing a target protein, wherein the host cell is engineered to overexpress at least one polynucleotide encoding at least one protein involved in lipid metabolism.

[0181] 59. The host cell of item 58, wherein the protein involved in lipid metabolism is involved in sphingolipid biosynthesis, phospholipid biosynthesis, lipid transport, ergosterol biosynthesis, fatty acid biosynthesis, phosphatidic acid biosynthesis and / or phospholipid metabolism.

[0182] 60. The host cell of item 58 or 59, wherein the protein involved in lipid metabolism is not a transcription factor.

[0183] 61. The host cell of any one of items 58-59, wherein the protein involved in lipid metabolism comprises an amino acid sequence shown in any one of SEQ ID NOs: 1-15, preferably any one of SEQ ID NOs: 1-9, SEQ ID NO: 10, SEQ ID NO: 11 or SEQ ID NOs: 12-15, or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15.

[0184] 62. The host cell of any one of items 58-61, wherein the protein involved in lipid metabolism or the functional homolog thereof increases the production of the model protein HyHEL (heavy chain SEQ ID NO: 39 and light chain SEQ ID NO: 40) by at least 10% compared to the host cell before engineering.

[0185] 63. The host cell of any one of items 58-62, wherein the overexpression is achieved by having 1, 2, 3, 4 or more copies of the polynucleotide encoding the protein involved in lipid metabolism or its functional homolog in the host cell.

[0186] 64. The host cell of any one of items 58 to 63, wherein the polynucleotide encoding the protein involved in lipid metabolism or a functional homolog thereof is integrated into the genome of the host cell.

[0187] 65. The host cell of claim 64, wherein the integration is ectopic and / or at the native locus.

[0188] 66. The host cell of item 65, wherein the at least one polynucleotide encoding a protein involved in lipid metabolism or a functional homolog thereof is integrated into the AOX1, GAP, ENO1, TEF, HIS4, TYR1, HIS3, LEU2, URA3, LYS2, ADE2, TRP1, GAL1 or ADH1 locus of the host cell genome.

[0189] 67. The host cell of any one of items 58 to 66, wherein the polynucleotide encoding the protein involved in lipid metabolism or a functional homologue thereof is contained in a vector or plasmid.

[0190] 68. The host cell of item 67, wherein the vector is a YIp-type vector, a YEp-type vector, a YRp-type vector, a YCp-type vector, pGPD-2, pAO815, pGAPZ, pGAPZα, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, pPICZ, pPICZα, pPIC3K, pHWO10, pPUZZLE or a 2μm plasmid.

[0191] 69. The host cell of any one of items 56 to 68, wherein the overexpression of the polynucleotide encoding the protein involved in lipid metabolism or a functional homologue thereof is achieved by using a recombinant promoter driving the expression of the polynucleotide.

[0192] 70. The host cell of item 69, wherein the promoter is PAOX1, PTPI, PPGK, PGAPDH, PLAC, PGAL, PPGI, PGAP, PTEF, PENO1, PTPI, PRPS2, PRPS7, PRPS31, PRPL1, PFLD, PICL, PTHI, PSSA1, PHSP90, PKAR2, PGND1, PGPM1, PTKL1, PPIS1, PFET3, PFTR1, PPHO8, PNMT1, PMCM1, PUBI4, PRAD2, PPET9, PFMD, PGAL1, PADH1, PADH2 / GAP, PCUP1 or PMAL.

[0193] 71. The host cell of item 69, wherein the overexpression of the polynucleotide encoding the protein involved in lipid metabolism or its functional homolog is achieved by using an enhancer to enhance the activity of the promoter.

[0194] 72. The host cell of item 71, wherein the enhancer is the yeast upstream activation sequence UAS / GAL.

[0195] 73. The host cell of any one of items 58-72, wherein the eukaryotic host cell is a non-mammalian eukaryotic host cell.

[0196] 74. The host cell of item 73, wherein the non-mammalian eukaryotic host cell is a fungal host cell.

[0197] 75. The host cell of claim 74, wherein the host cell is Pichia pastoris, Hansenula polymorpha, Trichoderma reesei, Saccharomyces cerevisiae, Kluyveromyces lactis, Yarrowia lipolytica, Pichia methanolica, Candida boidinii, Komagataella sp., Aspergillus sp., and Schizosaccharomyces pombe.

[0198] 76. The host cell of any one of items 58-75, wherein 1, 2, 3, 4, 5, 6, 7, 8 or more proteins involved in lipid metabolism are overexpressed, wherein the proteins involved in lipid metabolism are selected from SEQ ID NO: 1-15, PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (PRY2), PP7435_Chr4-0963 (FAD12) and PP7435_Chr1-0794 (PSD1), or a functional homolog thereof.

[0199] 77. The host cell of item 76, wherein the protein defined in items 27-46 is overexpressed.

[0200] 78. The host cell of any one of items 58-77, further engineered to overexpress a polynucleotide encoding a molecular chaperone.

[0201] 79. The host cell of item 78, wherein the molecular chaperone comprises the amino acid sequence shown in SEQ ID NO: 18 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 18.

[0202] 80. The host cell of item 78 or 79, wherein a protein as defined in items 48 to 52 is overexpressed.

[0203] 81. The host cell of any one of items 58-80, comprising a heterologous polynucleotide sequence encoding the target protein.

[0204] 82. The host cell of item 81, wherein the target protein is a target non-membrane protein.

[0205] 83. The host cell of item 82, wherein the target non-membrane protein is an enzyme, a therapeutic protein, a food additive or a feed additive.

[0206] 84. The host cell of item 83, wherein the therapeutic protein comprises an antibody or an antibody fragment that still has the activity of binding to its antigen.

[0207] 85. The host cell of any one of items 58 to 84, wherein overexpression is achieved by modifying a regulatory sequence operably linked to an endogenous polynucleotide encoding a protein involved in lipid metabolism or a functional homologue thereof.

[0208] 86. The host cell of any one of items 58 to 85, wherein overexpression of the at least one polynucleotide encoding a protein involved in lipid metabolism alters the lipid composition of the biological membrane of the host cell.

[0209] 87. Use of the host cell according to any one of items 58 to 86 for producing a target protein.

[0210] 88. The use of the host cell according to item 87, wherein the target protein is a target non-membrane protein.

[0211] 89. An isolated polynucleotide encoding a protein involved in lipid metabolism and comprising the amino acid sequence shown in any one of SEQ ID NOs: 1-15 or a functional homolog thereof, or an isolated polynucleotide encoding a molecular chaperone comprising the amino acid sequence shown in SEQ ID NO: 18 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15 and 18, respectively.

[0212] 90. An isolated polynucleotide comprising the nucleotide sequence shown in any one of SEQ ID NOs: 19-33 and 36.

[0213] 91. Use of the isolated polynucleotide according to item 89 or 90 for integration into a host cell.

[0214] 92. Use of the polynucleotide according to item 89 or 90 for producing a target protein, preferably a target non-membrane protein.

[0215] 93. Use of the polynucleotide according to item 89 or 90 for preparing a host cell.

[0216] 94. An isolated polypeptide comprising an amino acid sequence having at least 30% sequence identity to the amino acid sequence shown in any one of SEQ ID NOs: 1-15 and 18.

[0217] 95. Use of the isolated polypeptide according to item 94 for preparing a target protein, preferably a target non-membrane protein.

[0218] 96. A composition comprising at least 0.25%, 0.5%, 1%, 2%, 3%, 4%, 5% or 10% of a target protein and a polynucleotide according to item 86 or 87, wherein the polynucleotide is operably linked to a heterologous promoter, and wherein the target protein is preferably a target non-membrane protein.

[0219] 97. A method for increasing the production of a target protein in a eukaryotic host cell, the method comprising underexpressing at least one polynucleotide encoding a protein involved in lipid metabolism in the host cell, thereby increasing the production of the target protein compared to a host cell that does not underexpress the polynucleotide encoding the protein involved in lipid metabolism.

[0220] 98. The method of item 97, wherein the protein involved in lipid metabolism is involved in lipid storage.

[0221] 99. The method of item 97 or 98, wherein the protein involved in lipid metabolism is not a transcription factor.

[0222] 100. The method of item 98 or 99, wherein the protein involved in lipid storage comprises the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17.

[0223] 101. The method of claim 100, wherein the following proteins involved in lipid storage are underexpressed:

[0224] a) a protein comprising the amino acid sequence shown in SEQ ID NOs: 16 and 17 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NOs: 16 and 17;

[0225] b) a protein comprising the amino acid sequence shown in SEQ ID NO: 16 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16;

[0226] c) a protein comprising the amino acid sequence shown in SEQ ID NO: 17 or a functional homologue thereof, wherein the functional homologue has a sequence identity of at least 30% with the amino acid sequence shown in SEQ ID NO: 17.

[0227] 102. The method of any one of items 97-101, wherein the target protein is a target non-membrane protein.

[0228] 103. The method of any one of items 97-102, wherein the eukaryotic host cell is a non-mammalian eukaryotic host cell.

[0229] 104. The method of claim 103, wherein the non-mammalian eukaryotic host cell is a fungal host cell, wherein preferably the fungal host cell is Pichia pastoris, Hansenula polymorpha, Trichoderma reesei, Saccharomyces cerevisiae, Kluyveromyces lactis, Yarrowia lipolytica, Pichia methanolica, Candida boidinii, Komagataella sp., Aspergillus sp. and Schizosaccharomyces pombe, wherein the fungal host cell is even more preferably Pichia pastoris.

[0230] 105. The method of any one of items 97 to 104, comprising:

[0231] - engineering the host cell to underexpress a polynucleotide encoding a protein involved in lipid metabolism and comprising the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17,

[0232] - engineering the host cell to contain a heterologous polynucleotide encoding the protein of interest,

[0233] - culturing the host cell under suitable conditions to express the target protein, and optionally

[0234] - isolating the target protein from the cell culture.

[0235] 106. A method for preparing the target protein according to any one of items 97 to 104, the method comprising:

[0236] - providing a host cell, wherein the host cell is engineered to low-express a polynucleotide encoding a protein involved in lipid metabolism and comprising the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17, wherein the host cell comprises a heterologous polynucleotide encoding the target protein;

[0237] - culturing the host cell under suitable conditions to low-express the protein involved in lipid metabolism or its functional homologue and express the target protein, and optionally

[0238] - isolating the target protein from the cell culture.

[0239] 107. The method of any one of items 97 to 106, wherein the following proteins involved in lipid metabolism are underexpressed:

[0240] a) A protein comprising the amino acid sequences shown in SEQ ID NOs: 16 and 17 or functional homologues thereof, wherein the functional homologues have at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 16 and 17, respectively.

[0241] 108. The method of any one of items 97-106, comprising overexpressing at least one polynucleotide encoding a protein involved in lipid metabolism in the host cell.

[0242] 109. The method of item 108, wherein the protein that is overexpressed and involved in lipid metabolism is involved in lipid storage, sphingolipid biosynthesis, phospholipid biosynthesis, phospholipid metabolic process or phosphatidic acid biosynthesis.

[0243] 110. The method of claim 109, wherein at least one protein involved in sphingolipid biosynthesis is overexpressed, and at least two proteins involved in lipid storage are underexpressed.

[0244] 111. The method of claim 110, wherein the following proteins involved in sphingolipid biosynthesis are overexpressed, and the following proteins involved in phospholipid storage are underexpressed:

[0245] a) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 or a functional homologue thereof is overexpressed, and a protein comprising the amino acid sequences shown in SEQ ID NOs: 16 and 17 or functional homologues thereof is underexpressed, wherein the functional homologues have at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1, 16 and 17, respectively.

[0246] 112. The method of claim 109, wherein at least one protein involved in phospholipid biosynthesis is overexpressed, and at least two proteins involved in lipid storage are underexpressed.

[0247] 113. The method of item 112, wherein the protein involved in phospholipid biosynthesis comprises the amino acid sequence shown in PP7435_Chr3-0950 (SLC4), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2) or SEQ ID NO: 10, and the protein involved in lipid storage comprises the amino acid sequence shown in SEQ ID NO: 16 and 17.

[0248] 114. The method of claim 113, wherein the following proteins involved in phospholipid biosynthesis are overexpressed, and the following proteins involved in lipid storage are underexpressed:

[0249] a) a protein comprising the amino acid sequence shown in PP7435_Chr3-0950 (SLC4) or a functional homologue thereof is overexpressed, and a protein comprising the amino acid sequence shown in SEQ ID NOs: 16 and 17 or a functional homologue thereof is underexpressed, wherein the functional homologues have at least 30% sequence identity with the amino acid sequence shown in PP7435_Chr3-0950, SEQ ID NOs: 16 and 17, respectively;

[0250] b) a protein comprising the amino acid sequence shown in PP7435_Chr1-0160 (SLC1) or a functional homologue thereof is overexpressed, and a protein comprising the amino acid sequences shown in SEQ ID NOs: 16 and 17 or functional homologues thereof is underexpressed, wherein the functional homologues have at least 30% sequence identity with the amino acid sequences shown in PP7435_Chr1-0160, SEQ ID NOs: 16 and 17, respectively;

[0251] c) a protein comprising the amino acid sequence shown in PP7435_CHR1-0078 (GPT2) or a functional homologue thereof is overexpressed, and a protein comprising the amino acid sequence shown in SEQ ID NOs: 16 and 17 or a functional homologue thereof is underexpressed, wherein the functional homologues have at least 30% sequence identity with the amino acid sequence shown in PP7435_CHR1-0078, SEQ ID NOs: 16 and 17, respectively;

[0252] d) a protein comprising the amino acid sequence shown in SEQ ID NO: 10 or a functional homolog thereof is overexpressed, and a protein comprising the amino acid sequences shown in SEQ ID NOs: 16 and 17 or functional homologs thereof is underexpressed, wherein the functional homologs have at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 10, 16 and 17, respectively.

[0253] 115. The method of claim 109, wherein at least one protein involved in phospholipid metabolism is overexpressed, and at least two proteins involved in lipid storage are underexpressed.

[0254] 116. The method of item 115, wherein the protein involved in the phospholipid metabolism process is overexpressed and comprises the amino acid sequence shown in PP7435_Chr2-0045 (CDS1) or its functional homolog, and the protein involved in lipid storage is underexpressed and comprises the amino acid sequence shown in SEQ ID NO: 16 or 17 or its functional homolog, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in PP7435_Chr2-0045, SEQ ID NO: 16 and 17, respectively.

[0255] 117. The method of claim 116, wherein at least one protein involved in phosphatidic acid biosynthesis is overexpressed, and at least two proteins involved in lipid storage are underexpressed.

[0256] 118. The method of item 117, wherein the protein involved in phosphatidic acid biosynthesis is overexpressed and comprises the amino acid sequence shown in PP7435_Chr3-1169 (DGK1) or a functional homolog thereof, and the protein involved in lipid storage is underexpressed and comprises the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in PP7435_Chr3-1169, SEQ ID NO: 16 and 17, respectively.

[0257] 119. The method of item 109, wherein at least one protein involved in lipid storage is overexpressed and at least two proteins involved in lipid storage are underexpressed.

[0258] 120. The method of item 119, wherein the overexpressed protein involved in lipid storage comprises the amino acid sequence shown in PP7435_Chr3-0741 (ARE2) or a functional homolog thereof, and the underexpressed protein involved in lipid storage comprises the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in PP7435_Chr3-0741, SEQ ID NO: 16 and 17, respectively.

[0259] 121. A recombinant eukaryotic host cell for producing a target protein, wherein the host cell is engineered to low-express at least one polynucleotide encoding a protein involved in lipid metabolism, wherein the target protein is preferably a non-membrane protein.

[0260] 122. The host cell of item 121, wherein the protein involved in lipid metabolism is involved in lipid storage and comprises the amino acid sequence shown in any one of SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NO: 16 or 17.

[0261] 123. The host cell of item 121 or 122, wherein the following proteins involved in lipid storage are underexpressed:

[0262] a) a protein comprising the amino acid sequences shown in SEQ ID NOs: 16 and 17 or functional homologues thereof, wherein the functional homologues have at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 16 and 17, respectively;

[0263] b) a protein comprising the amino acid sequence shown in SEQ ID NO: 16 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16;

[0264] c) a protein comprising the amino acid sequence shown in SEQ ID NO: 17 or a functional homologue thereof, wherein the functional homologue has a sequence identity of at least 30% with the amino acid sequence shown in SEQ ID NO: 17.

[0265] 124. The host cell of any one of items 121 to 123, wherein at least one polynucleotide encoding a protein involved in lipid metabolism is overexpressed as defined in items 109-120.

[0266] 125. The host cell of any one of items 121 to 124, wherein the protein involved in lipid metabolism or the functional homolog thereof increases the production of the model protein HyHEL (heavy chain SEQ ID NO: 39 and light chain SEQ ID NO: 40) by at least 10% compared to the host cell before engineering.

[0267] 126. A method for increasing the production of a target protein in a eukaryotic host cell by changing the lipid composition of the host cell's membrane, wherein preferably the host cell's membrane is a cell membrane or an endoplasmic reticulum membrane.

[0268] 127. The method of item 126, wherein the lipid composition of the membrane of the host cell is altered by overexpression of at least one protein involved in lipid metabolism, preferably an auxiliary protein as described herein.

[0269] 128. A method for increasing the production of a target protein in a eukaryotic host cell by altering the molecular species pattern of sphingolipids, preferably by increasing the amount of the C26 fatty acyl moiety of ceramides and / or inositol-containing phosphoceramides (inositolphosphoceramide, mannose-inositolphosphoceramide, mannose-diinositol-phosphoceramide) and / or decreasing the amount of the C24 fatty acyl moiety of ceramides and / or inositol-containing phosphoceramides (inositolphosphoceramide, mannose-inositolphosphoceramide, mannose-diinositol-phosphoceramide).

[0270] 129. The method of claim 128, wherein the molecular species pattern of sphingolipids is altered by overexpression of at least one protein involved in lipid metabolism, preferably an auxiliary protein as described herein.

[0271] 130. The method of item 128 or 129, wherein the relative amount of fatty acyl groups with a chain length of 26 carbons (C26) introduced into ceramides IPC, MIPC and M(IP)2C is increased by at least 100%, while the relative amount of fatty acyl groups with a chain length of 24 carbons (C24) is decreased by at least 70%.

[0272] 131. A method for increasing the production of a target protein in a eukaryotic host cell by reducing the amount of IPC and MIPC (by about 30%) and / or increasing the formation of the mature form of inositol-containing phosphorylceramide M(IP)2C by at least 6-fold (600%).

[0273] 132. The method of item 131, wherein the reduction and / or increase is achieved by overexpression of at least one protein involved in lipid metabolism, preferably an auxiliary protein as described herein.

[0274] 133. The method of claim 131 or 132, wherein the relative distribution of sphingolipids is affected as follows: M(IP)2C increases 6-fold (600%), and the relative distribution of IPC and MIPC decreases by approximately 30%.

[0275] 134. A method for increasing the production of a target protein in a eukaryotic host cell by depleting the non-polar storage lipid triacylglycerol (TG).

[0276] 135. The method of item 134, wherein the depletion is achieved by underexpression of at least one protein involved in lipid metabolism, preferably an auxiliary protein described herein. Detailed Description of the Invention

[0278] The present invention is based in part on the surprising discovery that expression of the accessory proteins described herein that are involved in lipid metabolism, when overexpressed (accessory proteins comprising the amino acid sequences shown in SEQ ID NOs: 1-15) or underexpressed (KO accessory proteins comprising the amino acid sequences shown in SEQ ID Nos: 16 and 17), was found to increase the production of the target protein. The amino acid sequence and nucleotide sequence of each accessory protein used herein, particularly in the examples, and their corresponding gene identifiers are listed in Table 1 below, designated as "OE" (overexpressed accessory protein) and "KO" (underexpressed accessory protein). Combinations of overexpressed and underexpressed accessory proteins are described in detail herein and in Example 6.

[0279] Table 1

[0280] Gene identities for Pichia pastoris sequences were retrieved from Sturmberger et al. [J. Biotechnol. (2016) 235(4):121-131], and for Saccharomyces cerevisiae sequences were retrieved from Cherry JM et al. [Nucleic Acids Res. (2012) 40 (Database issue D700-5)]. Gene ontology terms were defined as follows: "sphingolipid" refers to sphingolipid biosynthesis including fatty acid elongation; "transport" refers to lipid transport; "phospholipid" refers to phospholipid biosynthesis; "sterol" refers to ergosterol biosynthesis; and "storage" refers to lipid storage. Gene accession numbers were retrieved from the European Nucleotide Dataset (ENA) and protein accession numbers from UniProtKB. *KAR2 sequences (nucleotide and amino acid) were annotated only for Pichia pastoris strain GS115, which is nearly identical to CBS7435. Therefore, the gene / protein accession number for KAR2 is listed in the sequence annotated in the context of Pichia pastoris strain GS 115. It is noted that, for the avoidance of doubt, the amino acid or nucleotide sequences referred to in SEQ ID NOs. supersede any other source of such sequences.

[0281]

[0282]

[0283] As used herein, "auxiliary protein" or "auxiliary protein of the present invention" refers to a protein that participates in lipid metabolism and increases the production of the model protein or target protein (POI) described herein, preferably, when overexpressed (if it is an auxiliary protein shown in SEQ ID NO: 1-15, such as SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15) in a host cell that also expresses the target protein, or when underexpressed (if it is an auxiliary protein shown in SEQ ID NO: 16 or 17), it participates in lipid metabolism and increases the production of the model protein or target protein (POI) described herein. Additional auxiliary proteins of the present invention that are involved in lipid metabolism and enhance the production of model proteins when overexpressed are shown in PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), 5_chr1-0934 (PRY2), ARV1 (ORF not annotated; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1) or their functional homologs. This term should be understood broadly and should not be limited to, for example, molecular chaperones or molecular chaperone-like proteins. The disclosure of the present invention clearly shows that the functions of the accessory proteins of the present invention vary, but all are involved in certain types of lipid metabolism. Preferred accessory proteins of the present invention comprise the amino acid sequence shown in any one of SEQ ID NOs: 1 to 17 or a functional homologue thereof. Preferred accessory proteins of the present invention may be encoded by the nucleotide sequence of any one of SEQ ID NOs: 19 to 36, respectively, or by a nucleotide sequence encoding any one of the variants of the functional homologues of SEQ ID NOs: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15. For the purposes of the present invention, the term "accessory protein" is also intended to include a functional homologue of the accessory protein shown in any one of SEQ ID NOs: 1 to 17, respectively.The present invention provides an isolated polynucleotide sequence encoding an auxiliary protein comprising the amino acid sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15.The present invention provides an isolated polynucleotide sequence encoding a polypeptide comprising the polypeptides shown in PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), The amino acid sequences of PP7435_Chr1-0934 (PRY2), ARV1 (ORF not annotated; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1), and PP7435_Chr2-0045 (CDS1) or their functional equivalents are shown. Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (PR Y2), ARV1 (ORF not annotated; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1) have an amino acid sequence identity of at least 30%.

[0284] The term "involved in lipid metabolism" means that the accessory protein has a function / activity in lipid metabolism in eukaryotic cells. Lipid metabolism includes functions such as lipid synthesis, lipid degradation, lipid transport (mediated by proteins, vesicles or direct membrane contact to bring lipids from their site of synthesis to their destination, such as incorporation into biological membranes or to transport excess or malfunctioning lipids outside the cell), lipid storage (storage of lipids in biologically inert forms such as sterol esters or triacylglycerols to avoid lipotoxicity caused by excess free sterols or fatty acids; lipid storage occurs in specialized organelles called lipid droplets), lipid modification, lipid stability, lipid-lipid interactions, fatty acid biosynthesis and modification, sphingolipid biosynthesis, phospholipid biosynthesis, ergosterol biosynthesis, alteration of the molecular species of abundant sphingolipids The invention also provides a method for modifying the fatty acyl moiety of ceramides (ceramide and hexosyl-ceramide) and inositol-containing phosphoceramides (IPC inositolphosphoceramide, MIPC mannosyl-inositolphosphoceramide, M(IP)2C mannosyl-diinositolphosphoceramide) to preferentially contain C26 (26 carbons in the fatty acyl chain) rather than C24 (24 carbons in the fatty acyl chain) at the expense of IPC; and for shifting the sphingolipid distribution pattern toward a higher proportion of mature complex sphingolipids (i.e., more M(IP)2C) at the expense of IPC; and for depleting cellular triacylglycerols, which are the primary storage lipids of Pichia pastoris. Preferably, the auxiliary protein involved in lipid metabolism is not a transcription factor. Thus, when overexpressed or underexpressed as described herein, the auxiliary protein involved in lipid metabolism can alter the lipid composition of biological membranes in eukaryotic host cells, particularly fungal host cells, thereby positively affecting the production of recombinant proteins. As used herein, the term "biological membrane" includes, but is not limited to, cell membranes and endoplasmic reticulum membranes, vesicle membranes, Golgi membranes, and the like. Thus, when used herein, the term "lipid metabolism" can be replaced by the term "modification of biological membrane lipid composition" when used in the context of overexpression or underexpression of auxiliary proteins, respectively, preferably by modification of biological membrane lipid composition in eukaryotic host cells, particularly in fungal host cells. As described herein, in the context of overexpression of auxiliary proteins, such auxiliary proteins participate in sphingolipid biosynthesis (comprising auxiliary proteins of SEQ ID NO: 1-9), phospholipid biosynthesis (comprising auxiliary proteins of SEQ ID NO: 10), lipid transport (comprising auxiliary proteins of SEQ ID NO: 11), ergosterol biosynthesis (comprising auxiliary proteins of SEQ ID NO: 12-15), fatty acid biosynthesis, phosphatidic acid biosynthesis, and / or phospholipid metabolism. As used herein, the term "sphingolipid biosynthesis" includes fatty acid elongation. Thus, auxiliary proteins involved in sphingolipid biosynthesis can participate in sphingolipid biosynthesis and / or fatty acid elongation. The biosynthesis of complex sphingolipids such as IPC, MIPC, or M(IP)2C is inseparable from the elongation of fatty acids.During fatty acid elongation, long-chain fatty acids undergo a continuous four-step cycle, resulting in the formation of very-long-chain fatty acids (such as C24 or C26). The very-long-chain fatty acids produced by fatty acid elongation are then readily incorporated as direct substrates into sphingolipid biosynthesis, generating complex sphingolipids (IPC, MIPC, and M(IP)2C). The initial steps of sphingolipid biosynthesis occur in the endoplasmic reticulum, but further modification and maturation of ceramide to form complex inositol-containing phosphoceramides occurs in the Golgi apparatus. Therefore, ceramide and hexosylceramide are found in significant quantities in the membranes of the endoplasmic reticulum, but also to a lesser extent in other organelles of the secretory pathway (vesicles and the Golgi apparatus) and the plasma membrane. Complex sphingolipids (IPC, MIPC, and M(IP)2C) are most highly enriched in the plasma membrane, colocalizing with sterols in so-called lipid rafts, but are also found in lower amounts in the membranes of the endoplasmic reticulum and other organelles of the secretory pathway (vesicles and the Golgi apparatus). As also mentioned herein in the context of the low expression of auxiliary proteins, such auxiliary proteins are for example involved in lipid storage (such as the KO auxiliary proteins comprising SEQ ID NO: 16 or 17). Therefore, in the case of overexpression of auxiliary proteins as described herein, the modification of biological membrane lipid composition can preferably be affected by sphingolipid biosynthesis, phospholipid biosynthesis, lipid transport or ergosterol biosynthesis, or in the case of low expression of auxiliary proteins as described herein, the modification of biological membrane lipid composition can preferably be affected by lipid storage. Preferably, the auxiliary proteins of the present invention that participate in lipid metabolism are not transcription factors. Different groups of auxiliary proteins as described herein (i.e., participating in sphingolipid biosynthesis, phospholipid biosynthesis, lipid transport, ergosterol biosynthesis and lipid storage) are based on Pichia pastoris genes.

[0285] As used herein, the term "target protein" generally refers to any protein, but preferably refers to a "heterologous protein" or a "recombinant protein", and even more preferably refers to a "target non-membrane protein". "Target non-membrane protein" means that the target protein is preferably not a protein constituting the entire membrane, and the protein constituting the entire membrane is permanently part of the biomembrane of a eukaryotic cell (such as a fungal cell) or attached to the biomembrane of a eukaryotic cell (such as a fungal cell) in its natural environment (i.e., in situ). These proteins are classified as spanning a biomembrane at least once. Therefore, preferably, the target non-membrane protein as used herein does not have a transmembrane domain. However, the term "non-membrane protein" as used herein includes GPI-anchored proteins.

[0286] As used herein, a "homolog" or "functional homolog" of an auxiliary protein of the present invention shall refer to a protein having identical or conserved residues at corresponding positions in its primary, secondary, or tertiary structure. The term also extends to two or more nucleotide sequences encoding homologous polypeptides. In particular, polypeptides homologous to an auxiliary protein of the present invention have at least about 30% amino acid sequence identity with the sequences disclosed herein (SEQ ID Nos: 1-18). Preferably, a homologous polypeptide has at least about 35% amino acid sequence identity, more preferably at least about 40% amino acid sequence identity, more preferably at least about 45% amino acid sequence identity, more preferably at least about 50% amino acid sequence identity, more preferably at least about 55% amino acid sequence identity, more preferably at least about 60% amino acid sequence identity, more preferably at least about 65% amino acid sequence identity, more preferably at least about 70% amino acid sequence identity, more preferably at least about 75% amino acid sequence identity, more preferably at least about 80% amino acid sequence identity, more preferably at least about 85% amino acid sequence identity, more preferably at least about 90% amino acid sequence identity, such as 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% amino acid sequence identity, more preferably at least about 95% amino acid sequence identity with the native sequence of the full-length compound or any other specifically defined fragment. When the function of such a homologue as an auxiliary protein is verified, the homologue is called a "functional homologue". A functional homologue performs the same or substantially the same function as the auxiliary protein from which it is derived, that is, it has the same enzymatic activity in the lipid metabolism of the cell or catalyzes the same metabolic reaction. In the case of a nucleotide sequence, a "functional homologue" preferably refers to a nucleotide sequence having a sequence different from the original nucleotide sequence, but due to the use of a degenerate genetic code, it still encodes the same amino acid sequence. A functional homologue can also be a biologically active fragment of an auxiliary protein. In general, a biologically active fragment of an auxiliary protein should refer to a fragment of the auxiliary protein that exerts a biological effect similar to or comparable to that of the full-length auxiliary protein, meaning that the biologically active fragment results in an increase in POI production of at least 50%, at least 60%, at least 70%, at least 80% or at least 90% of the observed increase in POI production using the corresponding full-length auxiliary protein (SEQ ID-NOs 1-18). Such active fragments may be obtained, for example, by amino- and / or carboxyl-terminal deletions and / or deletion of at least one amino acid which is not the amino- and / or carboxyl-terminal amino acid of the amino acid sequence of the full-length accessory protein.

[0287] In general, any mutagenesis procedure known in the art, such as site-directed mutagenesis, synthetic gene construction, semi-synthetic gene construction, random mutagenesis, shuffling, etc., can be used to prepare homologues. Site-directed mutagenesis is a technique in which one or more restricted sites on the polynucleotide encoding the parent are introduced into one or more (e.g., several) mutations. Site-directed mutagenesis can be accomplished in vitro by PCR involving the use of oligonucleotide primers comprising the desired mutation. Site-directed mutagenesis can also be implemented in vitro by cassette mutagenesis, which involves cutting on a site in a plasmid comprising the polynucleotide encoding the parent and subsequently connecting an oligonucleotide comprising the mutation on the polynucleotide. Typically, the restriction enzymes that digest the plasmid and the oligonucleotide are identical, thereby allowing the sticky ends of the plasmid and the insert to be connected to each other. See, e.g., Scherer and Davis, 1979, Proc. Natl. Acad. Sci. USA 76:4949-4955; and Barton et al., 1990, Nucleic Acids Res. 18:7349-4966. Site-directed mutagenesis can also be accomplished in vivo by methods known in the art. See, e.g., U.S. Patent Application Publication No. 2004 / 0171154; Storici et al., 2001, Nature Biotechnol. 19:773-776; Kren et al., 1998, Nat. Med. 4:285-290; and Calissano and Macino, 1996, Fungal Genet. Newslett. 43:15-16. Synthetic gene construction requires the in vitro synthesis of a designed polynucleotide molecule encoding a polypeptide of interest. Gene synthesis can be performed using a variety of techniques, such as the multiplexed microchip-based technology described by Tian et al. (2004, Nature 432: 1050-1054) and similar technologies in which oligonucleotides are synthesized and assembled on a photo-programmable microfluidic chip. Single or multiple amino acid substitutions, deletions and / or insertions can be performed and tested using known mutagenesis, recombination and / or shuffling methods, followed by relevant screening procedures, such as those disclosed by Reidhaar-Olson and Sauer, 1988, Science 241: 53-57; Bowie and Sauer, 1989, Proc. Natl. Acad. Sci. USA 86: 2152-2156; WO 95 / 17413 or WO 95 / 22625.Other available methods include error-prone PCR, phage display (e.g., Lowman et al., 1991, Biochemistry 30:10832-10837; U.S. Patent No. 5,223,409; WO 92 / 06204), and region-specific mutagenesis (Derbyshire et al., 1986, Gene 46:145; Ner et al., 1988, DNA 7:127). Mutagenesis / shuffling methods can be combined with high-throughput, automated screening methods to detect the activity of cloned, mutagenized polypeptides expressed by host cells (Ness et al., 1999, Nature Biotechnology 17:893-896). Mutagenized DNA molecules encoding active polypeptides can be recovered from host cells and rapidly sequenced using standard methods known in the art. These methods allow for the rapid determination of the importance of individual amino acid residues in a polypeptide. Semi-synthetic gene construction is completed by the combination of each aspect of synthetic gene construction and / or site-directed mutagenesis and / or random mutagenesis and / or reorganization.Semi-synthetic construction is characterized by utilizing the process of synthetic polynucleotide fragments and the PCR technology combination.Therefore, the gene of restricted region can be synthesized de novo, and other zones can adopt site-specific mutagenic primer amplification, and also have other zones to stand error-prone PCR or mistake-free PCR amplification.Then, polynucleotide subsequence is reorganized.Alternatively, can be from natural origin, as by screening the cDNA library of other biology, preferably close relative or related biology, obtain homologue.

[0288] The function of homologs of any one of SEQ ID NOs: 1 to 17 or other auxiliary proteins disclosed herein (e.g., in paragraph

[0046] ) can be tested by providing an expression cassette into which the homolog sequence has been inserted, transforming a host cell carrying a sequence encoding a test protein, such as one or another POI of the model proteins used in the Examples section, and determining the difference in the production of the model protein or POI under the same conditions.

[0289] The present invention provides an isolated polynucleotide sequence encoding SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17 or a functional homolog of SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or 17. The isolated polynucleotide sequence may comprise any one of SEQ ID NO: 19 to 35. Preferably, the isolated polynucleotide sequence consists of the nucleotide sequence of any one of SEQ ID NO: 30 to 58. The present invention also provides an isolated polynucleotide sequence encoding PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_Chr4-0626 (IFA38), r1-0934 (PRY2), ARV1 (ORF unnamed; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1) or their functional homologs.

[0290] In addition, the present invention provides an isolated polypeptide comprising an amino acid sequence selected from SEQ ID NO: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or 18 having at least 30%, such as at least 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 94, 95, 96, 97, 98, 99, or 100% sequence identity. In addition, the present invention provides an isolated polypeptide comprising a polypeptide selected from the group consisting of PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP 7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (PRY2), ARV1 (ORF unnamed; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1) have at least 30%, such as at least 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 94, 95, 96, 97, 98, 99, or 100% sequence identity.

[0291] The term "isolated" refers to a substance that is in a form or environment that does not occur in nature. Non-limiting examples of isolated substances include: (1) any non-naturally occurring substance; (2) any substance that is at least partially removed from one or more or all of the naturally occurring components with which it is associated in nature, including but not limited to any enzyme, variant, nucleic acid, protein, peptide, or cofactor; (3) any substance that has been artificially modified relative to the substance found in nature, such as preparing cDNA from mRNA; or (4) any substance that has been modified by increasing the amount of the substance relative to the other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).

[0292] The present invention provides the use of any of the above-described isolated polynucleotides for integration into a host cell. Alternatively, if one or more of the polynucleotides are already present in the host cell, the host cell may be manipulated to overexpress them, as described below. In another aspect, the present invention relates to the use of the polynucleotides for increasing the production of a POI in a host cell, wherein the nucleotide sequence encoding the POI is co-expressed with the polynucleotide.

[0293] "Sequence identity" or "% identity" refers to the percentage of residue matches between at least two polypeptide or polynucleotide sequences aligned using a standardized algorithm. In order to optimize the alignment between two sequences, such an algorithm can insert gaps in the compared sequences in a standardized and reproducible manner, thereby achieving a more meaningful comparison of the two sequences. For the purposes of the present invention, the sequence identity between two amino acid or nucleotide sequences is determined using the NCBI BLAST program version 2.2.29 (January 6, 2014) (Altschul et al., Nucleic Acids Res. (1997) 25:3389-3402). The sequence identity of two amino acid sequences can be determined using blastp with the following parameters: matrix: BLOSUM62, word length: 3; expectation: 10; gap cost: presence = 11, extension = 1; filtering = low complexity activated; filter string: L; compositional adjustment: conditional composition score matrix adjustment. For the purposes of the present invention, sequence identity between two nucleotide sequences is determined using the NCBI BLAST program version 2.2.29 (January 6, 2014) of blastn with the following exemplary parameters: word length: 11; expectation: 10; gap cost: existence = 5, extension = 2; filter = low complexity activated; match / mismatch score: 2, -3; filter string: L; m.

[0294] In addition, the present invention provides a host cell engineered to overexpress a polynucleotide encoding an auxiliary protein of the present invention. The auxiliary protein includes any one of SEQ ID NO: 1-15 or a functional homologue thereof. The auxiliary protein also includes PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (P RY2), ARV1 (ORF unnamed; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1), or functional homologs thereof. Similarly, the present invention provides a host cell engineered to underexpress a polynucleotide encoding an accessory protein of the present invention (KO accessory protein). The KO accessory protein comprises any one of SEQ ID NO: 16 or 17, respectively, or a functional homolog thereof. Host cells engineered to underexpress a polynucleotide encoding a KO accessory protein or an accessory protein of the invention can further overexpress one or more accessory proteins as set forth in the items disclosed herein.

[0295] Preferably, the present invention provides a recombinant host cell for producing a target protein, wherein the host cell is engineered to overexpress a polynucleotide encoding an auxiliary protein comprising amino acids having at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15.

[0296] Preferably, the present invention provides a recombinant host cell for producing a target protein, wherein the host cell is engineered to underexpress a polynucleotide encoding a KO helper protein comprising amino acids having at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NO: 16 or 17.

[0297] The term "expressed polynucleotide" refers to when a polynucleotide is transcribed into mRNA and the mRNA is translated into a polypeptide. The term "overexpression" generally refers to any amount greater than or equal to the expression level shown by a reference standard. In the present invention, the term "overexpressed" refers to the expression of a gene product or polypeptide at a level higher than the expression of the same gene product or polypeptide in a comparable host that has not been genetically altered under defined conditions before the host cell is genetically altered. In the present invention, an auxiliary protein comprising the amino acid sequence shown in any one of SEQ ID NOs: 1-15 is overexpressed. If a host cell does not contain a given gene product, it is possible to introduce the gene product into the host cell for expression; in this case, the term "overexpression" includes any detectable expression.

[0298] The term "low expression" generally refers to any amount less than the expression level shown by a reference standard, wherein the reference standard is a host cell engineered to underexpress a KO auxiliary protein as described herein. In the present invention, the term "low expression" refers to gene product or polypeptide expressed at a level lower than the expression of the same gene product or polypeptide in a comparable host before or without genetic alteration of the host cell. For example, compared to a reference standard, the KO protein may be underexpressed by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or may not even be expressed at all (reduced by 100%). It is also encompassed in the term "low expression" that a gene product or polypeptide is not expressed by, for example, a deletion / knockout KO auxiliary gene.

[0299] As used herein, the term "engineered" host cell is a host cell that has been manipulated using genetic engineering (i.e., by human intervention). When a host cell is "engineered to overexpress" a given protein, the host cell is manipulated so that the host cell has the ability to express, preferably overexpress, an accessory protein or a functional homolog thereof, thereby increasing expression of the given protein, such as a POI or a model protein, compared to the host cell under the same conditions before manipulation.

[0300] When the host cell "low expresses" or is "engineered to low express" a given protein, the host cell is operated so that the host cell has the ability to low-express KO auxiliary protein or its functional homologue, thereby increasing the expression of a given protein such as POI or model protein compared to the host cell under the same conditions before the operation. Low expression can be implemented by any method that prevents the functional expression of KO auxiliary protein, and the KO auxiliary protein comprises an amino acid sequence or its functional homologue shown in any one of SEQ ID NO: 16 or 17. The result of low expression is that it cannot play its function. The means of low expression may include gene silencing (e.g., RNAi gene antisense), knocking out, changing expression levels, changing expression patterns, by mutagenic gene sequences, destroying (disrupt) sequences, inserting, adding, mutating, modifying expression regulatory sequences, etc. Preferred low expression means are to knock out the functional expression of KO auxiliary protein by deleting the coding sequence of KO auxiliary protein or a fragment thereof or by deleting the regulatory sequence (e.g., promoter) required for expressing KO auxiliary protein.

[0301] When "before engineering" is used in the context of a host cell of the present invention, it means that such host cell has not been engineered with a polynucleotide encoding an accessory protein or a functional homologue thereof. Thus, the term also refers to a host cell that does not overexpress or underexpress a polynucleotide encoding an accessory protein or a functional homologue thereof, or a host cell that has not been engineered to overexpress or underexpress a polynucleotide encoding an accessory protein or a functional homologue thereof.

[0302] As used herein, the term "engineering the host cell to contain a heterologous polynucleotide encoding the protein of interest" means equipping the host cell of the present invention with a heterologous polynucleotide encoding the protein of interest, i.e., the host cell of the present invention is engineered to contain a heterologous polynucleotide encoding the protein of interest. This can be achieved, for example, by transformation or transfection or any other suitable technique known in the art for introducing a polynucleotide into a host cell.

[0303] Overexpression

[0304] As will be described in detail later, all can realize overexpression in any way well known by persons skilled in the art.Generally speaking, can be by improving the transcription / translation of gene, as by improving the copy number of described gene or changing or modifying the regulatory sequence or the site relevant to gene expression, as the endogenous polynucleotide of the albumen that coding participates in lipid metabolism or its function homologue realizes overexpression.For example, can realize overexpression by introducing one or more copies of the polynucleotide of the coding auxiliary protein or function homologue that are operably connected to regulatory sequence (such as promotor).For example, in order to reach high expression level, described gene can be operably connected to strong constitutive promoter and / or strong broad spectrum expression type (ubiquitous) promoter.This promotor can be endogenous promoter or recombinant promoter.Alternatively, regulatory sequence can be removed so that expression becomes constitutive.People can replace the natural promoter of given gene with the heterologous promoter that increases given gene expression or causes given gene constitutive expression. For example, the host cell may overexpress the auxiliary protein by greater than 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200% or greater than 300% compared to the host cell before engineering and cultured under the same conditions. Alternatively, the use of an inducible promoter can increase expression during host cell culture. In addition, overexpression can be achieved by, for example, modifying the chromosomal location of a specific gene; changing the nucleic acid sequence adjacent to a specific gene, such as a ribosome binding site or transcription terminator; modifying proteins associated with the transcription of the gene and / or the translation of the gene product (e.g., regulatory proteins, repressors, enhancers, transcription activators, etc.); or any other conventional techniques conventional in the art for dysregulating the expression of a specific gene, including but not limited to, the use of antisense nucleic acid molecules, for example, to block the expression of a repressor protein, or deleting or mutating the gene for a transcription factor that normally inhibits the expression of the gene to be overexpressed. Prolonging the lifespan of mRNA can also increase expression levels. For example, certain terminator regions can be used to extend the half-life of mRNA (Yamanishi et al., Biosci. Biotechnol. Biochem. (2011) 75: 2234 and US 2013 / 0244243). If multiple copies of genes are included, these genes can be located in a plasmid with a variable copy number or integrated and amplified in the chromosome. If the host cell does not contain genes encoding auxiliary proteins, the genes can be introduced into the host cell for expression. In this case, "overexpression" refers to expressing the gene product using any method known to those skilled in the art.

[0305] Those skilled in the art will appreciate the references to Martin et al. (Bio / Technology 5, 137-146 (1987)), Guerrero et al. (Gene 138, 35-41 (1994)), Tsuchiya and Morinaga (Bio / Technology 6, 428-430 (1988)), Eikmanns et al. (Gene 102, 93-98 (1991)), EP 0 472 869, U.S. Pat. No. 4,601,893, Schwarzer and (Bio / Technology 9, 84-87 (1991)), Reinscheid et al. (Applied and Environmental Microbiology 60, 126-132 (1994)), LaBarre et al. (Journal of Bacteriology 175, 1001-1007 (1993)), WO 96 / 15246, Malumbres et al. (Gene 134, 15-24 (1993)), JP-A-10-229891, Jensen and Hammer (Biotechnology and Bioengineering 58, 191-195 (1998)) and Makrides (Microbiological Reviews 60, 512-538 (1996)), in particular, descriptions can be found in well-known textbooks on genetics and molecular biology.

[0306] Accessory proteins

[0307] The auxiliary proteins of the present invention were originally isolated from the Pichia pastoris CBS7435 strain, or in the case of SEQ ID NOs: 8 and 9, originally isolated from Saccharomyces cerevisiae. The methylotrophic yeast Pichia pastoris (Komagataella phaffii) CBS7435 is the parent strain of a commonly used Pichia pastoris recombinant protein production host. Its complete genome sequence is described in Sturmberger et al. [J. Biotechnol. (2016). 235 (4): 121-131)]. The genes encoding the auxiliary proteins identified herein have not yet been associated with beneficial effects on protein production. The complete genome sequence of the very closely related Pichia pastoris strain GS115 is almost identical to the genome sequence of CBS7435 (Nat. Biotechnol. 27 (6), 561-566), and the sequence of GS115 corresponding to the sequence of CBS7435 can also be used in the present invention.

[0308] It is envisioned that the accessory protein can be overexpressed in a wide range of host cells. Thus, the sequence of the accessory protein may also be taken from or derived from other prokaryotic or eukaryotic organisms, rather than employing sequences native to their species or genus. Foreign DNA sequences encoding the accessory protein may be obtained from a variety of sources, such as from plants, insects, fungi or mammalian species, preferably from the class Saccharomyces, preferably from the orders Saccharomyces, preferably from the family Saccharomyces, preferably from the genus Komagataella.

[0309] In particular, the present invention relates to a genetically modified host cell capable of overexpressing a single accessory protein comprising an amino acid sequence shown in any one of SEQ ID NOs: 1-15 or a functional homologue thereof, or a combination thereof. In a preferred embodiment, host cells engineered to reflect a combination of accessory proteins are envisioned. These host cells are preferably used in the methods and uses described herein. The combination comprises two or more, such as two, three, four, five, six, seven, eight or more, accessory proteins selected from any one of SEQ ID NOs: 1-15 or a functional homologue thereof.

[0310] Likewise, the combination includes overexpression of one or more selected from SEQ ID NOs: 1-15 and PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (PRY2), ARV1 ( ORF is not named; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1) or a functional homolog thereof, in combination with an underexpressed accessory protein selected from any one of SEQ ID NO: 16 or 17 or a functional homolog thereof. In a preferred embodiment, host cells engineered to reflect this combination are contemplated. These host cells can be used in the methods and uses described herein.

[0311] Preferably, the following accessory proteins and combinations of accessory proteins of the invention involved in sphingolipid biosynthesis are used in the host cells, methods and uses described herein:

[0312] (a) a protein comprising the amino acid sequence shown in SEQ ID NO: 1 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1;

[0313] (b) a protein comprising the amino acid sequence shown in SEQ ID NO: 2 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 2;

[0314] (c) a protein comprising the amino acid sequence shown in SEQ ID NO: 3 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 3;

[0315] (d) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 2 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 2, respectively;

[0316] (e) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 3 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 3, respectively;

[0317] (f) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1, 3 and 4 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1, 3 and 4, respectively;

[0318] (g) a protein comprising the amino acid sequence shown in SEQ ID NO: 1, 3, 4 and 8 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, 3, 4 and 8, respectively;

[0319] (h) a protein comprising the amino acid sequences shown in SEQ ID NOs: 5 and 6 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 5 and 6, respectively;

[0320] (i) a protein comprising the amino acid sequences shown in SEQ ID NOs: 1 and 7 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 1 and 7, respectively;

[0321] (j) a protein comprising the amino acid sequences shown in SEQ ID NOs: 5, 6 and 9 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NOs: 5, 6 and 9, respectively;

[0322] (k) A protein comprising the amino acid sequence shown in SEQ ID NO: 1, 5, 6 and 9 or a functional homologue thereof, wherein the functional homologue has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 1, 5, 6 and 9, respectively.

[0323] The combination of accessory proteins of the present invention comprises overexpressing at least one protein involved in sphingolipid biosynthesis and at least one protein involved in lipid transport. In a preferred combination for the host cells, methods, and uses described herein, the protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 1 or a functional homolog thereof, and the protein involved in lipid transport comprises the amino acid sequence shown in SEQ ID NO: 11 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 11, respectively.

[0324] The combination of accessory proteins of the present invention comprises overexpressing at least one protein involved in phospholipid biosynthesis and at least one protein involved in lipid transport. In a preferred combination for the host cells, methods, and uses described herein, the protein involved in phospholipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 10 or a functional homolog thereof, and the protein involved in lipid transport comprises the amino acid sequence shown in SEQ ID NO: 11 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NO: 10 and SEQ ID NO: 11, respectively.

[0325] The present invention further relates to overexpressing a molecular chaperone other than the accessory protein of the present invention. As used herein, the term "molecular chaperone" refers to a polypeptide that assists in the folding, unfolding, assembly, or disassembly of other polypeptides. Preferably, the molecular chaperone comprises the amino acid sequence shown in SEQ ID NO: 18 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 18.

[0326] Therefore, the combination of accessory proteins of the present invention comprises overexpression of at least one protein involved in sphingolipid biosynthesis and at least one molecular chaperone. Preferably, the protein involved in sphingolipid biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 1 or a functional homolog thereof, and the molecular chaperone comprises the amino acid sequence shown in SEQ ID NO: 18 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 18, respectively.

[0327] Another combination of accessory proteins of the present invention comprises overexpressing at least one protein involved in ergosterol biosynthesis and at least one molecular chaperone. Preferably, the protein involved in ergosterol biosynthesis comprises the amino acid sequence shown in SEQ ID NO: 13, SEQ ID NO: 14 or SEQ ID NO: 15, or a functional homolog thereof, and the molecular chaperone comprises the amino acid sequence shown in SEQ ID NO: 18, or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequences shown in SEQ ID NO: 13 and 18, respectively.

[0328] Target protein

[0329] As used herein, the term "protein of interest" (POI) refers to a protein produced in a host cell by recombinant technology. More specifically, the protein can be a polypeptide that does not naturally occur in the host cell, i.e., a heterologous protein, or it can be native to the host cell, i.e., a homologous protein of the host cell, but produced by, for example, transformation with a self-replicating vector containing a nucleic acid sequence encoding the POI, or integration of one or more copies of the nucleic acid sequence encoding the POI into the genome of the host cell by recombinant technology, or by recombinant modification of one or more regulatory sequences (e.g., promoter sequences) that control the expression of the gene encoding the POI. In general, the target protein mentioned herein can be produced by recombinant expression methods well known to those skilled in the art. Preferably, the target protein is not a membrane protein, i.e., preferably, the POI is a target non-membrane protein.

[0330] host cells

[0331] As used herein, "host cell" refers to a cell capable of expressing and optionally secreting a protein. Such host cells are used in the methods of the present invention. To achieve the goal of causing a host cell to overexpress or underexpress a polypeptide involved in lipid metabolism, a nucleotide sequence encoding the polypeptide is present in the cell or introduced into the cell. The host cells provided by the present invention can be eukaryotic host cells. More preferably, they are non-mammalian eukaryotic host cells. Even more preferably, they are fungal host cells. As will be appreciated by those skilled in the art, prokaryotic cells lack a nuclear membrane, while eukaryotic cells do have a nuclear membrane. Examples of eukaryotic cells include, but are not limited to, vertebrate cells, mammalian cells, human cells, animal cells, invertebrate cells, plant cells, nematode cells, insect cells, stem cells, fungal cells, or yeast cells.

[0332] Examples of yeast cells include, but are not limited to, Saccharomyces (e.g., Saccharomyces cerevisiae, Saccharomyces kluyveri, Saccharomyces uvarum), Komagataella (Komagataella pastoris, Komagataella pseudopastoris, or Komagataella phaffii), Kluyveromyces (e.g., Kluyveromyces lactis, Kluyveromyces marxianus), Candida (e.g., Candina utilis, Candida cacaoi), Geotrichum (e.g., Geotrichum fermentans), as well as Hansenula polymorpha and Yarrowia lipolytica.

[0333] The genus Pichia is of particular interest. The genus Pichia comprises many species, including Pichia pastoris, Pichia methanolica, Pichia kluyveri, and Pichia angusta. Most preferred is the species Pichia pastoris.

[0334] The former species Pichia pastoris has been classified and renamed Komagataella pastoris and Komagataella phaffii. Pichia pastoris is therefore synonymous with Komagataella pastoris and Komagataella phaffii.

[0335] Examples of Pasteurella strains useful in the present invention are X33 and its subtypes GS115, KM71, KM71H; CBS7435 (mut+) and its subtypes CBS7435 mut s 、CBS7435 mut s ΔArg, CBS7435 mut s ΔHis, CBS7435 mut s ΔArg, ΔHis, CBS7435 mut s PDI + , CBS 704 (=NRRL Y-1603=DSMZ 70382), CBS 2612 (=NRRLY-7556), CBS 9173-9189 and DSMZ 70877 and mutants thereof. These yeast strains can be obtained from, for example, the American Tissue Culture Collection (ATCC), the "Deutsche Sammlung von Mikroorganismen und Zellkulturen" (DSMZ) in Brunswick, Germany, or from the Dutch "Centraalbureau voor Schimmelcultures" (CBS) in Uetrecht, The Netherlands.

[0336] According to a further preferred embodiment, the host cell is Pichia pastoris, Hansenula polymorpha, Trichoderma reesei, Saccharomyces cerevisiae, Kluyveromyces lactis, Yarrowia lipolytica, Pichia methanolica, Candida boidinii, Komagataella and Schizosaccharomyces pombe. It can also be a host cell from Ustilago maydis. These yeast strains are available from cell banks such as the American Tissue Culture Collection (ATCC), the "Deutsche Sammlung von Mikroorganismen und Zellkulturen" (DSMZ) in Braunschweig, Germany, or from the Dutch "Centraalbureau voor Schimmelcultures" (CBS) in Uetrecht, The Netherlands.

[0337] Colibacillary examples comprise those that are derived from the E. coli K12 bacterial strain, are specially HMS174, HMS174 (DE3), NM533, XL1-Blue, C600, DH1, HB101, JM109, and those that are derived from the B-bacterial strain, are specially BL-21, BL21 (DE3) etc. Escherichia coli cells can be used for example for the purpose of cloning, also can be used as host cell of the present invention.These bacterial strains can obtain from the cell bank of " Deutsche Sammlung von Mikroorganismen und Zellkulturen " (DSMZ) that is positioned at Brunswick, Germany or from the Netherlands " Centraalbureau voor Schimmelcultures " (CBS) that is positioned at Uetrecht, the Netherlands.

[0338] Preferably, the auxiliary proteins expressed by the host cell are from the same cell or are recombined from cells of the same species, genus or family. As used herein, "recombinant" refers to the change of genetic material by human intervention. Generally, recombinant refers to the manipulation of DNA or RNA in viruses, cells, plasmids or vectors by molecular biology (recombinant DNA technology) methods (including cloning and recombination). Recombinant cells, polypeptides or nucleic acids can typically be described with reference to how they differ from their naturally occurring counterparts ("wild type"). "Recombinant cell" or "recombinant host cell" refers to a cell or host cell that has been genetically altered to contain a nucleic acid sequence that is non-natural to the cell.

[0339] As used herein, the term "preparation" refers to the process of expressing the target protein. "Host cell for preparing the target protein" refers to a host cell into which a nucleic acid sequence encoding the target protein can be introduced. The recombinant host cell in the present invention does not necessarily contain a nucleic acid sequence encoding the target protein. Those skilled in the art will appreciate that the host cell can be provided, for example, in a kit for inserting the desired nucleotide sequence into the host cell. "Preparation" also refers to the process of producing a POI using the host cell of the present invention, comprising culturing the host cell of the present invention under suitable conditions to overexpress a protein involved in lipid metabolism or a functional homolog thereof and express the target protein, and optionally isolating the target protein from the cell culture.

[0340] As used herein, the term "nucleotide sequence" or "nucleic acid sequence" refers to DNA or RNA. A "nucleic acid sequence" or "polynucleotide sequence" or simply "polynucleotide" refers to a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' to the 3' end. This includes self-replicating plasmids, infectious polymers of DNA or RNA, and non-functional DNA or RNA.

[0341] The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are subsequently modified, such as hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refer to compounds that have the same basic chemical structure as naturally occurring amino acids, i.e., carbon is linked to hydrogen, carboxyl, amino, and R groups, such as homoserine, norleucine, methionine sulfoxide, and methionine methylsulfonium. These analogs have modified R groups (such as norleucine) or modified peptide backbones, but retain the same basic chemical structure as naturally occurring amino acids. Amino acid mimetics refer to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but function in a manner similar to naturally occurring amino acids.

[0342] The term "polypeptide" is used interchangeably with "protein". The term "polypeptide" refers to a protein or peptide containing two or more amino acids, typically at least 3, preferably at least 20, more preferably at least 30, such as at least 50 amino acids. Therefore, a polypeptide comprises an amino acid sequence and a polypeptide that therefore sometimes comprises an amino acid sequence is referred to herein as a "polypeptide comprising a polypeptide sequence". Therefore, the term "polypeptide sequence" is used interchangeably with the term "amino acid sequence" herein. As mentioned, overexpression can be achieved by inserting one or more copies of a selected auxiliary protein. According to a preferred embodiment, the polynucleotide encoding the auxiliary protein can be presented in the form of a single copy or multiple copies in each cell. These copies can be adjacent to each other or away from each other. According to another preferred embodiment, the method of the present invention uses a recombinant nucleotide sequence encoding an auxiliary protein, and the recombinant nucleotide sequence is provided in the form of a single copy or multiple copies in each cell in one or more plasmids suitable for integration into the host cell genome. These copies can be adjacent to each other or away from each other. In one embodiment, overexpression can be achieved by expressing one or more copies of the polynucleotide per host cell, such as 2, 3, 4, 5, 6 or more copies of the polynucleotide. Preferably, the polynucleotide is operably linked to transcriptional and translational regulatory sequences that provide for polypeptide expression in a host cell. As used herein, the term "transcriptional regulatory sequence" refers to a nucleotide sequence that is associated with a gene nucleic acid sequence and that regulates the transcription of the gene. As used herein, the term "translational regulatory sequence" refers to a nucleotide sequence that is associated with a gene nucleic acid sequence and that regulates the translation of the gene. The transcriptional and / or translational regulatory sequence can be located in a plasmid or vector, or integrated into the chromosome of the host cell. The transcriptional and / or translational regulatory sequence is located in the same nucleic acid molecule as the gene that the sequence regulates. Preferably, overexpression can be achieved by having 1, 2, 3, 4 or more copies of a polynucleotide encoding an accessory protein comprising an amino acid sequence as shown in any one of SEQ ID NOs: 1 to 15 or a functional homologue thereof in each host cell, or by having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 copies of a polynucleotide encoding an accessory protein comprising an amino acid sequence as shown in any one of SEQ ID NOs: 1 to 15 or a functional homologue thereof in each host cell.

[0343] Preferably, the polynucleotide encoding the accessory protein and / or the polynucleotide encoding the POI are integrated into the genome of the host cell. The term "genome" generally refers to the entire genetic information of an organism encoded in DNA (or RNA for some viral species). The genome can be present in a chromosome, a plasmid or a vector, or both. Preferably, the polynucleotide encoding the accessory protein is integrated into the chromosome of the cell.

[0344] The polynucleotides encoding the auxiliary protein or its functional homologue can be integrated into its natural locus." natural locus " refers to the position on a specific chromosome, at which the polynucleotides encoding the auxiliary protein are located in the natural locus of the gene encoding the auxiliary protein of the present invention. Any such gene can be identified according to the gene identifiers as shown in Table 1 above. However, in another embodiment, the polynucleotides encoding the auxiliary protein present in the genome of the host cell are not in their natural locus, but are integrated ectopically. The term "ectopic integration " refers to the insertion of a nucleic acid that is not a site of its usual chromosomal locus in the microbial genome, i.e., predetermined or random integration. Alternatively, the polynucleotides encoding the auxiliary protein or its functional homologue can be integrated into its natural locus and ectopically.

[0345] For yeast cells, polynucleotides encoding auxiliary proteins and / or polynucleotides encoding POIs can be inserted into desired gene loci, such as, but not limited to, AOX1, GAP, ENO1, TEF, HIS4 (Zamir et al., Proc. NatL Acad. Sci. USA (1981) 78(6):3496-3500), HO (Voth et al., Nucleic Acids Res. 2001 June 15; 29(12):e59), TYR1 (Mirisola et al., Yeast 2007; 24:761–766), His3, Leu2, Ura3 (Taxis et al., BioTechniques (2006) 40:73-78), Lys2, ADE2, TRP1, GAL1, ADH1 or on the integration of the 5S ribosomal RNA gene.

[0346] In other embodiments, the polynucleotide encoding the accessory protein and / or the polynucleotide encoding the POI can be incorporated into a plasmid or vector. The terms "plasmid" and "vector" include both autonomously replicating and genome-integrating nucleotide sequences. A skilled artisan will be able to select an appropriate plasmid or vector based on the host cell being used.

[0347] Preferably, the plasmid is a eukaryotic expression vector, preferably a yeast expression vector.

[0348] Plasmids can be used for transcription of recombinant nucleotide sequences (i.e., recombinant genes) cloned in suitable host organisms and translation of their mRNA. Plasmids can also be used for integration of target polynucleotides into host cell genomes by methods known in the art, such as J. Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2001). "Plasmids" typically include an origin for autonomous replication in host cells, a selective marker, a plurality of restriction enzyme cleavage sites, a suitable promoter sequence, and a transcription terminator, and the components are operably linked together. The target sequence encoding a polypeptide is operably linked to transcription and translation regulatory sequences that provide polypeptide expression in host cells.

[0349] A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence on the same nucleic acid molecule. For example, a promoter is operably linked to a coding sequence of a recombinant gene when the promoter is capable of effecting expression of the coding sequence of the recombinant gene.

[0350] Most plasmids exist in only one copy per bacterial cell. However, some plasmids exist in higher copy numbers. For example, the plasmid ColE1 is typically present in 10 to 20 copies per chromosome in E. coli. If a plasmid contains a nucleotide sequence of the present invention, the plasmid may have a copy number of 1-10, 10-20, 20-30, 30-100, or more per host cell. Using a high copy number plasmid allows the cell to overexpress accessory proteins.

[0351] A large number of suitable plasmids or vectors are known to those skilled in the art, and many are commercially available. Examples of suitable vectors are provided in Sambrook et al., ed., Molecular Cloning: A Laboratory Manual (2nd Ed.), Vols. 1-3, Cold Spring Harbor Laboratory (1989), and Ausubel et al., ed., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York (1997).

[0352] The vectors or plasmids of the present invention encompass yeast artificial chromosomes comprising telomeric, centromeric, and origin of replication sequences, wherein the yeast artificial chromosome refers to a DNA construct that can be genetically modified to contain a heterologous DNA sequence (e.g., a DNA sequence as large as 3000 kb).

[0353] The vectors or plasmids of the present invention also encompass bacterial artificial chromosomes (BACs) comprising an origin of replication sequence (Ori) and may comprise one or more helicases (e.g., parA, parB, and parC), wherein the bacterial artificial chromosome refers to a DNA construct that can be genetically modified to contain a heterologous DNA sequence (e.g., a DNA sequence as large as 300 kb).

[0354] Examples of plasmids for yeast as a host include YIp-type vectors, YEp-type vectors, YRp-type vectors, YCp-type vectors (Yxp-type vectors are described in, for example, Romanos et al., 1992, Yeast. 8(6): 423-488), pGPD-2 (described in Bitter et al., 1984, Gene, 32: 263-274), pYES, pAO815, pGAPZ, pGAPZα, pHIL-D2, pHIL-S1, pPIC3.5K, pPIC9K, pPICZ, pPICZα, pPIC3K, pPINK-HC, pPINK-LC (all available from Thermo Fisher Scientific). Fisher Scientific / Invitrogen), pHWO10 (described in Waterham et al., 1997, Gene, 186:37-44), pPZeoR, pPKanR, pPUZZLE and pPUZZLE derivatives (described in Stadlmayr et al., 2010, J Biotechnol. 150(4):519-29.; Marx et al., 2009, FEMS Yeast Res. 9(8):1260-70), pJ-vectors (such as pJAN, pJAG, pJAZ and their derivatives; all available from BioGrammatics, Inc), pJexpress vectors, pD902, pD905, pD915, pD912 and their derivatives, pD12xx, pJ12xx (all available from ATUM / DNA2.0), pRG plasmids (described in Gnügge et al., 2016, Yeast 33:83–98) and 2 μm plasmids (described in, for example, Ludwig et al., 1993, Gene 132(1):33-40). These vectors are known and, for example, are described in Cregg et al., 2000, Mol Biotechnol. 16(1):23-52 or Ahmad et al., 2014., Appl Microbiol Biotechnol. 98(12):5301-17. In addition, suitable vectors can be readily produced by advanced modular cloning techniques such as those described by Lee et al., 2015, ACS Synth Biol. 4(9):975-986; Agmon et al., 2015, ACS Synth. Biol., 4(7):853–859; or Wagner and Alper, 2016, Fungal Genet Biol. 89:126-136. In addition, these and other suitable vectors are also available from www.addgene.org.

[0355] Examples of plasmids that use E. coli as their host include pBR322 (available from, for example, New England Biolabs and ThermoFisher Scientific), pBAD-vectors, the pET-vector series (both available from, for example, ThermoFisher Scientific, and pET vectors also available from Novagen), pUC18, pUC19, pUC118 / 119 (all available from, for example, Takara), pVC119 (described in Del Sol et al., 2006, J Bacteriol. 188(4):1540–1550), pSP64, pSP65 (both from Promega), pTZ-18R / -18U (from Amersham), pTZ-19R / -19U (from Sigma-Aldrich), pGEM-3, pGEM-4, pGEM-3Z, pGEM-4Z, pGEM-5Zf(-) (pGEM vectors available from Promega), and pBluescript KS (available from Agilent). Examples of plasmids suitable for expression in E. coli include pKK223 (described in Brosius and Holy, 1984, Proc. Natl. Acad. Sci. USA 81: 6929-6933), pMC1403, pMC931 (both described in Casadaban et al. 1980, J Bacteriol. 143(2): 971-980), and pKC30 (described in Rao, 1984, Gene 31(1-3): 247-250). These and other suitable vectors are also available from www.addgene.org.

[0356] promoter

[0357] Overexpression of endogenous polypeptides in recombinant cells can be achieved by modifying transcriptional and translational regulatory sequences, including, for example, promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), etc., which provide for expression of polynucleotide sequences in host cells. Such sequences specifically interact with cellular proteins involved in transcription (Maniatis et al., Science, 236: 1237-1245 (1987)). Exemplary sequences are described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, Calif. (1990).

[0358] For example, overexpression of an endogenous auxiliary protein in a recombinant cell can be achieved by modifying the promoter, for example, by replacing an endogenous promoter operably linked to the auxiliary protein with another, stronger promoter to achieve high expression levels. Such promoters can be inducible or constitutive. Modification of endogenous promoters can be implemented by mutation or homologous recombination using methods known in the art.

[0359] Overexpression of polynucleotides encoding accessory proteins can be achieved by other methods known in the art, for example, by genetically modifying the endogenous regulatory regions of the accessory proteins as described in Marx et al., 2008 (Marx, H., Mattanovich, D. and Sauer, M. Microb Cell Fact 7 (2008): 23) and Pan et al., 2011 (Pan et al., FEMS Yeast Res. (2011) May; (3): 292-8.), including, for example, the integration of recombinant promoters that increase expression of the accessory proteins. Transformation is described in Cregg et al., (1985) Mol. Cell. Biol. 5: 3376-3385. A "recombinant" promoter refers to a sequence for which expression is driven. As used herein, a recombinant promoter means when the promoter is not a native promoter for a given sequence, that is, when the promoter is different from a naturally occurring promoter ("native promoter"). Sometimes such promoters are also referred to herein as heterologous promoters.

[0360] The term "promoter" as used herein refers to a region that contributes to the transcription of a specific gene. A promoter generally increases the amount of recombinant product expressed from a nucleotide sequence compared to the amount of recombinant product expressed when no promoter is present. A promoter derived from one organism can be used to enhance the expression of recombinant products from a sequence derived from another organism. The promoter can be integrated into the host cell chromosome by homologous recombination using methods known in the art (e.g., Datsenko et al., Proc. Natl. Acad. Sci. USA, 97(12): 6640-6645(2000)). In addition, a promoter element can increase the amount of products expressed by multiple sequences connected in series. Therefore, a promoter element can enhance the expression of one or more recombinant products.

[0361] Promoter activity can be assessed by the transcription efficiency of the promoter. Promoter activity can be determined directly by measuring the amount of mRNA transcribed from the promoter, as by Northern blotting, quantitative PCR, or indirectly by measuring the amount of the gene product expressed from the promoter.

[0362] A promoter can be an "inducible promoter" or a "constitutive promoter." An "inducible promoter" is a promoter that can be induced by the presence or absence of certain factors, while a "constitutive promoter" is an unregulated promoter that allows for continuous transcription of one or more genes associated with the promoter.

[0363] In a preferred embodiment, the transcription of the nucleotide sequence encoding the auxiliary protein and the POI is each driven by an inducible promoter. In another preferred embodiment, the transcription of the nucleotide sequence encoding the auxiliary protein and the POI is each driven by a constitutive promoter. In another preferred embodiment, the transcription of the nucleotide sequence encoding the auxiliary protein is driven by a constitutive promoter, and the transcription of the nucleotide sequence encoding the POI is driven by an inducible promoter. In another preferred embodiment, the transcription of the nucleotide sequence encoding the auxiliary protein is driven by an inducible promoter, and the transcription of the nucleotide sequence encoding the POI is driven by a constitutive promoter. For example, the transcription of the auxiliary protein gene can be driven by a constitutive GAP promoter, and the transcription of the nucleotide sequence encoding the POI can be driven by an inducible AOX1 promoter. In one embodiment, the transcription of the nucleotide sequence encoding the auxiliary protein and the POI is driven by the same promoter or a similar promoter with respect to promoter activity and / or expression behavior.

[0364] Many inducible promoters are known in the art. Many inducible promoters are described in the review of Gatz, Curr.Op.Biotech., 7:168 (1996) (also referring to Gatz, Ann.Rev.Plant.Physiol.Plant Mol.Biol., 48:89 (1997)). Examples include tetracycline repressor system, Lac repressor system, copper induction system, salicylic acid induction system (such as PR1 system), glucocorticoid induction type (Aoyama et al., 1997), alcohol induction system (such as AOX promoter) and ecdysone induction system (ecdysome-inducible system). Also included are benzenesulfonamide induction system (U.S. Patent No. 5,364,780) and alcohol induction system (WO 97 / 06269 and WO 97 / 06268) and glutathione S-transferase promoter.

[0365] Suitable promoter sequences for use with yeast host cells are described in Mattanovich et al., Methods Mol. Biol. (2012) 824:329-58, including glycolytic enzymes such as triosephosphate isomerase (TPI), phosphoglycerate kinase (PGK), glyceraldehyde-3-phosphate dehydrogenase (GAPDH or GAP) and variants thereof, lactase (LAC) and galactosidase (GAL), P. pastoris glucose-6-phosphate isomerase promoter (PPGI), 3-phosphoglycerate kinase promoter (PPGK), glyceraldehyde phosphate dehydrogenase promoter (PGAP), translation elongation factor promoter (PTEF) and P. pastoris enolase 1 promoter (PENO1), triosephosphate isomerase (PTPI), ribosomal subunit proteins (PRPS2, PRPS7, PRPS31, PRPL1), alcohol oxidase promoter (PAOX) or variants thereof with modified properties, formaldehyde dehydrogenase promoter (PFLD) ), isocitrate lyase promoter (PICL), α-ketoisocaproate decarboxylase promoter (PTHI), promoters of heat shock protein family members (PSSA1, PHSP90, PKAR2), 6-phosphogluconate dehydrogenase (PGND1), phosphoglycerate mutase (PGPM1), transketolase (PTKL1), phosphatidylinositol synthase (PPIS1), ferro-O2-oxidoreductase (PFET3), high-affinity iron permease (PFTR1), inhibitory alkaline phosphatase (PPHO8), N-myristoyltransferase (PNMT1), pheromone-responsive transcription factor (PMCM1), ubiquitin (PUBI4), single-stranded DNA endonuclease (PRAD2), promoter of the major ADF / ATP carrier of the inner mitochondrial membrane (PPET9) (WO2008 / 128701) and formate dehydrogenase (FMD) promoter. The GAP promoter, the AOX promoter or a promoter derived from the GAP or AOX promoter is particularly preferred. The AOX promoter is inducible by methanol and repressible, for example, by glucose.

[0366] Further examples of suitable promoters include Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triosephosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase (PGK), and the maltase gene promoter (MAL).

[0367] Other useful promoters for yeast host cells are described by Romanos et al., 1992, Yeast 8:423-488.

[0368] Suitable promoter sequences for use with E. coli include the T7 promoter in plasmids, the T5 promoter, the tryptophan (trp) promoter, the lactose (lac) promoter, the tryptophan / lactose (tac) promoter, the lipoprotein (lpp) promoter, and the lambda phage PL promoter.

[0369] Preferably, the promoter driving expression of the polynucleotide encoding the accessory protein is not endogenous relative to the promoter of the accessory gene. Preferably, a recombinant promoter is used rather than the endogenous promoter of the accessory protein gene.

[0370] enhancer

[0371] In a preferred embodiment, overexpression is achieved by using enhancers to enhance the promoter activity that drives the expression of auxiliary proteins. Transcription enhancers are relatively independent of direction and position and have been found in the 5' and 3', introns and coding sequences of transcription units. Enhancers can be spliced ​​into the expression vector at the 5' or 3' position of the coding sequence, but are preferably located at the 5' position of the promoter. Most yeast genes contain only one UAS, which is usually located within a few hundred base pairs of the cap position, and when located at the 3' position of the promoter, most yeast enhancers (UAS) cannot function, but enhancers in higher eukaryotes can function at both the 5' and 3' positions of the promoter.

[0372] Many enhancer sequences are known to be derived from mammalian genes (globin, RSV, SV40, EMC, elastase, albumin, α-fetoprotein, and insulin). Enhancers from eukaryotic cell viruses, such as the SV40 late enhancer, the cytomegalovirus early promoter enhancer, the polyoma virus late enhancer on the replication origin, and adenovirus enhancers, can also be used. Yeast enhancers, also known as upstream activating sequences (UASs), such as the UAS / GAL system from Saccharomyces cerevisiae, can be advantageously used with yeast promoters (described in European Patent No. 0317254 and Rudoni et al., The International Journal of Biochemistry and Cell Biology, (2000), 32(2):215-224).

[0373] In a preferred embodiment, 2, 3, 4, 5, 6, 7, 8, 9 or more types of accessory proteins disclosed herein are overexpressed. For example, a host cell can be engineered to overexpress 2, 3, 4, 5, 6, 7, 8, 9 or more accessory proteins selected from any one of SEQ ID NOs: 1-15 or functional homologs thereof, wherein the functional homologs thereof comprise amino acids having at least 30% sequence identity with any one of SEQ ID NOs: 1-15, respectively.In further embodiments, the host cell can be engineered to overexpress 2, 3, 4, 5, 6, 7, 8, 9 or more genes selected from SEQ ID NOs: 1-15, PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (PRY2), ARV1 (ORF not shown), located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1), or an auxiliary protein thereof, wherein the functional homolog thereof comprises an auxiliary protein having the same or similar residues as SEQ ID NO:1-15, PP7435_Chr3-0788(SUR2), PP7435_Chr3-1005(PHS1), PP7435_Chr2-0350(AUR1), PP7435_Chr4-0626(IFA38), PP7435_C hr3-0669(SCS7), PP7435_Chr3-0636(CRD1), PP7435_Chr3-0950(SLC4), PP7435_Chr2-0585(PIS1), PP7435_chr1-0934(PRY2), ARV 1 (ORF unnamed; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1) having at least 30% amino acid sequence identity.

[0374] Target protein

[0375] It is envisioned that when the host cell can be cultured under conditions suitable for overexpression of the auxiliary protein and the target protein, the host cell will express the target protein and overexpress a polynucleotide encoding an auxiliary protein comprising an amino acid sequence shown in any one of SEQ ID NOs: 1-15 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15, respectively.It is further contemplated that when the host cell is cultured under conditions suitable for the co-expression of the accessory protein and the protein of interest, the host cell will express the protein of interest and overexpress a polynucleotide encoding a polypeptide comprising the polypeptides shown in SEQ ID NOs: 1-15, PP7435_Chr3-0788 (SUR2), PP7435_Chr3-1005 (PHS1), PP7435_Chr2-0350 (AUR1), PP7435_Chr4-0626 (IFA38), PP7435_Chr3-0669 (SCS7), PP7435_Chr3-0636 (CRD1), PP7435_Chr3-0950 (SLC4), PP7435_Chr2-0585 (PIS1), PP7435_chr1-0934 (PRY2), ARV1 (ORF not named; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1), or an auxiliary protein of the amino acid sequence thereof, wherein the functional homologs are respectively the same as those shown in SEQ ID NO:1-15, PP7435_Chr3-0788(SUR2), PP7435_Chr3-1005(PHS1), PP7435_Chr2-0350(AUR1), PP7435_Chr4-0626(IFA38), PP7435_Ch r3-0669(SCS7), PP7435_Chr3-0636(CRD1), PP7435_Chr3-0950(SLC4), PP7435_Chr2-0585(PIS1), PP7435_chr1-0934(PRY2), ARV1 (ORF unnamed; located between PP7435_Chr4-0493 / 0494), PP7435_Chr3-0741 (ARE2), PP7435_Chr4-0963 (FAD12), PP7435_Chr1-0794 (PSD1), PP7435_Chr1-0160 (SLC1), PP7435_CHR1-0078 (GPT2), PP7435_Chr3-1169 (DGK1) and PP7435_Chr2-0045 (CDS1) have an amino acid sequence that has at least 30% sequence identity.

[0376] As used herein, the term "protein of interest" (POI) refers to a protein produced in a host cell by recombinant technology. More specifically, the protein can be a polypeptide that does not naturally occur in the host cell, i.e., a heterologous protein, or it can be native to the host cell, i.e., a homologous protein of the host cell, but produced by, for example, transformation with a self-replicating vector containing a nucleic acid sequence encoding the POI, or by integrating one or more copies of the nucleic acid sequence encoding the POI into the host cell genome by recombinant technology, or by recombinant modification of one or more regulatory sequences (e.g., promoter sequences) that control the expression of the gene encoding the POI. In general, the target protein mentioned herein can be produced by recombinant expression methods well known to those skilled in the art.

[0377] There is no limitation on the protein of interest (POI) herein. Generally, the POI is a eukaryotic or prokaryotic polypeptide, a variant or derivative thereof. The POI can be any eukaryotic or prokaryotic protein. Examples of POIs are described in Schmidt, Appl. Microbiol. Biotechnol. (2004), 65: 363-372 or Kirk et al., Curr. Opin. Biotechnol. (2002), 13: 345-351. Any protein mentioned in Tables 1 and 2 of Schmidt and Table 1 of Kirk et al. is encompassed by the term "POI" as used herein. The protein can be a naturally secreted protein or an intracellular protein (i.e., a non-naturally secreted protein). The present invention also includes biologically active fragments of the protein. In another embodiment, the POI can be an amino acid chain or exist as a complex such as a dimer, trimer, hetero-dimer, multimer or oligomer.

[0378] The target protein can be a protein used as a nutritional, dietary, digestive, or supplemental ingredient, such as in a food, feed product, or cosmetic. The food can be, for example, a broth, a dessert, a cereal bar, a confectionery, a sports drink, a dietary product, or other nutritional product. Preferably, the target protein is a food additive.

[0379] In another embodiment, the target protein can be used in animal feed. The POI can be a detoxifying enzyme such as a mycotoxin degrading enzyme. Mycotoxin degrading enzymes include aflatoxin degrading enzymes, zearalenone esterase, zearalenone lactonase, zearalenone hydrolase, fumonisin carboxylesterase, fumonisin aminotransferase, aminopolyol amine oxidase, and deoxynivalenol epoxide hydrolase. The POI can also be an enzyme that degrades ochratoxin derivatives or ergot alkaloids. These compounds are toxic to living organisms, including humans and farm animals. Examples of these enzymes include ochratoxin amidase, ergotamine hydrolase, and ergotamine amylase. Mycotoxin-degrading enzymes in animal feed are useful for controlling mycotoxin contamination of feed.

[0380] Further examples of POIs include antimicrobial proteins such as lactoferrin, lysozyme, lactoferricin, lactohedrin, kappa-casein, haptocorrin, lactoperoxidase, milk proteins, acute phase proteins, such as proteins normally produced in production animals in response to infection.

[0381] Examples of enzymes useful as feed additives include phytases, xylanases and beta-glucanases. "Food" means any natural or artificial dietary meal or the like, or component of such meals, intended or suitable for human consumption, ingestion, digestion.

[0382] Examples of enzymes useful as food additives include protease, lipase, lactase, pectinmethyl esterase, pectinase, transglutaminase, amylase, β-glucanase, acetolactate decarboxylase, and laccase.

[0383] enzymes

[0384] The POI may be an enzyme. Preferred enzymes are those useful in, for example, the preparation of detergents, starches, fuels, textiles, pulp and paper, oils, personal care products, or in industrial applications such as baking and organic synthesis. (See Kirk et al., Current Opinion in Biotechnology (2002) 13:345-351).

[0385] Therapeutic proteins

[0386] The POI can be a therapeutic protein. As described in more detail herein, the POI can be, but is not limited to, a protein suitable for use as a biopharmaceutical substance such as an antibody or antibody fragment, or a scaffold derived from an antibody, a single domain antibody and its derivatives, other non-antibody-derived affinity scaffolds, a growth factor, a hormone, an enzyme, a vaccine, and the like.

[0387] Preferably, the target protein is a mammalian polypeptide, or even more preferably a human polypeptide. Particularly preferred therapeutic proteins refer to any polypeptide, protein, protein variant, fusion protein and / or its fragment that can be applied to mammals. It is envisioned, but not necessarily, that the therapeutic protein according to the present invention is cell heterologous. Examples of proteins that can be produced by the cells of the present invention are, but are not limited to, enzymes, regulatory proteins, receptors, peptide hormones, growth factors, cytokines, scaffold-binding proteins (such as anticalins), structural proteins, lymphokines, adhesion molecules, receptors and any other polypeptide that can be used as agonists or antagonists and / or has therapeutic or diagnostic purposes. In addition, the target protein can be an antigen, vaccine, antigen-binding protein, immunostimulatory protein for vaccination.

[0388] These therapeutic proteins include, but are not limited to, insulin, insulin-like growth factor, hGH, tPA, cytokines, such as interleukins such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, interferon (IFN) α, IFNβ, IFNγ, IFNω or IFNτ, tumor necrosis factor (TNF) TNFα and TNFβ, TRAIL; G-CSF, GM-CSF, M-CSF, MCP-1 and VEGF.

[0389] In a preferred embodiment, the protein is an antibody. The term "antibody" is intended to include any polypeptide chain containing a molecular structure having a specific shape suitable for and recognizing an epitope, wherein one or more non-covalent binding interactions stabilize the complex between the molecular structure and the epitope. The prototype antibody molecule is an immunoglobulin, and all types of immunoglobulins (IgG, IgM, IgA, IgE, IgD, IgY, etc.) from all sources (such as humans, rodents, rabbits, cattle, sheep, pigs, dogs, other mammals, chickens, other birds, etc.) are considered to be "antibodies". For example, antibody fragments may include, but are not limited to: Fv (a molecule comprising VL and VH), single-chain Fv (scFV) (a molecule comprising VL and VH connected by a peptide linker), Fab, Fab', F(ab')2, single domain antibodies (sdAb) (molecules comprising a single variable domain and 3 CDRs) and their multivalent presentation forms (presentation). The antibody or its fragment may be a mouse, human, humanized or chimeric antibody or its fragment. Examples of therapeutic proteins include antibodies, polyclonal antibodies, monoclonal antibodies, recombinant antibodies, antibody fragments such as Fab', F(ab')2, Fv, scFv, di-scFv, bi-scFv, tandem scFv, bispecific tandem scFv, sdAb, nanobodies, V H and V L , or a human antibody, a humanized antibody, a chimeric antibody, an IgA antibody, an IgD antibody, an IgE antibody, an IgG antibody, an IgM antibody, an intrabody, a diabody, a tetrabody, a minibody or a monobody.

[0390] Further examples of therapeutic proteins include coagulation factors (VII, VIII, IX), Fusarium alkaline protease, calcitonin, CD4 receptor darbepoetin, DNase (cystic fibrosis), erythropoietin, eutropin (human growth hormone derivative), follicle-stimulating hormone (follitropin), gelatin, glucagon, glucocerebrosidase (Gaucher disease), glucoamylase from Aspergillus niger, glucose oxidase from Aspergillus niger, gonadotropins, growth factors (GCSF, GMCSF), growth hormone (somatotropine), hepatitis B vaccine, hirudin, human antibody fragments, human apolipoprotein AI, human procalcitonin, human collagenase IV, human epidermal growth factor, human insulin-like growth factor, Human interleukin 6, human laminin, human pre-apolipoprotein AI, human serum albumin, insulin, insulin and muteins, insulin, interferon alpha and muteins, interferon beta, interferon gamma (mutein), interleukin 2, luteinizing hormone, monoclonal antibody 5T4, mouse collagen, OP-1 (osteoblastic, neuroprotective factor), oprelektin (interleukin 11-agonist), organophosphohydrolase, PDGF-agonist, phytase, platelet-derived growth factor (PDGF), recombinant plasminogen activator G, staphylokinase, stem cell factor, tetanus toxin fragment C, tissue plasminogen activator, and tumor necrosis factor (see Schmidt, Appl Microbiol Biotechnol (2004) 65:363-372).

[0391] leader sequence

[0392] The protein of interest can be linked to a leader sequence that triggers secretion of the POI from the host cell. When the POI to be recombinantly expressed and secreted is a protein that is not naturally secreted and therefore lacks a native secretion leader sequence, or when its nucleotide sequence has been cloned without its native secretion leader sequence, the presence of the secretion leader sequence in the expression vector is essential. Generally speaking, any secretion leader sequence that is effective in triggering secretion of the POI from the host cell can be used in the present invention. The secretion leader sequence can be derived from yeast (e.g., yeast α-factor, such as MFa from Saccharomyces cerevisiae, or yeast phosphatase), from mammalian or plant sources, or other sources. The selection of a suitable secretion leader sequence will be readily apparent to the skilled artisan. Alternatively, the secretion leader sequence can be fused to the nucleotide sequence encoding the POI to be recombinantly expressed, or the nucleotide sequence encoding the POI can be cloned into the expression vector, containing the native secretion leader sequence, prior to cloning the nucleotide sequence into the expression vector, using conventional cloning techniques known to the skilled artisan. In these cases, the presence of the secretion leader sequence in the expression vector is not necessary.

[0393] The recombinant nucleotide sequences encoding one or more POIs and the recombinant nucleotide sequences encoding the accessory proteins may also be provided in one or more autonomously replicating plasmids in the form of a single copy or multiple copies per cell.

[0394] Optionally, the recombinant nucleotide sequence encoding the POI and the recombinant nucleotide sequence encoding the auxiliary protein are present in the same plasmid in the form of a single copy or multiple copies per cell.

[0395] Low expression of accessory proteins

[0396] The inventors have also identified several auxiliary proteins involved in lipid storage (KO auxiliary proteins), and it was observed that their expression has a negative effect on the production of POI from the host cell. Preferably, such auxiliary proteins that have a negative effect on the production of POI from the host cell are not transcription factors. Preferred are auxiliary proteins comprising the amino acid sequence shown in any one of SEQ ID NOs 16 or 17 or functional homologs thereof. Functional homologs of the auxiliary proteins comprising the amino acid sequence shown in any one of SEQ ID NOs 16 or 17 are expressed as KO auxiliary proteins. 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, In addition, it has been found that modification (such as mutation or deletion) of the gene encoding the KO auxiliary protein of SEQ ID NO 16 or 17 can increase the yield of POI. This discovery provides methods and materials that can be used to further improve POI yield by engineering the host cell so that it underexpresses the KO auxiliary gene identified by the inventor. If such auxiliary protein exists in the host cell, it can be modified (such as mutation or knockout) to improve the yield of POI. Based on the gene identifier or nucleotide sequence provided herein, any method known in the art can be used to identify the presence of such KO auxiliary protein. Advantageously, the KO auxiliary protein that is lacking from the host cell to improve the yield of the target non-membrane protein is listed in Table 1 above.

[0397] Preferably, the host cell can be engineered to underexpress a polynucleotide encoding a KO protein comprising the amino acid sequence shown in SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 or 17. For example, the host cell can be engineered to underexpress a polynucleotide encoding a protein comprising amino acids having at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16. For example, the host cell can be engineered to underexpress a polynucleotide encoding a protein comprising amino acids having at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 17.

[0398] Preferably, when KO1 (the accessory protein comprising the amino acid sequence shown in SEQ ID NO: 16) and / or KO2 (the accessory protein comprising the amino acid sequence shown in SEQ ID NO: 16) are underexpressed, the expression of KO protein is enhanced compared to the host cell before the host cell was engineered to underexpress the KO protein. 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290 or at least 300% and preferably at least 10% when an auxiliary protein with the amino acid sequence of NO: 17 is used.

[0399] The term "low expression" generally refers to any amount less than the expression level shown by a reference standard, wherein the reference standard is a host cell before being engineered to underexpress the KO protein. The term "low expression" of the present invention refers to the expression of a gene product or polypeptide at a level less than the expression of the same gene product or polypeptide in a comparable host before or without genetic alteration of the host cell. For example, compared to a reference standard, the KO protein may be underexpressed by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or may not even be expressed at all (reduced by 100%). The term "low expression" also encompasses the absence of expression of a gene product or polypeptide.

[0400] Low expression can be achieved by any method that prevents the functional expression of one or more of KO1 and KO2 or their functional homologs. The result of low expression is the inability to exert their functions or all functions. The means of low expression may include gene silencing (e.g., RNAi gene antisense), knockout, changing expression levels, changing expression patterns, mutagenesis of gene sequences, sequence disruption, insertion, addition, mutation, modification of expression regulatory sequences, etc.

[0401] Preferably, low expression is achieved by knocking out a polynucleotide encoding a KO protein in the host cell. A gene can be knocked out by deleting all or part of the coding sequence. Methods for gene knockout are known in the art, such as those described in Kuhn and Wurst (Eds.) Gene Knockout Protocols (Methods in Molecular Biology) Humana Press (March 27, 2009). A gene can also be knocked out by removing part or all of the gene sequence. Alternatively, a gene can be knocked out or inactivated by inserting a nucleotide sequence such as a resistance gene. Alternatively, the gene can be knocked out or inactivated by inactivating the promoter of the gene. Therefore, for low expression of KO1 and KO2, preferred host cells express SEQ ID NO: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity to the amino acid sequence shown in SEQ ID NO: 16 or 17, such as fungal host cells of Pichia pastoris, Hansenula polymorpha, Trichoderma reesei, Saccharomyces cerevisiae, Kluyveromyces lactis, Yarrowia lipolytica, Pichia methanolica, Candida boidinii, Komagataella, and Schizosaccharomyces pombe. Even more preferred are fungal host cells from the genus Pichia pastoris expressing SEQ ID NO: 16 or 17.

[0402] In one embodiment, underexpression is achieved by disrupting a polynucleotide representing a gene encoding the KO protein in the host cell.

[0403] A "disruption" is a change in a nucleotide or amino acid sequence that results in the addition, deletion or substitution of one or more nucleotides or amino acid residues compared to the original sequence before the disruption.

[0404] An "insertion" or "addition" is a change in a nucleic acid or amino acid sequence that adds one or more nucleotides or amino acid residues compared to the original sequence before the disruption.

[0405] "Deletion" is defined as a change in a nucleotide or amino acid sequence in which one or more nucleotides or amino acid residues are removed (i.e., deleted) accordingly. Deletion encompasses deletion of an entire sequence, deletion of a portion of the coding sequence, or deletion of a single nucleotide or amino acid residue.

[0406] "Substitution" generally refers to the replacement of a nucleotide or amino acid residue by another nucleotide or amino acid residue. For example, "substitution" can be performed by site-directed mutagenesis, random mutation generation, and the gapped-duplex approach (see, e.g., U.S. Patent No. 4,760,025; Moring et al., Biotech. (1984) 2: 646; and Kramer et al., Nucleic Acids Res., (1984) 12: 9441).

[0407] Preferably, the disruption results in a frame shift mutation, an early stop codon, a point mutation of a critical residue, nonsense translation, or other non-functional protein product.

[0408] In another embodiment, low expression is achieved by destroying a promoter operably linked to the polypeptide to be knocked out. The promoter directs transcription of downstream genes. The promoter is essential and, together with other expression control sequences such as enhancers, ribosome binding sites, transcription start and stop sequences, translation start and stop sequences, and enhancer or activator sequences, expresses a given gene. Therefore, any of the expression control sequences can also be destroyed to hinder expression of the polypeptide.

[0409] In another embodiment, low expression is achieved by post-transcriptional gene silencing (PTGS). As a common technique in the art, PTGS reduces the expression level of a gene by expressing a heterologous RNA sequence (often antisense to the gene to be disrupted) (Lechtreck et al., J. Cell Sci (2002). 115: 1511-1522; Smith et al., Nature (2000). 407: 319-320; Furhmann et al., J. Cell Sci (2001). 114: 3857-3863; Rohr et al., Plant J (2004). 40(4): 611-21).

[0410] "Low expression" can be achieved by any technique known in the art that reduces gene expression. For example, a promoter operably linked to the polypeptide can be replaced by another promoter with lower promoter activity. Promoter activity can be assessed by the transcription efficiency of the promoter. Promoter activity can be measured directly by measuring the amount of mRNA transcribed from the promoter, such as by Northern blotting, quantitative PCR, or indirectly by measuring the amount of gene product expressed from the promoter. In another embodiment, low expression can be achieved by intervening in the folding of the expressed KO protein so that the KO protein cannot be correctly folded into a functional protein. For example, mutations can be introduced to remove the formation of disulfide bonds of the KO protein or to disrupt the formation of α helices and β folds.

[0411] In another embodiment, a host cell that underexpresses the accessory proteins KO1 and / or KO2 may overexpress one or more accessory proteins of the invention. Specific combinations of overexpressed and underexpressed accessory proteins are disclosed in the present invention.

[0412] use

[0413] The present invention further provides the use of the engineered host cells for producing a target protein. The host cells can advantageously be used to introduce polypeptides encoding one or more POIs, after which the host cells can be cultured under suitable conditions to express the POIs. Details of this use are described herein in connection with the methods of the present invention.

[0414] The polynucleotides encoding the accessory protein and the POI can be recombined in the host cell by ligating the relevant genes into a vector. A single vector carrying the genes can be constructed, or two independent vectors, one of which carries the accessory protein gene and the other carries the POI gene. The genes can be integrated into the genome of the host cell by transforming the host cell with one or more of the vectors. In some embodiments, the gene encoding the POI is integrated into the genome, while the gene encoding the accessory protein is integrated into a plasmid or vector. In some embodiments, the gene encoding the accessory protein is integrated into the genome, while the gene encoding the POI is integrated into a plasmid or vector. In some embodiments, the genes encoding the POI and the accessory protein are both integrated into the genome. In some embodiments, the genes encoding the POI and the accessory protein are integrated into a plasmid or vector. If multiple genes encoding the POI are used, some of the genes encoding the POI are integrated into the genome, while other genes are integrated into the same or different plasmids or vectors. If multiple genes encoding accessory proteins are used, some of the genes encoding the accessory proteins are integrated into the genome, while others are integrated into the same or different plasmids or vectors. Further teachings can be found in the following sections of this application.

[0415] Generally, the target protein can be produced using recombinant host cells by culturing the host cells in a suitable medium, isolating the expressed POI from the culture, and purifying the POI by a method suitable for the expression product, in particular, isolating the POI from the cells.

[0416] The present invention further provides use of an isolated polypeptide for preparing a target protein, wherein the isolated polypeptide comprises an amino acid sequence having at least 30% identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15 and 18.

[0417] method

[0418] The present invention further relates to a method for increasing the production of a target protein in a host cell, the method comprising overexpressing a polynucleotide of the present invention, wherein the polynucleotide encodes an accessory protein comprising amino acids having at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15.

[0419] The present invention further relates to a method for increasing the production of a target protein in a host cell, comprising underexpressing an auxiliary protein comprising an amino acid having at least 30% sequence identity with the amino acid sequence shown in SEQ ID NO: 16 and / or 17.

[0420] As used herein, the term "increasing the production of a target protein in a host cell" means that the production of the target protein is increased compared to the same cells expressing the same POI under the same culture conditions but without overexpressing the polynucleotide encoding the accessory protein.

[0421] Those skilled in the art will appreciate that overexpression of the accessory proteins of the present invention has been shown to increase product yields of POIs. Thus, for a given host cell expressing a POI at a level that should be increased, the present invention can be applied by expressing any one or several accessory proteins in the host cell if the accessory protein is not already present in the host cell, or by further increasing the expression level of the accessory protein in the host cell if the gene encoding the accessory protein is already present in the host cell.

[0422] The present invention further provides a method for increasing the yield of a target protein in a host cell. The method comprises (i) engineering a host cell to express or overexpress an auxiliary protein, (ii) engineering the host cell to comprise a heterologous polynucleotide encoding the target protein, and (iii) culturing the host cell under suitable conditions to overexpress the auxiliary protein and express the target protein and optionally (iv) isolating the target protein from the cell culture. It should be noted that the steps described in (i) and (ii) do not need to be implemented in the order described. The step described in (ii) may be implemented first and then the step described in (i). In step (i), the host cell may be engineered to overexpress a polynucleotide encoding an auxiliary protein comprising an amino acid having at least 30% sequence identity to an amino acid sequence shown in any one of SEQ ID NOs: 1-15.

[0423] The present invention further provides a method for increasing the output of target protein in host cell. The method comprises (i) engineering host cell to low expression auxiliary protein, (ii) engineering the host cell to include heterologous polynucleotides encoding the target protein, and (iii) cultivating the host cell under suitable conditions to express the target protein and optionally (iv) isolating the target protein from the cell culture. It should be noted that the steps described in (i) and (ii) do not need to be implemented in the order described. The step described in (ii) can be first implemented and then the step described in (i). In step (i), the host cell can be engineered to low expression polynucleotides, and the polynucleotide encoding comprises an auxiliary protein of an amino acid with at least 30% sequence identity to the amino acid sequence shown in SEQ ID NO: 16 and 17.

[0424] Those skilled in the art are familiar with procedures for manipulating polynucleotide sequences encoding, for example, accessory proteins and / or POIs, promoters, enhancers, leaders, etc., as described in, for example, J. Sambrook et al., Molecular Cloning: A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2001).

[0425] Can be by various means, such as by homologous recombination or by adopting the hybrid recombinase (hybrid recombinase) of the sequence of specific targeting at integration site, foreign source or target polynucleotide (such as the polynucleotide encoding overexpressed auxiliary protein or POI) is inserted into chromosome. Typically, described foreign source or target polynucleotide is present in carrier ("insertion carrier"). Typically, these carriers are circular and linear before being used for homologous recombination. As an alternative, described foreign source or target polynucleotide can be the DNA fragment connected by fusion PCR or synthetic DNA fragment constructed later by being recombined into host cell. In addition to homology arms, carrier can also contain markers, replication origin and other elements suitable for selection or screening. Heterologous recombination that causes random or non-targeted integration can also be adopted. Heterologous recombination refers to the recombination between DNA molecules and significantly different sequences. Methods of recombination are known in the art, for example, described in Boer et al., Appl Microbiol Biotechnol (2007) 77:513–523. For genetic manipulation of yeast cells, reference can also be made to Primrose and Twyman's Principles of Gene Manipulation and Genomics (7th edition, Blackwell Publishing 2006).

[0426] The polynucleotide encoding the overexpressed accessory protein and / or POI may also be present in an expression vector. These vectors are known in the art and have been described above. In the expression vector, a promoter is placed upstream of the gene encoding the heterologous protein and regulates the expression of the gene. Polyclonal vectors are particularly useful due to their multiple cloning sites. For expression, the promoter is typically placed upstream of the multiple cloning site. Vectors for the integration of polynucleotides encoding the accessory protein and / or POI can be constructed by first preparing a DNA construct containing the complete DNA sequence encoding the accessory protein and / or POI and then inserting this construct into a suitable expression vector, or by sequentially inserting DNA fragments containing the genetic information of individual elements (e.g., leader sequence, target DNA sequence) and then ligating them. As an alternative to fragment restriction and ligation, attachment site (att)-based recombination methods and recombinases can be used to insert DNA sequences into vectors. These methods are described, for example, by Landy (1989) Ann. Rev. Biochem. 58:913-949 and are known to those skilled in the art.

[0427] Host cells according to the present invention can be obtained by introducing a vector or plasmid comprising the target polynucleotide sequence into a cell. The technology for transfection or transformation of eukaryotic cells or transformation of prokaryotic cells is well known in the art. These technologies can include lipid vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (calcium phosphate / DNA coprecipitation), viral infection (particularly using modified viruses such as, for example, modified adenoviruses), microinjection, and electroporation. For prokaryotic transformation, technology can include heat shock-mediated uptake, fusion of bacterial protoplasts with intact cells, microinjection, and electroporation. Technology for plant transformation includes transfer (such as realized by Agrobacterium tumefaciens)-mediated, rapidly propelled tungsten or gold microbullets, electroporation, microinjection, and polyethylene glycol-mediated uptake. DNA can be single-stranded or double-stranded, linear or circular, relaxed, or supercoiled DNA. For various techniques for transfecting mammalian cells, see, eg, Keown et al. (1990) Processes in Enzymology 185:527-537.

[0428] The present invention further provides a method for preparing a target protein in a host cell, the method comprising (i) providing a host cell, the host cell being engineered to overexpress a polynucleotide encoding an auxiliary protein comprising an amino acid sequence shown in any one of SEQ ID NOs: 1-15 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in any one of SEQ ID NOs: 1-15, wherein the host cell comprises a heterologous polynucleotide encoding the target protein; and (ii) culturing the host cell under suitable conditions to overexpress the auxiliary protein or a functional homolog thereof and express the target protein and optionally isolating the target protein from the cell culture.

[0429] The present invention further provides a method for producing a target protein in a host cell, the method comprising (i) providing a host cell, the host cell being engineered to underexpress a polynucleotide encoding an auxiliary protein comprising an amino acid sequence shown in any one of SEQ ID NOs: 16 or 17 or a functional homolog thereof, wherein the functional homolog has at least 30% sequence identity with the amino acid sequence shown in SEQ ID NOs: 16 or 17, wherein the host cell comprises a heterologous polynucleotide encoding the target protein; and (ii) culturing the host cell under suitable conditions to express the target protein and optionally isolating the target protein. Preferably, the host cell is engineered to underexpress two polynucleotides encoding auxiliary proteins comprising an amino acid sequence shown in any one of SEQ ID NOs: 16 or 17 or a functional homolog thereof.

[0430] It should be understood that the methods disclosed herein may further include culturing the recombinant host cells under conditions that allow expression of the POI and accessory proteins. The recombinantly produced POI can then be isolated from the cells or cell culture medium, depending on the expression system and the properties of the expressed protein, such as whether the protein is fused into a single peptide and whether the protein is solubl...

Claims

1. A method for increasing the yield of a target protein in a eukaryotic host cell, the method comprising overexpressing a polynucleotide encoding a protein involved in lipid metabolism in the host cell, wherein the overexpression of the polynucleotide can increase the yield of the model protein SDZ-Fab and / or HyHEL-Fab compared to a host cell that does not overexpress a polynucleotide encoding a protein involved in lipid metabolism, wherein the protein involved in lipid metabolism is involved in sphingolipid biosynthesis, phospholipid biosynthesis, lipid transport and / or ergosterol biosynthesis, The amino acid sequence of the protein involved in lipid metabolism is shown in any one of SEQ ID NOs: 1, 3 and 10-15, The target protein is a non-membrane protein, the non-membrane protein is a therapeutic protein, and the eukaryotic host cell is Pichia pastoris; the heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO:37, and the light chain sequence is shown in SEQ IN NO:38; the heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO:39, and the light chain sequence is shown in SEQ IN NO:

40.

2. The method according to claim 1, wherein the amino acid sequence of the protein involved in sphingolipid biosynthesis is shown in SEQ ID NO: 1 or 3, or The amino acid sequence of the protein involved in phospholipid biosynthesis is shown in SEQ ID NO: 10, or The amino acid sequence of the protein involved in lipid transport is shown in SEQ ID NO: 11, or The amino acid sequence of the protein involved in ergosterol biosynthesis is shown in any one of SEQ ID NOs: 12-15.

3. A method for preparing a target protein in a eukaryotic host cell, the method comprising: - providing a host cell, the host cell being engineered to overexpress a polynucleotide encoding a protein involved in lipid metabolism and having an amino acid sequence shown in any one of SEQ ID NOs: 1, 3 and 10-15, wherein the host cell comprises a heterologous polynucleotide encoding a protein of interest; - culturing the host cell under suitable conditions to overexpress the protein involved in lipid metabolism and express the target protein, and optionally - isolating the target protein from the cell culture; Wherein, the target protein is a non-membrane protein, the non-membrane protein is a therapeutic protein, and the eukaryotic host cell is Pichia pastoris; Compared with a host cell that does not overexpress a polynucleotide encoding a protein involved in lipid metabolism, overexpression of the polynucleotide can increase the production of model proteins SDZ-Fab and / or HyHEL-Fab; wherein the heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO: 37, and the light chain sequence is shown in SEQ IN NO: 38; the heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO: 39, and the light chain sequence is shown in SEQ IN NO:

40.

4. The method of claim 3, wherein the host cell is engineered to overexpress i) a polynucleotide encoding a protein involved in sphingolipid biosynthesis, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 1 or 3, ii) a polynucleotide encoding a protein involved in phospholipid biosynthesis, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 10, iii) a polynucleotide encoding a protein involved in lipid transport, wherein the amino acid sequence of the protein is shown in SEQ ID NO: 11, or iv) a polynucleotide encoding a protein involved in ergosterol biosynthesis, wherein the amino acid sequence of the protein is shown in any one of SEQ ID NOs: 12-15.

5. A method for increasing the production of a target protein in a eukaryotic host cell, the method comprising overexpressing in the host cell a polynucleotide encoding the following protein involved in sphingolipid biosynthesis: (a) proteins whose amino acid sequences are shown in SEQ ID NOs: 1 and 2, respectively; or (b) proteins whose amino acid sequences are shown in SEQ ID NOs: 1 and 3, respectively; or (c) proteins whose amino acid sequences are shown in SEQ ID NOs: 1, 3 and 4, respectively; or (d) proteins whose amino acid sequences are shown in SEQ ID NOs: 1, 3, 4 and 8, respectively; or (e) proteins whose amino acid sequences are shown in SEQ ID NOs: 1 and 7, respectively; or (f) proteins whose amino acid sequences are shown in SEQ ID NOs: 1, 5, 6 and 9, respectively; The target protein is a non-membrane protein, which is a therapeutic protein, and the eukaryotic host cell is Pichia pastoris; compared with a host cell that does not overexpress a polynucleotide encoding a protein involved in sphingolipid biosynthesis, overexpression of the polynucleotide can increase the production of model proteins SDZ-Fab and / or HyHEL-Fab; wherein the heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO:37, and the light chain sequence is shown in SEQ IN NO:38; the heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO:39, and the light chain sequence is shown in SEQ IN NO:

40.

6. A method for increasing the production of a target protein in a eukaryotic host cell, the method comprising overexpressing a polynucleotide encoding a protein involved in sphingolipid biosynthesis and a polynucleotide encoding a protein involved in lipid transport in the host cell, wherein the amino acid sequence of the protein involved in sphingolipid biosynthesis is shown in SEQ ID NO: 1, and the amino acid sequence of the protein involved in lipid transport is shown in SEQ ID NO: 11, wherein the overexpression of the polynucleotide can increase the production of the model protein SDZ-Fab and / or HyHEL-Fab compared to a host cell that does not overexpress the polynucleotide encoding the protein involved in sphingolipid biosynthesis and the polynucleotide encoding the protein involved in lipid transport; or The method comprises overexpressing a protein encoding a protein involved in phospholipid biosynthesis and a protein encoding a protein involved in lipid transport in the host cell, wherein the amino acid sequence of the protein involved in phospholipid biosynthesis is shown in SEQ ID NO: 10, and the amino acid sequence of the protein involved in lipid transport is shown in SEQ ID NO: 11, wherein compared with a host cell that does not overexpress a polynucleotide encoding a protein involved in phospholipid biosynthesis and a polynucleotide encoding a protein involved in lipid transport, overexpression of the polynucleotide can increase the production of the model protein SDZ-Fab and / or HyHEL-Fab; or The method comprises overexpressing a polynucleotide encoding a protein involved in sphingolipid biosynthesis and a polynucleotide encoding a protein as a molecular chaperone in the host cell, wherein the amino acid sequence of the protein involved in sphingolipid biosynthesis is shown in SEQ ID NO: 1, and the amino acid sequence of the molecular chaperone is shown in SEQ ID NO: 18, wherein the overexpression of the polynucleotide can increase the production of the model protein SDZ-Fab and / or HyHEL-Fab compared to a host cell that does not overexpress the polynucleotide encoding the protein involved in sphingolipid biosynthesis and the polynucleotide encoding the protein as a molecular chaperone; or The method comprises overexpressing a polynucleotide encoding a protein involved in ergosterol biosynthesis and a polynucleotide encoding a protein as a molecular chaperone in the host cell, wherein the amino acid sequence of the protein involved in ergosterol biosynthesis is shown in SEQ ID NO: 13, and the amino acid sequence of the molecular chaperone is shown in SEQ ID NO: 18, wherein compared with a host cell that does not overexpress the polynucleotide encoding the protein involved in ergosterol biosynthesis and the polynucleotide encoding the protein as a molecular chaperone, the overexpression of the polynucleotide can increase the production of the model protein SDZ-Fab and / or HyHEL-Fab; The target protein is a non-membrane protein, the non-membrane protein is a therapeutic protein, and the eukaryotic host cell is Pichia pastoris; the heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO:37, and the light chain sequence is shown in SEQ IN NO:38; the heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO:39, and the light chain sequence is shown in SEQ IN NO:

40.

7. A recombinant eukaryotic host cell for preparing a target protein, wherein the host cell is engineered to overexpress a polynucleotide encoding a protein involved in lipid metabolism, The amino acid sequence of the protein involved in lipid metabolism is shown in any one of SEQ ID NOs: 1, 3 and 10-15, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1 and 2, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1 and 3, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1, 3 and 4, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1, 3, 4 and 8, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1 and 7, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1, 5, 6 and 9, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1 and 11, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 10 and 11, or The amino acid sequence of the protein involved in lipid metabolism is shown in SEQ ID NO: 1 and 18, or The amino acid sequences of the proteins involved in lipid metabolism are shown in SEQ ID NOs: 13 and 18; The target protein is a non-membrane protein, which is a therapeutic protein; the eukaryotic host cell is Pichia pastoris; compared with a host cell that does not overexpress a polynucleotide encoding a protein involved in lipid metabolism, overexpression of the polynucleotide can increase the production of the model protein SDZ-Fab and / or HyHEL-Fab; the heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO:37, and the light chain sequence is shown in SEQ IN NO:38; the heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO:39, and the light chain sequence is shown in SEQ IN NO:

40.

8. A method for increasing the yield of a target protein in a eukaryotic host cell, the method comprising underexpressing two polynucleotides encoding proteins involved in lipid metabolism in the host cell, wherein the underexpression of the two polynucleotides can increase the yield of model proteins SDZ-Fab and / or HyHEL-Fab compared to the host cell that does not underexpress the polynucleotides encoding proteins involved in lipid metabolism, The first protein involved in lipid metabolism is involved in lipid storage, and has an amino acid sequence as shown in SEQ ID NO: 16, and The second protein involved in lipid metabolism is also involved in lipid storage and has an amino acid sequence shown in SEQ ID NO: 17, The target protein is a non-membrane protein, the non-membrane protein is a therapeutic protein, and the eukaryotic host cell is Pichia pastoris; the heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO:37, and the light chain sequence is shown in SEQ IN NO:38; the heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO:39, and the light chain sequence is shown in SEQ IN NO:

40.

9. A method for preparing the target protein according to claim 8, the method comprising: - providing a host cell, wherein the host cell is engineered to under-express polynucleotides encoding two proteins, the first of which is involved in lipid metabolism and has an amino acid sequence shown in SEQ ID NO: 16, and the second of which is also involved in lipid metabolism and has an amino acid sequence shown in SEQ ID NO: 17, wherein the host cell comprises a heterologous polynucleotide encoding the target protein; - culturing the host cell under suitable conditions to low-express the protein involved in lipid metabolism and express the target protein, and optionally - isolating the target protein from the cell culture; Wherein, the target protein is a non-membrane protein, the non-membrane protein is a therapeutic protein, and the host cell is Pichia pastoris; compared with the host cell that does not low-express the polynucleotides encoding the two proteins, the low expression of the two polynucleotides can increase the production of the model protein SDZ-Fab and / or HyHEL-Fab; the heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO:37, and the light chain sequence is shown in SEQ IN NO:38; the heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO:39, and the light chain sequence is shown in SEQ IN NO:

40.

10. A recombinant eukaryotic host cell for preparing a target protein, wherein the host cell is engineered to under-express two polynucleotides encoding proteins involved in lipid metabolism, wherein the target protein is a non-membrane protein, The first protein involved in lipid metabolism is involved in lipid storage and has an amino acid sequence shown in SEQ ID NO: 16, and the second protein involved in lipid metabolism is also involved in lipid storage and has an amino acid sequence shown in SEQ ID NO: 17, in, The target protein is a non-membrane protein, which is a therapeutic protein. The eukaryotic host cell is Pichia pastoris. Compared with host cells that do not low-express polynucleotides encoding the two proteins, low expression of the two polynucleotides can increase the production of model proteins SDZ-Fab and / or HyHEL-Fab. The heavy chain sequence of the model protein SDZ-Fab is shown in SEQ IN NO:37, and the light chain sequence is shown in SEQ IN NO:

38. The heavy chain sequence of the model protein HyHEL-Fab is shown in SEQ IN NO:39, and the light chain sequence is shown in SEQ IN NO:40.

Images