Compositions and methods for isolating target nucleic acids

Abstract

A population of target capture probes that can be used for nucleic acid separation and purification is provided. The probes of the population include: a first region and a second region, the first region having a length of at least about 12 residues and including a poly(r) sequence, the poly(r) sequence including (i) a random sequence including G and A nucleotides or (ii) a non-random repeating (A and G) sequence; the second region includes a first specific binding partner (SBP), wherein the SBP is capable of specifically binding to a second specific binding partner (SBP2). Related combinations, methods, uses, kits, and reaction mixtures are also provided.

Description

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 504,900, filed May 11, 2017, which is incorporated herein by reference for all purposes.

[0002] The present disclosure relates to the field of molecular biology and, more particularly, to methods and compositions for isolating nucleic acids from a mixture (eg, a sample) by using a population of probes that hybridize to one or more target nucleic acids to allow their separation from other components of the mixture.

[0003] Sequence Listing

[0004] This application is submitted with a sequence listing in electronic format. The sequence listing is provided in the form of a file titled "2018-05-01_01159-0016-00PCT_Seq_List_ST25.txt" created on May 1, 2018, and the file size is 4,131 bytes. The electronic format information of the sequence listing is incorporated herein by reference in its entirety.

[0005] Background technology and invention content

[0006] Many molecular biology procedures, such as in vitro amplification of nucleic acids and in vitro hybridization, involve the preparation of some nucleic acids to facilitate subsequent procedures. Methods for nucleic acid purification can separate all nucleic acids present in a sample, separate different types of nucleic acids based on physical characteristics, or separate specific nucleic acids from a sample. Many methods involve complex procedures, use harsh chemicals or conditions, or require a long time to complete the nucleic acid separation. Some methods involve the use of specialized oligonucleotides, each of which is specific to the expected target nucleic acid, which increases the complexity of the design, optimization, and performance of the method, especially if more than one target nucleic acid needs to be separated or the sequence of the desired target nucleic acid is unknown. Some methods can separate target nucleic acids without a specific target sequence, but cannot efficiently separate all sequences. Therefore, there is still a need for a simple, efficient and rapid method to separate the nucleic acid of interest from other sample components.

[0007] Therefore, the following embodiments are among the embodiments provided in the present disclosure.

[0008] Embodiment 1 is a capture probe population for separating target nucleic acids from a sample, comprising: a first region and a second region, wherein the first region has a length of at least about 12 residues and comprises at least one poly(r) sequence, wherein the poly(r) sequence comprises (i) a random sequence comprising G and A nucleotides or (ii) a non-random repeated (A and G) sequence; and the second region comprises a first specific binding partner (SBP), wherein the SBP is capable of specifically binding to a second specific binding partner (SBP2).

[0009] Embodiment 2 is a population of capture probes according to embodiment 1, wherein the poly(r) sequence comprises a random sequence comprising G and A nucleotides.

[0010] Embodiment 3 is a capture probe population according to embodiment 2, wherein the first region comprises at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 random poly (r) sequence nucleotides.

[0011] Embodiment 4 is a capture probe population according to any of the preceding embodiments, wherein the poly (r) sequence includes at least about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 non-random repeat (A and G) sequence nucleotides.

[0012] Embodiment 5 is a capture probe population according to any of the preceding embodiments, wherein the length of the first region is at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0013] Embodiment 6 is a population of capture probes according to any one of the preceding embodiments, wherein the first region consists of random G and A nucleotides, non-random repeating (A and G) sequences, or a combination thereof.

[0014] Embodiment 7 is a capture probe population as described in any one of joint embodiments 1 to 5, wherein the first region further includes a linker sequence between the poly (r) sequence and a second poly (r) sequence, and the second poly (r) sequence includes (i) a random sequence including G and A nucleotides or (ii) a non-random repeated (A and G) sequence.

[0015] Embodiment 8 is a population of capture probes according to embodiment 7, wherein the poly(r) sequence is at least about 6 residues in length and the second poly(r) sequence is at least about 6 residues in length.

[0016] Embodiment 9 is a population of capture probes according to any one of the preceding embodiments, wherein the first region comprises 2'-O-methyl modified RNA residues.

[0017] Example 10 is a capture probe population according to any one of the foregoing examples, wherein the first region comprises poly(r) 18 , poly(r) 24 or poly(r) 25 sequences.

[0018] Example 11 is a capture probe population according to any one of the foregoing examples, wherein the SBP is a non-nucleic acid moiety.

[0019] Example 12 is a capture probe population according to any one of Examples 1 to 10, wherein the SBP comprises a homopolymeric sequence.

[0020] Example 13 is a capture probe population according to Example 12, wherein the SBP comprises dT3dA 30 (SEQ ID NO:10) or dA 30 (SEQ ID NO:11) sequences.

[0021] Example 14 is a capture probe population according to any one of the foregoing examples, wherein the SBP is located at the 3' position of the first region.

[0022] Example 15 is a combination comprising a capture probe population according to any one of the foregoing examples and a second capture probe population, the second capture probe population comprising a first region and a second region, the first region having a length of at least about 12 residues and comprising a poly(k) sequence, the poly(k) sequence comprising (i) a random sequence comprising G and U / T nucleotides or (ii) a non-random repeat (G and U / T) sequence; the second region comprises a third specific binding partner (SBP3), wherein the SBP3 is capable of specifically binding a fourth specific binding partner (SBP4).

[0023] Example 16 is the combination according to Example 15, wherein the SBP and SBP3 are capable of binding the same SBP2 / SBP4.

[0024] Example 17 is the combination according to Example 16, wherein the SBP and the SBP3 are identical to each other.

[0025] Example 18 is the combination according to any one of Examples 15 to 17, wherein the first region of the second population has a length of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides.

[0026] Embodiment 19 is the combination of any one of embodiments 15 to 18, wherein the first region of the second population comprises poly(k) 18 、Poly(k) 24 or poly(k) 25 sequence.

[0027] Embodiment 20 is a combination according to any one of embodiments 15 to 19, wherein the first region of the second population consists of random G and U / T nucleotides or non-random repeats (G and U / T).

[0028] Embodiment 21 is a kit or reaction mixture for isolating a target nucleic acid from a sample, the reaction mixture comprising:

[0029] Embodiment 22 is a capture probe population according to any one of embodiments 1 to 14 or a combination according to any one of embodiments 15 to 20; and

[0030] Example 23 is SBP2 immobilized on a carrier.

[0031] Embodiment 24 is a kit or reaction mixture according to embodiment 21, wherein the SBP and SBP2 are substantially complementary nucleic acid sequences.

[0032] Embodiment 25 is a kit or reaction mixture according to embodiment 21, wherein the SBP and SBP2 are non-nucleic acid moieties.

[0033] Embodiment 26 is the kit or reaction mixture of any one of embodiments 21 to 23, wherein the reaction mixture further comprises a detergent.

[0034] Embodiment 27 is a kit or reaction mixture according to any one of embodiments 21 to 24, wherein the reaction mixture further comprises lithium dodecyl sulfate or sodium dodecyl sulfate and / or lithium hydroxide.

[0035] Embodiment 28 is a kit or reaction mixture according to any one of embodiments 21 to 25, wherein the reaction mixture comprises a combination of capture probes according to any one of embodiments 15 to 20.

[0036] Embodiment 29 is a kit or reaction mixture according to embodiment 26, wherein said SBP and said SBP3 are capable of binding to said SBP2.

[0037] Embodiment 30 is a kit or reaction mixture according to embodiment 26, wherein the reaction mixture further comprises SBP4 immobilized on a carrier.

[0038] Embodiment 31 is a kit or reaction mixture according to any one of embodiments 21 to 28, wherein the mixture further comprises a solution phase.

[0039] Embodiment 32 is a reaction mixture according to embodiment 29, wherein the reaction mixture includes target nucleic acids in the solution phase and / or associated with the capture probes.

[0040] Embodiment 33 is a reaction mixture according to embodiment 30, wherein the target nucleic acid is derived from cells treated to release intracellular components into the solution phase.

[0041] Embodiment 34 is the reaction mixture of any one of embodiments 29 to 31, wherein the solution phase comprises a sample from an animal, environmental, food, or industrial source.

[0042] Embodiment 35 is the reaction mixture of any one of embodiments 29 to 32, wherein the solution phase comprises a sample comprising peripheral blood, serum, plasma, cerebrospinal fluid, sputum, or a swab specimen.

[0043] Embodiment 36 is a method for isolating a target nucleic acid from a sample, the method comprising: contacting the capture probe according to any one of Embodiments 1 to 14 or the combination according to any one of Embodiments 15 to 20 with a solution containing nucleic acid to form a reaction mixture, wherein the reaction mixture further comprises a carrier comprising the SBP2; incubating the reaction mixture under conditions that allow the first region to hybridize with the target nucleic acid and allow the SBP to associate with the SBP2 immobilized on the carrier, thereby forming a hybridization complex in contact with the solution phase; and separating the carrier from the solution phase, thereby separating the target nucleic acid from other components in the sample.

[0044] Embodiment 37 is a method for isolating a target nucleic acid from a sample, the method comprising: incubating the reaction mixture according to any one of Embodiments 21 to 33 with the sample under conditions that allow the first region to hybridize with the target nucleic acid and allow the SBP to associate with the SBP2 immobilized on the carrier, thereby forming a hybridization complex in contact with a solution phase; and separating the carrier from the solution phase, thereby separating the target nucleic acid from other components in the sample.

[0045] Embodiment 38 is a method according to embodiment 34 or 35, wherein the sample contains cells and is treated prior to the contacting step to release intracellular components into the solution.

[0046] Embodiment 39 is a method according to embodiment 36, wherein the treating comprises treating the sample with a solution containing a detergent.

[0047] Embodiment 40 is a method according to any one of embodiments 34 to 37, wherein the sample is from an animal, environmental, food, or industrial source.

[0048] Embodiment 41 is a method according to any one of embodiments 34 to 38, wherein the sample comprises peripheral blood, serum, plasma, cerebrospinal fluid, sputum or a swab specimen.

[0049] Embodiment 42 is a method according to any one of embodiments 34 to 39, wherein the sample comprises a cell lysate.

[0050] Embodiment 43 is a method according to any one of embodiments 34 to 40, wherein said SBP and said SBP2 are non-nucleic acid moieties.

[0051] Embodiment 44 is a method according to any one of embodiments 34 to 40, wherein said SBP and said SBP2 are substantially complementary nucleic acid sequences.

[0052] Embodiment 45 is the method of any one of embodiments 34-42, wherein the combination of any one of embodiments 15-20 is contacted with the solution containing nucleic acid.

[0053] Embodiment 46 is a method according to embodiment 43, wherein said SBP and said SBP3 are capable of binding to said SBP2.

[0054] Embodiment 47 is a method according to embodiment 43, wherein the reaction mixture further comprises a vector comprising the SBP4.

[0055] Embodiment 48 is a population, combination, reaction mixture or method according to any one of the preceding embodiments, wherein the target nucleic acid comprises DNA.

[0056] Embodiment 49 is a population, combination, reaction mixture or method according to any one of the preceding embodiments, wherein the target nucleic acid comprises RNA.

[0057] Embodiment 50 is a population, combination, reaction mixture or method according to any one of the preceding embodiments, wherein the target nucleic acid comprises viral nucleic acid.

[0058] Embodiment 51 is a population, combination, reaction mixture or method according to any one of the preceding embodiments, wherein the target nucleic acid comprises a prokaryotic nucleic acid.

[0059] Embodiment 52 is a population, combination, reaction mixture or method according to any one of the preceding embodiments, wherein the target nucleic acid comprises a eukaryotic nucleic acid.

[0060] Embodiment 53 is a population, combination, reaction mixture or method according to any one of the preceding embodiments, wherein the target nucleic acid comprises a synthetic nucleic acid.

[0061] Embodiment 54 is a population, combination, reaction mixture or method according to any of the preceding embodiments, wherein the target nucleic acid comprises a combination of DNA, RNA, viral nucleic acid, bacterial nucleic acid, eukaryotic nucleic acid and / or synthetic nucleic acid. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 Shows that (r) will be used 18 / (k) 18 Extraction of capture probe mixture and use of only (k) 18 The capture probes were extracted and the ΔCT of 49 clinical specimens were compared as described in Example 2. Each bar graph represents the results from a single specimen. DETAILED DESCRIPTION

[0063] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to specific compositions or process steps, as such compositions or process steps may vary. It should be noted that, unless the context clearly indicates otherwise, as used in this specification and the appended claims, the singular forms "a / an" and "the" include the plural forms. Thus, for example, reference to an "oligomer" includes a plurality of oligomers, etc. The conjunction "or" will be interpreted in an inclusive sense, i.e., equivalent to "and / or", unless the inclusive sense is unreasonable in the context.

[0064] It should be understood that there is an implicit "about" before the temperatures, concentrations, times, etc. discussed in this disclosure, so that slight and insubstantial deviations are within the scope of the present teachings. Generally, the term "about" indicates an insubstantial change in the amount of a component of a composition, which does not have any significant effect on the activity or stability of the composition. Moreover, the use of "comprise / comprises / comprising", "contain / contains / containing", "include / includes / including" is not intended to be restrictive. It should be understood that the foregoing general description and detailed description are merely exemplary and explanatory, and are not constraints on the present teachings. To the extent that any material incorporated by reference is inconsistent with the explicit content of the present disclosure, the explicit content shall prevail.

[0065] Unless otherwise specified, embodiments described in the specification as "including" various components are also considered to be "consisting of" or "consisting essentially of" the components; embodiments described in the specification as "consisting of various components" are also considered to be "including" the components or "consisting essentially of" the components; and embodiments described in the specification as "consisting essentially of various components" are also considered to be "consisting of" or "including" the components (this interchangeability does not apply to the use of these terms in the claims).

[0066] A. Definition

[0067] "Sample" includes any specimen that may contain a target nucleic acid. Samples include "biological samples", which include any tissue or material derived from a living or dead organism, wherein the material or tissue may contain a target nucleic acid derived from the living or dead organism, including, for example, peripheral blood, plasma, serum, lymph nodes, gastrointestinal tissue, cerebrospinal fluid, sputum, swab specimens or other body fluids or materials. Biological samples can be treated to physically or mechanically destroy tissue or cell structures, thereby releasing intracellular components into a solution, which can further contain enzymes, buffers, salts, detergents, etc., which are used to prepare biological samples for analysis using standard methods. Similarly, samples can include processed samples, such as samples obtained by passing the sample through or through a filter device, or then centrifuging, or by adhering to a medium, matrix or carrier.

[0068] "Nucleic acid" refers to a polymeric compound comprising two or more covalently bonded nucleosides or nucleoside analogs with nitrogen-containing heterocyclic bases or base analogs, wherein the nucleosides are linked together by phosphodiester bonds or other bonds to form polynucleotides. Nucleic acids include RNA, DNA or chimeric DNA-RNA polymers or oligonucleotides and analogs thereof. The "backbone" of nucleic acids can be composed of a variety of bonds, including one or more of the following: sugar-phosphodiester bonds, peptide-nucleic acid bonds (in "peptide nucleic acids" or PNAs, see, for example, International Patent Application Publication No. WO 95 / 32305), phosphorothioate bonds, methylphosphonate bonds, or combinations thereof. The sugar moiety of nucleic acids can be ribose or deoxyribose, or similar compounds with known substitutions such as, for example, 2'-methoxy substitutions and 2'-halide substitutions (e.g., 2'-F)). The nitrogenous base can be a conventional base (A, G, C, T, U), an analog thereof (e.g., inosine, 5-methylisocytosine, isoguanine; see, e.g., The Biochemistry of the Nucleic Acids, 5-36, Adams et al., ed., 11th ed., 1992; Abraham et al., 2007, BioTechniques 43:617-24), a derivative containing a purine base or a pyrimidine base (e.g., N4 -methyldeoxyglycine, deaza- or aza-purine, deaza- or aza-pyrimidine, pyrimidine bases with substituents at positions 5 or 6, purine bases with altered or substituted substituents at positions 2, 6 and / or 8 (e.g., 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine and O 4 -alkyl-pyrimidines) and pyrazole compounds (e.g., unsubstituted or 3-substituted pyrazolino[3,4-d]pyrimidines); U.S. Pat. Nos. 5,378,825, 6,949,367, and International Patent Application Publication No. WO 93 / 13121, each of which is incorporated herein by reference). Nucleic acids may contain "abasic" residues in which the backbone does not contain one or more nitrogenous bases of the residues (see, e.g., U.S. Pat. No. 5,585,481, which is incorporated herein by reference). Nucleic acids may include only conventional sugars, bases, and linkages as found in RNA and DNA, or may also contain conventional components and substitutions (e.g., conventional bases linked by a 2'-methoxy backbone, or nucleic acids containing mixtures of conventional bases and one or more base analogs). Nucleic acids may comprise "locked nucleic acids" (LNAs), in which one or more nucleotide monomers have a bicyclic furanose unit locked in an RNA that mimics a sugar conformation, thereby enhancing hybridization affinity to complementary sequences in single-stranded RNA (ssRNA), single-stranded DNA (ssDNA), or double-stranded DNA (dsDNA) (Vester et al., Biochemistry 43: 13233-41, 2004, which is incorporated herein by reference). Nucleic acids may comprise modified bases to alter the function or behavior of the nucleic acid, for example, adding a 3'-terminal dideoxynucleotide to prevent additional nucleotides from being added to the nucleic acid. Although nucleic acids can be purified from natural sources using conventional techniques, synthetic methods for preparing nucleic acids in vitro are well known in the art.

[0069] As used herein, the term "polynucleotide" refers to a nucleic acid chain. Throughout this application, nucleic acids are named from the 5'-end to the 3'-end. Synthetic nucleic acids, such as DNA, RNA, DNA / RNA chimeras (including when non-natural nucleotides or analogs are included herein), are generally synthesized "3' to 5'", i.e., by adding nucleotides to the 5'-end of the growing nucleic acid.

[0070] As used herein, "nucleotide" is a subunit of a nucleic acid consisting of a phosphate group, a 5-carbon sugar, and a nitrogenous base (also referred to herein as a "nucleobase"). The 5-carbon sugar found in RNA is ribose. In DNA, the 5-carbon sugar is 2'-deoxyribose. The term also includes analogs of such subunits, such as the methoxy group at the 2' position of ribose (also referred to herein as "2'-O-Me" or "2'-methoxy"). As used herein, unless otherwise indicated, the "T" residue in a 2'-methoxy oligonucleotide is interchangeable with a "U".

[0071] As used herein, a "non-nucleotide unit" is a unit that does not significantly participate in polymer hybridization. For example, such a unit does not participate in any significant hydrogen bonding with a nucleotide, and would exclude units having one of the five nucleotide bases or an analog thereof as a component.

[0072] As used herein, "target nucleic acid" is a nucleic acid that includes a target sequence to be amplified. The target nucleic acid can be a DNA or RNA as described herein, and can be single-stranded or double-stranded. In addition to the target sequence, the target nucleic acid can include other sequences, which may not be amplified.

[0073] As used herein, "target hybridizing sequence" refers to the portion of an oligomer configured to hybridize to a target nucleic acid. A target hybridizing sequence may, but need not, include a linker (eg, a linker sequence or a non-nucleotide strand) between segments that hybridize to a target.

[0074] As used herein, the term "region" refers to a portion of a nucleic acid, wherein the portion is smaller than the entire nucleic acid. For example, when the reference nucleic acid is a capture probe, the term "region" can be used to refer to a smaller target hybridizing portion of the entire oligonucleotide or a smaller portion that acts as a specific binding partner.

[0075] The interchangeable terms "oligomer", "oligo" and "oligonucleotide" refer to nucleic acids having generally less than 1,000 nucleotide (nt) residues, comprising a polymer in the range of about 5nt residues and about 500 to 900nt residues. In certain embodiments, oligonucleotides are in the range of about 12 to 15nt and about 50 to 600nt, while other embodiments are in the range of about 15 to 20nt and about 22 to 100nt. Oligonucleotides can be purified from naturally occurring sources or can be synthesized using any of a variety of well-known enzymes or chemical methods. The term oligonucleotide does not represent any specific function of a reagent; on the contrary, it is generally used to cover all such reagents described herein. Oligonucleotides can play a variety of different functions. For example, if the oligonucleotide is specific for a complementary strand and is capable of hybridizing with the complementary strand and can be further extended in the presence of a nucleic acid polymerase, the oligonucleotide can be used as a primer; if the oligonucleotide contains a sequence that is recognized by an RNA polymerase and allows transcription (e.g., a T7 primer), the oligonucleotide can be used as a primer and provide a promoter; if the oligonucleotide is capable of hybridizing with a target nucleic acid or an amplicon thereof, the oligonucleotide can function to detect the target nucleic acid and further provide a detectable portion (e.g., a fluorophore).

[0076] "Amplification" refers to any known step for obtaining multiple copies of a target nucleic acid sequence or its complement or its fragment. Multiple copies can be referred to as amplicons or amplification products, which can be double-stranded or single-stranded and can include DNA, RNA or both. The amplification of a "fragment" refers to the generation of an amplified nucleic acid containing less than a complete target nucleic acid or its complement, for example, by using an oligonucleotide of an amplification that hybridizes with an internal position of the target nucleic acid and polymerizes from the internal position to produce. Known amplification methods include, for example, replicase-mediated amplification, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), and transcription-mediated or transcription-related amplification. Replicase-mediated amplification uses self-replicating RNA molecules and replicase, such as QB-replicase (see, for example, U.S. Patent No. 4,786,600, which is incorporated herein by reference). PCR amplification uses a DNA polymerase, primer pairs, and thermal cycling to synthesize multiple copies of two complementary strands of dsDNA or cDNA (see, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; and 4,800,159; each of which is incorporated herein by reference). LCR amplification uses four or more different oligonucleotides to amplify a target and its complementary strands by using multiple cycles of hybridization, ligation, and denaturation (see, e.g., U.S. Pat. Nos. 5,427,930 and 5,516,663, each of which is incorporated herein by reference). SDA uses primers that contain recognition sites for a restriction endonuclease and an endonuclease that cleaves one strand of a hemi-modified DNA duplex containing the target sequence, thereby performing amplification in a series of primer extension and strand displacement steps (see, e.g., U.S. Pat. Nos. 5,422,252; 5,547,861; and 5,648,211; each of which is incorporated herein by reference). Amplification can be linear or exponential.

[0077] "Detection probe", "detection oligonucleotide", "probe oligomer" and "detection probe oligomer" are used interchangeably to refer to a nucleic acid oligomer that specifically hybridizes to a target sequence in a nucleic acid or an amplified nucleic acid under conditions that promote hybridization to detect a target sequence or an amplified nucleic acid. Detection can be direct (e.g., a probe that hybridizes directly to its target sequence) or indirect (e.g., a probe that is connected to its target through an intermediate molecular structure). The detection probe can be DNA, RNA, an analog thereof, or a combination thereof (e.g., a DNA / RNA chimera), and they can be labeled or unlabeled. The detection probe may further comprise alternative backbone bonds, such as 2'-O-methyl bonds. The "target sequence" of a detection probe generally refers to a smaller nucleic acid sequence region within a larger nucleic acid sequence that specifically hybridizes to at least a portion of a probe oligomer through standard base pairing. The detection probe may include a target-specific sequence and other sequences that contribute to the three-dimensional conformation of the probe (see, e.g., U.S. Pat. Nos. 5,118,801; 5,312,728; 6,849,412; 6,835,542; 6,534,274; and 6,361,945;) and U.S. Patent Application Publication No. 20060068417; each of which is incorporated herein by reference).

[0078] By "stable" or "assay stable" is meant that the temperature of the reaction mixture is at least 2°C below the melting point of the nucleic acid duplex.

[0079] As used herein, "label" refers to a part or compound directly or indirectly connected to a probe that is detected or causes a detectable signal. Direct labeling can occur by a bond or interaction (including covalent bonds or non-covalent interactions, such as hydrogen bonds, hydrophobic and ionic interactions) connecting the label to the probe or by forming a chelate or coordination complex. Indirect labeling can occur by using a bridging part or "linker" such as a binding pair member, an antibody or an additional oligomer, which can be directly or indirectly labeled and can amplify a detectable signal. Labels include any detectable part, such as a radionuclide, a ligand (such as biotin, avidin), an enzyme or enzyme substrate, a reactive group or a chromophore (such as a dye, particle or bead that imparts a detectable color), a luminescent compound (such as a bioluminescent, phosphorescent or chemiluminescent label) or a fluorophore. Labels can be detected in a homogeneous assay, in which a probe bound to the label in the mixture has a detectable change different from a probe not bound to the label, such as instability or differential degradation characteristics.

[0080] "Capture probe," "capture oligonucleotide," "capture oligomer," "target capture oligomer," and "capture probe oligomer" are used interchangeably to refer to a nucleic acid oligomer that specifically hybridizes to a target sequence in a target nucleic acid through standard base pairing and binds to a binding partner on an immobilized probe to capture the target nucleic acid on a support. One example of a capture oligomer comprises two binding regions: a sequence binding region (e.g., a target-specific portion) and an immobilized probe binding region are typically located on the same oligomer, although the two regions may be present on two different oligomers connected together by one or more linkers. Another embodiment of a capture oligomer uses a target sequence binding region that comprises a random or non-random poly-GU, poly-GT, or poly-U sequence to non-specifically bind to the target nucleic acid and connect it to an immobilized probe on a support.

[0081] As used herein, "immobilized oligonucleotide", "immobilized probe", "immobilized binding partner", "immobilized oligomer" or "immobilized nucleic acid" refers to a nucleic acid binding partner that directly or indirectly connects the capture oligomer to a carrier. The immobilized probe connected to the carrier helps to separate the target bound by the capture probe from unbound substances in the sample. One embodiment of the immobilized probe is an oligomer connected to a carrier, which helps to separate the bound target sequence from unbound substances in the sample. The carrier can contain known materials (such as matrix and particles that are insoluble in solution), which can be composed of nitrocellulose, nylon, glass, polyacrylate, mixed polymers, polystyrene, silane, polypropylene, metal or other compositions, one embodiment of which can be magnetically attracted particles. The carrier can be a monodisperse magnetic sphere (e.g., uniform size + 5%), and the immobilized probe is directly connected (by covalent bond, chelation or ionic interaction) or indirectly connected (by one or more linkers) to the monodisperse magnetic sphere, wherein the bond or interaction between the probe and the carrier is stable under hybridization conditions.

[0082] "Complementary" refers to that the nucleotide sequences of similar regions of two single-stranded nucleic acids or two different regions of the same single-stranded nucleic acid have a nucleotide base composition that allows the single-stranded region to hybridize together in a stable double-stranded hydrogen bond region under stringent hybridization or amplification conditions. Through standard nucleic acid base pairing (e.g., G:C, A:T or A:U pairing), the sequences that hybridize to each other can be fully complementary or partially complementary to the expected target sequence. "Sufficiently complementary" refers to a continuous sequence that can be hybridized with another sequence through hydrogen bonding between a series of complementary bases, and the complementary bases can be complementary at each position of the sequence through standard base pairing or can contain one or more residues, including non-complementary abasic residues. Sufficiently complementary continuous sequences are generally at least 80% or at least 90% complementary to the sequence that will be specifically hybridized with the oligomer. "Sufficiently complementary" sequences allow nucleic acid oligomers to stably hybridize with their target sequences under suitable hybridization conditions, even if the sequences are not fully complementary. Nucleotide sequences are "fully" complementary when a contiguous sequence of nucleotides of one single-stranded region is capable of forming a series of "canonical" or "Watson-Crick" hydrogen-bonded base pairs with a similar sequence of nucleotides of the other single-stranded region such that A pairs with U or T and C pairs with G (see, e.g., Sambrook et al., Molecular Cloning A Laboratory Manual, 2nd ed. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989), according to §§1.90-1.91, 7.37-7.57, 9.47-9.51, and 11.47-11.57, specifically §§9.50-9.51, 11.12-11.13, 11.45-11.47, and 11.55-11.57, which is incorporated herein by reference). It should be understood that the scope of percent identity includes all integers and partial numbers (e.g., at least 90% includes 90, 91, 93.5, 97.687, etc.). Unless the context otherwise indicates, reference to the "complement" of a particular sequence generally refers to a fully complementary sequence. Suitable hybridization conditions are well known in the art and can be predicted based on sequence composition, or can be determined using conventional testing methods (see, e.g., Sambrook et al., Molecular Cloning Laboratory Manual, 2nd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989), the document is according to §§1.90-1.91, 7.37-7.57, 9.47-9.51 and 11.47-11.57, specifically §§9.50-9.51, 11.12-11.13, 11.45-11.47 and 11.55-11.57, which are incorporated herein by reference).

[0083] A "wobble" base pair is when a G pairs with either a U or a T.

[0084] "Nucleic acid hybrid", "hybrid" or "duplex" refers to a nucleic acid structure containing double-stranded regions, hydrogen-bonded regions, wherein the regions are sufficiently stable to allow separation or purification of the duplex under appropriate conditions. Such hybrids can include RNA: RNA, RNA: DNA or DNA: DNA duplex molecules, etc.

[0085] "Isolation" or "purification" means that one or more components of a sample are removed or separated from other sample components. Sample components include target nucleic acids, which are usually in a generally aqueous solution phase, and may also include cell fragments, proteins, carbohydrates, lipids, and other nucleic acids. "Isolation" or "purification" does not mean any degree of purification. Typically, separation or purification removes at least 70%, or at least 80%, or at least 95% of the target nucleic acid from other sample components.

[0086] Unless otherwise specified, reference to "sequence of SEQ ID NO: X", particularly in the claims, refers to the base sequence of the corresponding sequence listing entry, and does not require the identity of the backbone (including but not limited to RNA, 2'-O-Me RNA, DNA or LNA). In addition, unless otherwise specified, for the purpose of sequence listing entries, T and U residues should be considered interchangeable, for example, regardless of whether the sixth residue of the subject sequence is T or U, the subject sequence is considered to be the same as the SEQ ID NO with T as the sixth nucleotide.

[0087] B. Capture Probe Populations, Methods, and Uses

[0088] Provided herein is a population of capture probes for isolating a target nucleic acid from a sample, comprising: a first region and a second region, wherein the first region is at least about 12 residues in length and comprises at least one poly(r) sequence, wherein the poly(r) sequence comprises (i) a random sequence comprising G and A nucleotides or (ii) a non-random repeating sequence (A and G); and the second region comprises a first specific binding partner (SBP), wherein the SBP is capable of specifically binding to a second specific binding partner (SBP2). "Poly(r)" is used as an abbreviation for polypurine (A and / or G). In some embodiments, the poly(r) sequence comprises (i) a random sequence comprising G and A nucleotides and (ii) a non-random repeating sequence (A and G). Also provided is the use of such a population for purifying or isolating a target nucleic acid from a mixture, and a method for purifying or isolating a target nucleic acid from a mixture using such a population.

[0089] The capture probe population can bind to the target nucleic acid without requiring a specific sequence in the target, and therefore can be used to capture various known or unknown target nucleic acids. In some embodiments, the capture probe is attached to the carrier, for example, by specific binding with a fixed probe on the carrier. In this way, the capture probe can be separated from other sample components together with the target nucleic acid. In some embodiments, the capture probe population comprises a first region including a non-random or random polymer sequence and a second region including a specific binding partner (SBP). The polymer sequence hybridizes non-specifically with the target nucleic acid, and the SBP binds to the second specific binding partner (SBP2), which can be attached to a fixed probe or carrier. Some embodiments of the capture probe include a first region, wherein the first region includes a random polymer sequence consisting of guanine (G) and adenine (A) nucleotides, which can be deoxyribonucleotides, ribonucleotides and / or 2'-O-methyl modified RNA residues (also referred to as 2'-O-Me nucleotides). Some embodiments include one or more base analogs (e.g., inosine, 5-nitroindole) or a baseless position in a random polymer sequence. Some embodiments comprise a random polymer sequence comprising one or more poly(r) base sequences, i.e., a random mixture of G and A bases (see, e.g., WIPO Handbook on Industrial Property Information and Documentation, Standard ST.25 (1998), Table 1). G bases are selected because of their "wobble" properties, i.e., G binds to C or U / T. It will be appreciated that the synthesis of capture probes using random polymer sequences provides a population of oligonucleotides containing different random polymer sequences, wherein the random polymer sequence is composed of bases included during the synthesis of the random portion. For example, a population of non-specific capture probes comprising a 15 nt random polymer sequence consisting of G and A consists of at most 2 15 A sole member.

[0090] The non-specific capture probes described herein can exist in many different embodiments. In some embodiments, the probe can be represented by the structure RP-SBP or SBP-RP, where "RP" stands for random or repetitive sequence (first region) and "SBP" stands for "specific binding partner" (second region). In these representative figures, SBP is represented in a linear manner relative to RP, but those skilled in the art will understand that SBP can be connected to the RP of the capture probe at any point. Therefore, unless otherwise stated, the first region and the second region do not necessarily have any particular spatial relationship to each other. In embodiments where RP is composed of G and A bases, the non-specific capture probe can be represented by the structure (r) shown in the figure. x -SBP or SBP-(r) x, where "r" represents the G and A bases of the RP portion, "x" represents the length of the r sequence (in nt), and "SBP" stands for "specific binding partner". Although SBP and (r) are shown in a linear fashion x sequence, but it should be understood that the SBP can be attached to the capture probe at any point. In some embodiments, the first region includes (r) x sequence, wherein x is a value in the range of 2 to 30, such as about 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30. In some embodiments, including but not limited to when x is less than about 12, the first region comprises (r) y A sequence wherein the sum of x+y is greater than or equal to approximately 12.

[0091] In some embodiments, the first region includes non-random repeat (A and G) sequences. Specifically, the non-random repeat sequence can include direct repeat or inverted repeat, or both. Therefore, examples of such repeat sequences including A and G nucleotide repeats include (AG) (GA) (AG) (GA) (AG) (GA) (SEQ ID NO: 1), (AG) (AG) (AG) (GA) (AG) (AG) (SEQ ID NO: 2), (AAG) (GAA) (GAA) (AAG) (SEQ ID NO: 3), (AAG) (AAG) (AAG) (AAG) (SEQ ID NO: 4) and the like, wherein the brackets represent composition repeats, but do not have any structural meaning. In some embodiments, the non-random repeat sequence includes one or more partial repeats, for example, (AAG) (AAG) (AAG) (AAG) (A) (SEQ ID NO: 5).

[0092] The first region may consist of a poly (r) sequence as described herein and an optional linker as described herein. Alternatively, the first region may consist of a random (A and G) sequence as described herein and an optional linker as described herein. Alternatively, the first region may consist of a non-random repeat (A and G) sequence as described herein, a poly (r) sequence as described herein, and an optional linker (e.g., a non-nucleotide linker (e.g., a C-9 linker) or a nucleotide linker (e.g., an arbitrary sequence, e.g., about 1-10 nucleotides in length)).

[0093] The SBP component of the non-specific capture probe can be any member of a specific binding pair that specifically binds to SBP2, which can be part of an immobilized probe. Some embodiments of specific binding pairs suitable for use as members of SBP and SBP2 include receptor and ligand pairs, enzyme and substrate or cofactor pairs, enzyme and coenzyme pairs, antibody (or antibody fragment) and antigen pairs, sugar and lectin pairs, biotin and avidin or streptavidin, ligand and chelator pairs, nickel and histidine, and completely or substantially complementary nucleic acid sequences. In some embodiments, the SBP and SBP2 members are substantially complementary nucleic acid sequences, such as complementary homopolymeric sequences, for example, the capture probe comprises a 3' substantially homopolymeric SBP sequence that hybridizes to a complementary immobilized SBP2 sequence attached to a support. Other embodiments use non-nucleic acid binding pairs, such as biotin that specifically binds to avidin or streptavidin as members of SBP and SBP2.

[0094] Embodiments of non-specific capture probes can be synthesized to include any of a variety of nucleic acid configurations, such as standard DNA or RNA oligonucleotides, or oligonucleotides containing one or more modified bonds, wherein the sugar moiety has one or more positions in a substitution (e.g., 2'methoxy or 2'halide) or alternative configuration (e.g., locked nucleic acid (LNA) or protein nucleic acid (PNA) configuration). Embodiments of capture probes can include non-nucleotide compounds as linkers (e.g., C-9) that connect random polymers and / or non-random repeats of capture probes. Some embodiments of non-specific capture probes include probes that synthesize random polymer portions using 2'-O-methyl modified RNA residues or probes containing one or more residues in an LNA configuration. One or more configurations included in the oligonucleotide portion of the non-specific capture probe can be selected based on the type of target nucleic acid expected or to be isolated. For example, non-specific capture probes synthesized with 2'-O-methyl modified RNA residues in the random polymer region can be used to capture RNA targets, while non-specific capture probes synthesized with certain LNA configurations in the random polymer region can be used to capture single-stranded DNA (ssDNA) targets. Some embodiments of capture probes comprise a combination of configurations (eg, LNA and DNA), which may be adjacent or connected via a linker. In some embodiments, the first region consists of 2'-O-methyl modified RNA residues.

[0095] The non-specific target capture method is relatively fast and easy to perform, requiring less than an hour to complete in some embodiments, and in some embodiments the target capture reaction requires only 5 minutes of incubation. Optional steps, such as washing the captured nucleic acid to further purify the nucleic acid (e.g., about another 20 minutes).

[0096] In some embodiments, non-specific target capture involves mixing a sample containing or suspected of containing a target nucleic acid with a non-specific capture probe as described herein in a substantially aqueous solution and under conditions that allow the capture probe to hybridize non-specifically with the target nucleic acid in the mixture. Such conditions may involve raising the temperature in a short period of time (e.g., 60°C for about 15 minutes), followed by incubation at room temperature (e.g., about 20-25°C for about 10 to 90 minutes). Alternatively, the entire incubation may be performed at room temperature and may be substantially shorter (e.g., about 5 minutes). The mixture may also include a fixed probe that specifically binds to the non-specific capture probe through a SBP-SBP2 specific binding pair. The fixed probe may be introduced into the mixture simultaneously with the capture probe or before or after the capture probe is mixed with the sample. In some embodiments, after the capture probe is incubated with the sample, the fixed probe is introduced into a mixture of the sample and the non-specific capture probe so that the capture probe and the target nucleic acid hybridize non-specifically in the solution phase before the capture probe is combined with the fixed probe. In other embodiments, the fixed probe is introduced into the mixture substantially simultaneously with the capture probe to minimize the mixing step, which is particularly useful for automated systems. In an embodiment using a capture probe having a tail sequence as an SBP, the capture probe specifically binds to a complementary sequence (SBP2) contained in the fixed probe under nucleic acid hybridization conditions to allow the target nucleic acid to non-specifically bind to the capture probe and be connected to the carrier through the fixed probe, thereby being separated from other sample components.

[0097] After incubation in which the capture object is non-specifically hybridized with the target nucleic acid and specifically bound to the fixed probe, the complex consisting of the fixed probe, the capture probe and the target nucleic acid is separated from other sample components by separating the carrier with the attached complex from the solution. Then, one or more washing steps can be optionally performed to remove non-nucleic acid sample components that may have been attached to the complex, the components of the complex or the carrier. In some embodiments, the following washing steps are performed: the complex attached to the carrier is washed with a substantially aqueous washing solution, the washing solution keeps the hybridization complex on the carrier, and then the complex attached to the carrier is separated from the washing solution containing other sample components. The captured target nucleic acid can be separated from one or more of the other complex components before the subsequent determination step is performed, or the complex attached to the carrier can be directly used in one or more subsequent steps. Subsequent steps include, for example, using a detection probe to detect the captured nucleic acid, and / or one or more sequences contained in the captured nucleic acid are amplified in vitro.

[0098] Although the length of one or more continuous random sequences contained in the non-specific capture probe can vary, a poly (r) sequence of about 12 nt or longer is sufficient to efficiently capture many targets. The presence of non-random oligonucleotides or non-nucleotide spacers between random poly (r) sequences in the non-specific capture probe may affect the target capture efficiency. A non-specific capture probe comprising at least a portion of a random poly-(r) sequence in an LNA configuration can more effectively capture ssDNA than a non-specific capture probe of similar length in a DNA configuration, and a non-specific capture probe comprising a mixture of LNA and DNA residues can be more effective than a non-specific capture probe comprising all poly (r) sequences in an LNA configuration. Compared with target capture of double-stranded DNA (dsDNA), a non-specific capture probe comprising at least a portion of a random poly (r) sequence in an LNA configuration can more effectively capture RNA and ssDNA. Compared with a capture probe of a random poly (r) sequence of the same length synthesized by using 2'-methoxy RNA bases, a non-specific capture probe comprising at least a portion of a random poly (r) sequence in an LNA configuration can more effectively capture RNA. These general parameters can be used to select appropriate embodiments of a capture probe population for capturing an intended target nucleic acid or target nucleic acid type, which can be tested using standard procedures as described in the examples below to select non-specific capture probes and conditions that provide the desired target capture results.

[0099] The fixed probe can be connected to the carrier by any bond that is stable under the hybridization conditions used in the target capture method. Some embodiments use a carrier of monodisperse particles, which can be retrieved from the mixture using known methods (e.g., centrifugation, filtration, magnetic attraction or other physical or electrochemical separation). In some embodiments, the monodisperse particles are magnetic microbeads. In some embodiments, magnetic attraction is used to retrieve the particles from the mixture. In some embodiments, the captured target nucleic acid is separated and concentrated on the carrier, that is, the target nucleic acid is concentrated on the carrier compared to the concentration of the target nucleic acid in the initial sample, which can improve the sensitivity of subsequent measurement steps using the captured nucleic acid, such as amplification measurement steps.

[0100] Multiple (e.g., two or more) target nucleic acids can be isolated from the same sample simultaneously using the target capture probe population and methods described herein, because the non-specific capture probe binds to more than one nucleic acid present in the sample. In some embodiments, non-specific capture probes can be designed and selected for preferential capture of specific types of nucleic acids (e.g., RNA) from samples containing a mixture of nucleic acids (e.g., DNA and RNA). In some embodiments, the non-specific capture probe can be selectively removed from the mixture by designing the capture probe to selectively bind to different fixed probes, which are introduced into the mixture and subsequently separated from the attachment complex containing the capture probe and the target nucleic acid. For example, a first non-specific capture probe that preferentially binds to RNA in a mixture of DNA and RNA can bind to a first fixed SBP2 on a first carrier through a first SBP, while a second non-specific capture probe that preferentially binds to DNA in a mixture of DNA and RNA can bind to a second fixed SBP2 on a second carrier through a second SBP. Then, by selectively removing the first carrier and the second carrier and their attached complexes to different areas of the assay system or at different times during the assay, the RNA component of the sample can be selectively separated from the DNA component of the same sample.

[0101] In an exemplary embodiment, a sample is prepared by mixing a target nucleic acid or a solution thereof with a basic aqueous solution (e.g., a buffer solution containing salts and chelating agents). A portion of the sample is mixed with a reagent contained in a basic aqueous solution, a non-specific target capture probe, and a fixed probe attached to a carrier (e.g., a magnetic particle) to prepare a target capture mixture. The target capture mixture is incubated at a suitable temperature to form a capture complex consisting of a non-specific capture probe, a target nucleic acid, and a fixed probe attached to a carrier. The complex on the carrier is then separated from the solution phase. The complex on the carrier is optionally washed to remove the remainder of the solution phase, and the complex on the carrier is separated from the washing solution. The target nucleic acid associated with the carrier is detected to qualitatively detect or quantitatively measure the number of target nucleic acids separated from other sample components. It will be understood that additional oligonucleotides, such as auxiliary oligonucleotides (U.S. Pat. No. 5,030,557, Hogan et al.) and / or amplification primers may be included in the target capture mixture.

[0102] In vitro methods can be used to synthesize nonspecific target capture probes (e.g., Caruthers et al., Methods in Enzymology, Vol. 154, p. 287 (1987); U.S. Pat. No. 5,252,723, Bhatt; WO92 / 07864, Klem et al.). Synthetic oligonucleotides can be prepared using standard RNA bases and bonds, DNA bases and bonds, RNA bases with 2' methoxy bonds, DNA bases in LNA configurations or oligonucleotides containing such structural combinations. Oligonucleotides can be synthesized to contain non-nucleotide spacers (e.g., C-9) or nucleic acid analogs (e.g., inosine or 5-nitroindole). In some embodiments, one or more nonspecific portions of the capture probe typically contain one position or a series of positions that are random "r" residues (i.e., G or A bases). In some embodiments, random r residues are synthesized by using a mixture containing equal amounts of G and A bases. Some embodiments of nonspecific capture probes include a 5' portion containing a first region that nonspecifically hybridizes to a target nucleic acid and, for example, a dT 0-3 dA 18-30 (SEQ ID NO:9) constitutes a 3'DNA "capture tail" sequence, such as dT3dA 30 (SEQ ID NO: 10) or dA 30 (SEQ ID NO: 11) sequence. The capture tail portion (sometimes also simply referred to as the tail) allows the capture probe (with or without a bound target nucleic acid) to associate with the support attached to the poly-dT oligomer and separate from the solution phase of the target capture mixture. It will be understood that any "tail" sequence or non-nucleic acid specific binding partner (SBP) can be attached to the non-specific capture probe, and the specific binding partner selected on the support (SBP2) is a member of a specific binding pair with the SBP.

[0103] The embodiments of non-specific capture probes described herein use the following nomenclature to abbreviate the structures of the oligonucleotide components in the 5' to 3' orientation. Oligonucleotides containing one or more random G or A base residues are termed "(r) x ”, where “r” represents a random assortment of G and A, and “x” represents the number of positions in the random assortment of G and A residues. If the oligomer uses RNA bases with a 2'-methoxy backbone, the term may also include “2'-Ome” to represent a modified bond of the random assortment of G and A bases, such as 2'-Ome-(r) x If the oligonucleotide uses standard DNA linkage, the term may include a "d" to indicate a random assortment of G and A bases, e.g. d(r) x, whereas if the oligomer uses DNA bases in a locked nucleic acid (LNA) configuration, the term includes "L" to denote the LNA configuration with a random assortment of G and A bases, e.g., L(r) x . Oligonucleotides consisting of a combination of different parts may contain one or more of these terms to define the entire structure. For example, an oligonucleotide consisting of six random G and A bases with standard DNA bonds (r bases), three T bases with standard DNA bonds, and five random G and A bases with standard DNA bonds (r bases) oriented 5' to 3' would be abbreviated as d(r)6-dT3-d(r)5 (SEQ ID NO: 12). For another example, an oligonucleotide consisting of five random G and A bases with LNA bonds, three A bases with DNA bonds, and four random G and A bases with DNA bonds oriented 5' to 3' would be abbreviated as L(r)5-dA3-d(r)4 (SEQ ID NO: 13). As another example, an oligonucleotide consisting of ten random G and A bases with 2'-methoxy bonds and a 3' tail of thirty A bases with standard DNA bonds in a 5' to 3' orientation would be abbreviated as 2'-Ome-(r) 10 -dA 30 (SEQ ID NO: 14).

[0104] In some embodiments, a combination of a capture probe population as described above and a second capture probe population is provided, wherein the second capture probe population comprises: a first region and a second region, wherein the first region is at least about 12 residues in length and comprises a poly(k) sequence, wherein the poly(k) sequence comprises (i) a random sequence comprising G and U / T nucleotides or (ii) a non-random repeating (G and U / T) sequence; and the second region comprises a third specific binding partner (SBP3), wherein the SBP3 is capable of specifically binding to a fourth specific binding partner (SBP4). Becker et al. describe an exemplary second population in US 2013 / 0209992 (August 15, 2013), which is incorporated herein by reference. The same as (r) discussed above can be used. x Nomenclature Parallel (k) xThe capture probes of the second population are described using the nomenclature. "G and U / T nucleotides" include (i) G and U nucleotides, (ii) G and T nucleotides, or (iii) G, U, and T nucleotides. Similarly, the repeats in the non-random repeat (G and U / T) sequence may include (i) G and U nucleotides, (ii) G and T nucleotides, or (iii) G, U, and T nucleotides, and sequences such as (GU) and (GT) are considered to be repeated with each other, despite the presence of U in the former and T in the latter. The second capture probe population may include RNA, DNA, LNA, and / or 2'-O-methyl modified RNA residues. SBP4 may be any of the embodiments described above for SBP2, and is not necessarily the same as SBP2.

[0105] In some embodiments, the SBP (of a population comprising poly(r) sequences) and the SBP3 of a second population are capable of binding to the same SBP2 / SBP4, i.e., the same entity can function as both SBP2 and SBP4. For example, SBP2 / SBP4 can be poly(R) sequences, and SBP and SBP3 can be independently dA 30 (SEQ ID NO: 11) or dT3dA 30 (SEQ ID NO: 10) sequence. In some embodiments, SBP and SBP3 are identical to each other.

[0106] In some embodiments, the capture probe population or combination disclosed herein is provided in a reaction mixture or kit further comprising SBP2 immobilized on a carrier. Examples of SBP2 are discussed above. The reaction mixture or components of the kit can be provided in dry form or in solution phase. In some embodiments, the solution phase includes a detergent, such as lithium dodecyl sulfate or sodium dodecyl sulfate. In some embodiments, the solution phase includes a base, such as lithium hydroxide.

[0107] The populations, combinations, reaction mixtures, and kits disclosed herein can be used to isolate target nucleic acids from various types of samples. In some embodiments, the sample is from an animal source (e.g., a human, a non-human vertebrate, a non-human mammal), an environmental source (e.g., water, plants, soil), a food source (e.g., food, food preparation area), or an industrial source (e.g., a bioreactor, a cell culture dish, a pharmaceutical vessel, a biological reagent, a pharmaceutical reagent). Exemplary animal or human sources include peripheral blood, serum, plasma, cerebrospinal fluid, sputum, or a swab specimen (e.g., nasopharyngeal, oral, wound, vaginal, or penile secretions). Therefore, in some embodiments, the reaction mixture further includes a sample (such as any of the foregoing). In some embodiments, the target nucleic acid is associated with a member of the target capture probe population in the reaction mixture. The target nucleic acid can be a viral, prokaryotic, eukaryotic, or synthetic source, or a combination thereof, and can be DNA, RNA, a modified nucleic acid, or a combination thereof.

[0108] Examples are included to describe embodiments of the disclosed nonspecific target capture methods and compositions. Exemplary reagents in the target capture procedures described below are as follows, although those skilled in the art of molecular biology will appreciate that many different reagents can be used to perform the basic steps of the reactions and assays described. Sample Reagents: 110 mM Lithium Dodecyl Sulfate (LLS), 15 mM NaH2PO4, 15 mM Na2HPO4, 1 mM EDTA, 1 mM EGTA, pH 6.7. Target Capture Reagent (TCR): 250 mM HEPES, 1.88 M LiCl, 310 mM LiOH, 100 mM EDTA, pH 6.4, and 250 μg / ml of magnetic particles (0.7-1.05 μ particles, Sera-Mag TM MG-CM) and covalently bound to it (dT) 14 Oligomers. Washing solution: 10 mM HEPES, 150 mM NaCl, 6.5 mM NaOH, 1 mM EDTA, 0.3% (v / v) ethanol, 0.02% (w / v) methylparaben, 0.01% (w / v) propylparaben, and 0.1% (w / v) sodium lauryl sulfate, pH 7.5. Hybridization reagents: 100 mM succinic acid, 2% (w / v) LLS, 100 mM LiOH, 15 mM aldrithiol-2, 1.2 M LiCI, 20 mM EDTA, and 3.0% (v / v) ethanol, pH 4.7. Selection reagents: 600 mM boric acid, 182.5 mM NaOH, 1% (v / v) octoxynol ( X-100), pH 8.5 or pH 9.2, to hydrolyze the label on the unhybridized detection probe oligomer. The detection reagents include detection reagent I: 1 mM nitric acid and 32 mM H2O2, and detection reagent II: 1.5 M NaOH, to generate chemiluminescence from the label (see U.S. Patents 5,283,174, 5,656,744 and 5,658,737).

[0109] The captured target nucleic acid can be detected by using any method for detecting nucleic acid. For example, the captured nucleic acid can be detected by using a dye that selectively binds to general nucleic acid or selectively binds to a specific form of nucleic acid. Specific nucleic acid can be detected by combining with a detection probe that specifically hybridizes with the target sequence in the captured nucleic acid, or the target sequence in the captured nucleic acid can be processed by in vitro nucleic acid amplification to amplify the part of the captured nucleic acid, and then detect the part. In certain embodiments, the target nucleic acid in the sample is labeled by hybridizing with a specific detection probe. Detection probe hybridization can occur before target capture, simultaneously with target capture, and / or after target capture. An exemplary form of the detection probe is labeled with an acridinium ester (AE) compound that produces a chemiluminescent signal (expressed as relative light units or "RLU") in a homogeneous system using well-known procedures described in detail elsewhere (U.S. Pat. No. 5,658,737, see col. 25, lines 27-46, and Nelson et al., 1996, Biochem, 35:8429-8438, 8432).

[0110] This description and exemplary embodiments should not be considered as limiting. For the purpose of this specification and the appended claims, unless otherwise stated, all numbers representing quantities, percentages or ratios and other numerical values ​​used in the specification and claims should be understood as modified by the term "about" (if not yet modified) in all cases. Therefore, unless otherwise indicated, the numerical parameters listed in the following specification and the appended claims are approximate values, which can vary according to the desired characteristics attempted to be obtained. At least, and without attempting to limit the application of the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be interpreted according to the number of reported significant figures and by applying ordinary rounding techniques.

[0111] Examples

[0112] The following examples are provided to illustrate certain disclosed embodiments and should not be construed as limiting the scope of the present disclosure in any way.

[0113] Example 1 - Using (r) 18 and (k) 18 / (r) 18 Capture probes recover short DNA fragments

[0114] This example illustrates the 18 and containing (k) 18 The use of target capture probe populations by themselves or in combination with each other to capture short DNA fragments. (k) 18 and (r) 18The capture probe includes a target hybridization sequence (random (k) 18 and (r) 18 , wherein the nucleotide residue contains a 2'-methoxyribose) and is directly linked to the target hybridization sequence ((k) 18 or (r) 18 The capture tail at the 3' end of the sequence) is formed to form a continuous nucleic acid sequence as shown below.

[0115] (r) 18 Capture probe sequence:

[0116] 5'-RRRRRRRRRRRRRRRRRTTTAAAAAAAAAAAAAAAAAAAAAAAAAAA-3'(SEQ ID NO:6)

[0117] (k) 18 Capture probe sequence:

[0118] 5'-KKKKKKKKKKKKKKKKKKTTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA-3'(SEQ ID NO:7)

[0119] The poly-A nucleotide segment is used to hybridize the capture probe with the magnetic microparticle coated with the poly-T nucleotide segment. One end of the capture probe is hybridized with the magnetic microparticle, and the other end of the capture probe is non-specifically hybridized with the target nucleic acid. By applying a magnetic field, the microparticles associated with the capture probe and the target nucleic acid are separated from the solution.

[0120] In this experiment, a 500 bp DNA fragment corresponding to a region of the adenovirus 1 hexon gene (also referred to as the adenovirus gene block) was used as a target nucleic acid to measure (k) 18 The capture probe itself, (r) 18 The capture probe itself, or (k) 18 / (r) 18 The capture probe mixture is used to capture the ability of short DNA fragments. The sequence of the adenovirus gene block is as follows:

[0121] ATGTGCCTTACCGCCAGAGAACGCGCGAAGATGGCTACCCCTTCGATGATGCCGCAGTGGTCTTACATGCACATCTCGGGCCAGGACGCCTCGGAGTACCTGAGCCCCGGGCTGGTGCAGTTCGCC CGCGCCACCGAGACGTACTTCAGCCTGAATAACAAGTTTAGAAACCCCACGGTGGCGCCTACGCACGACGTGACCACAGACCGGTCTCACGGTTTGACGCTGCGGTTTATCCCCGTGGACCGCGAG GATACCGCATACTCGTACAAGGCGCGGTTTACCCTGGCTGTGGGTGACAACCGTGTGCTTGACATGGCTTCCACATACTTTGACATTCGCGGCGTGCTGGACCGGGGCCCCACTTTTAAGCCCTACTCCGGCACTGCCTACAACGCTCTAGCCCCCAAAGGCGCTCCCAATTCCTGCGAGTGGGAACAAGAAGAACCAACTCAGGAAATGGCTGAAGAACTTGAAGATGAGGAGGAGGCAGAGGAGGA (SEQ ID NO: 8). The recovery of adenoviral gene blocks was measured by a real-time PCR assay specific for the region of the adenoviral genome.

[0122] The adenoviral gene block was introduced into a matrix comprising a pool of adenovirus-negative nasopharyngeal (NP) swab specimens at a concentration of approximately 13,888 copies per mL. These NP specimens contained physiological levels of non-adenoviral background nucleic acid. The NP specimens containing the adenoviral gene block were treated to denature double-stranded DNA. 72 μL of the NP specimens containing the adenoviral gene block (containing approximately 1000 copies of the adenoviral gene block) were incubated in a final reaction volume of 936 μL containing 100 μg of magnetic microparticles coated with poly-T and one of the following: a) 20 pmoles of (k) 18 Target capture probe; b) 20 pmol of (r) 18 target capture probe; or c) 10 pmoles of (k) 18 Target capture probe plus 10 pmol (r) 18Target capture probe. The magnetic microparticles and bound nucleic acids are separated from the solution by applying a magnetic field, thereby removing the supernatant from the captured target: capture probe: magnetic microparticle combination. The magnetic microparticles are then resuspended in a wash solution. The resuspended microparticles are subjected to another round of separation, the supernatant is removed, and they are resuspended in a wash solution. After separation and removal of the second round of wash solution, the microparticles are incubated in 50 μL of elution buffer (5 mM Tris in water with a preservative), which destroys nucleotide hybridization. The magnetic particles are separated by applying a magnetic field, and the nucleic acids containing the eluate are recovered.

[0123] The recovery of adenoviral gene blocks for each nucleic acid containing eluate was determined by real-time PCR. As a control, pure adenoviral gene blocks without target capture were determined at a copy level representing 100% recovery ("direct spike" in Table 1). The copy level of the recovered adenoviral gene blocks was inferred from the number of cycles at which the real-time PCR amplification curve exceeded a fixed threshold (CT). Table 1 lists the CT values ​​and estimates the percentage of recovery of adenoviral gene blocks using different target capture probes.

[0124] Table 1. Recovery of adenoviral gene fragments

[0125]

[0126] This experiment shows that (r) 18 Capture probes are better able to capture short sequences of DNA. Importantly, in (r) 18 Add (k) to the capture probe 18 The capture probe did not interfere with the recovery of the adenoviral gene fragments, and 10 pmoles of R18 capture probe (with 10 pmoles of (k) 18 Capture probe combination) and using 20 pmoles of (r) 18 Capture probes produce similar results. 18 Target capture probe and (k) 18 The target capture probes are compatible when they are mixed together in a capture reaction.

[0127] Example 2 - Using (k) 18 / (r) 18 Capture probes for recovery of adenoviral nucleic acid from clinical specimens

[0128] This example demonstrates that, compared to using only (k) 18 Compared with the target capture probe, using (k) 18 Target capture probe and (r) 18 Combination of target capture probes (k) 18 / (r) 18The efficiency of recovering adenovirus nucleic acid from clinical specimens was improved by using a mixture of (r) and (r) swabs. The clinical samples used in this study were nasopharyngeal (NP) swab specimens. 18 and (k) 18 The capture probes are as described in Example 1 above.

[0129] In this experiment, (k) 18 / (r) 18 Mixture or only (k) 18 49 clinical NP specimens known to be adenovirus positive by comparative assay were processed. Briefly, NP specimens were processed to denature double-stranded DNA. NP specimens were incubated in a final reaction volume of 936 μL containing 100 μg of poly-T coated magnetic microparticles and one of the following: a) 20 pmoles of (k) 18 Target capture probe or b) 10 pmol (k) 18 Target capture probe plus 10 pmol (r) 18 Target capture probe. The magnetic microparticles and bound nucleic acids are separated from the solution by applying a magnetic field, thereby removing the supernatant from the captured target: capture probe: magnetic microparticle combination. The magnetic microparticles are then resuspended in a wash solution. The resuspended microparticles are subjected to another round of separation, the supernatant is removed, and they are resuspended in a wash solution. After separation and removal of the second round of wash solution, the microparticles are incubated in 50 μL of elution buffer, which destroys nucleotide hybridization. The magnetic particles are separated by applying a magnetic field, and the nucleic acids containing the eluate are recovered.

[0130] The recovery of adenoviral nucleic acid from each nucleic acid containing eluate was determined by real-time PCR. By comparing the number of cycles at which the real-time PCR curves exceeded a fixed threshold (CT), the relative difference in adenoviral nucleic acid recovery between the two tested conditions can be inferred. The delta CT (ΔCT) is (k) 18 / (r) 18 Mixture extracted CT minus only (k) 18 Extracted CT. Negative ΔCT indicates (k) 18 / (r) 18 The mixture recovered more adenoviral nucleic acid and the positive ΔCT indicated that only (k) 18 More adenoviral nucleic acid was recovered. Figure 1 ΔCT of all 49 clinical specimens was plotted.

[0131] The data show that (k) 18 / (r) 18 The mixture recovered more adenoviral nucleic acid in 39 of the 49 samples. In these samples, the average ΔCT was -0.64, which indicates that the use of (k) 18 / (r)18 The recovery of adenovirus nucleic acid from the mixture increased by 56%. Across all 49 specimens, the average ΔCT was -0.46, which indicates that the use of (k) 18 / (r) 18 The recovery of adenoviral DNA from the mixture was increased by 38%. Sequence Listing <110> GEN-PROBE INCORPORATED <120> Compositions and methods for isolating target nucleic acids <130> 01159-0016-00PCT <150> US 62 / 504,900 <151> 2017-05-11 <160> 14 <170> PatentIn Version 3.5 <210> 1 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Exemplary non-random repeat sequences <400> 1 aggaaggaag ga 12 <210> 2 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Exemplary non-random repeat sequences <400> 2 agagaggaag ag 12 <210> 3 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Exemplary non-random repeat sequences <400> 3 aaggaagaaa ag 12 <210> 4 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Exemplary non-random repeat sequences <400> 4 aagaagaaga ag 12 <210> 5 <211> 13 <212> DNA <213> Artificial sequence <220> <223> Exemplary non-random repeat sequences <400> 5 aagaagaaga aga 13 <210> 6 <211> 51 <212> DNA <213> Artificial sequence <220> <223> (r)18 capture probe sequence <400> 6 rrrrrrrrrr rrrrrrrtt taaaaaaaaa aaaaaaaaaa aaaaaaaaaa a 51 <210> 7 <211> 51 <212> DNA <213> Artificial sequence <220> <223> (k) 18 Capture probe sequence <400> 7 kkkkkkkkkk kkkkkkkktt taaaaaaaaa aaaaaaaaaa aaaaaaaaaa a 51 <210> 8 <211> 500 <212> DNA <213> Artificial sequence <220> <223> 500 bp DNA fragment of adenovirus 1 hexon <400> 8 atgtgcctta ccgccagaga acgcgcgaag atggctaccc cttcgatgat gccgcagtgg 60 tcttacatgc acatctcggg ccaggacgcc tcggagtacc tgagccccgg gctggtgcag 120 ttcgcccgcg ccaccgagac gtacttcagc ctgaataaca agtttagaaa ccccacggtg 180 gcgcctacgc acgacgtgac cacagaccgg tctcagcgtt tgacgctgcg gtttatcccc 240 gtggaccgcg aggataccgc atactcgtac aaggcgcggt ttaccctggc tgtgggtgac 300 aaccgtgtgc ttgacatggc ttccacatac tttgacattc gcggcgtgct ggaccggggc 360 cccactttta agccctactc cggcactgcc tacaacgctc tagcccccaa aggcgctccc 420 aattcctgcg agtgggaaca agaagaacca actcaggaaa tggctgaaga acttgaagat 480 gaggaggagg cagaggagga 500 <210> 9 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Nonspecific capture probe <220> <221> misc_feature <222> (1)..(3) <223> t is present or absent at every position <220> <221> misc_feature <222> (19)..(30) <223> a is present or absent at each position <400> 9 tttaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa 33 <210> 10 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Nonspecific capture probe <400> 10 tttaaaaaaa aaaaaaaaaa aaaaaaaaaa aaa 33 <210> 11 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Nonspecific capture probe <400> 11 aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 30 <210> 12 <211> 14 <212> DNA <213> Artificial sequence <220> <223> Exemplary Oligonucleotides <400> 12 rrrrrrtttr rrrr 14 <210> 13 <211> 12 <212> DNA <213> Artificial sequence <220> <223> Exemplary Oligonucleotides <220> <221> misc_feature <222> (1)..(5) <223> Locked Nucleic Acid (LNA) Configuration <400> 13 rrrrraaarr rr 12 <210> 14 <211> 40 <212> DNA <213> Artificial sequence <220> <223> Exemplary Oligonucleotides <220> <221> misc_feature <222> (1)..(10) <223> 2'-Methoxy bond <400> 14 rrrrrrrrrr aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa 40

Claims

1. A capture probe population for isolating a target nucleic acid from a sample, wherein the target nucleic acid is DNA, the capture probe comprising: A first region and a second region, wherein the first region is at least 18 residues in length and includes at least one poly(r) sequence, wherein the poly(r) sequence consists of a random sequence of 18 G and A nucleotides; the second region includes a first specific binding partner (SBP), wherein the SBP is capable of specifically binding to a second specific binding partner (SBP2), and the SBP comprises a homopolymeric nucleic acid sequence, and wherein the random sequence is different between members of the capture probe population.

2. The capture probe population of claim 1, wherein the first region consists of random G and A nucleotides.

3. The capture probe population of claim 1 or 2, wherein the first region comprises 2'-O-methyl modified RNA residues.

4. The capture probe population of claim 1 or 2, wherein the SBP is a non-nucleic acid moiety.

5. The capture probe population according to claim 1 or 2, wherein the SBP comprises dT3dA 30 (SEQ ID NO: 10) or dA 30 (SEQ ID NO: 11) sequence.

6. The capture probe population of claim 1 or 2, wherein the SBP is located at the 3' position of the first region.

7. A combination of a capture probe population as described in any one of the preceding claims and a second capture probe population, wherein the second capture probe population comprises a first region and a second region, wherein the first region is at least 12 residues in length and comprises a poly(k) sequence, wherein the poly(k) sequence consists of (i) a random sequence of G and U / T nucleotides or (ii) a non-random repeated G and U / T sequence; and the second region comprises a third specific binding partner (SBP3), wherein the SBP3 is capable of specifically binding to a fourth specific binding partner (SBP4).

8. The combination according to claim 7, wherein said SBP and said SBP3 are capable of binding to the same SBP2 / SBP4.

9. The combination according to claim 8, wherein said SBP and said SBP3 are identical to each other.

10. The combination according to any one of claims 7 to 9, wherein the first region of the second population is at least 18 nucleotides in length.

11. The combination according to any one of claims 7 to 9, wherein the first region of the second population comprises poly(k) 18 、Poly(k) 24 or poly(k) 25 sequence.

12. The combination according to any one of claims 7 to 9, wherein the first region of the second population consists of random G and U / T nucleotides.

13. A kit or reaction mixture for isolating a target nucleic acid from a sample, the kit or reaction mixture comprising: a. A capture probe population according to any one of claims 1 to 6 or a combination according to any one of claims 7 to 12; as well as b. SBP2 immobilized on a carrier.

14. The kit or reaction mixture according to claim 13, wherein the SBP and SBP2 are complementary nucleic acid sequences.

15. The kit or reaction mixture of claim 13, wherein said SBP and said SBP2 are non-nucleic acid moieties.

16. The kit or reaction mixture according to any one of claims 13 to 15, further comprising a detergent.

17. The kit or reaction mixture according to any one of claims 13 to 15, further comprising lithium dodecyl sulfate and / or lithium hydroxide, or sodium dodecyl sulfate and / or lithium hydroxide.

18. A kit or reaction mixture according to any one of claims 13 to 15, comprising a combination of capture probes according to any one of claims 7 to 12.

19. The kit or reaction mixture of claim 18, wherein said SBP and said SBP3 are capable of binding to said SBP2.

20. The kit or reaction mixture according to claim 18, further comprising SBP4 immobilized on a carrier.

21. The kit or reaction mixture of any one of claims 13 to 15, further comprising a solution phase.

22. The reaction mixture of claim 21, wherein the reaction mixture comprises target nucleic acid in the solution phase and / or associated with the capture probe.

23. The reaction mixture of claim 22, wherein the target nucleic acid originates from cells that have been treated to release intracellular components into the solution phase.

24. The reaction mixture of claim 21, wherein the solution phase comprises a sample from an animal, environmental, food, or industrial source.

25. The reaction mixture of claim 21, wherein the solution phase comprises a sample comprising peripheral blood, serum, plasma, cerebrospinal fluid, sputum, or a swab specimen.

26. A method for isolating a target nucleic acid from a sample, wherein the target nucleic acid is DNA, the method comprising: a. contacting a capture probe population according to any one of claims 1 to 6 or a combination according to any one of claims 7 to 12 with a solution containing nucleic acid to form a reaction mixture, wherein the reaction mixture further comprises a carrier comprising the SBP2; b. incubating the reaction mixture under conditions that allow the first region to hybridize with the target nucleic acid and allow the SBP to associate with the SBP2 immobilized on the carrier, thereby forming a hybridization complex in contact with the solution; and c. Separating the carrier from the solution phase, thereby separating the target nucleic acid from other components in the sample.

27. A method for isolating a target nucleic acid from a sample, wherein the target nucleic acid is DNA, the method comprising: a. incubating the reaction mixture according to any one of claims 13 to 25 with the sample under conditions allowing the first region to hybridize with the target nucleic acid and allowing the SBP to associate with the SBP2 immobilized on the carrier, thereby forming a hybridization complex in contact with the solution; as well as b. Separating the carrier from the solution phase, thereby separating the target nucleic acid from other components in the sample.

28. The method of claim 26 or 27, wherein the sample contains cells and is treated prior to the contacting step in a to release intracellular components into the solution.

29. The method of claim 28, wherein the treating comprises treating the sample with a solution containing a detergent.

30. The method of claim 26 or 27, wherein the sample is from an animal, environmental, food or industrial source.

31. The method of claim 26 or 27, wherein the sample comprises peripheral blood, serum, plasma, cerebrospinal fluid, sputum or a swab specimen.

32. The method of claim 26 or 27, wherein the sample comprises a cell lysate.

33. The method of claim 26 or 27, wherein the SBP and the SBP2 are non-nucleic acid moieties.

34. The method of claim 26 or 27, wherein the SBP and SBP2 are complementary nucleic acid sequences.

35. The method of claim 26, wherein the combination as described in any one of claims 13 to 18 is contacted with the solution containing nucleic acids.

36. The method of claim 35, wherein said SBP and said SBP3 are capable of binding to said SBP2.

37. The method of claim 35, wherein the reaction mixture further comprises a vector comprising SBP4.

38. A population according to claim 1 or 2, a combination according to any one of claims 7 to 9, a reaction mixture according to any one of claims 13 to 15, or a method according to claim 26 or 27, wherein the target nucleic acid comprises viral nucleic acid.

39. The population of claim 1 or 2, the combination of any one of claims 7 to 9, the reaction mixture of any one of claims 13 to 15, or the method of claim 26 or 27, wherein the target nucleic acid comprises a prokaryotic nucleic acid.

40. The population of claim 1 or 2, the combination of any one of claims 7 to 9, the reaction mixture of any one of claims 13 to 15, or the method of claim 26 or 27, wherein the target nucleic acid comprises a eukaryotic nucleic acid.

41. The population of claim 1 or 2, the combination of any one of claims 7 to 9, the reaction mixture of any one of claims 13 to 15, or the method of claim 26 or 27, wherein the target nucleic acid comprises a synthetic nucleic acid.

Images