A method for the preparation of laminaribiose from starch

Abstract

The application discloses a method for constructing an in-vitro multi-enzyme molecular machine to prepare laminaribiose through multi-enzyme cascade catalysis, and belongs to the field of enzyme catalytic preparation of laminaribiose. The method for preparing laminaribiose disclosed by the application comprises converting glucose units in starch into glucose-1-phosphate and glucose through starch phosphorylase and glucosidase respectively, and then synthesizing laminaribiose from glucose-1-phosphate and glucose through laminaribiose phosphorylase. In the process, the utilization rate of starch and the final concentration of laminaribiose can be further improved by adding other auxiliary enzymes, such as isoamylase, to promote complete phosphorolysis of starch. The technical method has the advantages of cheap and easy-to-obtain substrate, low production cost, high product yield, simple separation and purification, and the like, and can realize the large-scale production of laminaribiose.

Description

Technical Field

[0001] This invention belongs to the field of biomanufacturing, specifically relating to a method for preparing laminarin from starch using an enzymatic process. Background Technology

[0002] Laminobio is an oligosaccharide linked by β-1,3 glycosidic bonds. It is mainly used in agriculture to promote seed germination and as a natural preservative.

[0003] Currently, the production of laminarin mainly relies on the traditional method of hydrolyzing pine needles or kelp polysaccharides using dilute acid. This process suffers from low yield and high extraction costs, resulting in a persistently high price for laminarin. Laminarin can also be prepared chemically, using halogenated glycosyl groups as glycosyl donors and obtaining laminarin through O-glycosylation derived from the Koenigs-Knorr method. However, the final product is difficult to purify, resulting in a yield of less than 10%.

[0004] With the development of industrial enzyme biotechnology, some scientists have begun to try enzymatic synthesis of laminarin. Japanese scientists used three enzymes (sucrase phosphorylase, glucose isomerase, and laminarin phosphorylase) to produce laminarin from sucrose as a substrate. However, the yield of laminarin was only about 50%, which led to high costs for subsequent product separation.

[0005] Therefore, there is an urgent need to develop a low-cost, low-pollution, and high-yield method for preparing laminarinase. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a method for preparing laminarin, which uses starch as a substrate and produces laminarin through an in vitro multi-enzyme catalytic reaction. This method has the advantages of high yield, low production cost and environmental friendliness.

[0007] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0008] This invention provides a method for preparing laminarin using an enzyme-catalyzed reaction. The method is characterized by using starch as a substrate and adding starch phosphorylase (α-glucan phosphorylase, EC 2.4.1.1, αGP), glucosidase (α-glucosidase, EC 3.2.1.20, AG), and laminarinbiose phosphorylase (EC 2.4.1.31, LBP) to carry out a multi-enzyme catalytic reaction. In this invention, starch is used as the substrate, and starch is converted into glucose-1-phosphate and glucose by starch phosphorylase and glucosidase, respectively. Glucose-1-phosphate and glucose are then catalyzed by laminarinbiose phosphorylase to generate laminarin.

[0009] Preferably, the starch is any one or a mixture in any proportion of soluble starch, soluble amylose, soluble amylopectin, starch dextrin, maltodextrin, maltose polysaccharide, and maltose.

[0010] Preferably, the concentration of starch in the multi-enzyme catalytic reaction is 1-200 g / L, more preferably 5-50 g / L, even more preferably 8-20 g / L, and most preferably 10 g / L.

[0011] Preferably, the reaction temperature of the multi-enzyme catalytic reaction is 10-95℃, more preferably 20-80℃, even more preferably 30-60℃, and most preferably 50℃.

[0012] Preferably, the reaction time of the multi-enzyme catalytic reaction is 0.5-150 hours, more preferably 1-60 hours, more preferably 6-48 hours, and most preferably 12 hours.

[0013] Preferably, buffer solution, phosphate, and metal ions are also added to the multi-enzyme catalytic reaction.

[0014] Those skilled in the art will understand that various buffer solutions can be used in this invention, such as HEPES buffer, Tris-HCl buffer, MOPS buffer, citrate buffer (e.g., sodium citrate buffer), etc. Preferably, the buffer solution is HEPES buffer. Preferably, the pH of the buffer solution is 5.0-8.0, more preferably 6.0-7.5, and most preferably 6.5. Preferably, the concentration of the buffer solution in the reaction system is 10-500 mM, further preferably 20-150 mM, more preferably 50-120 mM, and most preferably 100 mM.

[0015] Those skilled in the art will understand that various phosphates can be used in this invention, such as potassium phosphate, sodium phosphate, etc. Preferably, the phosphate is potassium phosphate. Preferably, the concentration of phosphate in the reaction system is 1-50 mM, more preferably 2-30 mM, more preferably 5-15 mM, and most preferably 20 mM.

[0016] Those skilled in the art will understand that various metal ions can be used in this invention, such as zinc ions, magnesium ions, manganese ions, etc. Preferably, the metal ion is zinc ion. Preferably, the concentration of zinc ions in the reaction system is 1-20 mM, more preferably 2-15 mM, more preferably 3-10 mM, and most preferably 5 mM.

[0017] In a preferred embodiment, starch treated with isoamylase (EC 3.2.1.68, IA) is used as a substrate, and starch phosphorylase (α-glucan phosphorylase, EC 2.4.1.1, αGP), glucosidase (α-glucosidase, EC 3.2.1.20, AG) and laminaribose phosphorylase (EC 2.4.1.31, LBP) are added to carry out a multi-enzyme catalytic reaction.

[0018] Preferably, the isoamylase treatment conditions are a reaction at 10-99°C for 0.5-72 hours, more preferably a reaction at 30-95°C for 1-48 hours, more preferably a reaction at 50-90°C for 1-12 hours, and most preferably a reaction at 85°C for 3 hours.

[0019] Preferably, when treating starch with isoamylase, the starch concentration is 1-500 g / L, more preferably 10-300 g / L, even more preferably 50-250 g / L, and most preferably 200 g / L; the amount of isoamylase used is 0.1-20 U / mL, more preferably 0.5-10 U / mL, even more preferably 1-8 U / mL, and most preferably 5 U / mL.

[0020] Preferably, the isoamylase treats starch in a system containing buffer solution and metal ions.

[0021] Those skilled in the art will understand that various buffer solutions can be used in this invention, such as sodium acetate buffer, HEPES buffer, citrate buffer (e.g., sodium citrate buffer), etc. Preferably, the buffer solution is sodium acetate buffer. Preferably, the pH of the buffer solution is 4.0-8.0, more preferably 4.5-6.5, and most preferably 5.5. Preferably, the concentration of the buffer solution in the reaction system is 1-50 mM, further preferably 2-20 mM, more preferably 3-10 mM, and most preferably 5 mM.

[0022] Those skilled in the art will understand that various metal ions can be used in this invention, such as zinc ions, magnesium ions, manganese ions, etc., preferably zinc ions. Preferably, the concentration of zinc ions in the reaction system is 0.01-10 mM, more preferably 0.1-5 mM, more preferably 0.2-1 mM, and most preferably 0.5 mM.

[0023] In this invention, the starch phosphorylase, glucosidase and laminarin phosphorylase added to the multi-enzyme catalytic reaction can be in any proportion.

[0024] Preferably, the ratio of added starch phosphorylase, glucosidase and laminarin phosphorylase is 1-3:1:1-3.

[0025] More preferably, the ratio of added starch phosphorylase, glucosidase and laminarin phosphorylase is 2:1:3.

[0026] Preferably, the amount of starch phosphorylase used in the multi-enzyme catalytic reaction is 0.1-50 U / mL, more preferably 0.5-10 U / mL, more preferably 1-5 U / mL, and most preferably 2 U / mL.

[0027] Preferably, the amount of glucosidase used in the multi-enzyme catalytic reaction is 0.1-50 U / mL, more preferably 0.5-10 U / mL, more preferably 1-5 U / mL, and most preferably 1 U / mL.

[0028] Preferably, the amount of laminarin phosphorylase used in the multi-enzyme catalytic reaction is 0.1-50 U / mL, more preferably 0.5-10 U / mL, even more preferably 1-5 U / mL, and most preferably 3 U / mL.

[0029] In this invention, various sources of starch phosphorylase, laminarin phosphorylase, isoamylase, and glucosidase can be used. For example, starch phosphorylase can be derived from *Thermotoga maritima*, *Clostridium thermocellum*, *Thermus thermophilus*, etc., preferably from *Thermotoga maritima*; laminarin phosphorylase can be derived from *Paenibacillus* sp., *Euglena Gracilis*, *Acholeplasma laidlawii*, etc., preferably from *Paenibacillus* sp.; isoamylase can be derived from *Sulfolobustokodaii*, *Arabidopsis thaliana*, *Flavobacterium* sp., etc., preferably from *Sulfolobustokodaii*; glucosidase can be derived from *Aspergillus niger*, *Betavulgaris*, *Paecilomyces lilacinus*. The enzymes used in this invention include, preferably, *Paecilomyces lilacinus*, and the glucosidase is derived from *Paecilomyces lilacinus*. The invention can also utilize amylases, laminarinases, isoamylases, and glucosidases whose amino acid sequences have at least 60%, preferably at least 80%, more preferably at least 90%, and most preferably at least 95% identity with the enzymes from the aforementioned sources.

[0030] This invention uses starch as a substrate and adds starch phosphorylase, glucosidase and laminarin phosphorylase to prepare a three-enzyme reaction system. The enzyme catalytic pathway includes: starch phosphorylase and glucosidase converting glucose units in starch into glucose-1-phosphate and glucose, respectively; and laminarin phosphorylase converting glucose and glucose-1-phosphate into laminarin.

[0031] Starch is a mixture of amylose and amylopectin of different chain lengths. Amylose glucose units are linked by α-1,4 glycosidic bonds, while amylopectin is linked to the starch backbone by α-1,6 glycosidic bonds. Since starch phosphorylase cannot break down α-1,6 glycosidic bonds, isoamylase, a debranching enzyme capable of breaking down α-1,6 glycosidic bonds in starch, is added to the reaction system to improve starch utilization.

[0032] Since inorganic phosphorus is cyclical during the reaction, only a small amount of phosphate buffer needs to be added to start the reaction and keep it running. Therefore, the use of phosphate in actual production does not cause environmental stress.

[0033] Compared with the prior art, the technical solution of the present invention has the following advantages:

[0034] This invention utilizes starch as a raw material in a multi-enzyme catalytic reaction, converting it into laminarin via in vitro multi-enzyme catalysis. Through process optimization and the addition of enzymes that promote starch hydrolysis, the conversion efficiency is significantly improved, resulting in a high yield and a substantial reduction in the separation cost of laminarin. This method is simple, has high raw material utilization, high laminarin yield, low separation cost, and is environmentally friendly, enabling large-scale production of laminarin. Attached Figure Description

[0035] Figure 1 This is a schematic diagram of the in vitro multi-enzyme catalytic pathway for the conversion of starch into lamina bisaccharide; where: IA is isoamylase, αGP is starch phosphorylase, AG is glucosidase, and LBP is lamina bisaccharide phosphorylase.

[0036] Figure 2 Four key enzymes were detected by SDS-PAGE; M was the marker, IA and αGP were purified by heat treatment, and AG and LBP were purified by Ni-NTA column.

[0037] Figure 3 shows the in vitro synthesis of laminabiose from 10 g / L starch under initial conditions catalyzed by multiple enzymes. Figure 3A The reaction process curves for the in vitro multi-enzyme catalytic synthesis of laminarin from starch under initial conditions are shown. Figure 3B The results are obtained by high-performance liquid chromatography analysis of the in vitro multi-enzyme catalytic synthesis of laminarin from starch under initial conditions.

[0038] Figure 4 The results represent the in vitro synthesis of laminarin from starch treated with 10 g / L IA under initial conditions using multiple enzymes.

[0039] Figure 5 The reaction process curve for the synthesis of laminabiose from starch treated with 10 g / L IA under optimal conditions is shown in vitro under multi-enzyme catalysis.

[0040] Figure 6 The reaction process curves for the synthesis of laminarin from starch treated with high concentrations of IA under optimal conditions are shown in vitro under multi-enzyme catalysis. Detailed Implementation

[0041] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, it should be understood that the embodiments described are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but such modifications or substitutions all fall within the protection scope of the present invention.

[0042] The following materials are used in the embodiments of the present invention.

[0043] Soluble starch, ACROS product, product number: 424490020;

[0044] pET20b vector, Novagen, Madison, WI;

[0045] Escherichia coli expression strain BL21(DE3), Invitrogen, Carlsbad, CA;

[0046] All enzymes in this invention are available from Sigma-Aldrich and can be obtained by prokaryotic expression using genetic engineering methods.

[0047] Example 1: In vitro multi-enzyme catalysis of starch to laminarin

[0048] The catalytic pathway for converting starch to laminarin via an in vitro multi-enzyme catalytic system is described in [link to relevant documentation]. Figure 1 The key enzymes and steps involved include: (1) starch phosphorylase (αGP, EC 2.4.1.1), which is used to release glucose-1-phosphate from starch; (2) glucosidase (AG, EC 3.2.1.20), which is used to release glucose from starch; and (3) laminarin phosphorylase (LBP, EC 2.4.1.31), which is used to catalyze the reaction of glucose-1-phosphate and glucose to produce laminarin.

[0049] In this embodiment, the amylase was derived from *Thermotoga maritima*, with its gene number TM1168 on KEGG; the glucosidase was derived from *Paecilomyces lilacinus*, with its gene number QAQ81244 on KEGG; and the laminarinase was derived from *Paenibacillus* sp., with its gene number BAJ10826 on KEGG. All of these genomic DNA samples were available from the ATCC website (www.atcc.org). These two genes were obtained from the corresponding genomic DNA by PCR using F1 / R1, F2 / R2, and F3 / R3, respectively. F1: GTTTAACTTTAAGAAGGAGATATAGTGCTGGAGAAACTTCCCGA G; R1: GTGGTGGTGGTGGTGCTCGAGTCAGAGAACCTTCTTCCAGAC; F2: C ATCATCATCATCATCACAGCAGCGGCTTGAAAAAAACATGGTGGAAAGAAG; R2: GTGGTGGTGGTGGTGGTGCTCGAGTTCTTTCCAGATGTAT ACGCG CGCC; F3: GTTTAACTTTAAGAAGGAGATATACCATGGGTCAGAAAGGCTG GAAATTTC; R3: CAGTGGTGGTGGTGGTGGTGGTGCTCGAGACTAATATTACG GCCCAGGGTCAC. The results were obtained using Simple Cloning (You C, Zhang XZ, Zhang Y-HP. 2012. Simple Cloning). The plasmids were cloned into the pET20b vector (Novagen, Madison, WI) via the method of direct transformation of PCR product (DNA Multimer) to Escherichia coli and Bacillus subtilis. Appl. Environ. Microbiol. 78(5):1593-5., obtaining the corresponding expression vectors pET20b-TmαGP, pET20b-PlAG, and pET20b-PsLBP. Then, these two plasmids were transformed into E. coli expression strain BL21(DE3) (Invitrogen, Carlsbad, CA) for protein expression and purification. The results of protein purification are as follows: Figure 2 As shown.

[0050] The reaction system then contained 100 mM HEPES buffer (pH 6.5), 5 mM divalent zinc ions, 20 mM potassium phosphate (pH 6.5), 1 U / mL starch phosphorylase, 1 U / mL glucosidase, 2 U / mL laminarin phosphorylase, and 10 g / L starch. The reaction was carried out at 50 °C for 12 hours.

[0051] The concentration of laminarin was determined by high-performance liquid chromatography (HPLC). 94.5 μL of the reaction sample was taken, and 5.5 μL of 10% sulfuric acid was added to terminate the reaction. The supernatant was collected by centrifugation, and the concentration of laminarin was calculated by determining the peak area and peak height using HPLC.

[0052] Liquid phase results as follows Figure 3B As shown, the response intensity of laminarin gradually increases. The final concentration of laminarin (calculated using the slope of the standard curve) is... Figure 3A The concentration is 12.1 mM, and the conversion rate relative to starch (10 g / L, approximately 55.5 mM glucose equivalent, 2 glucose equivalents to synthesize 1 molecule of laminabiose) is 43.6%.

[0053] Example 2: Increasing the yield of laminarin by adding an enzyme that promotes starch hydrolysis.

[0054] Starch phosphorylase cannot completely hydrolyze starch, such as Figure 1 As shown, isoamylase can assist in the hydrolysis of starch. That is, adding isoamylase (IA, EC 3.2.1.68), which can help hydrolyze starch, to the reaction system can increase the yield of laminarin.

[0055] In this embodiment, the isoamylase was derived from *Sulfolobus tokodaii*, whose gene is designated ST0928 on KEGG. The genomic DNA of this strain was purchased from the German Culture Collection (DSMZ). This gene was obtained from the corresponding genomic DNA via PCR using primers F4 / R4, where F3: GTTTAACTTTAAGAAGGAGATATAATGGTTTTTTCACACAAGGATAGACC, and R: GTGGTGGTGGTGGTGGTGCTCGAGCTAATATTCAATCCTCCTATATACC. The gene was then cloned into the pET20b vector using the Simple Cloning method to obtain the corresponding expression vector pET20b-StIA. This plasmid was then transformed into *E. coli* expression strain BL21(DE3) for protein expression and purification. The protein purification results are shown below. Figure 2 As shown.

[0056] The preparation of starch phosphorylase, glucosidase and laminarin phosphorylase is the same as in Example 1.

[0057] The reaction system contained 5 mM sodium acetate buffer (pH 5.5), 0.5 mM divalent zinc ions, 5 U / mL isoamylase, and 200 g / L starch. The catalytic reaction was carried out at 85 °C for 3 hours.

[0058] The reaction system then contained 100 mM HEPES buffer (pH 6.5), 5 mM divalent zinc ions, 20 mM potassium phosphate (pH 6.5), 1 U / mL starch phosphorylase, 1 U / mL glucosidase, 2 U / mL laminarin phosphorylase, and 10 g / L IA-treated starch. The reaction was carried out at 50 °C for 12 hours.

[0059] Based on the slope of the standard curve, the final concentration of laminarin after the reaction is completed (…). Figure 4 The concentration of 18 mM was 18 mM, and the conversion rate of starch (10 g / L, approximately 55.5 mM glucose equivalent, 2 glucose equivalents to synthesize 1 molecule of laminarin) was 64.8%, which is a certain improvement compared to the conversion rate of starch without IA treatment.

[0060] Example 3 further improved the yield of laminarin by optimizing the reaction system.

[0061] The preparation of isoamylase, starch phosphorylase, glucosidase and laminarin phosphorylase is the same as in Example 1.

[0062] The reaction system contained 5 mM sodium acetate buffer (pH 5.5), 0.5 mM divalent zinc ions, 5 U / mL isoamylase, and 200 g / L starch. The catalytic reaction was carried out at 85 °C for 3 hours.

[0063] After gradual optimization, the optimal potassium phosphate concentration was determined to be 20 mM, and the optimal enzyme dosage was 2 U / mL starch phosphorylase, 1 U / mL glucosidase, and 3 U / mL laminarin phosphorylase. The reaction system then contained 100 mM HEPES buffer (pH 6.5), 5 mM divalent zinc ions, 20 mM potassium phosphate (pH 6.5), 2 U / mL starch phosphorylase, 1 U / mL glucosidase, 3 U / mL laminarin phosphorylase, and 10 g / L IA-treated starch. The catalytic reaction was carried out at 50°C for 12 hours. The detection of laminarin was the same as in Example 1.

[0064] After testing, the final concentration of laminarin was determined. Figure 5 The concentration of glucose was 22 mM, and the conversion rate of starch (10 g / L, approximately 55.5 mM glucose equivalent) was 79%. Compared with the initial conditions, the conversion rate was significantly improved and the glucose concentration was significantly reduced.

[0065] Example 4: Formation of laminarin when starch concentration is increased

[0066] The preparation of isoamylase, starch phosphorylase, glucosidase and laminarin phosphorylase is the same as in Example 1.

[0067] The reaction system contained 5 mM sodium acetate buffer (pH 5.5), 0.5 mM divalent zinc ions, 5 U / mL isoamylase, and 200 g / L starch. The catalytic reaction was carried out at 85 °C for 3 hours.

[0068] The reaction system then contained 100 mM HEPES buffer (pH 6.5), 5 mM divalent zinc ions, 20 mM potassium phosphate (pH 6.5), 10 U / mL starch phosphorylase, 5 U / mL glucosidase, 15 U / mL laminarin phosphorylase, and 50 g / LIA-treated starch. The reaction was carried out at 50°C for 24 hours. The detection of laminarin was the same as in Example 1.

[0069] After the reaction is complete, the final concentration of laminarin ( Figure 6 The concentration was 101 mM (34.5 g / L), which did not significantly decrease the conversion rate compared to 10 g / L starch.

[0070] The reaction system then contained 100 mM HEPES buffer (pH 6.5), 5 mM divalent zinc ions, 10 mM potassium phosphate (pH 6.5), 10 U / mL starch phosphorylase, 5 U / mL glucosidase, 15 U / mL laminarin phosphorylase, and 100 g / LIA-treated starch. The reaction was carried out at 50°C for 24 hours. The detection of laminarin was the same as in Example 1.

[0071] After testing, the final concentration of laminarin was determined. Figure 6 The concentration was 202 mM (69 g / L), and compared to 10 g / L starch, the conversion rate did not decrease significantly.

[0072] The embodiments of the present invention have been described above. However, the present invention is not limited to the above embodiments. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for preparing laminarin using an enzyme-catalyzed reaction, characterized in that, The reaction system contains starch as the sole substrate, starch phosphorylase, glucosidase, laminarin phosphorylase, and a buffer. The starch phosphorylase is derived from *Thermophyton floccosum*, with the gene ID TM1168 on KEGG; the glucosidase is derived from *Paecilomyces lilacinus*, with the gene ID QAQ81244 on KEGG; and the laminarin phosphorylase is derived from *Bacillus subtilis*, with the gene ID BAJ1 on KEGG. 0826; The concentration of starch in the reaction system is 8-200 g / L, the amount of starch phosphorylase in the reaction system is 1-5 U / mL, the amount of glucosidase in the reaction system is 1-5 U / mL, and the amount of laminarin phosphorylase in the reaction system is 1-5 U / mL; the temperature of the enzyme-catalyzed reaction is 30-60℃, the time of the enzyme-catalyzed reaction is 6-48 hours, the pH of the buffer solution is 6.0-7.5, and the ratio of starch phosphorylase, glucosidase and laminarin phosphorylase added in the enzyme-catalyzed reaction is 2:1:3; the starch in the reaction system is first treated with isoamylase, which is derived from Sulfolobustokodaii, whose gene is numbered ST0928 on KEGG.

2. The method according to claim 1, characterized in that, The concentration of starch in the reaction system is 10 g / L or 100 g / L.

3. The method according to claim 1, characterized in that, The amount of starch phosphorylase used in the enzyme-catalyzed reaction is 2 U / mL.

4. The method according to claim 1, characterized in that, The amount of glucosidase used in the enzyme-catalyzed reaction is 1 U / mL.

5. The method according to claim 1, characterized in that, The amount of laminarin phosphorylase used in the enzyme-catalyzed reaction is 3 U / mL.

6. The method according to claim 1, characterized in that, The enzyme-catalyzed reaction is carried out at a temperature of 50°C.

7. The method according to claim 1, characterized in that, Starch is any one or more of soluble starch, soluble amylose, or soluble amylopectin, in any proportion.

8. The method according to claim 1, characterized in that, The buffer solution is HEPES buffer, Tris-HC1 buffer, MOPS buffer, or citrate buffer.

9. The method according to claim 8, characterized in that, The buffer solution in the reaction system is HEPES buffer.

10. The method according to claim 1, characterized in that, The pH of the buffer solution is 6.

5.

11. The method according to claim 1, characterized in that, The concentration of the buffer solution in the reaction system is 50-120 mM.

12. The method according to claim 11, characterized in that, The concentration of the buffer solution in the reaction system is 100 mM.

13. The method according to claim 1, characterized in that, The reaction system also contains phosphates and magnesium salts.

14. The method according to claim 13, characterized in that, Phosphates are potassium phosphate and sodium phosphate.

15. The method according to claim 14, characterized in that, The concentration of phosphate in the reaction system is 5-15 mM.

16. The method according to claim 15, characterized in that, The concentration of phosphate in the reaction system is 10 mM.

17. The method according to claim 1, characterized in that, The amount of isoamylase used in the reaction system is 0.5-1 U / mL.

18. The method according to claim 17, characterized in that, The amount of isoamylase used in the reaction system was 1 U / mL.

19. The method according to claim 1, characterized in that, First, add isoamylase to the reaction system, and after reacting for a period of time, add starch phosphorylase, glucosidase and laminarin phosphorylase.

20. The method according to claim 19, characterized in that, First, add isoamylase to the reaction system and react at 50-90℃ for 12 hours.

21. The method according to claim 19, characterized in that, Isoamylase was added to the reaction system first, and the reaction was carried out at 85°C for 12 hours.

22. The method according to claim 21, characterized in that, Add starch phosphorylase, glucosidase and laminarin phosphorylase to the reaction system and continue the reaction at 30-60℃ for 6-48 hours.

Images