New thiophosphoramidites

Abstract

The present invention relates to compounds of formula (II) or (IIb), wherein X, Y, R x , R y , R 5 and Nu are as defined in the specification and claims. The compound of formula (II) can be used to prepare oligonucleotides.

Description

Background of the Invention

[0002] The use of synthetic oligonucleotides as therapeutic drugs has witnessed significant progress over the past few decades, leading to the development of molecules that act through diverse mechanisms, including gapmers that activate RNase H, splice-switching oligonucleotides, microRNA inhibitors, siRNAs or aptamers (ST Crooke, Antisense drug technology: principles, strategies, and applications, 2nd edition, Boca Raton, FL: CRC Press, 2008). However, oligonucleotides are inherently unstable to nucleolytic degradation processes in biological systems. In addition, they show highly unfavorable pharmacokinetic behavior. In order to improve these shortcomings, various types of chemical modifications have been studied in recent decades. Arguably, one of the most successful modifications is the introduction of a phosphorothioate bond, in which one of the non-bridging phosphate oxygen atoms is replaced with a sulfur atom (F. Eckstein, Antisense and Nucleic Acid Drug Development 2009, 10, 117-121). Such phosphorothioate oligodeoxynucleotides show increased protein binding and significantly higher stability to nucleolytic degradation and thus significantly higher half-life in plasma, tissues and cells compared to their unmodified phosphodiester analogs. These defining features have allowed the development of first-generation oligonucleotide therapeutics and opened the door to their improvement by more recent modifications such as locked nucleic acids (LNA). However, replacing the phosphodiester bond with a phosphorothioate produces a chiral center at the phosphorus atom. Therefore, all approved phosphorothioate oligonucleotide therapeutics are used as mixtures of massive diastereomeric compounds, all of which may have different (and possibly opposite) physicochemical and pharmacological properties.

[0003] Although it is now possible to stereospecifically synthesize a single thiophosphate oligonucleotide that defines stereochemistry (N.Oka, M.Yamamoto, T.Sato, T.Wada, J.Am.Chem.Soc.2008,130,16031-16037), it is still a challenge to identify the stereoisomer with the best properties within a huge number of possible diastereoisomers. In this case, it is of great significance to reduce diastereoisomerism complexity by using non-chiral thiophosphate linkages. For example, symmetrical non-bridging dithioester modifications in which both non-bridging oxygen atoms within the phosphate bond are replaced by sulfur (see, e.g., WT Wiesler, MH Caruthers, J. Org. Chem. 1996, 61, 4272-4281) have been applied to immunostimulatory oligonucleotides (AM Krieg, S. Matson, E. Fisher, Antisense Nucleic Acid Drug Dev. 1996, 6, 133-139), siRNA (e.g., X. Yang, M. Sierant, M. Janicka, L. Peczek, C. Martinez, T. Hassell, N. Li, X. Li, T. Wang, B. Nawrot, ACS Chem. 1996, 6, 133-139), and oligonucleotides (e.g., X. Yang, M. Sierant, M. Janicka, L. Peczek, C. Martinez, T. Hassell, N. Li, X. Li, T. Wang, B. Nawrot, ACS Chem. 1996, 6, 133-139). Chem. Biol. 2012, 7, 1214-1220) and aptamers (e.g., X. Yang, S. Fennewald, BA Luxon, J. Aronson, NK Herzog, DG Gorenstein, Bioorg. Med. Chem. Lett. 1999, 9, 3357-3362). Interestingly, attempts to utilize such achiral modifications in the context of antisense oligonucleotides have so far achieved limited success (see, e.g., MK Ghosh, K. Ghosh, O. Dahl, JS Cohen, Nucleic Acids Res. 1993, 21, 5761-5766; and JP Vaughn, J. Stekler, S. Demirdji, JK Mills, MH Caruthers, JD Iglehart, JR Marks, Nucleic Acids Res. 1996, 24, 4558-4564).

[0004] To our surprise, we have now found that non-bridging dithiophosphates can be introduced into oligonucleotides, especially generally into oligonucleotide gapmers or mixmers and specifically into LNA-DNA-LNA gapmers or LNA / DNA mixmers. This modification is well tolerated and the resulting molecules show huge therapeutic application potential, while each non-bridging dithiophosphate modification reduces the size of the total library of possible diastereomers by 50%. When the modification is placed in the LNA flanks of gapmers, it is found that the resulting oligonucleotides are generally more powerful than the corresponding entire phosphorothioate parent. Generally, the modification is additionally well tolerated inside the gap region and even more surprisingly, when properly placed, can also lead to improved efficacy.

[0005] Therefore, we have surprisingly found that the present invention provides the oligonucleotide with improved physicochemical and pharmacological properties (for example, comprising improved effectiveness).In some respects, oligonucleotide of the present invention retains activity or effect, and may be replaced with the same compound (phosphorothioate reference compound) of conventional stereo-irregular phosphorothioate bond with its dithiophosphate bond of its formula (IA or IBIB) as strong or more powerful than.Introducing each time that non-bridging phosphorothioate is modified removes one of the chiral centers at phosphorus and thus reduces the diastereoisomerism complexity 50% of compound.In addition, whenever introducing dithioester modification, oligonucleotide seems to be taken into cell much better, especially taken into for example hepatocyte, muscle cell, cardiac cell.

[0006] The introduction of a non-bridging dithioate modification to the LNA flank of the gapmer appears to be particularly beneficial, resulting in molecules showing higher target reduction and substantially better uptake behavior, higher stability and a good safety profile.

[0007] Chemical synthesis of non-bridging phosphorodithioate linkages in oligonucleotides is best achieved by solid phase oligonucleotide synthesis techniques using appropriate thiophosphoramidite building blocks. Successful applications of such thiophosphoramidites have been described for normal DNA (X. Yang, Curr Protoc Nucleic Acid Chem 2016, 66, 4.71.71-74.71.14.) and for RNA (X. Yang, Curr Protoc Nucleic Acid Chem 2017, 70, 4.77.71–74.77.13.) and the required building blocks are available from commercial sources. Interestingly, the more challenging synthesis of the corresponding LNA thiophosphoramidites has not been reported. In the present application, we also report the successful synthesis of all four LNA thiophosphoramidites and their incorporation into oligonucleotides.

[0008] Brief description of the invention

[0009] The present invention relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside linkage of formula (I):

[0010]

[0011] One of the two oxygen atoms is bound to the adjacent nucleoside (A 1 ) and the other oxygen atom is connected to the 3' carbon atom of another adjacent nucleoside (A 2 ), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein R is a hydrogen or phosphate protecting group. The present invention also relates in particular to a gapmer oligonucleotide comprising a phosphorodithioate internucleoside bond of formula (I). The present invention also relates to a method for making an oligonucleotide of the present invention and to an LNA nucleoside monomer that can be used in particular to make an oligonucleotide of the present invention.

[0012] The present invention relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside bond of (IA) or (IB)

[0013]

[0014] One of the two oxygen atoms is bound to the adjacent nucleoside (A 1 ) and the other oxygen atom is connected to the 3' carbon atom of another adjacent nucleoside (A 2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation.

[0015] In other words, M is a metal, such as an alkali metal, such as Na or K; or M is NH4.

[0016] The present invention provides an antisense oligonucleotide comprising a phosphorothioate nucleoside interlinkage of formula IA or IB as described herein. The oligonucleotide of the present invention is preferably a single-stranded antisense oligonucleotide comprising one or more 2' sugar-modified nucleosides, such as one or more LNA nucleosides or one or more 2'MOE nucleosides. The antisense oligonucleotide of the present invention can regulate the expression of a target nucleic acid (e.g., pre-target mRNA or target microRNA) in a cell expressing the target RNA in vivo or in vitro. In some embodiments, the single-stranded antisense oligonucleotide also comprises a phosphorothioate nucleoside interlinkage. The single-stranded antisense oligonucleotide can, for example, be in the form of a gap polymer oligonucleotide, a mixed polymer oligonucleotide or a full polymer oligonucleotide. The single-stranded antisense oligonucleotide mixed polymer can be used to regulate the splicing events in the pre-target mRNA. The single-stranded antisense oligonucleotide mixed polymer can be used to inhibit the expression of the target microRNA.

[0017] The present invention also relates to the use of the oligonucleotides of the present invention (such as single-stranded antisense oligonucleotides) as therapeutic agents.

[0018] The present invention also particularly relates to a mixed polymer oligonucleotide comprising a phosphorodithioate internucleoside linkage of formula (IA or IB). The present invention also particularly relates to a full polymer oligonucleotide comprising a phosphorodithioate internucleoside linkage of formula (IA or IB).

[0019] The present invention also relates to methods for making the oligonucleotides of the present invention and to LNA nucleoside monomers which are particularly useful in making the oligonucleotides of the present invention.

[0020] The present invention also relates to methods for making the oligonucleotides of the present invention and to MOE nucleoside monomers that are particularly useful in making the oligonucleotides of the present invention.

[0021] The present invention also provides novel MOE monomers and LNA monomers that can be used to make the oligonucleotides of the present invention.

[0022] During oligonucleotide synthesis, the purpose of protective R groups is often used. After oligonucleotide synthesis, the protective group is generally exchanged for a hydrogen atom or a cation such as an alkali metal or ammonium cation, such as when the oligonucleotide is in salt form. Salt generally contains a cation, such as a metal cation, for example, a sodium or potassium cation or an ammonium cation. With regard to antisense oligonucleotides, preferably R is hydrogen, or the antisense oligonucleotide is in salt form (as shown in IB).

[0023] The phosphorodithioate internucleoside linkages of formula (IB) may, for example, be selected from:

[0024]

[0025] Wherein M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation. The oligonucleotides of the present invention can therefore be in the form of an oligonucleotide salt, an alkali metal salt, such as a sodium salt, a potassium salt or an ammonium salt.

[0026] Alternatively, the oligonucleotides of the invention may comprise phosphorodithioate internucleoside linkages of formula IA' or IB'

[0027]

[0028] The present invention also particularly relates to a gapmer oligonucleotide comprising a phosphorodithioate internucleoside linkage of formula (I) (Formula IA or IB or Formula IA' or Formula IB').

[0029] The present invention also particularly relates to a mixed polymer oligonucleotide comprising a phosphorodithioate internucleoside linkage of formula (I) (Formula IA or IB or Formula IA' or Formula IB').

[0030] The present invention also particularly relates to a full-polymer oligonucleotide comprising a phosphorodithioate internucleoside linkage of formula (I) (Formula IA or IB or Formula IA' or Formula IB').

[0031] In a preferred embodiment of the oligonucleotide of the present invention, the two nucleosides (A 1 ) and (A 2 ) is an LNA nucleoside.

[0032] In a preferred embodiment of the oligonucleotide of the present invention, the two nucleosides (A 1 ) and (A 2 ) is a 2'-O-MOE nucleoside.

[0033] In a preferred embodiment of the oligonucleotide of the present invention, the oligonucleotide is a single-stranded antisense oligonucleotide, two nucleotides (A 1 ) and (A 2 ) is an LNA nucleoside.

[0034] In a preferred embodiment of the oligonucleotide of the present invention, the oligonucleotide is a single-stranded antisense oligonucleotide, and the two nucleosides (A 1 ) and (A 2 ) is a 2'-O-MOE nucleoside.

[0035] The present invention provides an antisense oligonucleotide for inhibiting a target RNA in a cell, wherein the antisense gapmer oligonucleotide comprises at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0036]

[0037] wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein the antisense oligonucleotide is or comprises an antisense gapmer oligonucleotide (referred to herein as a gapmer or gapmer oligonucleotide),

[0038] The antisense oligonucleotide of the invention may thus comprise or consist of a gapmer.

[0039] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0040]

[0041] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein A2 is the 3' terminal nucleoside of the oligonucleotide.

[0042] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0043]

[0044] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein A1 is the 5' terminal nucleoside of the oligonucleotide.

[0045] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0046]

[0047] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2-O-MOE nucleoside and wherein in (IA), R is a hydrogen or phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein A2 is the 3' terminal nucleoside of the oligonucleotide.

[0048] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0049]

[0050] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2-O-MOE nucleoside and wherein in (IA), R is a hydrogen or phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, wherein A1 is the 5' terminal nucleoside of the oligonucleotide.

[0051] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0052]

[0053] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of another adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2' sugar modified nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein A2 is the 3' terminal nucleoside of the oligonucleotide.

[0054] The present invention provides an antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0055]

[0056] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is a 2' sugar modified nucleoside and wherein in (IA), R is a hydrogen or phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein A1 is the 5' terminal nucleoside of the oligonucleotide.

[0057] The 2' sugar modified nucleosides may be independently selected from 2' sugar modified nucleosides selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA and LNA nucleosides.

[0058] The present invention provides a single-stranded antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0059]

[0060] wherein one of the two oxygen atoms is attached to the 3' carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is attached to the 5' carbon atom of the other adjacent nucleoside (A2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded oligonucleotide further comprises at least one stereo-defined phosphorothioate internucleoside bond, which is (Sp, S) or (Rp, R)

[0061]

[0062] Where N 1 and N 2 It is a nucleoside.

[0063] The present invention also provides a single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2' sugar-modified nucleosides, and wherein at least one of the internucleoside bonds between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0064]

[0065] wherein one of the two oxygen atoms is attached to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is attached to the 5' carbon atom of the other adjacent nucleoside (A2) and wherein R is hydrogen or a phosphate protecting group.

[0066] The present invention also provides a single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2' sugar-modified nucleosides, and wherein at least one of the internucleoside bonds between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0067]

[0068] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of the other adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to modulate splicing of a pre-mRNA target RNA.

[0069] The present invention also provides a single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2' sugar-modified nucleosides, and wherein at least one of the internucleoside bonds between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0070]

[0071] wherein one of the two oxygen atoms is connected to the 3' carbon atom of the adjacent nucleoside (A1) and the other oxygen atom is connected to the 5' carbon atom of the other adjacent nucleoside (A2); and wherein in (IA), R is a hydrogen or phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of a non-coding long RNA. For examples of lncRNAs that can be targeted by the compounds of the present invention, see WO 2012 / 065143.

[0072] The present invention also provides a single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2' sugar-modified nucleosides, and wherein at least one of the internucleoside bonds between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0073]

[0074] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of the other adjacent nucleoside (A2); and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of a human mRNA or pre-mRNA target.

[0075] The present invention also provides a single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2' sugar-modified nucleosides, and wherein at least one of the internucleoside bonds between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0076]

[0077] wherein one of the two oxygen atoms is attached to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is attached to the 5' carbon atom of another adjacent nucleoside (A2); and wherein in (IA), R is a hydrogen or phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of a viral RNA target. Suitable viral RNA targets may, for example, be HCV or HBV.

[0078] The present invention also provides a single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 7-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2' sugar-modified nucleosides, and wherein at least one of the internucleoside bonds between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0079]

[0080] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of another adjacent nucleoside (A2); and wherein in (IA), R is a hydrogen or phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded antisense oligonucleotide is used to inhibit the expression of microRNA.

[0081] For targeting RNA target, for example pre-mRNA target, mRNA target, viral RNA target, microRNA or non-coding long RNA target, oligonucleotide of the present invention can appropriately suppress the expression of target RNA.This is realized by the complementarity between antisense oligonucleotide and target RNA.The suppression of RNA target can be realized by reducing RNA target level or by blocking the function of RNA target.The RNA suppression of RNA target can be appropriately realized by (for example, by using gap polymer) recruiting cellular RNA enzyme such as RNA enzyme H, or can be realized by non-nuclease mediated mechanism, such as steric hindrance mechanism (such as for microRNA suppression, for splicing regulation of pre-mRNA or for blocking the steric hindrance mechanism of interaction between non-coding long RNA and chromatin).

[0082] The present invention also relates to methods for making the oligonucleotides of the present invention and to LNA or MOE nucleoside monomers that are particularly useful for making the oligonucleotides of the present invention.

[0083] The present invention provides a pharmaceutically acceptable salt of the oligonucleotide of the present invention, or a conjugate thereof, in particular a sodium salt or a potassium salt or an ammonium salt.

[0084] The present invention provides a conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt thereof and at least one conjugate moiety covalently linked to the oligonucleotide or the pharmaceutically acceptable salt, optionally via a linker moiety.

[0085] The present invention provides a pharmaceutical composition comprising the oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention and a therapeutically inert carrier.

[0086] The present invention provides any oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention for use as a therapeutically active substance.

[0087] The present invention provides a method for regulating a target RNA in a cell expressing the target RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition of the present invention, wherein the oligonucleotide is complementary to the target RNA.

[0088] The present invention provides a method for regulating the splicing of a pre-RNA target in a cell expressing the pre-mRNA target, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition of the present invention, wherein the oligonucleotide is complementary to the target RNA and is capable of regulating splicing events in the pre-mRNA.

[0089] The present invention provides the use of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of the present invention for inhibiting pre-mRNA, mRNA or long non-coding RNA in a cell (such as a human cell).

[0090] The above method or use may be an in vitro method or an in vivo method.

[0091] The present invention provides use of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of the present invention in the manufacture of a medicament.

[0092] The present invention provides the use of the phosphorodithioate internucleoside linkage of (IA) or (IB) for enhancing the in vitro or in vivo stability of single-stranded phosphorothioate antisense oligonucleotides.

[0093] The present invention provides the use of phosphorodithioate internucleoside linkages of formula (IA) or (IB) for enhancing the duration of action of single-stranded phosphorothioate antisense oligonucleotides in vitro or in vivo.

[0094] The present invention provides the use of phosphorodithioate internucleoside linkages of formula (IA) or (IB) for enhancing the cellular uptake or tissue distribution of single-stranded phosphorothioate antisense oligonucleotides.

[0095] The present invention provides the use of phosphorodithioate internucleoside linkages of formula (IA) or (IB) for enhancing the uptake of single-stranded phosphorothioate antisense oligonucleotides into tissues selected from skeletal muscle, heart, epithelial cells, including retinal epithelial cells (e.g., compounds targeting Htra1), liver, kidney or spleen.

[0096] For in vivo use, the single-stranded phosphorothioate antisense oligonucleotide can be a therapeutic oligonucleotide. BRIEF DESCRIPTION OF THE DRAWINGS

[0098] Figure 1-Figure 4 Shown are target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of the oligonucleotides of the invention.

[0099] Figure 1 Shown are target mRNA levels in primary rat hepatocytes 24 and 74 hours after administration of an oligonucleotide gapmer having a single phosphorodithioate internucleoside linkage of the invention in the gap.

[0100] Figure 2 Shown are target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having multiple phosphorodithioate internucleoside linkages of the invention in the gap.

[0101] Figure 3 Shown are target mRNA levels in primary rat hepatocytes 24 hours and 74 hours after administration of an oligonucleotide gapmer having multiple phosphorodithioate internucleoside linkages of the invention in the gap.

[0102] Figure 4Shown are target mRNA levels in primary rat hepatocytes 24 and 74 hours after administration of oligonucleotide gapmers having phosphorodithioate internucleoside linkages of the invention in the flanks.

[0103] Figure 5 Thermal melting (Tm) of oligonucleotides containing phosphorodithioate internucleoside linkages of the invention hybridized to RNA and DNA are shown.

[0104] Figure 6 The stability of oligonucleotides containing phosphorodithioate internucleoside linkages of the invention in rat serum is shown.

[0105] Figure 7 : Exploration of achiral phosphorodithioate in the gapmer gap and flanking regions–residual mRNA levels after treatment of primary rat hepatocytes.

[0106] Figure 8 : Exploring the position dependence and optimization of achiral phosphorodithioates in the gap region of gapmers – residual mRNA levels after treatment of primary rat hepatocytes.

[0107] Fig. 9A and Fig. 9B : Exploring the effects of achiral phosphorodithioates in the gap region of gapmers on cellular uptake.

[0108] Fig. 10A and Fig. 10B : Introduction of achiral phosphorodithioates in gapmer flanking regions provides increased potency, and correlation between phosphorothioate loading and increased potency (4 bonds > 3 bonds > 2 bonds > 1 bond > no phosphorodithioate bonds in flank).

[0109] Fig.11 : ICs in different cell types 50 value.

[0110] Fig.12 : Rat serum stability in vitro of 3' end protected LNA oligonucleotides.

[0111] Fig.13 : In vivo evaluation of gapmers containing achiral phosphorodithioate bonds in the flank and gap regions–target inhibition.

[0112] Fig.14A : In vivo evaluation of gapmers containing achiral phosphorodithioate bonds in the flank and gap regions - tissue uptake.

[0113] Fig. 14B : In vivo evaluation of gapmers containing achiral phosphorodithioate bonds in the flank and gap regions - liver / kidney ratio.

[0114] Fig.15A and Fig. 15B : In vivo evaluation of gapmers containing achiral phosphorodithioate bonds in the flank and gap regions – metabolite analysis.

[0115] Fig.16 : The extended duration of action of antisense oligonucleotides containing achiral phosphorodithioate internucleoside linkages can be further enhanced by combining with stereo-defined phosphorothioate internucleoside linkages.

[0116] Fig.17A : In vitro EC targeting of achiral phosphorodithioate gapmers to MALAT-1 50 Determination.

[0117] Fig. 17B : In vivo efficacy of achiral phosphorodithioate gapmers targeting MALAT-1.

[0118] Fig. 17C : In vivo study of achiral phosphorodithioate gapmers targeting MALAT-1 – Tissue content

[0119] Fig.18A :In vitro study of achiral monophosphorothioate-modified gapmer oligonucleotides targeting ApoB. Activity data

[0120] Fig.18B : In vitro studies of achiral monothioate-modified gapmer oligonucleotides targeting ApoB. Cell content data.

[0121] Fig.19A :In vitro study of chiral phosphorodithioate-modified gapmer oligonucleotides targeting ApoB. Activity data

[0122] Fig.19B : In vitro studies of chiral phosphorodithioate-modified gapmer oligonucleotides targeting ApoB. Cell content data.

[0123] Fig. 20 : The effect of achiral phosphorodithioate (P2S) internucleoside bonds present in splice-switching oligonucleotides targeting the 3' splice site of TNFRSF1B. Human Colo 205 cells were seeded in 96-well plates and subjected to 5 μM (A) and 25 μM (B) oligos, respectively. The percentage of exon 7 skipping was analyzed by droplet digital PCR using probes targeting the junction of exons 6-8, and compared to the total amount of TNFRSF1B by an assay targeting exons 2-3. SSO#26 is the parent oligo, and SSO#27 is a negative control that does not target TNFRSF1B.

[0124] Fig.21 : Stability assay using S1 nuclease. Dithioester containing oligomers were incubated with S1 nuclease for 30 min and 120 min, respectively. Oligomers were visualized on 15% TBE-urea gels. As a migration marker, an intact oligomer (SSO#14) was included that was not subjected to S1 nuclease action.

[0125] definition

[0126] In this specification, the term "alkyl" refers alone or in combination to a straight or branched chain alkyl group having 1 to 8 carbon atoms, in particular a straight or branched chain alkyl group having 1 to 6 carbon atoms and more particularly a straight or branched chain alkyl group having 1 to 4 carbon atoms. Examples of straight and branched chain C1-C8 alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, isobutyl, tert-butyl, isomeric amyl, isohexyl, isoheptyl and isooctyl, in particular methyl, ethyl, propyl, butyl and amyl. Specific examples of alkyl groups are methyl, ethyl and propyl.

[0127] The term "cycloalkyl" alone or in combination refers to a cycloalkyl ring having 3 to 8 carbon atoms, particularly a cycloalkyl ring having 3 to 6 carbon atoms. Examples of cycloalkyl are cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl, more particularly cyclopropyl and cyclobutyl. A specific example of "cycloalkyl" is cyclopropyl.

[0128] The term "alkoxy" alone or in combination refers to a radical of the formula alkyl-O-, wherein the term "alkyl" has the meaning given previously, such as methoxy, ethoxy, n-propoxy, isopropoxy, n-butoxy, isobutoxy, sec-butoxy and tert-butoxy. Specific "alkoxy" are methoxy and ethoxy. Methoxyethoxy is a specific example of "alkoxyalkoxy".

[0129] The term "oxy" alone or in combination refers to an -O- group.

[0130] The term "alkenyl", alone or in combination, refers to a straight-chain or branched hydrocarbon residue comprising an olefinic bond and up to 8, preferably up to 6, particularly preferably up to 4 carbon atoms. Examples of alkenyl are ethenyl, 1-propenyl, 2-propenyl, isopropenyl, 1-butenyl, 2-butenyl, 3-butenyl and isobutenyl.

[0131] The term "alkynyl" alone or in combination refers to a straight-chain or branched hydrocarbon residue comprising a triple bond and up to 8, in particular 2, carbon atoms.

[0132] The term "halogen" or "halogen" refers alone or in combination to fluorine, chlorine, bromine or iodine and specifically to fluorine, chlorine or bromine, more specifically to fluorine. In combination with another group, the term "halogen" refers to a group substituted with at least one halogen, especially with one to five halogens, specifically one to four halogens (i.e. one, two, three or four halogens).

[0133] The term "haloalkyl" refers, alone or in combination, to an alkyl group substituted with at least one halogen, particularly one to five halogens, specifically one to three halogens. Examples of haloalkyl groups include monofluoro, difluoro or trifluoromethyl, ethyl or propyl, such as 3,3,3-trifluoropropyl, 2-difluoroethyl, 2,2,2-trifluoroethyl, fluoromethyl or trifluoromethyl. Fluoromethyl, difluoromethyl and trifluoromethyl are specific "haloalkyl groups".

[0134] The term "halocycloalkyl" alone or in combination refers to a cycloalkyl as defined above substituted with at least one halogen, especially with one to five halogens, specifically one to three halogens. Specific examples of "halocycloalkyl" are halogenated cyclopropyls, especially fluorocyclopropyls, difluorocyclopropyls and trifluorocyclopropyls.

[0135] The terms "hydroxy" and "hydroxyl," alone or in combination, refer to a -OH group.

[0136] The terms "thiohydroxyl" and "sulfhydryl," alone or in combination, refer to a -SH group.

[0137] The term "carbonyl" alone or in combination refers to a -C(O)- group.

[0138] The term "carboxy" or "carboxy", alone or in combination, refers to a -COOH group.

[0139] The term "amino" alone or in combination refers to a primary amino group (-NH2), a secondary amino group (-NH-) or a tertiary amino group (-N-).

[0140] The term "alkylamino" alone or in combination refers to an amino group as defined above substituted by one or two alkyl groups as defined above.

[0141] The term "sulfonyl", alone or in combination, means a -SO2 group.

[0142] The term "sulfinyl" alone or in combination refers to a -SO- group.

[0143] The term "sulfanyl," alone or in combination, refers to a -S- group.

[0144] The term "cyano" alone or in combination refers to a -CN group.

[0145] The term "azido" alone or in combination refers to a -N3 group.

[0146] The term "nitro", alone or in combination, refers to a NO2 group.

[0147] The term "formyl" alone or in combination refers to a -C(O)H group.

[0148] The term "carbamyl", alone or in combination, refers to a -C(O)NH2 group.

[0149] The term "cabamido", alone or in combination, refers to a -NH-C(O)-NH2 group.

[0150] The term "aryl", alone or in combination, refers to a monovalent aromatic carbocyclic monocyclic or bicyclic ring system containing 6 to 10 carbon ring atoms, which is optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of aryl include phenyl and naphthyl, especially phenyl.

[0151] The term "heteroaryl", alone or in combination, refers to a monovalent aromatic heterocyclic mono- or bicyclic ring system of 5 to 12 ring atoms, said system comprising 1, 2, 3 or 4 heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of heteroaryl groups include pyrrolyl, furanyl, thienyl, imidazolyl, oxazolyl, thiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, pyridinyl, pyrazinyl, pyrazolyl, pyridazinyl, pyrimidinyl, triazinyl, azepinyl, diazepinyl, isoxazolyl, benzofuranyl, isothiazolyl, benzothienyl, indolyl, isoindolyl, isobenzofuranyl, benzimidazolyl, benzoxazolyl, benzisoxazolyl, benzothiazolyl, benzisothiazolyl, benzoxadiazolyl, benzothiadiazolyl, benzotriazolyl, purinyl, quinolyl, isoquinolyl, quinazolinyl, quinoxalinyl, carbazolyl, or acridinyl.

[0152] The term "heterocyclyl" alone or in combination refers to a monovalent saturated or partially unsaturated monocyclic or bicyclic ring system of 4 to 12, in particular 4 to 9 ring atoms, comprising 1, 2, 3 or 4 ring heteroatoms selected from N, O and S, the remaining ring atoms being carbon, optionally substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxy, alkoxycarbonyl, alkylcarbonyl and formyl. Examples of monocyclic saturated heterocyclyl are azetidinyl, pyrrolidinyl, tetrahydrofuranyl, tetrahydro-thienyl, pyrazolidinyl, imidazolidinyl, oxazolinyl, isoxazolidinyl, thiazolidinyl, piperidinyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperazinyl, morpholinyl, thiomorpholinyl, 1,1-dioxo-thiomorpholin-4-yl, azepanyl, diazepanyl, homopiperazinyl or oxazepanyl. Examples of bicyclic saturated heterocycloalkyl are 8-aza-bicyclo[3.2.1]octyl, quinuclidinyl, 8-oxa-3-aza-bicyclo[3.2.1]octyl, 9-aza-bicyclo[3.3.1]nonyl, 3-oxa-9-aza-bicyclo[3.3.1]nonyl or 3-thia-9-aza-bicyclo[3.3.1]nonyl. Examples of partially unsaturated heterocycloalkyl are dihydrofuranyl, imidazolinyl, dihydrooxazolyl, tetrahydropyridinyl or dihydropyranyl.

[0153] The term "pharmaceutically acceptable salt" refers to those salts that retain the biological effects and characteristics of free alkali or free acid, and the biological effects and characteristics are not biologically unfavorable or bad. With inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, especially hydrochloric acid, and organic acids such as acetic acid, propionic acid, glycolic acid, pyruvic acid, oxalic acid, maleic acid, malonic acid, succinic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid, N-acetylcysteine ​​to form salts. In addition, these salts can be prepared from adding inorganic bases or organic bases to free acids. Salts derived from inorganic bases include but are not limited to sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary and tertiary amines, substituted amines, including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, lysine, arginine, N-ethylpiperidine, piperidine, polyamine resins. The oligonucleotides of the present invention may also be present in the form of zwitterionic surfactants. Particularly preferred pharmaceutically acceptable salts of the present invention are sodium salts, lithium salts, potassium salts and trialkylammonium salts.

[0154] The term "protecting group" alone or in combination refers to a group that selectively blocks a reactive site in a multifunctional compound so that a chemical reaction can be selectively performed at another unprotected reactive site. The protecting group can be removed. An exemplary protecting group is an amino protecting group, a carboxyl protecting group, or a hydroxyl protecting group.

[0155] A "phosphate protecting group" is a protecting group for a phosphate group. Examples of phosphate protecting groups are 2-cyanoethyl and methyl. A specific example of a phosphate protecting group is 2-cyanoethyl.

[0156] A "hydroxy protecting group" is a protecting group for a hydroxy group and is also used to protect a thiol group (thiol). Examples of hydroxyl protecting groups are acetyl (Ac), benzoyl (Bz), benzyl (Bn), β-methoxyethoxymethyl ether (MEM), dimethoxytrityl (or bis-(4-methoxyphenyl)phenylmethyl) (DMT), trimethoxytrityl (or tris-(4-methoxyphenyl)phenylmethyl) (TMT), methoxymethyl ether (MOM), methoxytrityl [(4-methoxyphenyl)diphenylmethyl (MMT), p-methoxybenzyl ether (PMB), methylthiomethyl ether, pivaloyl (Piv), tetrahydropyranyl (THP), tetrahydrofuran (THF), trityl or trityl (Tr), silyl ether (e.g. trimethylsilylimidazole (TMS), tert-butyldimethylsilyl (TBDMS), triisobutylsiloxymethyl (TOM) and triisopropylsilyl (TIPS) ether), methyl ether and ethoxyethyl ether (EE). Specific examples of hydroxyl protecting groups are DMT and TMT, especially DMT.

[0157] A "sulfhydryl protecting group" is a protecting group for sulfhydryl. Examples of the sulfhydryl protecting group are those of the "hydroxyl protecting group".

[0158] If one of the starting materials or compounds of the invention contains one or more functional groups that are unstable or reactive under the reaction conditions of one or more reaction steps, suitable protecting groups may be introduced prior to the key steps using methods well known in the art (as described in, for example, "Protective Groups in Organic Chemistry" by TW Greene and PGM Wuts, 3rd edition, 1999, Wiley, New York). Such protecting groups may be removed at a later stage of the synthesis using standard methods described in the literature. Examples of protecting groups are tert-butyloxycarbonyl (Boc), 9-fluorenylmethylcarbamate (Fmoc), 2-trimethylsilylethylcarbamate (Teoc), carbobenzyl (Cbz), and p-methoxybenzyloxycarbonyl (Moz).

[0159] The compounds described herein may contain several asymmetric centers and may exist as optically pure enantiomers, mixtures of enantiomers (such as, for example, racemates), mixtures of diastereomers, diastereomeric racemates or mixtures of diastereomeric racemates.

[0160] Oligonucleotides

[0161] As used herein, the term "oligonucleotide" is defined as a molecule comprising two or more covalently linked nucleosides as the technician generally understands it. This type of covalently linked nucleosides may also be referred to as nucleic acid molecules or oligomers. Oligonucleotides are often produced in the laboratory by solid phase chemical synthesis and subsequently purified. When referring to the sequence of an oligonucleotide, it refers to the sequence or order of the core base moiety or its modifier, covalently linked nucleotides or nucleosides. The oligonucleotide of the present invention is artificial, and is chemically synthesized, and is generally purified or separated. The oligonucleotide of the present invention may comprise one or more modified nucleosides or nucleotides.

[0162] Antisense Oligonucleotides

[0163] The term "antisense oligonucleotide" as used herein is defined as an oligonucleotide that can regulate the expression of a target gene by hybridizing with a target nucleic acid, particularly with a continuous sequence on the target nucleic acid. Antisense oligonucleotides are not substantially double-stranded and are therefore not siRNA or shRNA. Preferably, the antisense oligonucleotides of the present invention are single-stranded. It is understood that the single-stranded oligonucleotides of the present invention can form a hairpin or an intermolecular duplex structure (a duplex between two molecules of the same oligonucleotide), as long as the degree of self-complementarity within or between them is less than 50% across the total length of the oligonucleotide.

[0164] Regulation of expression

[0165] As used herein, the term "modulation of expression" is to be understood as a general term for the ability of an oligonucleotide to alter the expression of a target nucleic acid or to alter its level. Modulation of expression can be determined by comparison with the expression of the target nucleic acid or its level before administration of the oligonucleotide, or can be determined by reference to a control experiment in which the oligonucleotide of the invention is not administered. It is generally understood that a control is an individual or target cell treated with a saline composition or an individual or target cell treated with a non-targeting oligonucleotide (mimetic).

[0166] One type of regulatory effect is the ability of an oligonucleotide to inhibit, down-regulate, reduce, suppress, remove, stop, block, prevent, weaken, reduce, avoid or terminate target nucleic acid expression, such as by degrading the target nucleic acid (e.g., by RNAse H1-mediated degradation) or blocking transcription. Another type of regulatory effect is the ability of an oligonucleotide to restore, increase or enhance target RNA expression, such as by regulating splicing events on target pre-mRNA or by blocking inhibitory mechanisms (e.g., microRNA repression of mRNA).

[0167] Continuous nucleotide sequence

[0168] The term "continuous nucleotide sequence" refers to an oligonucleotide region that is complementary to a target nucleic acid (e.g., fully complementary). The term is used interchangeably with the term "continuous core base sequence" and the term "oligonucleotide motif sequence" herein. In some embodiments, all nucleotides of an oligonucleotide constitute a continuous nucleotide sequence. In some embodiments, an oligonucleotide comprises a continuous nucleotide sequence, such as a FG-F' gap polymer region, and may optionally comprise other nucleotides, such as a nucleotide joint region that can be used to join a functional group to a continuous nucleotide sequence, such as region D or D'. The nucleotide joint region may be complementary to or may not be complementary to the target nucleic acid. The antisense oligonucleotide mixed polymer mentioned herein may comprise a continuous nucleotide sequence or may consist of it.

[0169] Nucleotides

[0170] "Nucleotide" is the structural unit of oligonucleotides and polynucleotides and for the purposes of the present invention includes naturally occurring and non-naturally occurring nucleotides. In nature, nucleotides such as DNA and RNA nucleotides contain a ribose sugar moiety, a core base moiety, and one or more phosphate groups (which are not present in nucleosides). Nucleosides and nucleotides can also be referred to interchangeably as "units" or "monomers."

[0171] Modified Nucleosides

[0172] As used herein, the term "modified nucleoside" or "nucleoside modification" refers to a nucleoside modified by introducing one or more sugar moieties or (core) base moieties compared to an equivalent DNA nucleoside or RNA nucleoside. In a preferred embodiment, the modified nucleoside comprises a modified sugar moiety. The term "modified nucleoside" can also be used interchangeably with the term "nucleoside analog" or modified "unit" or modified "monomer" in this article. Nucleosides with unmodified DNA or RNA sugar moieties are referred to as DNA nucleosides or RNA nucleosides in this article. Nucleosides with modifications in the base region of a DNA nucleoside or RNA nucleoside are still usually referred to as DNA or RNA if Watson Crick base pairing is allowed.

[0173] Modified internucleoside bonds

[0174] The term "modified internucleoside bond" is defined as a bond other than the phosphodiester (PO) bond that two nucleosides are covalently linked together as generally understood by the technician. The oligonucleotide of the present invention can therefore comprise a modified internucleoside bond. In some embodiments, the modified internucleoside bond increases the nuclease resistance of the oligonucleotide compared to the phosphodiester bond. For naturally occurring oligonucleotides, the internucleoside bond includes a phosphate group that produces a phosphodiester bond between adjacent nucleosides. The modified internucleoside bond is particularly useful for stabilizing oligonucleotides for in vivo use, and can be used in the DNA nucleoside or RNA nucleoside region (e.g., inside the gap region of a gap polymer oligonucleotide) in the oligonucleotide of the present invention and in the modified nucleoside region (e.g., region F and region F') to protect from nuclease shearing.

[0175] In one embodiment, the oligonucleotide comprises one or more internucleoside bonds modified from natural phosphodiester, such as one or more modified internucleoside bonds that are more resistant to nuclease attack. Nuclease resistance can be determined by incubating the oligonucleotide in serum or by using a nuclease resistance assay (e.g., snake venom phosphodiesterase (SVPD)), both of which are well known in the art. The internucleoside bonds of the oligonucleotide that can enhance nuclease resistance are referred to as anti-nuclease internucleoside bonds. In some embodiments, at least 50% of the internucleoside bonds in an oligonucleotide or its continuous nucleotide sequence are modified, such as at least 60% in an oligonucleotide or its continuous nucleotide sequence, such as at least 70%, such as at least 80 or such as at least 90% of the internucleoside bonds are anti-nuclease internucleoside bonds. In some embodiments, all internucleoside bonds of an oligonucleotide or its continuous nucleotide sequence are anti-nuclease internucleoside bonds. It will be recognized that in some embodiments, the nucleosides connecting the oligonucleotide of the present invention to a non-nucleotide functional group such as a conjugate can be phosphodiester.

[0176] A preferred modified internucleoside linkage for use in the oligonucleotides of the invention is phosphorothioate.

[0177] Phosphorothioate internucleoside bonds are particularly useful because of nuclease resistance, beneficial pharmacokinetics and ease of production. In some embodiments, at least 50% internucleoside bonds in an oligonucleotide or its continuous nucleotide sequence are phosphorothioates, such as at least 60% in an oligonucleotide or its continuous nucleotide sequence, such as at least 70%, such as at least 80% or such as at least 90% internucleoside bonds are phosphorothioates. In some embodiments, except for the phosphorodithioate internucleoside bonds, all internucleoside bonds of an oligonucleotide or its continuous nucleotide sequence are phosphorothioates. In some embodiments, except for the phosphorodithioate bonds, the oligonucleotide of the present invention also comprises a bond and at least one phosphodiester bond between the phosphorothioate nucleoside, such as 2,3 or 4 phosphodiester bonds. In a gap polymer oligonucleotide, when present, a phosphodiester bond is suitably not located between the continuous DNA nucleosides in the gap region G.

[0178] Anti-nuclease bonds (such as phosphorothioate bonds) are particularly useful in regions of the oligonucleotide that are capable of recruiting nucleases when forming a duplex with a target nucleic acid (such as region G of a gapmer). However, phosphorothioate bonds can also be used in regions without nuclease recruitment and / or regions of enhanced affinity (such as regions F and F' of a gapmer). In some embodiments, a gapmer oligonucleotide can contain one or more phosphodiester bonds in region F and / or region F' or in both region F and region F', wherein the internucleoside bonds in region G can be all phosphorothioates.

[0179] Advantageously, all internucleoside bonds in the contiguous nucleotide sequence of the oligonucleotide or all internucleoside bonds of the oligonucleotide are phosphorothioate bonds.

[0180] It is recognized that antisense oligonucleotides may contain other internucleoside linkages (besides phosphodiester and phosphorothioate), such as alkyl phosphonate internucleoside linkages / methylphosphonate internucleoside linkages, as disclosed in EP 2 742 135, which, according to EP 2 742 135, may be tolerated, for example, in gap regions that are not DNA phosphorothioates.

[0181] Stereo-random phosphorothioate bond

[0182] Phosphorothioate bonds are internucleoside phosphate bonds in which one of the non-bridging oxygens has been replaced by sulfur. The replacement of one of the non-bridging oxygens by sulfur introduces a chiral center and thus within a single phosphorothioate oligonucleotide, each phosphorothioate internucleoside bond will be in an S (Sp) or R (Rp) stereo isoform. This type of internucleoside bond is referred to as a "chiral internucleoside bond." By comparison, phosphodiester internucleoside bonds are achiral because they have two non-terminal oxygen atoms.

[0183] The nomenclature for the chirality of stereocenters is determined according to the standard Cahn-Ingold-Prelog rules (CIP priority rules) first published in the following literature: Cahn, RS; Ingold, CK; Prelog, V. (1966) "Specification of Molecular Chirality" Angewandte Chemie International Edition 5(4):385–415. doi:10.1002 / anie.196603851.

[0184] During standard oligonucleotide synthesis, the stereoselectivity of the coupling and subsequent sulfurization is not controlled. For this reason, the stereochemistry of each phosphorothioate internucleoside bond is randomly either Sp or Rp, and thus phosphorothioate oligonucleotides produced by traditional oligonucleotide synthesis methods can actually be up to 2 X There are 2 different phosphorothioate diastereomers, wherein X is the number of phosphorothioate internucleoside bonds. Such oligonucleotides are referred to herein as stereo-random phosphorothioate oligonucleotides and do not contain any stereo-defined internucleoside bonds. Stereo-random phosphorothioate oligonucleotides are therefore mixtures of diastereomers derived from non-stereochemically defined synthesis. In this case, a mixture is defined as having up to 2 X Different phosphorothioate diastereoisomers.

[0185] Stereodefined internucleoside bonds

[0186] A stereodefined internucleoside bond is a chiral internucleoside bond having a diastereomeric excess of one of its two diastereomeric forms, Rp or Sp.

[0187] It will be appreciated that stereoselective oligonucleotide synthesis methods used in the art generally provide at least about 90% or at least about 95% diastereoselectivity at each chiral internucleoside bond, and thus up to about 10%, such as about 5%, of the oligonucleotide molecules may have alternative diastereomeric forms.

[0188] In some embodiments, the diastereomeric ratio of each stereodefined chiral internucleoside bond is at least about 90: 10. In some embodiments, the diastereomeric ratio of each chiral internucleoside bond is at least about 95:5.

[0189] A stereo-defined phosphorothioate bond is a specific example of a stereo-defined internucleoside bond.

[0190] Defines stereogenic phosphorothioate bonds

[0191] A stereodefined phosphorothioate bond is one that has a diastereomeric excess of one of its two diastereomeric forms, Rp or Sp.

[0192] The Rp and Sp configurations of phosphorothioate internucleoside linkages are shown below.

[0193]

[0194] wherein the 3'R group represents the 3' position of the adjacent nucleoside (5' nucleoside) and the 5'R group represents the 5' position of the adjacent nucleoside (3' nucleoside).

[0195] Herein, the Rp internucleoside linkage may also be represented as srP, and the Sp internucleoside linkage may be represented as ssP.

[0196] In a specific embodiment, the diastereoisomer ratio for each stereo-defined phosphorothioate bond is at least about 90:10 or at least 95:5.

[0197] In some embodiments, the diastereomeric ratio of each stereo-defined phosphorothioate bond is at least about 97: 3. In some embodiments, the diastereomeric ratio of each stereo-defined phosphorothioate bond is at least about 98: 2. In some embodiments, the diastereomeric ratio of each stereo-defined phosphorothioate bond is at least about 99: 1.

[0198] In some embodiments, the stereo-defined internucleoside bonds are in the same diastereomeric form (Rp or Sp) in at least 97%, such as at least 98%, such as at least 99%, or (substantially) all of the oligonucleotide molecules present in a population of oligonucleotide molecules.

[0199] The diastereomeric purity can be measured in a model system with only an achiral skeleton (i.e., phosphodiester). The diastereomeric purity of each monomer can be measured by, for example, coupling a monomer with a stereogenic internucleoside bond to the following model system "5't-po-t-po-t-po3'". The result of this measurement will be provided subsequently: 5'DMTr-t-srp-t-po-t-po-t-po 3' or 5'DMTr-t-ssp-t-po-t-po-t-po 3' that can be separated using HPLC. The diastereomeric purity is determined by integrating the UV signals from two possible diastereomers and obtaining the ratio of these diastereomers (e.g., 98:2, 99:1, or>99:1).

[0200] It will be appreciated that the diastereomeric purity of a particular single diastereomer (a stereo-defined single oligonucleotide molecule) will vary with the coupling selectivity of the defined stereocenter at each internucleoside position and the number of stereo-defined internucleoside bonds to be introduced. By way of example, if the coupling selectivity at each position is 97%, the resulting purity of a stereo-defined oligonucleotide with 15 stereo-defined internucleoside bonds would be 0.97. 15 , i.e. 63% of the desired diastereomer compared to 37% of the other diastereomer. The purity of a defined diastereomer can be improved after synthesis by purification, for example by HPLC, such as ion exchange chromatography or reverse phase chromatography.

[0201] In some embodiments, a stereo-defined oligonucleotide refers to a population of oligonucleotides wherein at least about 40% (eg, at least about 50%) of the population are of the desired diastereomer.

[0202] In other words, in some embodiments, a stereo-defined oligonucleotide refers to a population of oligonucleotides wherein at least about 40% (such as at least about 50%) of the population consists of a desired (specific) stereo-defined internucleoside linkage motif (also referred to as a stereo-defined motif).

[0203] For stereo-defined oligonucleotides containing a stereo-random internucleoside stereocenter and a stereo-defined internucleoside chiral center, the purity of the stereo-defined oligonucleotide is determined by reference to the % of the oligonucleotide population that retains the desired stereo-defined internucleoside linkage motif, ignoring stereo-random linkages in the calculation.

[0204] Nucleobase

[0205] The term "nucleobase" includes purine moieties (e.g., adenine and guanine) and pyrimidine moieties (e.g., uracil, thymine, and cytosine) in nucleosides and nucleotides that form hydrogen bonds in nucleic acid hybridization. In the context of the present invention, the term "nucleobase" also encompasses modified nucleobases that may be different from naturally occurring nucleobases but functional during nucleic acid hybridization. In this case, "nucleobase" refers to naturally occurring nucleobases such as adenine, guanine, cytosine, thymidine, uracil, xanthine, and hypoxanthine, as well as non-naturally occurring variants. Such variants are described, for example, in Hirao et al. (2012) Accounts of Chemical Research, Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1.

[0206] In some embodiments, the nucleobase moiety is modified by changing a purine or pyrimidine to a modified purine or pyrimidine, such as a substituted purine or substituted pyrimidine, such as a nucleobase selected from isocytosine, pseudoisocytosine, 5-methylcytosine, 5-thiazolocytosine, 5-propargyl-cytosine, 5-propargyl-uracil, 5-bromouracil, 5-thiazolouracil, 2-thio-uracil, 2'thio-thymine, inosine, diaminopurine, 6-aminopurine, 2-aminopurine, 2,6-diaminopurine and 2-chloro-6-aminopurine.

[0207] The nucleobase moiety may be indicated by means of a letter code for each corresponding nucleobase (e.g. A, T, G, C or U), wherein each letter may optionally include a functionally equivalent modified nucleobase. For example, in the exemplified oligonucleotides, the nucleobase moiety is selected from A, T, G, C and 5-methylcytosine. Optionally, for LNA gapmers, 5-methylcytosine LNA nucleosides may be used.

[0208] Modified oligonucleotides

[0209] The term "modified oligonucleotide" describes an oligonucleotide comprising one or more sugar modified nucleosides and / or modified internucleoside linkages. The term chimeric "oligonucleotide" is a term that has been used in the literature to describe oligonucleotides with modified nucleosides.

[0210] Defined stereogenic oligonucleotides

[0211] A stereo-defined oligonucleotide is an oligonucleotide wherein at least one of the internucleoside linkages is a stereo-defined internucleoside linkage.

[0212] A defined stereophosphorothioate oligonucleotide is an oligonucleotide wherein at least one of the internucleoside linkages is a defined stereophosphorothioate internucleoside linkage.

[0213] Complementarity

[0214] The term "complementarity" describes the Watson-Crick base pairing ability of nucleosides / nucleotides. Watson-Crick base pairs are guanine (G)-cytosine (C) and adenine (A)-thymine (T) / uracil (U). It should be understood that oligonucleotides can include nucleosides with modified nucleobases, such as 5-methylcytosine is often used to replace cytosine, and thus the term "complementarity" encompasses Watson Crick base pairing between unmodified nucleobases and modified nucleobases (see, for example, Hirao et al. (2012) Accounts of Chemical Research Vol. 45, p. 2055 and Bergstrom (2009) Current Protocols in Nucleic Acid Chemistry Suppl. 37 1.4.1).

[0215] As used herein, the term "% complementary" refers to the proportion of nucleotides within a continuous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) that, at a given position, is complementary to (i.e., forms a Watson Crick base pair with) a continuous nucleotide sequence at a given position of a respective nucleic acid molecule (e.g., a target nucleic acid). The percentage is calculated in the following manner: (when aligned from 3'-5' to the target sequence 5'-3' and the oligonucleotide sequence) the number of aligned bases that form a pairing between the two sequences is counted, divided by the total number of nucleotides in the oligonucleotide and multiplied by 100. In this comparison, a nucleobase / nucleotide that is not aligned (forming a base pair) is referred to as a mismatch. Preferably, insertions and deletions are not allowed when calculating the complementarity % of a continuous nucleotide sequence.

[0216] The term "fully complementary" refers to 100% complementarity.

[0217] Identity

[0218] The term "identity" as used herein refers to the number of nucleotides in a continuous nucleotide sequence in a nucleic acid molecule (e.g., an oligonucleotide) as a percentage, wherein at a given position, the nucleotide is identical to the continuous nucleotide sequence at a given position of a respective nucleic acid molecule (e.g., a target nucleic acid) (i.e., in terms of its ability to form Watson Crick base pairs with complementary nucleosides). The percentage is calculated in the following manner: the number of identical aligned bases between the two sequences is counted, divided by the total number of nucleotides in the oligonucleotide and multiplied by 100. Percent identity = (match x 100) / length of the aligned region. Preferably, insertions and deletions are not allowed when calculating the complementarity % of continuous nucleotide sequences.

[0219] Hybridization

[0220] As used herein, the term "hybridizes" or "hybridization" is understood to mean that two nucleic acid strands (e.g., an oligonucleotide and a target nucleic acid) form hydrogen bonds between base pairs on opposite strands, thereby forming a duplex. The affinity of the binding interaction between the two nucleic acid strands is the strength of the hybridization. It is often measured in terms of the melting temperature (T m ) describes it, and the melting temperature is defined as the temperature at which half of the oligonucleotides form a duplex with the target nucleic acid. Under physiological conditions, T m It is not strictly proportional to affinity (Mergny and Lacroix, 2003, Oligonucleotides 13:515–537). The standard state Gibbs free energy ΔG° is a more accurate representation of binding affinity and is related to the dissociation constant (K d ) multiplied by ΔG° = -RTln(K d), where R is the gas constant and T is the absolute temperature. Therefore, the very low ΔG° of the reaction between the oligonucleotide and the target nucleic acid reflects the strong hybridization between the oligonucleotide and the target nucleic acid. ΔG° is the energy associated with a reaction in which the water concentration is 1M, the pH is 7 and the temperature is 37°C. The hybridization of the oligonucleotide to the target nucleic acid is a spontaneous reaction and for a spontaneous reaction, ΔG° is less than zero. For example, ΔG° can be experimentally measured by utilizing an isothermal titration calorimetry (ITC) method as described in Hansen et al., 1965, Chem. Comm. 36–38 and Holdgate et al., 2005, Drug Discov Today. One of ordinary skill in the art will know that commercial equipment can be used to measure ΔG°. ΔG can also be estimated numerically by using a nearest neighbor model as described in SantaLucia, 1998, Proc Natl Acad Sci USA. 95: 1460–1465, appropriately using thermodynamic parameters described by Sugimoto et al., 1995, Biochemistry 34: 11211–11216 and McTigue et al., 2004, Biochemistry 43: 5388–5405. In order to obtain the possibility of regulating its intended nucleic acid target by hybridization, the oligonucleotides of the present invention hybridize with the target nucleic acid at a ΔG° estimate of less than -10 kcal for oligonucleotides of 10-30 nucleotides in length. In some embodiments, the degree or intensity of hybridization is measured according to the standard state Gibbs free energy ΔG°. The oligonucleotide can hybridize with the target nucleic acid at a ΔG° estimate of less than 10 kcal, such as less than -15 kcal, such as less than -20 kcal and such as less than -25 kcal for oligonucleotides of 8-30 nucleotides in length. In some embodiments, the oligonucleotide hybridizes to the target nucleic acid with an estimated ΔG° of -10 to -60 kcal, such as -12 to -40 kcal, such as -15 to -30 kcal or -16 to -27 kcal, such as -18 to -25 kcal.

[0221] Sugar modification

[0222] The oligomers of the invention may comprise one or more nucleosides having a modified sugar moiety (ie, a modified sugar moiety) when compared to the ribose sugar moiety present in DNA and RNA.

[0223] A number of nucleosides with modifications of the ribose sugar moiety have been generated, primarily with the goal of improving certain properties of the oligonucleotide, such as affinity and / or nuclease resistance.

[0224] Such modifications include modifications wherein the ribose ring structure is modified, for example, by replacement with a hexose ring (HNA) or a bicyclic ring (LNA) generally having a diradical bridge between C2 and C4 carbons on the ribose ring or a non-connected ribose ring (e.g., UNA) generally lacking a bond between C2 carbon and C3 carbon. Other sugar-modified nucleosides include, for example, bicyclohexose nucleic acids (WO 2011 / 017521) or tricyclic nucleic acids (WO 2013 / 154798). Modified nucleosides also include nucleosides in which the sugar moiety is replaced by a non-sugar moiety, for example, in the case of peptide nucleic acids (PNA) or morpholino nucleic acids.

[0225] Sugar modifications also include modifications made by changing substituents on the ribose ring to groups other than hydrogen or the 2'-OH group naturally present in DNA and RNA nucleosides. Substituents may be introduced, for example, at the 2', 3', 4' or 5' position.

[0226] 2' sugar modified nucleosides

[0227] 2' sugar modified nucleosides are nucleosides that have a substituent other than H or -OH at the 2' position (2' substituted nucleosides) or contain a 2' linked diradical capable of forming a bridge between the 2' carbon and the second carbon in the ribose ring, such as LNA (2'-4' diradical bridged) nucleosides.

[0228] In fact, most attention has been devoted to developing 2' substituted nucleosides, and it has been found that numerous 2' substituted nucleosides have beneficial properties when incorporated into oligonucleotides. For example, 2' modified sugars can provide enhanced binding affinity and / or increased nuclease resistance to oligonucleotides. Examples of 2' substituted modified nucleosides are 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. Other examples can be found, for example, in Freier and Altmann; Nucl. Acid Res., 1997, 25, 4429-4443 and Uhlmann; Curr. Opinion in Drug Development, 2000, 3 (2), 293-213 and Deleavey and Damha, Chemistry and Biology 2012, 19, 937. Some 2' substituted modified nucleosides are shown below.

[0229]

[0230] In relation to the present invention, 2' substitution does not include 2' bridged molecules such as LNA.

[0231] Locked Nucleoside Nucleosides (LNA Nucleosides)

[0232] "LNA nucleosides" are 2'-modified nucleosides that contain a C2' and C4' diradical (also referred to as a "2'-4' bridge") connecting the ribose sugar ring of the nucleoside, which restricts or locks the conformation of the ribose ring. These nucleosides are also referred to as bridged nucleic acids or bicyclic nucleic acids (BNA) in the literature. For complementary RNA or DNA molecules, locking the conformation of the ribose is associated with enhanced hybridization affinity (duplex stabilization) when LNA is incorporated into an oligonucleotide. This can be routinely determined by measuring the melting temperature of the oligonucleotide / complementary duplex.

[0233] Non-limiting exemplary LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352, WO 2004 / 046160, WO 00 / 047599, WO 2007 / 134181, WO 2010 / 077578, WO 2010 / 036698, WO 2007 / 090071, WO 2009 / 006478, WO 2011 / 156202, WO 2008 / 154401, WO 2009 / 067647, WO 2008 / 150729; Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76; Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81 and Mitsuoka et al., Nucleic Acids Research 2009, 37(4), 1225-1238.

[0234] A 2'-4' bridge comprises 2 to 4 bridging atoms and is especially of the formula -XY-, X being linked to C4' and Y to C2'.

[0235] in

[0236] X is oxygen, sulfur, -CR a R b -、-C(R a )=C(R b )-、-C(=CR a R b )-、-C(R a )=N-、-Si(R a )2-、-SO2-、-NR a -;-O-NR a -、-NR a -O-, -C(=J)-, Se, -O-NR a -、-NR a -CR aR b -、-N(R a )-O-or-O-CR a R b -;

[0237] Y is oxygen, sulfur, -(CR a R b ) n -、-CR a R b -O-CR a R b -、-C(R a )=C(R b )-、-C(R a )=N-、-Si(R a )2-、-SO2-、-NR a -, -C(=J)-, Se, -O-NR a -、-NR a -CR a R b -、-N(R a )-O-or-O-CR a R b -;

[0238] The condition is that -XY- is not -OO-, Si(R a )2-Si(R a )2-、-SO2-SO2-、-C(R a )=C(R b )-C(R a )=C(R b )、-C(R a )=NC(R a )=N-、-C(R a )=NC(R a )=C(R b )、-C(R a )=C(R b )-C(R a )=N- or -Se-Se-;

[0239] J is oxygen, sulfur, =CH2 or =N(R a );

[0240] R a and R bindependently selected from hydrogen, halogen, hydroxy, cyano, sulfhydryl, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocyclic, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, ureido, alkanoyloxy, sulfonyl, alkylsulfonyloxy, nitro, azido, thiohydroxylsulfidealkylsulfanyl, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, -OC(=X a )R c 、-OC(=X a )NR c R d and-NR e C(=X a )NR c R d ;

[0241] or two R a and R b together form an optionally substituted methylene group;

[0242] or two R a and R b Together with the carbon atom to which they are attached, they form a cycloalkyl or halocycloalkyl group having only one carbon atom of -XY-;

[0243] wherein substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy and substituted methylene are alkyl, alkenyl, alkynyl and methylene substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, heterocyclyl, aryl and heteroaryl;

[0244] X a is oxygen, sulfur or -NR c ;

[0245] R c , R d and R e are independently selected from hydrogen and alkyl; and

[0246] n is 1, 2, or 3.

[0247] In yet another embodiment of the present invention, X is oxygen, sulfur, -NR a -、-CR a R b -or-C(=CRa R b )-, specifically oxygen, sulfur, -NH-, -CH2- or -C(=CH2)-, more specifically oxygen.

[0248] In another specific embodiment of the present invention, Y is -CR a R b -、-CR a R b -CR a R b -or-CR a R b -CR a R b -CR a R b -, especially -CH2-CHCH3-, -CHCH3-CH2-, -CH2-CH2- or -CH2-CH2-CH2-.

[0249] In a specific embodiment of the invention, -XY- is -O-(CR a R b ) n -、-S-CR a R b -、-N(R a )CR a R b -、-CR a R b -CR a R b -、-O-CR a R b -O-CR a R b -、-CR a R b -O-CR a R b -、-C(=CR a R b )-CR a R b -、-N(R a )CR a R b -、-ON(R a )-CR a R b -or-N(R a )-O-CR a R b -.

[0250] In a specific embodiment of the present invention, R a and Rb Independently selected from hydrogen, halogen, hydroxy, alkyl and alkoxyalkyl, especially hydrogen, halogen, alkyl and alkoxyalkyl.

[0251] In another embodiment of the present invention, R a and R b Independently selected from hydrogen, fluorine, hydroxy, methyl and -CH2-O-CH3, especially hydrogen, fluorine, methyl and -CH2-O-CH3.

[0252] Advantageously, the R of -XY- a and R b One of them is as defined above and the others are simultaneously hydrogen.

[0253] In another specific embodiment of the present invention, R a is hydrogen or alkyl, especially hydrogen or methyl.

[0254] In another specific embodiment of the present invention, R b is hydrogen or alkyl, especially hydrogen or methyl.

[0255] In a specific embodiment of the present invention, R a and R b One or both are hydrogen.

[0256] In a specific embodiment of the present invention, R a and R b Only one of them is hydrogen.

[0257] In a specific embodiment of the present invention, R a and R b One of them is methyl and the other is hydrogen.

[0258] In a specific embodiment of the present invention, R a and R b At the same time, they are all methyl groups.

[0259] In a specific embodiment of the present invention, -XY- is -O-CH2-, -S-CH2-, -S-CH(CH3)-, -NH-CH2-, -O-CH2CH2-, -O-CH(CH2-O-CH3)-, -O-CH(CH2CH3)-, -O-CH(CH3)-, -O-CH2-O-CH2-, -O-CH2-O-CH2-, -CH2-O-CH2-, -C(=CH2)CH2-, -C(=CH2)CH(CH3)-, -N(OCH3)CH2- or -N(CH3)CH2-;

[0260] In a specific embodiment of the invention, -XY- is -O-CR aR b -, where R a and R b Independently selected from hydrogen, alkyl and alkoxyalkyl, especially hydrogen, methyl and -CH2-O-CH3.

[0261] In a particular embodiment, -XY- is -O-CH2- or -O-CH(CH3)-, especially -O-CH2-.

[0262] The 2'-4' bridge can be located below the plane of the ribose ring (β-D-configuration), or above the plane of the ring (α-L-configuration), as shown in formula (A) and formula (B), respectively.

[0263] The LNA nucleosides of the present invention are particularly of formula (B1) or (B2)

[0264]

[0265] in

[0266] W is oxygen, sulfur, -N(R a )-or-CR a R b -, especially oxygen;

[0267] B is a nucleobase or a modified nucleobase;

[0268] Z is an internucleoside bond to an adjacent nucleoside or a 5' terminal group;

[0269] Z* is an internucleoside bond to the adjacent nucleoside or a 3' terminal group;

[0270] R 1 , R 2 , R 3 , R 5 and R 5 * is independently selected from hydrogen, halogen, alkyl, haloalkyl, alkenyl, alkynyl, hydroxy, alkoxy, alkoxyalkyl, azido, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, and aryl; and

[0271] X, Y, R a and R b As defined above.

[0272] In one embodiment, in the definition of -XY-, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of -XY-, R b is hydrogen or alkyl, especially hydrogen or methyl. In yet another specific embodiment, in the definition of -XY-, R a and R bIn one embodiment, in the definition of -XY-, R a and R b In one embodiment, in the definition of -XY-, R a and R b In one embodiment, in the definition of -XY-, R a and R b At the same time, they are all methyl groups.

[0273] In yet another specific embodiment, in the definition of X, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of X, R b is hydrogen or alkyl, especially hydrogen or methyl. In one embodiment, in the definition of X, R a and R b In one embodiment, in the definition of X, R a and R b In one embodiment, in the definition of X, R a and R b In one embodiment, in the definition of X, R a and R b At the same time, they are all methyl groups.

[0274] In yet another specific embodiment, in the definition of Y, R a is hydrogen or alkyl, especially hydrogen or methyl. In another specific embodiment, in the definition of Y, R b is hydrogen or alkyl, especially hydrogen or methyl. In a specific embodiment, in the definition of Y, R a and R b In one embodiment, in the definition of Y, R a and R b In one embodiment, in the definition of Y, R a and R b In one embodiment, in the definition of Y, R a and R b At the same time, they are all methyl groups.

[0275] In a specific embodiment of the present invention, R 1 , R 2 , R 3 , R 5 and R 5* is independently selected from hydrogen and alkyl, especially hydrogen and methyl.

[0276] In another particularly advantageous embodiment of the present invention, R 1 , R 2 , R 3 , R 5 and R 5 *Both are hydrogen.

[0277] In another specific embodiment of the present invention, R 1 , R 2 , R 3 At the same time, both are hydrogen, R 5 and R 5 * one of which is hydrogen and the other is as defined above, specifically alkyl, more specifically methyl.

[0278] In a specific embodiment of the present invention, R 5 and R 5 * is independently selected from hydrogen, halogen, alkyl, alkoxyalkyl and azido, in particular selected from hydrogen, fluorine, methyl, methoxyethyl and azido. In a particularly advantageous embodiment of the present invention, R 5 and R 5* one of which is hydrogen and the other is alkyl, especially methyl, halogen, especially fluorine, alkoxyalkyl, especially methoxyethyl or azido; or R 5 and R 5* At the same time, both are hydrogen or halogen, especially both are hydrogen or fluorine. In this type of embodiment, W may advantageously be oxygen, and -XY- is advantageously -O-CH2-.

[0279] In a specific embodiment of the invention, -XY- is -O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* Such LNA nucleosides are disclosed in WO 99 / 014226, WO 00 / 66604, WO 98 / 039352 and WO 2004 / 046160, all of which are hereby incorporated by reference, and include β-D-oxy LNA nucleosides and α-L-oxy LNA nucleosides commonly known in the art.

[0280] In another embodiment of the present invention, -XY- is -S-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5*Such thio-LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference herein.

[0281] In another embodiment of the invention, -XY- is -NH-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* Such amino LNA nucleosides are disclosed in WO 99 / 014226 and WO 2004 / 046160, which are hereby incorporated by reference herein.

[0282] In another specific embodiment of the present invention, -XY- is -O-CH2CH2- or -OCH2CH2CH2-, W is oxygen, and R 1 , R 2 , R 3 , R 5 and R 5* Such LNA nucleosides are disclosed in WO 00 / 047599 and Morita et al., Bioorganic & Med. Chem. Lett. 12, 73-76, both of which are hereby incorporated by reference herein, and include 2'-0-4'C-ethylene bridged nucleic acids (ENA) generally known in the art.

[0283] In another specific embodiment of the present invention, -XY- is -O-CH2-, W is oxygen, R 1 , R 2 , R3 are both hydrogen, R 5 and R 5* One of them is hydrogen and the other is not hydrogen, such as alkyl, for example methyl. Such 5' substituted LNA nucleosides are disclosed in WO 2007 / 134181, which is hereby incorporated herein by reference.

[0284] In another specific embodiment of the present invention, -XY- is -O-CR a R b -, where R a and R b One or both of them are not hydrogen, especially alkyl, for example methyl, W is oxygen, R 1 , R 2 , R3 are both hydrogen, R 5 and R 5*One of the two is hydrogen and the other is not hydrogen, in particular an alkyl group, such as a methyl group. Such doubly modified LNA nucleosides are disclosed in WO 2010 / 077578, which is hereby incorporated herein by reference.

[0285] In another specific embodiment of the invention, -XY- is -O-CHR a -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* and are both hydrogen. Such 6'-substituted LNA nucleosides are disclosed in WO 2010 / 036698 and WO 2007 / 090071, both of which are hereby incorporated by reference herein. In such 6'-substituted LNA nucleosides, R a Especially C1-C6 alkyl, such as methyl.

[0286] In another specific embodiment of the present invention, -XY- is -O-CH(CH2-O-CH3)- ("2'O-methoxyethyl bicyclic nucleic acid", Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81).

[0287] In another specific embodiment of the present invention, -XY- is -O-CH(CH2CH3)-;

[0288] In another specific embodiment of the present invention, -XY- is -O-CH(CH2-O-CH3)-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* At the same time, both are hydrogen. In the art, this type of LNA nucleoside is also known as cyclic MOE (cMOE) and is disclosed in WO 2007 / 090071.

[0289] In another specific embodiment of the present invention, -XY- is -O-CH(CH3)- ("2'O-ethyl bicyclic nucleic acid", Seth et al. J. Org. Chem. 2010, Vol 75(5) pp. 1569-81).

[0290] In another specific embodiment of the present invention, -XY- is -O-CH2-O-CH2- (Seth et al. J. Org. Chem. 2010, supra).

[0291] In another embodiment of the present invention, -XY- is -O-CH(CH3)-, W is oxygen and R1 , R 2 , R 3 , R 5 and R 5* Such 6'-methyl LNA nucleosides are also referred to in the art as cET nucleosides and may be (S)-cET or (R)-cET diastereomers as disclosed in WO 2007 / 090071 (β-D) and WO 2010 / 036698 (α-L), both of which are hereby incorporated by reference herein.

[0292] In another specific embodiment of the present invention, -XY- is -O-CR a R b -, where R a and R b are not hydrogen, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* In one embodiment, R a and R b At the same time, both are alkyl, in particular at the same time, both are methyl. Such 6' disubstituted LNA nucleosides are disclosed in WO 2009 / 006478, which is hereby incorporated herein by reference.

[0293] In another specific embodiment of the invention, -XY- is -S-CHR a -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* and are both hydrogen. Such 6'-substituted thio-LNA nucleosides are disclosed in WO 2011 / 156202, which is hereby incorporated by reference herein. In a specific embodiment of such 6'-substituted thio-LNA, R a is an alkyl group, especially a methyl group.

[0294] In a specific embodiment of the present invention, -XY- is -C(=CH2)C(R a R b )-、-C(=CHF)C(R a R b )-or-C(=CF2)C(R a R b )-, W is oxygen and R 1 , R 2 , R 3 , R5 and R 5* At the same time, they are all hydrogen. a and R b R is advantageously independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, especially hydrogen, methyl, fluorine and methoxymethyl. a and R b Especially, both are hydrogen or methyl or R a and R b One of them is hydrogen and the other is methyl. Such vinyl carbon LNA nucleosides are disclosed in WO 2008 / 154401 and WO 2009 / 067647, both of which are hereby incorporated herein by reference.

[0295] In a specific embodiment of the invention, -XY- is -N(OR a )-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* In one embodiment, R a is an alkyl group such as methyl. Such LNA nucleosides are also known as N-substituted LNAs and are disclosed in WO 2008 / 150729, which is hereby incorporated herein by reference.

[0296] In a specific embodiment of the invention, -XY- is -ON(R a )-、-N(R a )-O-、-NR a -CR a R b -CR a R b -or-NR a -CR a R b -, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* At the same time, they are all hydrogen. a and R b Advantageously, R is independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, in particular hydrogen, methyl, fluorine and methoxymethyl. a is an alkyl group, such as methyl, R b is hydrogen or methyl, especially hydrogen. (Seth et al., J. Org. Chem 2010 supra).

[0297] In a specific embodiment of the invention, -XY- is -ON(CH3)- (Seth et al., J. Org. Chem 2010 supra).

[0298] In a specific embodiment of the present invention, R 5 and R 5* In another specific embodiment of the present invention, R 5 and R 5* In this embodiment, one of R is hydrogen and the other is alkyl, such as methyl. 1 , R 2 and R 3 In particular, it may be hydrogen and -XY- may in particular be -O-CH2- or -O-CHC(R a )3-, such as -O-CH(CH3)-.

[0299] In a specific embodiment of the invention, -XY- is -CR a R b -O-CR a R b -, such as -CH2-O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* In this embodiment, R a In particular, it may be an alkyl group such as a methyl group, R b In particular it may be hydrogen or a methyl group, in particular hydrogen. Such LNA nucleosides are also called conformationally restricted nucleotides (CRNs) and are disclosed in WO 2013 / 036868, which is hereby incorporated herein by reference.

[0300] In a specific embodiment of the invention, -XY- is -O-CR a R b -O-CR a R b -, such as -O-CH2-O-CH2-, W is oxygen and R 1 , R 2 , R 3 , R 5 and R 5* At the same time, they are all hydrogen. a and R b Advantageously, R is independently selected from hydrogen, halogen, alkyl and alkoxyalkyl, especially hydrogen, methyl, fluorine and methoxymethyl. a In particular, it may be an alkyl group such as a methyl group, R bIn particular it may be hydrogen or methyl, in particular hydrogen. Such LNA nucleosides are also known as COC nucleotides and are disclosed in Mitsuok et al., Nucleic Acids Research 2009, 37(4), 1225-1238, which is hereby incorporated herein by reference.

[0301] It will be appreciated that unless specifically stated otherwise, LNA nucleosides may be in either the β-D or α-L stereoisoform.

[0302] Specific examples of LNA nucleosides of the invention are shown in Scheme 1 (wherein B is as defined above).

[0303] Solution 1

[0304]

[0305]

[0306]

[0307] Specific LNA nucleosides are β-D-oxy-LNA, 6'-methyl-β-D-oxy-LNA such as (S)-6'-methyl-β-D-oxy-LNA ((S)-cET) and ENA.

[0308] MOE nucleosides

[0309] The term "MOE" stands for "methoxy-ethyl" and, as abbreviated, refers to a nucleoside substituted in the 2' position with a methoxy-ethoxy group as represented below.

[0310]

[0311] The above nucleoside may therefore be named "MOE" or "2'-O-MOE nucleoside".

[0312] RNase H activity and recruitment

[0313] The RNase H activity of an antisense oligonucleotide refers to its ability to recruit RNase H when forming a duplex with a complementary RNA molecule. WO01 / 23613 provides an in vitro method for determining RNase H activity, which can be used to determine the ability to recruit RNase H. An oligonucleotide is generally considered to be able to recruit RNase H if the following conditions occur: when a complementary target nucleic acid sequence is provided, it has such an initial rate as measured in pmol / l / minute that is at least 5% such as at least 10% or more than 20% of the initial rate determined using the following oligonucleotide and using the method provided in Examples 91-95 of WO01 / 23613 (which is hereby incorporated by reference herein as a reference), wherein the oligonucleotide has the same base sequence as the modified oligonucleotide under test, but contains only DNA monomers, and all monomers of the oligonucleotide are phosphorothioate bonds. For use in determining RHase H activity, recombinant human RNase H1 is available from Lubio Science GmbH, Switzerland.

[0314] Gapmer

[0315] The antisense oligonucleotide of the present invention or its continuous nucleotide sequence can be a gapmer. Antisense gapmers are often used to inhibit target nucleic acids by means of RNAse H-mediated degradation. Gapmer oligonucleotides contain at least three unique structural regions 5'-flank, gap and 3'-flank in a '5->3' orientation, which are FG-F'. The "gap" region (G) contains a section of continuous DNA nucleotides that enable the oligonucleotide to recruit RNAse H. The gap region is flanked by a 5' flanking region (F) containing one or more sugar-modified nucleosides, advantageously sugar-modified high-affinity nucleosides, and a 3' flanking region (F') containing one or more sugar-modified nucleosides, advantageously sugar-modified high-affinity nucleosides. One or more sugar-modified nucleosides in region F and region F' enhance the affinity of the oligonucleotide to the target nucleic acid (i.e., are sugar-modified nucleosides that enhance affinity). In some embodiments, one or more sugar-modified nucleosides in region F and region F' are 2' sugar-modified nucleosides, such as independently selected from LNA and 2'-MOE, such as high affinity 2' sugar modifications.

[0316] In the gapmer layout, the 5' and 3' last nucleosides of the gap region are DNA nucleosides, and sugar-modified nucleosides are present adjacent to the 5' (F) region or the 3' (F') region, respectively. The flanking regions can be further defined by having at least one sugar-modified nucleoside at the end farthest from the gap region (i.e., at the 5' end of the 5' flanking region and at the 3' end of the 3' flanking region).

[0317] The region FG-F' forms a continuous nucleotide sequence. The antisense oligonucleotide of the present invention or its continuous nucleotide sequence may comprise a gapmer region of the formula FG-F'.

[0318] The overall length of the gapmer layout FG-F' may for example be 12 to 32 nucleosides, such as 13 to 24 such as 14 to 22 nucleosides, such as 14 to 17 such as 16 to 18 nucleosides.

[0319] By way of example, a gapmer oligonucleotide of the invention may be represented by the following formula:

[0320] F 1-8 -G 5-16 -F' 1-8 ,like

[0321] F 1-8 -G 7-16 -F' 2-8

[0322] Provided that the overall length of the gapmer region FG-F' is at least 12, such as at least 14 nucleotides in length.

[0323] Regions F, G and F' are further defined below and may be incorporated into the formula FG-F'.

[0324] Gapmer-Region G

[0325] The region G (gap region) of the gapmer is a region of nucleosides, typically DNA nucleosides, that enables the oligonucleotide to recruit RNase H, such as human RNase H1. RNase H is a cellular enzyme that recognizes duplexes between DNA and RNA and enzymatically cleaves RNA molecules. Suitable gapmers can have a gap region (G) of at least 5 or 6 consecutive DNA nucleosides, such as 5-16 consecutive DNA nucleosides, such as 6-15 consecutive DNA nucleosides, such as 7-14 consecutive DNA nucleosides, such as 8-12 consecutive DNA nucleotides, such as 8-12 consecutive DNA nucleotides. In some embodiments, the gap region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive DNA nucleosides. In some cases, the cytosine (C) DNA in the gap region can be methylated, and such residues are annotated as 5-methyl-cytosine ( me C or e with substitution of c). If the cg dinucleotide is present in the gap, methylation of the cytosine DNA in the gap is beneficial to reduce potential toxicity, and this modification has no significant effect on the efficacy of the oligonucleotide.

[0326] In some embodiments, the gap region G can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 consecutive phosphorothioate linked DNA nucleosides. In some embodiments, all internucleoside bonds in the gap are phosphorothioate bonds.

[0327] Although conventional gapmers have a DNA gap region, there are numerous examples of modified nucleosides that allow recruitment of RNase H when the modified nucleosides are used inside the gap region. Modified nucleosides that are capable of recruiting RNase H when the modified nucleosides are incorporated inside the gap region have been reported to include, for example, α-L-LNA, C4' alkylated DNA (as described in PCT / EP2009 / 050349 and Vester et al., Bioorg. Med. Chem. Lett. 18 (2008) 2296-2300, both of which are incorporated herein by reference), arabinose-derivatized nucleosides such as ANA and 2'F-ANA (Mangosr et al. 2003 J. AM. CHEM. SOC. 125, 654-661), UNA (unlocked nucleic acid) (as described in Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which are incorporated herein by reference). UNA is a non-locked nucleic acid, generally in which the bond between C2 and C3 of the ribose has been removed, forming a non-locked "sugar" residue. The modified nucleosides used in such gapmers can be nucleosides that adopt a 2' internal (DNA-like) structure when introduced into the gap region, i.e., modifications that allow the recruitment of RNase H. In some embodiments, the DNA gap region (G) described herein can optionally contain 1 to 3 sugar-modified nucleosides that adopt a 2' internal (DNA-like) structure when introduced into the gap region.

[0328] Area G - Gap-breaker

[0329] Alternatively, there are numerous reports of inserting modified nucleosides that confer a 3' endo conformation into the gap region of a gapmer while retaining some RNase H activity. Such gapmers with a gap region comprising one or more 3' endo modified nucleosides are referred to as "gap-breakers" or "gap-disrupted" gapmers, see, for example, WO2013 / 022984. The gap breaker oligonucleotide retains enough DNA nucleoside region inside the gap region to allow the recruitment of RNase H. The ability of the gap breaker oligonucleotide layout to recruit RNase H is generally sequence-specific or even compound-specific - see Rukov et al., 2015 Nucl. Acids Res. Vol. 43, pp. 8476-8487, which discloses "gap-breaker" oligonucleotides that recruit RNase H that provide more specific target RNA cleavage in some cases. The modified nucleosides used inside the gap region of the gap breaker oligonucleotide can be, for example, modified nucleosides that confer a 3' endo conformation, such as 2'-O-methyl (OMe) or 2'-O-MOE (MOE) nucleosides, or β-D LNA nucleosides (the bridge between C2' and C4' of the ribose sugar ring of the nucleoside is in the β conformation), such as β-D-oxy LNA or ScET nucleosides.

[0330] As with the gapmer containing region G described above, the gap region of the gapbreaker gapmer or the gap-hindering gapmer has a DNA nucleoside at the 5' end of the gap (adjacent to the 3' nucleoside of region F) and a DNA nucleoside at the 3' end of the gap (adjacent to the 5' nucleoside of region F'). Gapmers containing hindered gaps generally retain a region of at least 3 or 4 consecutive DNA nucleosides at the 5' end or 3' end of the gap region.

[0331] An exemplary layout of a gap breaker oligonucleotide includes

[0332] F 1-8 -[D 3-4 -E1-D 3-4 ]-F' 1-8

[0333] F 1-8 -[D 1-4 -E1-D 3-4 ]-F' 1-8

[0334] F 1-8 -[D 3-4 -E1-D 1-4 ]-F' 1-8

[0335] The region G is in brackets [D n -Er -D m ] within the scope of, D is a contiguous DNA nucleoside sequence, E is a modified nucleoside (a gap breaker or a gap-blocking nucleoside), and F and F' are flanking regions as defined herein, and with the proviso that the overall length of the gapmer region FG-F' is at least 12, such as at least 14 nucleotides in length.

[0336] In some embodiments, the region G of the gapmer that hinders the gap comprises at least 6 DNA nucleosides, such as 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16 DNA nucleosides. As previously described, the DNA nucleosides may be consecutive or may be optionally interspersed with one or more modified nucleosides, provided that the gap region G is capable of mediating RNase H recruitment.

[0337] Gapmer-flanking regions, F and F'

[0338] Region F is present immediately adjacent to the 5' DNA nucleoside of region G. The 3' last nucleoside of region F is a sugar modified nucleoside, such as a sugar modified high affinity nucleoside, for example a 2' substituted nucleoside, such as a MOE nucleoside, or a LNA nucleoside.

[0339] Region F' is present immediately adjacent to the 3' DNA nucleoside of region G. The 5' last nucleoside of region F' is a sugar modified nucleoside, such as a sugar modified high affinity nucleoside, for example a 2' substituted nucleoside, such as a MOE nucleoside, or an LNA nucleoside.

[0340] Region F has a length of 1-8 consecutive nucleotides, such as 2-6, such as 3-4 consecutive nucleotides. Advantageously, the 5'-last nucleoside of region F' is a sugar-modified nucleoside. In some embodiments, the two 5'-last nucleosides of region F are sugar-modified nucleosides. In some embodiments, the 5'-last nucleoside of region F is an LNA nucleoside. In some embodiments, the two 5'-last nucleosides of region F are LNA nucleosides. In some embodiments, the two 5'-last nucleosides of region F are 2'-substituted nucleosides, such as two 3'MOE nucleosides. In some embodiments, the 5'-last nucleoside of region F is a 2'-substituted nucleoside, such as a MOE nucleoside.

[0341] Region F' has a length of 2-8 consecutive nucleotides, such as 3-6, such as 4-5 consecutive nucleotides. Advantageously, in some embodiments, the 3'-last nucleoside of region F' is a sugar-modified nucleoside. In some embodiments, the two 3'-last nucleosides of region F' are sugar-modified nucleosides. In some embodiments, the two 3'-last nucleosides of region F' are LNA nucleosides. In some embodiments, the 3'-last nucleosides of region F' are LNA nucleosides. In some embodiments, the two 3'-last nucleosides of region F' are 2'-substituted nucleosides, such as two 3'MOE nucleosides. In some embodiments, the 3'-last nucleosides of region F' are 2'-substituted nucleosides, such as MOE nucleosides.

[0342] It should be noted that when the length of region F and / or region F' is one, it is advantageously an LNA nucleoside.

[0343] In some embodiments, region F and region F' independently consist of or comprise a continuous sequence of sugar-modified nucleosides. In some embodiments, the sugar-modified nucleosides of region F can be independently selected from 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, LNA units, arabino nucleic acid (ANA) units, and 2'-fluoro-ANA units.

[0344] In some embodiments, region F and region F' independently comprise LNA and 2' substituted modified nucleosides (mixed flank layout).

[0345] In some embodiments, region F and region F' consist of only one type of sugar-modified nucleosides (eg, only MOE or only β-D-oxy LNA or only ScET).This type of design is also called a unified flank design or a unified gapmer design.

[0346] In some embodiments, all nucleosides of region F or region F' or F and F' are LNA nucleosides, such as independently selected from β-D-oxy LNA, ENA or ScET nucleosides. In some embodiments, region F consists of 1-5, such as 2-4, such as 3-4, such as 1, 2, 3, 4 or 5 consecutive LNA nucleosides. In some embodiments, all nucleosides of region F and region F' are β-D-oxy LNA nucleosides.

[0347] In some embodiments, all nucleosides of region F or region F', or F and F' are 2'substituted nucleosides, such as OMe or MOE nucleosides. In some embodiments, region F consists of 1, 2, 3, 4, 5, 6, 7 or 8 consecutive OMe or MOE nucleosides. In some embodiments, only one of the flanking regions may consist of 2'substituted nucleosides (such as OMe or MOE nucleosides). In some embodiments, it is the 5'(F) flanking region that consists of 2'substituted nucleosides (such as OMe or MOE nucleosides), while the 3'(F') flanking region comprises at least one LNA nucleoside, such as β-D-oxy LNA nucleosides or cET nucleosides. In some embodiments, it is the 3'(F') flanking region that consists of 2'substituted nucleosides (such as OMe or MOE nucleosides), while the 5'(F) flanking region comprises at least one LNA nucleoside, such as β-D-oxy LNA nucleosides or cET nucleosides.

[0348] In some embodiments, all modified nucleosides of region F and region F' are LNA nucleosides, such as independently selected from β-D-oxy LNA, ENA or ScET nucleosides, wherein region F or region F' or F and F' may optionally contain DNA nucleosides (alternating flanks, see the definitions of these regions for more details). In some embodiments, all modified nucleosides of region F and region F' are β-D-oxy LNA nucleosides, wherein region F or region F' or F and F' may optionally contain DNA nucleosides (alternating flanks, see the definitions of these regions for more details).

[0349] In some embodiments, the 5'-last nucleoside and the 3'-last nucleoside of region F and region F' are LNA nucleosides, such as β-D-oxy LNA nucleosides or ScET nucleosides.

[0350] In some embodiments, the internucleoside bond between region F and region G is a phosphorothioate internucleoside bond. In some embodiments, the internucleoside bond between region F' and region G is a phosphorothioate internucleoside bond. In some embodiments, the internucleoside bond between nucleosides in region F or regions F', F and F' is a phosphorothioate internucleoside bond.

[0351] Other gapmer designs are disclosed in WO 2004 / 046160, WO 2007 / 146511 and WO 2008 / 113832, which are hereby incorporated herein by reference.

[0352] LNA gapmer

[0353] An LNA gapmer is one in which either or both of region F and region F' comprises or consists of an LNA nucleoside. A β-D-oxy gapmer is one in which either or both of region F and region F' comprises or consists of a β-D-oxy LNA nucleoside.

[0354] In some embodiments, the LNA gapmer has the formula: [LNA] 1–5 -[Region G]-[LNA] 1-5 , wherein region G is defined as in the definition of gapmer region G.

[0355] MOE gapmer

[0356] A MOE gapmer is a gapmer in which region F and region F' consist of MOE nucleosides. In some embodiments, the MOE gapmer has the following layout: [MOE] 1-8 -[Region G]-[MOE] 1-8 , such as [MOE] 2-7 -[Area G] 5-16 -[MOE] 2-7 , such as [MOE] 3-6 -[Region G]-[MOE] 3-6 , wherein region G is defined as in the definition of gapmer. MOE gapmers with a 5-10-5 layout (MOE-DNA-MOE) have been widely used in the art.

[0357] Hybrid Flank Gapmer

[0358] A hybrid flank gapmer is an LNA gapmer in which one or both of region F and region F' comprises a 2'-substituted nucleoside, such as a 2'-substituted nucleoside independently selected from the following: 2'-O-alkyl-RNA units, 2'-O-methyl-RNA, 2'-amino-DNA units, 2'-fluoro-DNA units, 2'-alkoxy-RNA, MOE units, arabino nucleic acid (ANA) units and 2'-fluoro-ANA units, such as MOE nucleosides. In some embodiments in which at least one of region F and region F' or both region F and region F' comprise at least one LNA nucleoside, the remaining nucleosides of region F and region F' are independently selected from MOE and LNA. In some embodiments in which at least one of region F and region F' or both region F and region F' comprise at least two LNA nucleosides, the remaining nucleosides of region F and region F' are independently selected from MOE and LNA. In some hybrid flank embodiments, one or both of region F and region F' may further comprise one or more DNA nucleosides.

[0359] Mixed flanking gapmer layouts are disclosed in WO 2008 / 049085 and WO 2012 / 109395, both of which are hereby incorporated herein by reference.

[0360] Alternating flank gapmers

[0361] The flanking regions may comprise both LNA nucleosides and DNA nucleosides and are referred to as "alternating flankings" because they comprise an alternating motif of LNA-DNA-LNA nucleosides. Gapmers comprising such alternating flankings are referred to as "alternating flanking gapmers". "Alternating flanking gapmers" are therefore LNA gapmer oligonucleotides in which at least one of the flankings (F or F') comprises DNA nucleosides in addition to LNA nucleosides. In some embodiments, at least one of region F or region F' or both region F and region F' comprise both LNA nucleosides and DNA nucleosides. In such embodiments, the flanking regions F or F', or both F and F', comprise at least three nucleosides, wherein the 5' and 3' last nucleosides of the F and / or F' regions are LNA nucleosides.

[0362] Alternating flanking LNA gapmers are disclosed in WO 2016 / 127002.

[0363] The alternating flanking regions may comprise up to 3 consecutive DNA nucleosides, such as 1 to 2 or 1 or 2 or 3 consecutive DNA nucleosides.

[0364] The alternating flanks may be annotated as a series of integers representing the number of LNA nucleosides (L) followed by the number of DNA nucleosides (D), e.g.

[0365] [L] 1-3 -[D] 1-4 -[L] 1-3

[0366] [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2

[0367] In the oligonucleotide layout, these will often be represented as numbers, whereby 2-2-1 represents 5'[L]2-[D]2-[L]3', and 1-1-1-1-1 represents 5'[L]-[D]-[L]-[D]-[L]3'. The length of the flanks (region F and region F') in an oligonucleotide with alternating flanks may independently be 3 to 10 nucleosides, such as 4 to 8, such as 5 to 6 nucleosides, such as 4, 5, 6 or 7 modified nucleosides. In some embodiments, only one of the flanks in a gapmer oligonucleotide is alternating, while the other is composed of LNA nucleotides. It may be advantageous to have at least two LNA nucleosides at the 3' end of the 3' flank (F') to confer additional exonuclease resistance. Some examples of oligonucleotides with alternating flanks are:

[0368] [L] 1-5 -[D] 1-4 -[L] 1-3 -[G] 5-16 -[L] 2-6

[0369] [L] 1-2 -[D] 1-2 -[L] 1-2 -[D] 1-2 -[L] 1-2 -[G] 5-16 -[L] 1-2 -[D] 1-3 -[L] 2-4

[0370] [L] 1-5 -[G] 5-16 -[L]-[D]-[L]-[D]-[L]2

[0371] Provided that the overall length of the gapmer is at least 12, such as at least 14 nucleotides in length.

[0372] Region D' or D" in the oligonucleotide

[0373] In some embodiments, the oligonucleotides of the invention may comprise or consist of a contiguous nucleotide sequence of the oligonucleotide that is complementary to the target nucleic acid (e.g., gapmer FG-F') and other 5' and / or 3' nucleosides. The other 5' and / or 3' nucleosides may or may not be completely complementary to the target nucleic acid. Such other 5' and / or 3' nucleosides may be referred to herein as regions D' and D".

[0374] To link a contiguous nucleotide sequence (such as a gapmer) to a conjugate moiety or another functional group, an additional region D' or D" can be used. When used for ligation, the contiguous nucleotide sequence with the conjugate moiety can act as a biocleavable linker. Alternatively, it can be used to provide exonuclease protection or facilitate synthesis or manufacturing.

[0375] Regions D' and D" may be linked to the 5' end of region F or the 3' end of region F', respectively, to produce a layout of the formula: D'-FG-F', FG-F'-D", or D'-FG-F'-D".

[0376] In this example, FG-F' is the gapmer portion of the oligonucleotide and regions D' or D" constitute independent portions of the oligonucleotide.

[0377] Region D' or D" may independently comprise or consist of 1, 2, 3, 4 or 5 additional nucleotides, which may or may not be complementary to the target nucleic acid. The nucleotides adjacent to the F or F' region are not sugar-modified nucleotides, such as DNA or RNA or base-modified forms of these. The D' or D" region may act as a nuclease-labile biocleavable linker (see definition of linker). In some embodiments, the additional 5' and / or 3' terminal nucleotides are linked by phosphodiester bonds and are DNA or RNA. Nucleotide-based biocleavable linkers suitable for use as region D' or D" are disclosed in WO 2014 / 076195, which include, by way of example, phosphodiester-linked DNA dinucleotides. WO 2015 / 113922 discloses the use of biocleavable linkers in multi-oligonucleotide constructs, wherein they are used to connect multiple antisense constructs (e.g., gapmer regions) within a single oligonucleotide.

[0378] In one embodiment, the oligonucleotide of the present invention comprises, in addition to the contiguous nucleotide sequence constituting the gapmer, a region D' and / or D".

[0379] In some embodiments, the oligonucleotides of the invention can be represented by the following formula:

[0380] FG-F'; especially F 1-8 -G 5-16 -F' 2-8

[0381] D'-FG-F'; especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8

[0382] FG-F'-D"; especially F 1-8 -G 5-16 -F'2-8 -D" 1-3

[0383] D'-FG-F'-D"; especially D' 1-3 -F 1-8 -G 5-16 -F' 2-8 -D" 1-3

[0384] In some embodiments, the internucleoside bond between region D′ and region F is a phosphodiester bond. In some embodiments, the internucleoside bond between region F′ and region D″ is a phosphodiester bond.

[0385] Totalmers

[0386] In some embodiments, all nucleosides of an oligonucleotide or a contiguous nucleotide sequence thereof are sugar-modified nucleosides. Such oligonucleotides are referred to herein as full polymers.

[0387] In some embodiments, all sugar-modified nucleosides of the whole polymer contain the same sugar modification, for example, they can all be LNA nucleosides, or can all be 2'O-MOE nucleosides. In some embodiments, the sugar-modified nucleosides of the whole polymer can be independently selected from LNA nucleosides and 2'substituted nucleosides, such as 2'substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide contains LNA nucleosides and 2'substituted nucleosides, such as 2'substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide comprises LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, the oligonucleotide comprises (S)cET LNA nucleosides and 2'-O-MOE nucleosides. In some embodiments, each nucleoside unit of the oligonucleotide is a 2' substituted nucleoside. In some embodiments, each nucleoside unit of the oligonucleotide is 2'-O-MOE.

[0388] In some embodiments, all nucleosides of the oligonucleotide or its contiguous nucleotide sequence are LNA nucleosides, such as β-D-oxy-LNA nucleosides and / or (S) cET nucleosides. In some embodiments, such LNA full polymer oligonucleotides have a length of between 7-12 nucleosides (see, e.g., WO 2009 / 043353). Such short complete LNA oligonucleotides are particularly effective in inhibiting microRNAs.

[0389] Several full-polymer compounds are highly effective as therapeutic oligomers, especially when targeting microRNAs (anti-miRs) or as splice-switching oligomers (SSOs).

[0390] In some embodiments, the holopolymer comprises or consists of at least one XYX or YXY sequence motif, such as a repeating sequence XYX or YXY, wherein X is LNA and Y is an alternative (i.e., non-LNA) nucleotide analog, such as a 2'-OMe RNA unit and a 2'-fluoro DNA unit. In some embodiments, the above sequence motif may be, for example, XXY, XYX, YXY, or YYX.

[0391] In some embodiments, the holopolymer may comprise or consist of a contiguous nucleotide sequence of between 7 and 24 nucleotides, such as 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides.

[0392] In some embodiments, the contiguous nucleotide sequence of the full polymer comprises at least 30%, such as at least 40%, such as at least 50%, such as at least 60%, such as at least 70%, such as at least 80%, such as at least 90%, such as 95%, such as 100% LNA units. For complete LNA compounds, it is advantageous that they have a length of less than 12 (such as 7-10) nucleotides.

[0393] The remaining units may be selected from the non-LNA nucleotide analogues mentioned herein, such as those selected from 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, PNA units, HNA units, INA units and 2'MOE RNA units or selected from 2'-OMe RNA units and 2'-fluoro DNA units.

[0394] Polymer

[0395] The term 'mixed polymer' refers to an oligomer comprising both DNA nucleosides and sugar-modified nucleosides, wherein there is a continuous DNA nucleoside of insufficient length to recruit RNase H. Suitable mixed polymers may contain up to 3 or up to 4 continuous DNA nucleosides. In some embodiments, the mixed polymer or its continuous nucleotide sequence comprises alternating sugar-modified nucleoside regions and DNA nucleoside regions. Oligonucleotides that do not recruit RNase H can be prepared by incorporating alternating regions of sugar-modified nucleosides that form an RNA-like (3' internal) conformation with a short DNA nucleoside region when incorporated into an oligonucleotide. Advantageously, the sugar-modified nucleoside is a sugar-modified nucleoside that enhances affinity.

[0396] Oligonucleotide polymers are often used to provide occupancy-based regulation of target genes such as splicing regulators or microRNA inhibitors.

[0397] In some embodiments, the sugar-modified nucleosides in the mixed polymer or its contiguous nucleotide sequence comprise or are all LNA nucleosides, such as (S)cET or β-D-oxy LNA nucleosides.

[0398] In some embodiments, all sugar-modified nucleosides of the mixed polymer contain the same sugar modification, for example, they can all be LNA nucleosides, or can all be 2'O-MOE nucleosides. In some embodiments, the sugar-modified nucleosides of the mixed polymer can be independently selected from LNA nucleosides and 2'substituted nucleosides, such as 2'substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide contains LNA nucleosides and 2'substituted nucleosides, such as 2'substituted nucleosides selected from the following: 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA (MOE), 2'-amino-DNA, 2'-fluoro-RNA and 2'-F-ANA nucleosides. In some embodiments, the oligonucleotide comprises an LNA nucleoside and a 2'-O-MOE nucleoside. In some embodiments, the oligonucleotide comprises an (S)cET LNA nucleoside and a 2'-O-MOE nucleoside.

[0399] In some embodiments, the mixed polymer or its contiguous nucleotide sequence comprises only LNA and DNA nucleosides, such LNA mixed polymer oligonucleotides may, for example, be between 8-24 nucleosides in length (see, for example, WO2007112754, which discloses LNA antmiR inhibitors of microRNAs).

[0400] Various mixed-polymer compounds are highly effective as therapeutic oligomers, especially when targeting microRNAs (anti-miRs) or as splice-switching oligomers (SSOs).

[0401] In some embodiments, the mixed polymer comprises the following motif

[0402] …[L]m[D]n[L]m[D]n[L]m…or

[0403] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m…or

[0404] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…or

[0405] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…

[0406] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…or

[0407] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…or

[0408] …[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…or

[0409] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m…

[0410] Wherein L represents a sugar-modified nucleoside such as LNA or a 2'substituted nucleoside (e.g., 2'-O-MOE), D represents a DNA nucleoside, and wherein each m is independently selected from 1-6, and each n is independently selected from 1, 2, 3, and 4, such as 1-3. In some embodiments, each L is an LNA nucleoside. In some embodiments, at least one L is an LNA nucleoside and at least one L is a 2'-O-MOE nucleoside. In some embodiments, each L is independently selected from LNA and 2'-O-MOE nucleosides.

[0411] In some embodiments, the mixed polymer may comprise or consist of a contiguous nucleotide sequence of between 10 and 24 nucleotides, such as 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 nucleotides.

[0412] In some embodiments, the contiguous nucleotide sequence of the mixed polymer comprises at least 30%, such as at least 40%, such as at least 50%, LNA units.

[0413] In some embodiments, the mixed polymer comprises or consists of a contiguous nucleotide sequence of a nucleotide analogue and a naturally occurring nucleotide repeating pattern, or a nucleotide analogue of one type and a nucleotide analogue of a second type. The repeating pattern may, for example, be as follows: every second or every third nucleotide is a nucleotide analogue, such as LNA, and the remaining nucleotides are naturally occurring nucleotides, such as DNA, or may be 2' substituted nucleotide analogues such as 2'MOE of the 2' fluoro analogues mentioned herein, or in some embodiments, may be selected from the group of nucleotide analogues mentioned herein. It is recognized that the repeating pattern of nucleotide analogues (such as LNA units) may be combined with nucleotide analogues at fixed positions - for example at the 5' or 3' end.

[0414] In some embodiments, counting from the 3' end, the first nucleotide of the oligomer is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0415] In some embodiments, which may be the same or different, the second nucleotide of the oligomer, counting from the 3' end, is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0416] In some embodiments, which may be the same or different, the 5' end of the oligomer is a nucleotide analog, such as an LNA nucleotide or a 2'-O-MOE nucleoside.

[0417] In some embodiments, the mixed polymer comprises at least one region comprising at least two consecutive nucleotide analogue units (such as at least two consecutive LNA units).

[0418] In some embodiments, the mixed polymer comprises at least one region comprising at least three consecutive nucleotide analogue units (such as at least three consecutive LNA units).

[0419] exosomes

[0420] Exosomes are natural biological nanovesicles that participate in cell-cell communication with the help of functionally active cargos (such as miRNA, mRNA, DNA and proteins), generally ranging from 30 to 500 nm.

[0421] Exosomes are secreted by all types of cells and are also abundantly present in body fluids, such as saliva, blood, urine and milk. The main function of exosomes is to carry information by delivering a variety of effectors or signaling molecules between specific cells (Acta Pol Pharm. 2014 July-August; 71(4):537-43). Such effectors or signaling molecules can be, for example, proteins, miRNAs or mRNAs. Exosomes are currently being explored as delivery vehicles for various drug molecules (including RNA therapeutic molecules) to expand the therapeutic and diagnostic applications of such molecules. There are disclosures in the art of exosomes loaded with synthetic molecules such as siRNA, antisense oligonucleotides and small molecules, wherein the exosomes suggest or show advantages compared to free drug molecules with respect to the delivery and efficacy of such molecules (see, e.g., Andaloussi et al. 2013 Advanced Drug Delivery Reviews 65:391-397, WO2014 / 168548, WO2016 / 172598, WO2017 / 173034 and WO 2018 / 102397).

[0422] Exosomes can be isolated from biological sources, such as milk (milk exosomes), especially bovine milk is a rich source for isolating bovine milk exosomes. See, for example, Manca et al., Scientific Reports (2018) 8: 11321.

[0423] In some embodiments of the present invention, the single-stranded oligonucleotide is encapsulated in exosomes (exosome preparations), and an example of loading exosomes with single-stranded antisense oligonucleotides is described in EP application number 18192614.8. In the method of the present invention, the antisense oligonucleotide can be administered to cells or subjects in the form of exosome preparations, and oral administration of exosome preparations is particularly contemplated.

[0424] In some embodiments, the antisense oligonucleotide can be conjugated, for example, with a lipophilic conjugate such as cholesterol, which can be covalently linked to the antisense oligonucleotide via a bio-cleavable linker (e.g., a region of phosphodiester-linked DNA nucleotides). Such lipophilic conjugates can facilitate the entry of antisense oligonucleotide formulations into exosomes and can further enhance delivery to target cells.

[0425] Conjugate

[0426] The term "conjugate" as used herein refers to an oligonucleotide covalently linked to a non-nucleotide moiety (conjugate moiety or region C or third region).

[0427] The conjugation of oligonucleotides of the present invention with one or more non-nucleotide parts can improve the pharmacology of oligonucleotides, for example, by affecting the activity, cell distribution, cellular uptake or stability of oligonucleotides. In some embodiments, the conjugate part regulates or enhances the pharmacokinetic properties of oligonucleotides by improving the cellular distribution, bioavailability, metabolism, excretion, permeability and / or cellular uptake of oligonucleotides. In particular, the conjugate can guide the oligonucleotide to a specific organ, tissue or cell type and thus enhance the effectiveness of the oligonucleotide in such an organ, tissue or cell type. Meanwhile, the conjugate can play a role in reducing the activity of oligonucleotides in non-target cell types, tissues or organs (e.g., off-target activity or activity in non-target cell types, tissues or organs).

[0428] WO 93 / 07883 and WO 2013 / 033230 provide suitable conjugate moieties, and the document is thus incorporated herein by reference. Other suitable conjugate moieties are those that can bind to asialoglycoprotein receptor (ASGPR). In particular, trivalent N-acetylgalactosamine conjugate moieties are suitable for binding to ASGPR, see, for example, WO 2014 / 076196, WO 2014 / 207232 and WO 2014 / 179620 (the document is thus incorporated herein by reference). Such conjugates are used to enhance the uptake of oligonucleotides to the liver while reducing their presence in the kidney, thereby increasing the liver / kidney ratio of the conjugated oligonucleotides compared to the unconjugated form of the same oligonucleotide.

[0429] Oligonucleotide conjugates and their synthesis have also been reported in the following literature: Comprehensive review by Manoharan, cited in Antisense Drug Technology, Principles, Strategies, and Applications, ST Crooke, ed., Chapter 16, Marcel Dekker, Inc., 2001 and Manoharan, Antisense and Nucleic Acid Drug Development, 2002, 12, 103, each of which is incorporated herein by reference in its entirety.

[0430] In one embodiment, the non-nucleotide moiety (conjugate moiety) is selected from a sugar, a cell surface receptor ligand, a drug, a hormone, a lipophilic substance, a polymer, a protein, a peptide, a toxin (e.g., a bacterial toxin), a vitamin, a viral protein (e.g., a capsid), or a combination thereof.

[0431] Connectors

[0432] A bond or linker is a connection between two atoms that binds one chemical group or segment of interest to another chemical group or segment of interest by means of one or more covalent bonds. The conjugate moiety can be directly linked to the oligonucleotide or connected through a linking moiety (e.g., a linker or tether). The linker serves to covalently link a third region, such as a conjugate moiety (region C), to a first region, such as an oligonucleotide or a continuous nucleotide sequence (region A) that is complementary to the target nucleic acid.

[0433] In some embodiments of the present invention, the conjugate or oligonucleotide conjugate of the present invention may optionally include a linker region (second region or region B and / or region Y) located between the oligonucleotide or continuous nucleotide sequence (region A or first region) complementary to the target nucleic acid and the conjugate portion (region C or third region).

[0434] Region B refers to a biocleavable linker that contains or consists of a physiologically labile bond that is cleavable under conditions commonly encountered inside the mammalian body or under conditions similar to those encountered inside the mammalian body. Conditions under which a physiologically labile linker undergoes chemical transformation (e.g., cleavage) include chemical conditions such as pH, temperature, oxidative or reductive conditions or substances, and salt concentrations that are present in mammalian cells or similar to those encountered in mammalian cells. Mammalian intracellular conditions also include the presence of enzyme activity that normally occurs in mammalian cells, such as from proteases or hydrolases or nucleases. In one embodiment, the biocleavable linker is susceptible to cleavage by S1 nuclease. In a preferred embodiment, the nuclease-sensitive linker comprises between 1 and 10 nucleosides, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 nucleosides, more preferably between 2 and 6 nucleosides and most preferably between 2 and 4 linked nucleosides, the nucleosides comprising at least two consecutive phosphodiester bonds, such as at least 3 or 4 or 5 consecutive phosphodiester bonds. Preferably, the nucleoside is DNA or RNA. Phosphodiester-containing biocleavable linkers are described in more detail in WO 2014 / 076195 (which is hereby incorporated herein by reference).

[0435] Region Y refers to such a linker, which does not have to be biocleavable, but mainly plays the following role: covalently linking the conjugate part (region C or the third region) to the oligonucleotide (region A or the first region). The region Y linker can contain a chain structure or oligomer of repeating units such as ethylene glycol units, amino acid units or aminoalkyl groups. The oligonucleotide conjugates of the present invention can be composed of the following regional elements AC, ABC, ABYC, AYBC or AYC. In some embodiments, the linker (region Y) is an aminoalkyl group, such as a C2-C36 aminoalkyl group, for example, including C6 to C12 aminoalkyl groups. In a preferred embodiment, the linker (region Y) is a C6 aminoalkyl group.

[0436] Application

[0437] The oligonucleotides or pharmaceutical compositions of the invention can be administered topically (e.g., to the skin, by inhalation, to the eye, or to the ear) or enterally (e.g., orally or via the gastrointestinal tract) or parenterally (e.g., intravenously, subcutaneously, intramuscularly, intracerebrally, intracerebroventricularly, or intrathecally).

[0438] In some embodiments, the oligonucleotide or pharmaceutical composition of the present invention is administered by a parenteral route, including intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion, intrathecal or intracranial, such as intracerebral or intraventricular, intravitreal administration. In one embodiment, an active oligonucleotide or oligonucleotide conjugate is administered intravenously. In another embodiment, an oligonucleotide or oligonucleotide conjugate active for subcutaneous administration is administered subcutaneously.

[0439] In some embodiments, the oligonucleotide, oligonucleotide conjugate or pharmaceutical composition of the invention is administered at a dose of 0.1-15 mg / kg, such as 0.2-10 mg / kg, such as 0.25-5 mg / kg. Administration may be once a week, every 2 weeks, every three weeks, once a month or twice a month.

[0440] The present invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the present invention as described for the manufacture of a medicament, wherein the medicament is in an ophthalmic dosage form such as an intravitreal injection dosage form. In some embodiments, the ophthalmic oligonucleotide is Htra-1.

[0441] The present invention also provides the use of an oligonucleotide or oligonucleotide conjugate of the present invention as described for the manufacture of a medicament, wherein the medicament is in a dosage form for intravenous, subcutaneous, intramuscular, intracerebral, intracerebroventricular or intrathecal administration (eg injection).

[0442] Schematic advantages

[0443] As shown herein, the achiral phosphorodithioate internucleoside linkages used in the compounds of the invention allow for the reduction of complexity of non-stereo-defined phosphorothioate oligonucleotides while maintaining the activity, efficacy or potency of the oligonucleotide.

[0444] Indeed, as demonstrated herein, the compounds used in the present invention provide unique benefits when combined with stereodefined phosphorothioates, thereby providing the opportunity to further reduce the complexity of phosphorothioate oligonucleotides while retaining or improving the activity, efficacy or potency of the oligonucleotide.

[0445] As shown herein, the achiral phosphorodithioate internucleoside linkages employed in the compounds of the invention allow for improved cellular uptake in vitro or in vivo.

[0446] As shown herein, the achiral phosphorodithioate internucleoside bonds used in the compounds of the invention allow for altered or improved biodistribution in vitro (measured as tissue content or cell content or activity / potency in target tissues). Notably, we have seen improvements in tissue uptake, content and / or potency in skeletal muscle, heart, spleen, liver, kidney, fibroblasts, epithelial cells.

[0447] In the case of mixed-polymer oligonucleotides, the inventors have identified that incorporation of phosphorodithioate bonds between or adjacent to one or more DNA nucleosides (as shown in (IA) or (IB)) provides improvements, such as increased stability and / or improved potency. In the case of gapmer oligonucleotides, the inventors have seen that incorporation of phosphorodithioate bonds between nucleosides in the flanking regions (such as between 2' sugar-modified nucleosides) (as shown in (IA) or (IB)) also provides improvements, such as increased stability and / or improved potency.

[0448] As shown herein, the non-chiral dithiophosphate nucleoside bonds used in the compounds of the present invention allow for improved oligonucleotide stability. Incorporation of non-chiral dithiophosphate nucleosides in the compounds of the present invention provides enhanced resistance to serum exonucleases and cellular exonucleases, especially 3' exonucleases, and additional 5' exonucleases, and the apparent stability of the compounds of the present invention further suggests resistance of compounds incorporating non-chiral dithiophosphate bonds to endonucleases. Stabilizing oligonucleotides is particularly important in reducing or preventing the accumulation of toxic degradation products and prolonging the duration of action of antisense oligonucleotides. As shown in the examples, rat serum stability can be used to analyze improved stability. In order to evaluate cell stability, tissue (e.g., liver) homogenate extracts can be used - for example, see WO2014076195 providing such methods. Other assays for measuring oligonucleotide stability include snake venom phosphodiesterase stability assays and S1 nuclease stability.

[0449] The reduced toxicity risk of the claimed oligonucleotides is tested with an in vitro hepatotoxicity assay (e.g., as disclosed in WO 2017 / 067970) or an in vitro nephrotoxicity assay (e.g., as disclosed in WO 2017 / 216340) or an in vitro neurotoxicity assay (e.g., as disclosed in WO2016127000). Alternatively, toxicity can be determined in vivo, for example, in mice or rats.

[0450] Enhanced stability may provide benefits to the duration of action of the oligonucleotides of the invention, which is particularly advantageous when the route of administration is diffusive, such as parenteral, e.g., intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular, or intrathecal.

[0451] General Oligonucleotide Embodiments

[0452] 1. An antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0453]

[0454] wherein one of the two oxygen atoms is attached to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is attached to the 5' carbon atom of the other adjacent nucleoside (A2), wherein at least one of the two nucleosides (A1) and (A2) is an LNA nucleoside and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation.

[0455] 2. The oligonucleotide according to embodiment 1, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a DNA nucleoside, an RNA nucleoside or a sugar-modified nucleoside.

[0456] 3. The oligonucleotide according to embodiment 1 or 2, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a DNA nucleoside or a sugar-modified nucleoside.

[0457] 4. The oligonucleotide according to any one of embodiments 1 to 3, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a DNA nucleoside.

[0458] 6. The oligonucleotide according to any one of embodiments 1 to 3, wherein one of (A1) and (A2) is an LNA nucleoside and the other is a sugar-modified nucleoside.

[0459] 7. The oligonucleotide according to any one of embodiments 2 to 6, wherein the sugar modified nucleoside is a 2'-sugar modified nucleoside.

[0460] 8. The oligonucleotide according to embodiment 7, wherein the 2'-sugar modified nucleoside is a 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleoside.

[0461] 9. The oligonucleotide according to embodiment 7 or 8, wherein the 2'-sugar modified nucleoside is an LNA nucleoside.

[0462] 10. The oligonucleotide according to any one of embodiments 1 to 9, wherein the LNA nucleosides are independently selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA.

[0463] 11. An oligonucleotide according to embodiment 9 or 10, wherein the LNA nucleosides are all β-D-oxy LNA.

[0464] 12. The oligonucleotide according to embodiment 7 or 8, wherein the 2'-sugar modified nucleoside is 2'-alkoxyalkoxy-RNA.

[0465] 13. The oligonucleotide according to embodiment 10, wherein the 2'-alkoxy-RNA is 2'-methoxy-RNA.

[0466] 14. The oligonucleotide according to any one of embodiments 1 to 12, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA.

[0467] 15. The oligonucleotide according to any one of embodiments 1 to 14, comprising between 1 and 15, in particular between 1 and 5, more particularly 1, 2, 3, 4 or 5 phosphorodithioate internucleoside linkages of formula (IA) or (IB) as defined in embodiment 1.

[0468] 16. The oligonucleotide according to any one of embodiments 1 to 15, comprising other internucleoside bonds independently selected from phosphodiester internucleoside bonds, phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (IA) or (IB) as defined in embodiment 1.

[0469] 17. The oligonucleotide according to embodiment 16, wherein the other internucleoside linkages are independently selected from phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (IA) or (IB) as defined in embodiment 1.

[0470] 18. The oligonucleotide according to embodiment 16 or 17, wherein the other internucleoside linkages are all phosphorothioate internucleoside linkages.

[0471] 19. The oligonucleotide according to embodiments 16 to 17, wherein the other internucleoside linkages are all phosphorodithioate internucleoside linkages of formula (IA) or (IB) as defined in embodiment 1.

[0472] 20. The oligonucleotide according to any one of embodiments 1 to 19, wherein the oligonucleotide has a length of 7 to 30 nucleotides.

[0473] 21. The oligonucleotide according to any one of embodiments 1 to 20, wherein one or more nucleosides are nucleobase modified nucleosides.

[0474] 22. The oligonucleotide according to any one of embodiments 1 to 21, wherein the oligonucleotide is an antisense oligonucleotide, a siRNA, a microRNA mimic or a ribozyme.

[0475] 23. A pharmaceutically acceptable salt, especially a sodium or potassium or ammonium salt, of the oligonucleotide according to any one of embodiments 1 to 22.

[0476] 24. A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 23 and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety.

[0477] 25. A pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 24 and a therapeutically inert carrier.

[0478] 26. An oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 24 for use as a therapeutically active substance.

[0479] 27. A method for producing an oligonucleotide according to any one of embodiments 1 to 24, the method comprising the following steps:

[0480] (a) coupling a thiophosphoramidite nucleoside to the terminal 5' oxygen atom of a nucleotide or oligonucleotide to generate a thiophosphite triester intermediate;

[0481] (b) sulfur-oxidizing the thiophosphite triester intermediate obtained in step a); and

[0482] (c) optionally further extending the oligonucleotide.

[0483] 28. An oligonucleotide produced according to the method of embodiment 27.

[0484] Gapmer Implementation

[0485] 1. An antisense gapmer oligonucleotide for inhibiting a target RNA in a cell, wherein the antisense gapmer oligonucleotide comprises at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0486]

[0487] wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation.

[0488] 2. An antisense gapmer oligonucleotide according to embodiment 1, wherein at least one phosphorodithioate internucleoside linkage has formula (IA) and R is hydrogen; or at least one phosphorodithioate internucleoside linkage has formula (IB) and M+ is Na+, K+ or ammonium.

[0489] 3. A gapmer oligonucleotide according to embodiment 1 or 2, wherein one of the two oxygen atoms of the at least one internucleoside bond of formula (I) is bonded to an adjacent nucleoside (A 1 ) and the other oxygen atom is connected to another nucleoside (A 2 ) is connected to the 5' carbon atom of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside.

[0490] 4. A gapmer oligonucleotide according to any one of embodiments 1 to 3, wherein (A 1 ) and (A 2 ) one of which is a 2'-sugar modified nucleoside and the other is a DNA nucleoside.

[0491] 5. A gapmer oligonucleotide according to any one of embodiments 1 to 3, wherein (A 1 ) and (A 2 ) are both 2'-modified nucleosides.

[0492] 6. A gapmer oligonucleotide according to any one of embodiments 1 to 3, wherein (A 1 ) and (A 2 ) are both DNA nucleosides.

[0493] 7. A gapmer oligonucleotide according to any one of embodiments 1 to 6, wherein the gapmer oligonucleotide comprises a contiguous nucleotide sequence of the formula 5'-FG-F'-3', wherein G is a region having 5 to 18 nucleosides capable of recruiting RNase H, and the region G is flanked by flanking regions F and F' on the 5' and 3' sides, respectively, wherein region F and region F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, wherein the nucleosides of region F adjacent to region G are 2'-sugar modified nucleosides and wherein the nucleosides of region F' adjacent to region G are 2'-sugar modified nucleosides.

[0494] 8. The gapmer oligonucleotide according to any one of embodiments 1 to 7, wherein the 2'-sugar modified nucleosides are independently selected from 2'-alkoxy-RNA nucleosides, 2'-alkoxyalkoxy-RNA nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, 2'-fluoro-ANA nucleosides and LNA nucleosides.

[0495] 9. The gapmer oligonucleotide according to embodiment 8, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA (2'-O-MOE).

[0496] 10. The gapmer oligonucleotide according to any one of embodiments 7 to 8, wherein region F and region F' comprise or consist of 2'-methoxyethoxy-RNA nucleotides.

[0497] 11. The gapmer oligonucleotide according to any one of embodiments 7 to 10, wherein at least one or all 2'-sugar modified nucleosides in region F or region F' or both region F and region F' are LNA nucleosides.

[0498] 12. The gapmer oligonucleotide according to any one of embodiments 7 to 11, wherein region F or region F' or both region F and region F' comprise at least one LNA nucleoside and at least one DNA nucleoside.

[0499] 13. The gapmer oligonucleotide according to any one of embodiments 7 to 12, wherein region F or region F' or both region F and region F' comprise at least one LNA nucleoside and at least one non-LNA 2'-sugar modified nucleoside, such as at least one 2'-methoxyethoxy-RNA nucleoside.

[0500] 14. The gapmer oligonucleotide according to any one of embodiments 1 to 13, wherein the gap region comprises 5 to 16, in particular 8 to 16, more particularly 8, 9, 10, 11, 12, 13 or 14 consecutive DNA nucleosides.

[0501] 15. The gapmer oligonucleotide according to any one of embodiments 1 to 14, wherein region F and region F' are independently 1, 2, 3, 4, 5, 6, 7 or 8 nucleosides in length.

[0502] 16. The gapmer oligonucleotide according to any one of embodiments 1 to 15, wherein region F and region F' each independently comprise 1, 2, 3 or 4 LNA nucleosides.

[0503] 17. The gapmer oligonucleotide according to any one of embodiments 8 to 16, wherein the LNA nucleosides are independently selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA.

[0504] 18. The gapmer oligonucleotide according to embodiments 8-18, wherein the LNA nucleoside is β-D-oxy LNA.

[0505] 19. The gapmer oligonucleotide according to any one of embodiments 1 to 18, wherein the oligonucleotide or its contiguous nucleotide sequence (FG-F') has a length of 10 to 30 nucleotides, particularly 12 to 22, more particularly 14 to 20 oligonucleotides.

[0506] 20. The gapmer oligonucleotide according to any one of embodiments 1-19, wherein at least one of the flanking regions, such as region F and region F', comprises a phosphorodithioate bond of formula (IA) or (IB) as defined in any one of embodiments 1-19.

[0507] 21. The gapmer oligonucleotide according to any one of embodiments 1-19, wherein both flanking regions, such as region F and region F', comprise phosphorodithioate bonds of formula (IA) or (IB) as defined in any one of embodiments 1-19.

[0508] 22. The gapmer oligonucleotide according to any one of embodiments 1-21, wherein at least one of the flanking regions, such as F or F', comprises a phosphorodithioate bond of formula (IA) or (IB) as defined in any one of embodiments 1-19.

[0509] 23. The gapmer oligonucleotide according to any one of embodiments 1 to 21, wherein the two flanking regions F and F' comprise at least two phosphorodithioate bonds of formula (IA) or (IB) as defined in any one of embodiments 1 to 19.

[0510] 24. The gapmer oligonucleotide according to any one of embodiments 1 to 23, wherein one or both flanking regions each comprise an LNA nucleoside having a phosphorodithioate bond of formula (IA) or (IB) linking the LNA to the 3' nucleoside.

[0511] 25. The gapmer oligonucleotide according to any one of embodiments 1 to 24, wherein one or both flanking regions each comprise two or more adjacent LNA nucleosides linked by phosphorodithioate bonds of formula (IA) or (IB), wherein the phosphorodithioate bonds of formula (IA) or (IB) link the LNA to the 3' nucleoside.

[0512] 26. The gapmer oligonucleotide according to any one of embodiments 1 to 25, wherein one or both flanking regions each comprise a MOE nucleoside having a phosphorodithioate bond of formula (IA) or (IB) linking the MOE to the 3' nucleoside.

[0513] 27. The gapmer oligonucleotide according to any one of embodiments 1 to 26, wherein one or both flanking regions each comprise two or more adjacent MOE nucleosides linked by phosphorodithioate bonds of formula (IA) or (IB), wherein the phosphorodithioate bonds of formula (IA) or (IB) link the MOE to the 3' nucleoside.

[0514] 28. A gapmer oligonucleotide according to any one of embodiments 1-27, wherein the flanking regions F and F' together comprise 1, 2, 3, 4 or 5 dithiophosphate internucleoside bonds of formula (IA) or (IB), and wherein optionally the internucleoside bond between the 3'-last nucleoside of region F and the 5'-last nucleoside of region G is also a dithiophosphate internucleoside bond of formula (IA) or (IB).

[0515] 29. A gapmer oligonucleotide according to any one of embodiments 1 to 28, comprising a phosphorodithioate internucleoside bond of formula (IA) or (IB) between adjacent nucleosides in region F or region F', between region F and region G, or between region G and region F'.

[0516] 30. The gapmer region according to any one of embodiments 1 to 29, wherein the gap region comprises 1, 2, 3 or 4 phosphorodithioate internucleoside linkages of formula (IA) or (IB), wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0517] 31. The gapmer according to any one of embodiments 1 to 30, wherein the gap region comprises a region of at least 5 consecutive DNA nucleotides, such as a region of 6-18 consecutive DNA nucleotides or 8-14 consecutive DNA nucleotides.

[0518] 32. The gapmer according to any one of embodiments 1 to 31, further comprising one or more stereo-defined phosphorothioate internucleoside bonds (Sp,S) or (Rp,R)

[0519]

[0520] Where N 1 and N 2 It is a nucleoside.

[0521] 33. A gapmer according to embodiment 32, wherein the gapmer comprises at least one stereo-defined internucleoside bond (Sp,S) or (Rp,R) between two DNA nucleosides (such as between two DNA nucleosides in the gap region).

[0522] 34. The gapmer oligonucleotide according to embodiment 32 or 33, wherein the gap region comprises 2, 3, 4, 5, 6, 7 or 8 stereo-defined phosphorothioate internucleoside linkages independently selected from Rp and Sp internucleoside linkages.

[0523] 35. The gapmer oligonucleotide according to any one of embodiments 32-33, wherein region G further comprises at least 2, 3 or 4 internucleoside bonds of formula IB.

[0524] 34. A gapmer oligonucleotide according to embodiments 32-35, wherein (i) all remaining internucleoside bonds within region G (i.e., between nucleosides in region G) are stereo-defined phosphorothioate internucleoside bonds independently selected from Rp and Sp internucleoside bonds, or (ii) all internucleoside bonds within region G are stereo-defined phosphorothioate internucleoside bonds independently selected from Rp and Sp internucleoside bonds.

[0525] 35. A gapmer oligonucleotide according to any one of embodiments 1-34, wherein all internucleoside bonds within the flanking regions are phosphorodithioate internucleoside bonds of formula (IA) or (IB), wherein optionally, the internucleoside bond between the 3'-last nucleoside of region F and the 5'-last nucleoside of region G is also a phosphorodithioate internucleoside bond of formula (IA) or (IB), and the internucleoside bond between the 3'-last nucleoside of region G and the 5'-last nucleoside of region F' is a stereo-defined phosphorothioate internucleoside bond.

[0526] 36. A gapmer oligonucleotide according to any one of embodiments 6 to 35, wherein the internucleoside linkages between nucleosides of region G are independently selected from phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I) as defined in embodiment 1.

[0527] 37. A gapmer oligonucleotide according to any one of embodiments 7 to 36, wherein the internucleoside bonds between the nucleosides of region G comprise 0, 1, 2 or 3 dithiophosphate internucleoside bonds of formula (I) as defined in embodiment 1, in particular 0 dithiophosphate internucleoside bonds of formula (I).

[0528] 38. A gapmer oligonucleotide according to any one of embodiments 1 to 37, wherein the remaining internucleoside linkages are independently selected from phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I) as defined in embodiment 1.

[0529] 39. A gapmer oligonucleotide according to any one of embodiments 7 to 38, wherein the internucleoside bonds between nucleosides of region F and the internucleoside bonds between nucleosides of region F' are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined in embodiment 1.

[0530] 40. The gapmer oligonucleotide according to any one of embodiments 7 to 39, wherein each flanking region F and F' independently comprises 1, 2, 3, 4, 5, 6 or 7 phosphorodithioate internucleoside linkages of formula (I) as defined in embodiment 1.

[0531] 41. The gapmer oligonucleotide according to any one of embodiments 7 to 40, wherein all internucleoside linkages of the flanking regions F and / or F' are phosphorodithioate internucleoside linkages of formula (I) as defined in embodiment 1.

[0532] 42. The gapmer oligonucleotide according to any one of embodiments 1 to 41, wherein the gapmer oligonucleotide comprises at least one stereo-defined internucleoside linkage, such as at least one stereo-defined phosphorothioate internucleoside linkage.

[0533] 43. The gapmer oligonucleotide according to any one of embodiments 1 to 42, wherein the gap region comprises 1, 2, 3, 4 or 5 stereo-defined phosphorothioate internucleoside linkages.

[0534] 44. The gapmer oligonucleotide according to any one of embodiments 1 to 43, wherein all internucleoside linkages between nucleosides in the gap region are stereo-defined phosphorothioate internucleoside linkages.

[0535] 45. A gapmer oligonucleotide according to any one of embodiments 7 to 44, wherein at least one phosphorodithioate internucleoside bond of formula (IA) or (IB) is located between nucleosides in region F, or between nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds within region F and region F', between region F and region G, and between region G and region F' are independently selected from stereo-defined phosphorothioate internucleoside bonds, stereo-random internucleoside bonds, phosphorodithioate internucleoside bonds of formula (IA) or (IB), and phosphodiester internucleoside bonds.

[0536] 46. ​​The oligonucleotide gapmer according to embodiment 45, wherein the remaining internucleoside linkages within region F, within region F', or within both region F and region F' are phosphorodithioate internucleoside linkages of formula (IA) or (IB).

[0537] 47. A gapmer oligonucleotide according to any one of embodiments 6 to 33, wherein the internucleoside bonds between nucleosides of region G comprise 0, 1, 2 or 3 dithiophosphate internucleoside bonds of formula (I) as defined in embodiment 1 and the remaining internucleoside bonds within region G are independently selected from stereo-phosphorothioate internucleoside bonds, stereo-random internucleoside bonds and phosphodiester internucleoside bonds.

[0538] 48. The gapmer oligonucleotide according to any one of embodiments 1 to 47, wherein the 3' terminal nucleoside of the antisense oligonucleotide is a LNA nucleoside or a 2'-O-MOE nucleoside.

[0539] 49. The gapmer oligonucleotide according to any one of embodiments 1 to 48, wherein the 5' terminal nucleoside of the antisense oligonucleotide is a LNA nucleoside or a 2'-O-MOE nucleoside.

[0540] 50. The gapmer oligonucleotide according to any one of embodiments 1 to 49, wherein the two 3'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0541] 51. The gapmer oligonucleotide according to any one of embodiments 1 to 50, wherein the two 5'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0542] 52. The gapmer oligonucleotide according to any one of embodiments 1 to 51, wherein the three 3'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0543] 53. The gapmer oligonucleotide according to any one of embodiments 1 to 52, wherein the three 5'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0544] 54. The gapmer oligonucleotide according to any one of embodiments 1 to 53, wherein the two 3'-most nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0545] 55. The gapmer oligonucleotide according to any one of embodiments 1 to 54, wherein the two 5'-most nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0546] 56. A gapmer oligonucleotide according to any one of embodiments 1 to 55, wherein the nucleoside (A 2 ) is the 3' terminal nucleoside of the oligonucleotide.

[0547] 57. A gapmer oligonucleotide according to any one of embodiments 1 to 56, wherein the nucleoside (A 1 ) is the 5' terminal nucleoside of the oligonucleotide.

[0548] 58. A gapmer oligonucleotide according to any one of embodiments 7-57, wherein the gapmer oligonucleotide comprises a contiguous nucleotide sequence of the formula 5'-D'-FG-F'-D"-3', wherein F, G and F' are as defined in any one of embodiments 7 to 45 and wherein regions D' and D" each independently consist of 0 to 5 nucleotides, in particular 2, 3 or 4 nucleotides, in particular DNA nucleotides (such as phosphodiester-linked DNA nucleosides) [oligonucleotide comprising the gapmer oligonucleotide and flanking sequences].

[0549] 59. The gapmer oligonucleotide according to any one of embodiments 1 to 58, wherein the gapmer oligonucleotide is capable of recruiting human RNase H1.

[0550] 60. The gapmer oligonucleotide according to any one of embodiments 1 to 59, wherein the gapmer oligonucleotide is used to inhibit a mammalian (such as human) mRNA or pre-mRNA target, or a viral target or a non-coding long RNA in vitro or in vivo.

[0551] 61. A pharmaceutically acceptable salt, especially a sodium or potassium salt, of the gapmer oligonucleotide according to any one of embodiments 1 to 60.

[0552] 62. A conjugate comprising a gapmer oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 61 and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety.

[0553] 63. A pharmaceutical composition comprising a gapmer oligonucleotide according to any one of embodiments 1 to 62, a pharmaceutically acceptable salt or conjugate and a therapeutically inert carrier.

[0554] 64. A gapmer oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 63 for use as a therapeutically active substance.

[0555] Antisense Oligonucleotide Embodiments

[0556] The present invention relates to an oligonucleotide comprising at least one phosphorodithioate internucleoside bond of (IA) or (IB)

[0557]

[0558] One of the two oxygen atoms is bound to the adjacent nucleoside (A 1 ) and the other oxygen atom is connected to the 3' carbon atom of another adjacent nucleoside (A 2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as Na+ or K+ cation; or M+ is an ammonium cation.

[0559] In other words, M is a metal, such as an alkali metal, such as Na or K; or M is NH4.

[0560] Oligonucleotides can be, for example, single-stranded antisense oligonucleotides that can regulate the expression of target nucleic acids (such as target microRNA) or can regulate the splicing process of target pre-mRNA comprising a continuous nucleotide sequence. The antisense oligonucleotides of the present invention comprise a continuous nucleotide sequence that is complementary to the target nucleic acid and can hybridize with the target nucleic acid and regulate its expression. In a preferred embodiment, the antisense oligonucleotide or its continuous nucleotide sequence is a mixed polymer oligonucleotide, wherein (A1) or (A2) is a DNA nucleoside, or both (A1) and (A2) are DNA nucleosides.

[0561] In the context of the present invention, an antisense oligonucleotide is a single-stranded oligonucleotide that is complementary to a nucleic acid target (such as a target RNA) and is capable of modulating (e.g., splicing modulating a pre-mRNA target) or inhibiting the expression of a nucleic acid target (e.g., an mRNA target, a pre-mRNA target, a viral RNA target, or a non-coding long RNA target). Depending on the target, the length of the oligonucleotide or the length of its region that is complementary to the target (i.e., antisense - preferably, the complementary region is fully complementary to the target) can be 7-30 nucleotides (referred to as a region of contiguous nucleotide sequence). For example, LNA nucleotide inhibitors of microRNAs can be as short as 7 contiguous complementary nucleotides (and can be as long as 30 nucleotides), and oligonucleotides that recruit RNase H generally have a length of at least 12 contiguous complementary nucleotides, such as 12-26 nucleotides in length. Splicing modulating antisense oligonucleotides generally have a contiguous nucleotide region of 10-30 complementary nucleotides.

[0562] Splicing regulatory oligonucleotides, also known as splice switching oligonucleotides (SSOs), are short, synthetic, antisense, modified nucleic acids that base pair with pre-mRNA and disrupt the normal transcript splicing repertoire by blocking RNA-RNA base pairing or protein-RNA binding interactions between components of the splicing apparatus and pre-mRNA. Pre-mRNA splicing is required for proper expression of the vast majority of protein-encoding genes, and therefore, targeting this process provides a means to manipulate protein production from genes. Splicing regulation is particularly valuable in disease situations caused by mutations that disrupt the normal splicing process or when interference with the normal splicing process of gene transcripts may be therapeutic. SSOs provide an effective and specific way to target and alter the splicing process in a therapeutic manner. See Haven's and Hasting NAR (2016) 44, 6549-6563. SSOs can be complementary to exon / intron boundaries in the target pre-mRNA or can target splicing enhancing elements or silencer elements (collectively referred to as cis-acting splicing elements) within the pre-mRNA that regulate the splicing process of the pre-mRNA. Splicing regulation can lead to exon skipping or exon inclusion and thus regulate the alternative splicing process of the pre-mRNA. SSOs function through non-nuclease-mediated regulation of the target pre-mRNA and are therefore unable to recruit RNases. They are often fully modified oligonucleotides, i.e., each nucleoside contains a modified sugar moiety, such as a 2' sugar substituted sugar moiety (e.g., based on a phosphorothioate backbone, completely containing, for example, 2'-O-MOE oligonucleotides of 15-25 nucleotides in length, often 18-22 or 20 nucleotides in length), or LNA mixed polymer oligonucleotides (oligonucleotides of 10-30 nucleotides in length, which contain DNA nucleosides and LNA nucleosides, and optionally other 2' sugar modified nucleosides, such as 2'-O-MOE). LNA oligonucleotides that do not contain DNA nucleosides, but contain LNA and other 2' sugar modified nucleosides (such as 2'-O-MOE nucleosides) are also contemplated. Table 1 of Haven's and Hasting NAR (2016) 44, 6549-6563, which is hereby incorporated by reference, shows a range of SSO targets and the chemistry of the oligonucleotides used with reported in vivo activity, and is reproduced in Table A below:

[0563] Table A

[0564]

[0565]

[0566]

[0567] In some embodiments of the invention, the antisense oligonucleotide is a splicing modulating oligonucleotide complementary to a pre-mRNA selected from the group consisting of: HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2, and ATXN3. Exemplary diseases that can be treated with the SSOs of the invention are provided on a target-to-target basis in Table A.

[0568] The following embodiments relate generally to single-stranded antisense oligonucleotides of the invention, and particularly to splicing modulating antisense oligonucleotides (SSOs):

[0569] 1. A single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises one or more 2' sugar-modified nucleosides, and wherein at least one of the internucleoside bonds between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0570]

[0571] wherein one of the two oxygen atoms is bonded to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is bonded to the 5' carbon atom of the other adjacent nucleoside (A2), and wherein R is hydrogen or a phosphate protecting group.

[0572] 2. The antisense oligonucleotide according to embodiment 1, wherein the two nucleosides (A 1 ) and (A 2 ) is a 2' sugar modified nucleoside.

[0573] 3. The antisense oligonucleotide according to embodiment 1, wherein the two nucleosides (A 1 ) and (A 2 ) are all 2' sugar modified nucleosides.

[0574] 4. The antisense oligonucleotide according to any one of embodiments 1 to 3, wherein the two nucleosides (A 1 ) and (A 2 ) at least one or two nucleosides (A 1 ) and (A 2 ) are all DNA nucleosides.

[0575] 5. The antisense oligonucleotide according to any one of embodiments 1 to 4, wherein the two nucleosides (A 1 ) and (A2 ) is a 2'-sugar modified nucleoside or the nucleosides are independently selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0576] 6. The antisense oligonucleotide according to any one of embodiments 1 to 5, wherein (A 1 ) and (A 2 ) is an LNA nucleoside.

[0577] 7. An antisense oligonucleotide according to any one of embodiments 1 to 5, wherein (A 1 ) and (A 2 ) Both are LNA nucleosides.

[0578] 8. An antisense oligonucleotide according to any one of embodiments 1 to 6, wherein (A 1 ) and (A 2 ) is a 2'-O-methoxyethyl nucleoside.

[0579] 9. The antisense oligonucleotide according to any one of embodiments 1 to 5, wherein (A 1 ) and (A 2 ) are both 2'-O-methoxyethyl nucleosides.

[0580] 10. The antisense oligonucleotide according to any one of embodiments 1 to 8, wherein the LNA nucleoside is selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA.

[0581] 11. The antisense oligonucleotide according to any one of embodiments 1 to 8, wherein the LNA nucleoside is β-D-oxy LNA.

[0582] 12. The antisense-oligonucleotide according to any one of embodiments 1-11, wherein the contiguous nucleotide sequence comprises one or more other 2'-sugar modified nucleosides, such as one or more other 2'-sugar modified nucleosides selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0583] 13. The antisense-oligonucleotide according to any one of embodiments 1 to 12, wherein the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0584] 14. The antisense oligonucleotide according to any one of embodiments 1 to 12, wherein the contiguous nucleotide sequence comprises LNA nucleosides and 2'-O-methoxyethyl nucleosides.

[0585] 15. The antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence comprises LNA nucleosides and 2' fluoro RNA nucleosides.

[0586] 16. The antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence comprises any of the following

[0587] (i) LNA and DNA nucleosides only

[0588] (ii) LNA and 2'-O-methoxyethyl nucleosides only

[0589] (iii) LNA, DNA and 2'-O-methoxyethyl nucleosides only

[0590] (iv) LNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides only

[0591] (v) LNA, DNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides only or LNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides only

[0592] (vi) 2'-O-methoxyethyl nucleosides only

[0593] 17. The antisense oligonucleotide according to any one of embodiments 1 to 16, wherein the contiguous nucleotide sequence does not comprise a sequence of 4 or more consecutive DNA nucleosides, or does not comprise a sequence of three or more consecutive DNA nucleosides.

[0594] 18. The antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the antisense oligonucleotide or the contiguous nucleotide sequence thereof is a mixed-polymer oligonucleotide or a full-polymer oligonucleotide.

[0595] 19. The antisense oligonucleotide according to any one of embodiments 1 to 18, wherein the antisense oligonucleotide is not capable of recruiting human RNase H1.

[0596] 20. An antisense oligonucleotide according to any one of embodiments 1 to 19, wherein the nucleoside (A 2 ) is a contiguous nucleotide sequence or the 3' terminal nucleoside of an oligonucleotide.

[0597] 21. The antisense oligonucleotide according to any one of embodiments 1 to 20, wherein the nucleoside (A1) is the 5' terminal nucleoside of the consecutive nucleotide sequence or of the oligonucleotide.

[0598] 22. The antisense-oligonucleotide according to any one of embodiments 1 to 21, comprising at least two phosphorodithioate internucleoside linkages of formula I, such as 2, 3, 4, 5 or 6 phosphorodithioate internucleoside linkages of formula I.

[0599] 23. The antisense-oligonucleotide according to any one of embodiments 1 to 22, wherein the internucleoside bond between the two 3'-most nucleosides of the consecutive nucleotide sequence is a phosphorodithioate internucleoside bond of formula I, and wherein the internucleoside bond between the two 5'-most nucleosides of the consecutive nucleotide sequence is a phosphorodithioate internucleoside bond of formula I.

[0600] 24. The antisense oligonucleotide according to any one of embodiments 1 to 23, further comprising a phosphorothioate internucleoside linkage.

[0601] 25. The antisense oligonucleotide according to any one of embodiments 1 to 24, further comprising stereo-defined phosphorothioate internucleoside linkages.

[0602] 26. The antisense oligonucleotide according to any one of embodiments 1 to 25, wherein the remaining internucleoside linkages are independently selected from phosphorodithioate internucleoside linkages, phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0603] 27. The antisense oligonucleotide according to any one of embodiments 1 to 26, wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0604] 28. An antisense oligonucleotide according to any one of embodiments 1-27, wherein the contiguous nucleotide sequence is complementary, such as 100% complementary, to a mammalian pre-mRNA, a mammalian mature mRNA target, a viral RNA target or a mammalian non-coding long RNA.

[0605] 29. Antisense The oligonucleotide according to any one of embodiment 28, wherein the RNA target is a human RNA target.

[0606] 30. The antisense oligonucleotide according to any one of embodiments 1 to 29, wherein the antisense oligonucleotide modulates splicing of a mammalian (such as human) pre-mRNA target, such as a splice-skipping or splice-modulating antisense oligonucleotide.

[0607] 31. The antisense oligonucleotide according to any one of embodiments 1 to 30, wherein the antisense oligonucleotide is complementary, such as 100% complementary, to an intron / exon splice site of a human pre-mRNA or a human pre-mRNA splicing regulatory region.

[0608] 32. An antisense oligonucleotide according to any one of embodiments 1-30, wherein the antisense oligonucleotide or a contiguous nucleotide sequence thereof is complementary, such as completely complementary, to a human pre-mRNA sequence selected from the group consisting of: TNFR2, HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2 and ATXN3.

[0609] 33. The antisense oligonucleotide according to any one of embodiments 1 to 32, wherein the antisense oligonucleotide consists of or comprises a contiguous nucleotide sequence selected from SSO#1 to SSO#25.

[0610] 34. The antisense oligonucleotide according to any one of embodiments 1 to 33, wherein the cell is a human cell.

[0611] 35. The antisense oligonucleotide according to any one of embodiments 1 to 34, wherein the antisense oligonucleotide is 10 to 30 nucleotides in length.

[0612] 36. The antisense oligonucleotide according to any one of embodiments 1 to 34, wherein the antisense oligonucleotide is 12 to 24 nucleotides in length.

[0613] 37. The antisense-oligonucleotide according to any one of embodiments 1 to 36, wherein the 3' terminal nucleoside of the antisense-oligonucleotide or its contiguous nucleotide sequence is an LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0614] 38. The antisense-oligonucleotide according to any one of embodiments 1 to 27, wherein the 5'-terminal nucleoside of the antisense-oligonucleotide or its contiguous nucleotide sequence is an LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0615] 39. The antisense-oligonucleotide according to any one of embodiments 1 to 38, wherein both the 5' terminal nucleoside and the 3' terminal nucleoside of the antisense-oligonucleotide or its contiguous nucleotide sequence are LNA nucleosides.

[0616] 40. The antisense-oligonucleotide according to any one of embodiments 1 to 39, wherein the contiguous nucleotide sequence comprises at least one region of two or three consecutive LNA nucleotides and / or at least one region of two or three consecutive 2′-O-methoxyethyl nucleotides.

[0617] 41. A pharmaceutically acceptable salt of the oligonucleotide according to any one of embodiments 1 to 40, in particular a sodium or potassium salt or an ammonium salt.

[0618] 42. A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 41 and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety.

[0619] 43. A pharmaceutical composition comprising an oligonucleotide according to any one of embodiments 1 to 42, a pharmaceutically acceptable salt or a conjugate and a therapeutically inert carrier.

[0620] 44. An oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 43 for use as a therapeutically active substance.

[0621] 45. A method for modulating a target RNA in a cell expressing said RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1 to 44.

[0622] 46. ​​A method for modulating splicing of a target pre-RNA in a cell expressing said target pre-RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1 to 44.

[0623] 47. The method according to embodiment 45 or 46, wherein the method is an in vitro method or an in vivo method.

[0624] 48. Use of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of any one of embodiments 1 to 44 for inhibiting RNA in a cell (such as a human cell), wherein the use is in vitro or in vivo.

[0625] Certain Polymer Embodiments

[0626] 1. A single-stranded antisense oligonucleotide for regulating an RNA target in a cell, wherein the antisense oligonucleotide comprises or consists of a contiguous nucleotide sequence of 10-30 nucleotides in length, wherein the contiguous nucleotide sequence comprises alternating regions of nucleosides having one or more 2' sugar modifications, wherein the maximum length of contiguous DNA nucleosides having the contiguous nucleotide sequence is 3 or 4, and wherein at least one of the internucleoside bonds present between the nucleosides of the contiguous nucleotide sequence is a phosphorodithioate bond of formula (IA) or (IB)

[0627]

[0628] wherein one of the two oxygen atoms is bonded to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is bonded to the 5' carbon atom of the other adjacent nucleoside (A2), and wherein R is hydrogen or a phosphate protecting group.

[0629] 2. The antisense oligonucleotide according to embodiment 1, wherein the two nucleosides (A 1 ) and (A 2 ) is a 2' sugar modified nucleoside.

[0630] 3. The antisense oligonucleotide according to embodiment 1, wherein the two nucleosides (A 1 ) and (A 2 ) are all 2' sugar modified nucleosides.

[0631] 4. The antisense oligonucleotide according to any one of embodiments 1 to 3, wherein the two nucleosides (A 1 ) and (A 2 ) at least one or two nucleosides (A 1 ) and (A 2 ) are all DNA nucleosides.

[0632] 5. The antisense oligonucleotide according to any one of embodiments 1 to 4, wherein the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside or the nucleosides are independently selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0633] 6. The antisense oligonucleotide according to any one of embodiments 1 to 5, wherein (A 1 ) and (A 2 ) is an LNA nucleoside.

[0634] 7. An antisense oligonucleotide according to any one of embodiments 1 to 5, wherein (A 1 ) and (A 2 ) Both are LNA nucleosides.

[0635] 8. An antisense oligonucleotide according to any one of embodiments 1 to 6, wherein (A 1 ) and (A 2 ) is a 2'-O-methoxyethyl nucleoside.

[0636] 9. The antisense oligonucleotide according to any one of embodiments 1 to 5, wherein (A 1 ) and (A 2 ) are both 2'-O-methoxyethyl nucleosides.

[0637] 10. The antisense oligonucleotide according to any one of embodiments 1 to 8, wherein the LNA nucleoside is selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA.

[0638] 11. The antisense oligonucleotide according to any one of embodiments 1 to 8, wherein the LNA nucleoside is β-D-oxy LNA.

[0639] 12. The antisense-oligonucleotide according to any one of embodiments 1-11, wherein the contiguous nucleotide sequence comprises one or more other 2'-sugar modified nucleosides, such as one or more other 2'-sugar modified nucleosides selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleosides.

[0640] 13. The antisense-oligonucleotide according to any one of embodiments 1 to 12, wherein the contiguous nucleotide sequence comprises LNA nucleosides and DNA nucleosides.

[0641] 14. The antisense oligonucleotide according to any one of embodiments 1 to 12, wherein the contiguous nucleotide sequence comprises LNA nucleosides and 2'-O-methoxyethyl nucleosides.

[0642] 15. The antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence comprises LNA nucleosides and 2' fluoro RNA nucleosides.

[0643] 16. The antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence comprises any of the following

[0644] (i) LNA and DNA nucleosides

[0645] (ii) LNA, DNA and 2'-O-methoxyethyl nucleosides

[0646] (iii) LNA, DNA, 2'-fluoro RNA and 2'-O-methoxyethyl nucleosides

[0647] 17. The antisense oligonucleotide according to any one of embodiments 1 to 16, wherein the contiguous nucleotide sequence does not comprise a sequence of 3 or more consecutive DNA nucleosides, or does not comprise a sequence of 2 or more consecutive DNA nucleosides.

[0648] 18. The antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the antisense oligonucleotide or a contiguous nucleotide sequence thereof is a mixed-polymer oligonucleotide, such as a splicing modulating oligonucleotide or a microRNA inhibitor oligonucleotide.

[0649] 19. The antisense oligonucleotide according to embodiment 18, wherein the mixed polymer consists of or comprises the following alternating region motifs

[0650] [L]m[D]n[L]m[D]n[L]m or

[0651] [L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0652] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0653] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0654] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0655] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0656] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m or

[0657] [L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m[D]n[L]m

[0658] wherein L represents a 2' sugar modified nucleoside, D represents a DNA nucleoside, and wherein each m is independently selected from 1-6, and each n is independently selected from 1, 2, 3 and 4, such as 1-3.

[0659] 20. The antisense oligonucleotide according to embodiment 19, wherein each L nucleoside is independently selected from LNA, 2'-O-MOE or 2'fluoro nucleoside, or each L is independently LNA or 2'-O-MOE.

[0660] 21. The antisense oligonucleotide according to embodiment 20, wherein each L is LNA.

[0661] 22. The antisense oligonucleotide according to any one of embodiments 1 to 21, wherein the antisense oligonucleotide is not capable of recruiting human RNase H1.

[0662] 23. An antisense oligonucleotide according to any one of embodiments 1 to 22, wherein the nucleoside (A 2 ) is a contiguous nucleotide sequence or the 3' terminal nucleoside of an oligonucleotide.

[0663] 24. An antisense oligonucleotide according to any one of embodiments 1 to 23, wherein the nucleoside (A 1 ) is a contiguous nucleotide sequence or the 5' terminal nucleoside of an oligonucleotide.

[0664] 25. The antisense-oligonucleotide according to any one of embodiments 1 to 24, comprising at least two phosphorodithioate internucleoside linkages of formula I, such as 2, 3, 4, 5 or 6 phosphorodithioate internucleoside linkages of formula I.

[0665] 26. An antisense-oligonucleotide according to any one of embodiments 1-25, wherein the consecutive nucleotide sequence comprises two consecutive DNA nucleotides, wherein the nucleoside bond between the two consecutive DNA nucleotides is a phosphorodithioate internucleoside bond of formula (IA) or (IB), i.e., a P2S-linked DNA nucleotide pair.

[0666] 27. The antisense-oligonucleotide according to any one of embodiments 1 to 26, wherein the contiguous nucleotide sequence comprises more than one P2S-linked DNA nucleotide pair.

[0667] 28. The antisense-oligonucleotide according to any one of embodiments 1 to 26, wherein all nucleoside bonds between two consecutive DNA nucleotides present in the consecutive nucleotide sequence are phosphorodithioate internucleoside bonds of formula (IA) or (IB).

[0668] 29. The antisense oligonucleotide according to any one of embodiments 1 to 27, wherein at least one internucleoside linkage between the 2' sugar modified nucleoside and the DNA nucleoside is a phosphorodithioate internucleoside linkage of formula (IA) or (IB).

[0669] 30. The antisense oligonucleotide according to any one of embodiments 1 to 27, wherein more than one internucleoside linkage between the 2' sugar modified nucleoside and the DNA nucleoside is a phosphorodithioate internucleoside linkage of formula (IA) or (IB).

[0670] 31. The antisense oligonucleotide according to any one of embodiments 1 to 27, wherein all of more than one internucleoside linkages between the 2' sugar modified nucleoside and the DNA nucleoside are phosphorodithioate internucleoside linkages of formula (IA) or (IB).

[0671] 32. The antisense oligonucleotide according to any one of embodiments 1 to 27, wherein at least one of the internucleoside linkages between two 2' sugar modified nucleosides is not a phosphorodithioate internucleoside linkage of formula (IA) or (IB), such as a phosphorothioate internucleoside linkage.

[0672] 33. The antisense oligonucleotide according to any one of embodiments 1 to 27, wherein all internucleoside linkages between two 2' sugar modified nucleosides are not phosphorodithioate internucleoside linkages of formula (IA) or (IB), such as phosphorothioate internucleoside linkages.

[0673] 34. The antisense-oligonucleotide according to any one of embodiments 1 to 33, wherein the internucleoside bond between the two 3'-most nucleosides of the consecutive nucleotide sequence is a phosphorodithioate internucleoside bond of formula I, and wherein the internucleoside bond between the two 5'-most nucleosides of the consecutive nucleotide sequence is a phosphorodithioate internucleoside bond of formula I.

[0674] 35. The antisense oligonucleotide according to any one of embodiments 1 to 34, further comprising a phosphorothioate internucleoside linkage.

[0675] 36. The antisense oligonucleotide according to any one of embodiments 1 to 35, further comprising stereo-defined phosphorothioate internucleoside linkages.

[0676] 37. The antisense oligonucleotide according to any one of embodiments 1 to 35, wherein the remaining internucleoside linkages are independently selected from phosphorodithioate internucleoside linkages, phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0677] 38. The antisense oligonucleotide according to any one of embodiments 1 to 36, wherein the remaining internucleoside linkages are phosphorothioate internucleoside linkages.

[0678] 39. The antisense oligonucleotide according to any one of embodiments 1 to 37, wherein the contiguous nucleotide sequence is complementary, such as 100% complementary, to a mammalian (such as human) pre-mRNA.

[0679] 40. The antisense oligonucleotide according to any one of embodiments 1 to 38, wherein the antisense oligonucleotide modulates splicing of a mammalian (such as human) pre-mRNA target, such as a splice-skipping or splice-modulating antisense oligonucleotide.

[0680] 41. The antisense oligonucleotide according to any one of embodiments 1 to 39, wherein the antisense oligonucleotide is complementary, such as 100% complementary, to an intron / exon splice site of a human pre-mRNA or a human pre-mRNA splicing regulatory region.

[0681] 42. An antisense oligonucleotide according to any one of embodiments 1-41, wherein the antisense oligonucleotide or a contiguous nucleotide sequence thereof is complementary, such as completely complementary, to a human pre-mRNA sequence selected from the group consisting of: TNFR2, HBB, FKTN, LMNA, CEP290, CLCN1, USH1C, BTK, LRP8, CTLA4, BCL2L1, ERBB4, MDM4, STAT3, IL1RAP, TNFRSF1B, FLT1, KDR, SMN2, MYBPC3, TTN, DMD, NBN, IL10, HTT, APOB, MSTN, GYS2 and ATXN3.

[0682] 43. The antisense oligonucleotide according to any one of embodiments 1 to 42, wherein the antisense oligonucleotide consists of or comprises a contiguous nucleotide sequence selected from SSO#1 to SSO#25.

[0683] 44. The antisense oligonucleotide according to any one of embodiments 1 to 43, wherein the cell is a mammalian cell.

[0684] 45. The antisense oligonucleotide according to any one of embodiments 1-44, wherein the antisense oligonucleotide is 10-30 nucleotides in length.

[0685] 46. ​​The antisense oligonucleotide according to any one of embodiments 1 to 44, wherein the antisense oligonucleotide is 12 to 24 nucleotides in length.

[0686] 47. The antisense-oligonucleotide according to any one of embodiments 1 to 46, wherein the 3' terminal nucleoside of the antisense-oligonucleotide or its contiguous nucleotide sequence is a LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0687] 48. The antisense-oligonucleotide according to any one of embodiments 1 to 47, wherein the 5'-terminal nucleoside of the antisense-oligonucleotide or its contiguous nucleotide sequence is a LNA nucleoside or a 2-O-methoxyethyl nucleoside.

[0688] 49. The antisense-oligonucleotide according to any one of embodiments 1 to 48, wherein both the 5' terminal nucleoside and the 3' terminal nucleoside of the antisense-oligonucleotide or its contiguous nucleotide sequence are LNA nucleosides.

[0689] 50. The antisense-oligonucleotide according to any one of embodiments 1 to 49, wherein the contiguous nucleotide sequence comprises at least one region of two or three consecutive LNA nucleotides and / or at least one region of two or three consecutive 2′-O-methoxyethyl nucleotides.

[0690] 51. A pharmaceutically acceptable salt of the oligonucleotide according to any one of embodiments 1 to 50, in particular a sodium or potassium salt or an ammonium salt.

[0691] 52. A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 51 and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety.

[0692] 53. A pharmaceutical composition comprising an oligonucleotide according to any one of embodiments 1 to 52, a pharmaceutically acceptable salt or a conjugate and a therapeutically inert carrier.

[0693] 54. An oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 53 for use as a therapeutically active substance.

[0694] 55. A method for modulating a target RNA in a cell expressing said RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1 to 54.

[0695] 56. A method for modulating the pre-RNA splicing process in a cell expressing a target pre-RNA, the method comprising the step of administering to the cell an effective amount of an oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any one of embodiments 1 to 54.

[0696] 57. The method according to embodiment 55 or 56, wherein the method is an in vitro method or an in vivo method.

[0697] 58. Use of the oligonucleotide, pharmaceutically acceptable salt, conjugate or composition of any one of embodiments 1 to 54 for inhibiting RNA in a cell (such as a mammalian cell), wherein the use is in vitro or in vivo.

[0698] Certain embodiments involving 3' end protection

[0699] 1. A single-stranded antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0700]

[0701] wherein one of the two oxygen atoms is linked to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is linked to the 5' carbon atom of another adjacent nucleoside (A2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein at least one of the two nucleosides (A1) and (A2) is a 2' sugar modified nucleoside, such as an LNA nucleoside or a 2'-O-MOE nucleoside, and wherein R is hydrogen or a phosphate protecting group, and wherein A2 is the 3' terminal nucleoside of the oligonucleotide.

[0702] 2. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside, or (A 1 ) and (A 2 ) Both are LNA nucleosides.

[0703] 3. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside and (A 1 ) are sugar-modified nucleotides.

[0704] 4. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 2 ) is an LNA nucleoside and (A 1 ) are DNA nucleotides.

[0705] 5. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 1 ) is an LNA nucleoside and (A 2 ) are sugar-modified nucleotides.

[0706] 6. The single-stranded antisense oligonucleotide according to embodiment 1, wherein (A 1 ) is an LNA nucleoside and (A 2 ) are DNA nucleotides.

[0707] 7. The single-stranded antisense oligonucleotide according to any one of embodiments 3 or 5, wherein the sugar-modified nucleoside is a 2'-sugar-modified nucleoside.

[0708] 8. The single-stranded antisense oligonucleotide according to embodiment 7, wherein the 2'-sugar modified nucleoside is a 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleoside.

[0709] 9. The single-stranded antisense oligonucleotide according to embodiment 7 or 8, wherein the 2'-sugar modified nucleoside is a 2'-O-methoxyethyl nucleoside.

[0710] 10. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 9, wherein the LNA nucleoside or nucleotide is in the β-D configuration.

[0711] 11. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 10, wherein the LNA nucleosides are independently selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA.

[0712] 12. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 11, wherein the LNA is β-D-oxy LNA.

[0713] 13. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 12, wherein the single-stranded antisense oligonucleotide consists of or comprises 7-30 consecutive nucleotides complementary to a target nucleic acid (such as a target nucleic acid selected from pre-mRNA, and mRNA, microRNA, viral RNA and non-coding long RNA) [referred to as a consecutive nucleotide sequence of the single-stranded oligonucleotide].

[0714] 14. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence comprises a gapmer region of the formula 5'-FG-F'-3', wherein G is a region having 5 to 18 nucleosides capable of recruiting RNase H, and the region G is flanked by flanking regions F and F' on the 5' and 3' sides, respectively, wherein region F and region F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, wherein the nucleosides of region F adjacent to region G are 2'-sugar modified nucleosides and wherein the nucleosides of region F' adjacent to region G are 2'-sugar modified nucleosides.

[0715] 14. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence is a mixed-polymer oligonucleotide, wherein the mixed-polymer oligonucleotide comprises LNA nucleosides and DNA nucleosides, and optionally 2' sugar modified nucleosides [such as those according to embodiments 8-9], wherein the single-stranded antisense oligonucleotide does not comprise a region of 4 or more contiguous DNA nucleosides.

[0716] 15. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the contiguous nucleotide sequence comprises only sugar-modified nucleosides.

[0717] 16. The oligonucleotide according to embodiment 14 or 15, wherein the oligonucleotide is a splicing modulating oligonucleotide [capable of modulating the splicing of pre-mRNA splicing events].

[0718] 17. The oligonucleotide according to embodiment 14 or 15, wherein the oligonucleotide is complementary to a microRNA, such as, is a microRNA inhibitor.

[0719] 18. An oligonucleotide according to any one of embodiments 1 to 17, comprising other internucleoside bonds independently selected from phosphodiester internucleoside bonds, phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds; or wherein the other internucleoside bonds within the oligonucleotide or within its contiguous nucleotide sequence are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds.

[0720] 18. The oligonucleotide according to any one of embodiments 1 to 18, wherein the other internucleoside linkages of the oligonucleotide or its consecutive nucleotide sequence are all phosphorothioate internucleoside linkages.

[0721] 19. The oligonucleotide according to any one of embodiments 1 to 18, wherein the oligonucleotide comprises a 5' region that is position 5' relative to the contiguous nucleotide sequence, wherein the 5' nucleoside region comprises at least one phosphodiester bond.

[0722] 20. The oligonucleotide according to embodiment 19, wherein the 5' region comprises 1-5 phosphodiester linked DNA nucleosides and optionally the oligonucleotide or a contiguous nucleotide sequence thereof can be linked to a conjugate moiety.

[0723] 21. The oligonucleotide according to any one of embodiments 1 to 20, wherein one or more nucleosides are nucleobase modified nucleosides.

[0724] 22. The oligonucleotide according to any one of embodiments 1 to 21, wherein one or more nucleosides are 5-methylcytosine, such as LNA 5-methylcytosine or DNA 5-methylcytosine.

[0725] 23. A pharmaceutically acceptable salt, especially a sodium or potassium or ammonium salt, of the oligonucleotide according to any one of embodiments 1 to 22.

[0726] 24. A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 23 and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety.

[0727] 25. A pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 24 and a therapeutically inert carrier.

[0728] 26. An oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 25 for use as a therapeutically active substance.

[0729] 27. An oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 24 for use in therapy, for administration to a subject by parenteral administration (e.g., intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular or intrathecal administration).

[0730] Embodiments involving oligonucleotides having achiral phosphorodithioate and stereodefined phosphorothioate bonds

[0731] 1. A single-stranded antisense oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (IA) or (IB)

[0732]

[0733] wherein one of the two oxygen atoms is attached to the 3' carbon atom of an adjacent nucleoside (A1) and the other oxygen atom is attached to the 5' carbon atom of another adjacent nucleoside (A2), and wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, such as a metal cation, such as an alkali metal cation, such as a Na+ or K+ cation; or M+ is an ammonium cation, and wherein the single-stranded oligonucleotide further comprises at least one stereo-defined phosphorothioate internucleoside bond, which is (Sp, S) or (Rp, R)

[0734]

[0735] Where N 1 and N 2 is a nucleoside. (Note: In some non-limiting embodiments, N 1 and / or N 2 is a DNA nucleotide).

[0736] 2. The single-stranded antisense oligonucleotide according to embodiment 1, wherein A2 is the 3' terminal nucleoside of the oligonucleotide.

[0737] 3. The single-stranded antisense oligonucleotide according to embodiment 1, wherein A1 is the 5' terminal nucleoside of the oligonucleotide.

[0738] 4. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 3, wherein the single-stranded oligonucleotide comprises 1, 2, 3, 4, 5 or 6 internucleoside bonds of Formula IB.

[0739] 5. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 4, wherein the 5' terminal internucleoside linkage of the antisense oligonucleotide and the 3' terminal internucleoside linkage of the antisense oligonucleotide are both internucleoside linkages of Formula IB.

[0740] 6. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 5, wherein in at least one of the internucleoside bonds of Formula IB, at least one of the two nucleosides (A1) and (A2) is a 2' sugar modified nucleoside, such as a 2' sugar modified nucleoside selected from 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA and LNA nucleosides.

[0741] 7. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 6, wherein in at least one of the internucleoside linkages of formula IB, at least one of the two nucleosides (A1) and (A2) is a LNA nucleoside.

[0742] 8. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 6, wherein in at least one of the internucleoside linkages of Formula IB, at least one of the two nucleosides (A1) and (A2) is a 2'-O-MOE nucleoside.

[0743] 9. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 8, wherein the 3' terminal nucleoside of the antisense oligonucleotide is a LNA nucleoside or a 2'-O-MOE nucleoside.

[0744] 10. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 9, wherein the 5' terminal nucleoside of the antisense oligonucleotide is a LNA nucleoside or a 2'-O-MOE nucleoside.

[0745] 11. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 10, wherein the two 3'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0746] 12. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 11, wherein the two 5'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0747] 13. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 12, wherein the three 3'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0748] 14. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 13, wherein the three 5'-most nucleosides of the antisense oligonucleotide are independently selected from LNA nucleosides and 2'-O-MOE nucleosides.

[0749] 15. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 14, wherein the two 3'-most nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0750] 16. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 15, wherein the two 5'-most nucleosides of the antisense oligonucleotide are LNA nucleosides.

[0751] 17. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 16, wherein the antisense oligonucleotide further comprises a region of 2 to 16 DNA nucleotides, wherein the internucleoside bonds between the DNA nucleotides are stereo-defined phosphorothioate internucleoside bonds.

[0752] 18. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the LNA nucleosides are independently selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA.

[0753] 19. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 17, wherein the LNA nucleoside is β-D-oxy LNA.

[0754] 20. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 19, wherein the oligonucleotide consists of or comprises 7 to 30 consecutive nucleotides that are complementary to the target nucleic acid (such as fully complementary to the target nucleic acid selected from pre-mRNA, and mRNA, microRNA, viral RNA and non-coding long RNA) [antisense oligonucleotide].

[0755] 21. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 20, wherein the single-stranded oligonucleotide is capable of modulating an RNA target.

[0756] 22. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 20, wherein the single-stranded antisense oligonucleotide is capable of inhibiting an RNA target, such as by RNase H1 recruitment.

[0757] 23. A single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22, wherein the contiguous nucleotide sequence of the oligonucleotide comprises a gapmer region of the formula 5'-FG-F'-3', wherein G is a region having 5 to 18 nucleosides capable of recruiting RNase H1, and the region G is flanked by flanking regions F and F' on the 5' and 3' sides, respectively, wherein region F and region F' independently comprise or consist of 1 to 7 2'-sugar modified nucleotides, wherein the nucleosides of region F adjacent to region G are 2'-sugar modified nucleosides and wherein the nucleosides of region F' adjacent to region G are 2'-sugar modified nucleosides.

[0758] 24. The single-stranded antisense oligonucleotide according to embodiment 23, region F or region F' comprises an internucleoside bond of formula IB according to any one of embodiments 1-19.

[0759] 25. The single-stranded antisense oligonucleotide according to embodiment 24, wherein both region F and region F' comprise an internucleoside bond of formula IB according to any one of embodiments 1-19.

[0760] 26. The single-stranded antisense oligonucleotide according to embodiments 23-25, wherein all internucleoside bonds within region F and / or region F' are internucleoside bonds according to formula IB according to any one of embodiments 1-19.

[0761] 27. The single-stranded antisense oligonucleotide according to embodiments 23-26, wherein region F and region F' both comprise or consist of LNA nucleosides.

[0762] 28. The single-stranded antisense oligonucleotide according to embodiments 23-27, wherein region F and region F' both comprise or consist of MOE nucleosides.

[0763] 29. The single-stranded antisense oligonucleotide according to embodiments 23-28, wherein region F comprises LNA nucleosides and F' comprises or consists of MOE nucleosides.

[0764] 30. The single-stranded antisense oligonucleotide according to embodiments 23-29, wherein region G further comprises at least one internucleoside bond of formula IB between the 3' terminal nucleoside of region F and the 5' terminal nucleoside of region G.

[0765] 31. The single-stranded antisense oligonucleotide according to embodiments 23-30, wherein region G comprises at least one stereo-defined phosphorothioate bond between two DNA nucleosides.

[0766] 32. The single-stranded antisense oligonucleotide according to embodiments 23-31, wherein region G comprises at least one internucleoside bond of formula IB between two DNA nucleosides.

[0767] 33. The single-stranded antisense oligonucleotide according to embodiments 23-32, wherein region G further comprises at least 2, 3, or 4 internucleoside bonds of formula IB.

[0768] 34. The single-stranded antisense oligonucleotide according to embodiments 23-31, wherein all remaining internucleoside linkages within region G are stereo-defined phosphorothioate internucleoside linkages independently selected from Rp and Sp internucleoside linkages.

[0769] 35. A single-stranded antisense oligonucleotide according to embodiments 23-31, wherein all internucleoside bonds within region G are stereo-defined phosphorothioate internucleoside bonds, independently selected from Rp and Sp internucleoside bonds, optionally with the exception of the internucleoside bond between the 3' terminal nucleoside of region F and the 5' terminal nucleoside of region G.

[0770] 36. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 22, wherein the antisense oligonucleotide comprises less than 4 consecutive DNA nucleotides.

[0771] 37. Single-stranded The antisense oligonucleotide according to any one of embodiments 1 to 22 or 36, wherein the antisense oligonucleotide is a mixed-polymer or full-polymer oligonucleotide.

[0772] 38. The single stranded oligonucleotide according to embodiment 37, wherein the mixed polymer oligonucleotide comprises LNA nucleosides and DNA nucleosides, and optionally 2' sugar modified nucleosides (eg see list in embodiment 6), such as 2'-O-MOE nucleosides.

[0773] 39. The single stranded antisense oligonucleotide according to any one of embodiments 1 to 38, wherein the antisense oligonucleotide comprises a region of 3 or more consecutive MOE nucleosides, and optionally wherein all nucleosides of the oligonucleotide are 2'MOE nucleosides.

[0774] 40. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 39, wherein the target is an mRNA or pre-mRNA target.

[0775] 41. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 40, wherein the oligonucleotide targets a pre-mRNA splice site or a region of a pre-mRNA that regulates splicing events at a pre-mRNA splice site.

[0776] 42. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 41, which is a splicing modulating oligonucleotide capable of modulating the splicing process of a pre-mRNA target.

[0777] 43. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 42, wherein the target is a microRNA.

[0778] 44. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 42, wherein the antisense oligonucleotide has a length of 10-20 nucleotides, such as a length of 12-24 nucleotides.

[0779] 45. The single-stranded antisense oligonucleotide according to embodiment 43, wherein the antisense oligonucleotide is 7-30, such as 8-12 or 12 to 23 nucleotides in length.

[0780] 46. ​​A single-stranded antisense oligonucleotide comprising the antisense oligonucleotide according to any one of embodiments 1 to 45, wherein the oligonucleotide further comprises a 5' region that is position 5' relative to the contiguous nucleotide sequence, wherein the 5' nucleoside region comprises at least one phosphodiester bond.

[0781] 47. The single-stranded antisense oligonucleotide according to embodiment 46, wherein the 5' region comprises 1-5 phosphodiester-linked DNA nucleosides, and optionally the oligonucleotide or a contiguous nucleotide sequence thereof can be linked to a conjugate moiety.

[0782] 48. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 47, wherein one or more nucleosides are nucleobase modified nucleosides.

[0783] 49. The single-stranded antisense oligonucleotide according to any one of embodiments 1 to 48, wherein one or more nucleosides are 5-methylcytosine, such as LNA 5-methylcytosine or DNA 5-methylcytosine.

[0784] 50. A pharmaceutically acceptable salt, especially a sodium or potassium or ammonium salt, of the single-stranded antisense oligonucleotide according to any one of embodiments 1 to 49.

[0785] 51. A conjugate comprising a single-stranded antisense oligonucleotide or a pharmaceutically acceptable salt according to any one of embodiments 1 to 49 and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety.

[0786] 52. A pharmaceutical composition comprising a single-stranded antisense oligonucleotide according to any one of embodiments 1 to 51, a pharmaceutically acceptable salt or conjugate and a therapeutically inert carrier.

[0787] 53. A single-stranded antisense oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 52 for use as a therapeutically active substance.

[0788] 54. A single-stranded antisense oligonucleotide, a pharmaceutically acceptable salt or a conjugate according to any one of embodiments 1 to 53, for administration to a subject by parenteral administration (e.g., intravenous, subcutaneous, intramuscular, intracerebral, intraocular, intracerebroventricular or intrathecal administration).

[0789] 55. Use of a single-stranded antisense oligonucleotide, salt or composition according to any preceding embodiment for inhibiting a target RNA in a cell in vitro, wherein the single-stranded antisense oligonucleotide is complementary to, such as completely complementary to, the target RNA.

[0790] 56. An in vivo or in vitro method for inhibiting a target RNA in a cell expressing the target RNA, the method comprising: administering to the cell an effective amount of an antisense oligonucleotide, a pharmaceutically acceptable salt, a conjugate or a composition according to any of the preceding embodiments, thereby aiming at inhibiting the target RNA.

[0791] 57. Use of a single-stranded antisense oligonucleotide, salt, or composition according to any preceding embodiment in vitro or in vivo for modulating target pre-mRNA splicing in a cell.

[0792] 58. An in vivo or in vitro method for regulating the splicing of a target pre-RNA in a cell expressing the target pre-RNA, the method comprising: administering to the cell an effective amount of an antisense oligonucleotide, salt, conjugate or composition according to any of the preceding embodiments, thereby aiming to regulate the splicing process of the target RNA.

[0793] Antisense oligonucleotides of the present invention targeting Htra-1

[0794] In some embodiments, the antisense oligonucleotides of the invention are complementary, for example, to mRNA or pre-mRNA encoding human high temperature requirement A1 Serine protease (Htra1) - see WO 2018 / 002105. Inhibition of Htra1 expression using antisense oligonucleotides of the invention targeting Htra1 mRNA or pre-mRNA is beneficial for treating a range of medical conditions, such as macular degeneration, such as age-related macular degeneration (geographic atrophy). Human Htra1 pre-mRNA and mRNA target sequences are available as follows:

[0795]

[0796] The compounds of the present invention that target Htra-1 are listed as Htra1#1-38 in the examples.

[0797] 1. An antisense oligonucleotide of the present invention having a length of 10-30 nucleotides, wherein the antisense oligonucleotide targets human HTRA1 mRNA or pre-mRNA, wherein the antisense oligonucleotide comprises a contiguous nucleotide region of 10-22 nucleotides, wherein the contiguous nucleotide region is at least 90% such as 100% complementary to SEQ ID NO 1 or 2 of WO 2018 / 002105, disclosed as SEQ ID NO 9 and 10 in the sequence listing, wherein the antisense oligonucleotide comprises at least one dithiophosphate internucleoside bond of Formula IA or Formula IB.

[0798] 2. The antisense oligonucleotide according to embodiment 1 or 2, wherein the contiguous nucleotide region is identical to a sequence present in a sequence selected from the group consisting of

[0799] SEQ ID NOs 11, 12, 13, 14, 15, 16, 17 and 18:

[0800] SEQ ID NO 11:CAAATATTTACCTGGTTG

[0801] SEQ ID NO 12: TTTACCTGGTTGTTGG

[0802] SEQ ID NO 13: CCAAATATTTAACCTGGTT

[0803] SEQ ID NO 14: CCAAATATTTACCTGGGTTGT

[0804] SEQ ID NO 15: ATATTTTACCTGGGTTGTTG

[0805] SEQ ID NO 16: TATTTAACCTGGTTGTT

[0806] SEQ ID NO 17: ATATTTTACCTGGGTTGT

[0807] SEQ ID NO 18: ATATTTTACCTGGTTGTT

[0808] 3. The antisense oligonucleotide according to any one of embodiments 1 to 3, wherein the contiguous nucleotide region comprises the sequence

[0809] SEQ ID NO 19: TTTACCTGGTT

[0810] 4. The antisense oligonucleotide according to any one of embodiments 1 to 4, wherein the contiguous nucleotide region of the oligonucleotide consists of or comprises a sequence selected from any one of SEQ ID NOs 11, 12, 13, 14, 15, 16, 17 and 18.

[0811] 5. The antisense oligonucleotide according to any one of embodiments 1-5, wherein the contiguous nucleotide region of the oligonucleotide comprises one or more 2' sugar modified nucleosides, such as one or more 2' sugar modified nucleosides independently selected from 2'-O-alkyl-RNA, 2'-O-methyl-RNA, 2'-alkoxy-RNA, 2'-O-methoxyethyl-RNA, 2'-amino-DNA, 2'-fluoro-DNA, arabino nucleic acid (ANA), 2'-fluoro-ANA and LNA nucleosides.

[0812] 6. An antisense oligonucleotide according to any one of embodiments 1 to 5, wherein the contiguous nucleotide region of the oligonucleotide comprises at least one modified internucleoside bond, such as one or more phosphorothioate internucleoside bonds, or such as all internucleoside bonds within the contiguous nucleotide region are phosphorothioate internucleoside bonds.

[0813] 7. An antisense oligonucleotide according to any one of embodiments 1 to 6, wherein the oligonucleotide or its contiguous nucleotide sequence is or comprises a gapmer, such as a gapmer of formula 5'-FG-F'-3', wherein region F and region F' independently comprise 1-7 sugar-modified nucleosides and G is a region of 6-16 nucleosides capable of recruiting RNase H, wherein the region F and region F' nucleosides adjacent to region G are sugar-modified nucleosides.

[0814] 8. The antisense oligonucleotide according to embodiment 7, wherein at least one of region F and region F' or both each comprises at least one LNA nucleoside.

[0815] 9. An antisense oligonucleotide according to any one of embodiments 1-8, selected from: Htra1#1-38, wherein capital letters represent β-D-oxy LNA nucleoside units, lowercase letters represent DNA nucleoside units, the subscript s represents thiophosphate internucleoside bonds, wherein all LNA cytosines are 5-methylcytosine, P represents dithiophosphate internucleoside bonds of formula IB, S represents Sp defines a stereothiophosphate internucleoside bond, R represents Rp defines a stereothiophosphate internucleoside bond, and X represents a stereo-random thiophosphate bond.

[0816] 10. The antisense oligonucleotide according to any preceding embodiment, which is in the form of a salt, such as a sodium salt, potassium salt or ammonium salt (eg a pharmaceutically acceptable salt).

[0817] 11. A conjugate comprising an oligonucleotide according to any one of embodiments 1 to 10 and at least one conjugate moiety covalently linked to the oligonucleotide, or a salt thereof.

[0818] 12. A pharmaceutical composition comprising the oligonucleotide of embodiments 1 to 10 or the conjugate of embodiment 11 and a pharmaceutically acceptable diluent, solvent, carrier, salt and / or adjuvant.

[0819] 13. An in vivo or in vitro method for modulating HTRA1 expression in a target cell expressing HTRA1, the method comprising administering to the cell an oligonucleotide according to any one of embodiments 1 to 10 or a conjugate according to embodiment 11 or a pharmaceutical composition according to embodiment 12 in an effective amount.

[0820] 14. A method for treating or preventing a disease, comprising administering a therapeutically effective amount or a prophylactically effective amount of an oligonucleotide according to any one of embodiments 1 to 10, or a conjugate according to embodiment 11, or a pharmaceutical composition according to embodiment 12 to a subject suffering from or susceptible to the disease.

[0821] 15. An oligonucleotide according to any one of embodiments 1 to 10 or a conjugate according to embodiment 11 or a pharmaceutical composition according to embodiment 12 for use in medicine.

[0822] 16. An oligonucleotide according to any one of embodiments 1 to 10 or a conjugate according to embodiment 11 or a pharmaceutical composition according to embodiment 12 for use in treating or preventing a disease selected from macular degeneration (such as wet AMD, dry AMD, geographic atrophy, intermediate dAMD, diabetic retinopathy), Parkinson's disease, Alzheimer's disease, Duchenne muscular dystrophy, arthritis (such as osteoarthritis) and familial ischemic cerebral small vessel disease.

[0823] 17. Use of an oligonucleotide according to embodiments 1-10 or a conjugate according to embodiment 11 or a pharmaceutical composition according to embodiment 12 for the preparation of a medicament for treating or preventing a disease selected from macular degeneration (such as wet AMD, dry AMD, geographic atrophy, intermediate dAMD, diabetic retinopathy), Parkinson's disease, Alzheimer's disease, Duchenne muscular dystrophy, arthritis (such as osteoarthritis) and familial ischemic cerebral small vessel disease.

[0824] 18. An oligonucleotide, a conjugate, a salt or a composition or use according to any preceding embodiment for use in the treatment of geographic atrophy.

[0825] Other embodiments of the present invention

[0826] The present invention therefore relates in particular to:

[0827] The oligonucleotide of the present invention, wherein the oligonucleotide is an antisense oligonucleotide capable of modulating the expression of a target RNA in a cell expressing said target RNA;

[0828] The oligonucleotide of the present invention, wherein the oligonucleotide is an antisense oligonucleotide capable of inhibiting the expression of a target RNA in a cell expressing said target RNA;

[0829] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2 ) one of which is an LNA nucleoside and the other is a DNA nucleoside, an RNA nucleoside or a sugar-modified nucleoside;

[0830] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2) one of which is an LNA nucleoside and the other is a DNA nucleoside or a sugar-modified nucleoside;

[0831] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2 ) one of which is an LNA nucleoside and the other is a DNA nucleoside;

[0832] The oligonucleotide of the present invention, wherein (A 1 ) and (A 2 ) one of which is an LNA nucleoside and the other is a sugar-modified nucleoside;

[0833] The oligonucleotide of the present invention, wherein the sugar-modified nucleoside is a 2'-sugar-modified nucleoside;

[0834] The oligonucleotide of the present invention, wherein the 2'-sugar modified nucleoside is a 2'-alkoxy-RNA, 2'-alkoxyalkoxy-RNA, 2'-amino-DNA, 2'-fluoro-RNA, 2'-fluoro-ANA or LNA nucleoside;

[0835] The oligonucleotide of the present invention, wherein the 2'-sugar modified nucleoside is an LNA nucleoside;

[0836] The oligonucleotide of the present invention, wherein the LNA nucleosides are independently selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA;

[0837] The oligonucleotide of the present invention, wherein the LNA nucleosides are all β-D-oxy LNA;

[0838] The oligonucleotide of the present invention, wherein the 2'-sugar modified nucleoside is 2'-alkoxyalkoxy-RNA;

[0839] The oligonucleotide of the present invention, wherein the 2'-alkoxy-RNA is a 2'-methoxy-RNA;

[0840] The oligonucleotide of the present invention, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA;

[0841] The oligonucleotides of the invention comprise between 1 and 15, in particular between 1 and 5, more particularly 1, 2, 3, 4 or 5 phosphorodithioate internucleoside linkages of formula (I) as defined above.

[0842] The oligonucleotides of the present invention, comprising other internucleoside bonds, are independently selected from phosphodiester internucleoside bonds, phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0843] The oligonucleotide of the present invention, wherein the other internucleoside linkages are independently selected from phosphorothioate internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I) as defined above.

[0844] The oligonucleotide of the present invention, wherein the other internucleoside bonds are phosphorothioate internucleoside bonds;

[0845] The oligonucleotide of the present invention, wherein the other internucleoside bonds are phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0846] The oligonucleotide of the invention, wherein the oligonucleotide is a gapmer, in particular an LNA gapmer, a mixed-flank gapmer, an alternating-flank gapmer, a splice-switching oligomer, a mixed-polymer or a full-polymer;

[0847] An oligonucleotide of the invention which is a gapmer and wherein at least one phosphorodithioate internucleoside linkage of formula (I) is contained in the gap region and / or in one or more flanking regions of the gapmer;

[0848] The oligonucleotide of the present invention, wherein the contiguous nucleotide sequence, such as the gapmer region FG-F', is flanked by flanking regions D' or D", or D' and D", said flanking regions comprising one or more DNA nucleosides linked to the rest of the oligonucleotide via phosphodiester internucleoside bonds;

[0849] An oligonucleotide of the invention which is a gapmer wherein one or both, in particular one, of the flanking regions F and F' is further flanked by phosphodiester-linked DNA nucleosides, in particular 1 to 5 phosphodiester-linked DNA nucleosides (regions D' and D''); and

[0850] The oligonucleotide of the present invention, wherein the oligonucleotide has a length of 7 to 30 nucleotides.

[0851] When the oligonucleotide of the invention is a gapmer, it advantageously has a length of 12 to 26 nucleotides. 16 nucleotides is a particularly advantageous gapmer oligonucleotide length.

[0852] When the oligonucleotide is an all-LNA oligonucleotide it is advantageously 7 to 10 nucleotides in length.

[0853] When the oligonucleotide is a mixed-polymer oligonucleotide, it advantageously has a length of from 8 to 30 nucleotides.

[0854] The present invention particularly relates to:

[0855] The oligonucleotide of the present invention, wherein one or more nucleosides are nucleobase-modified nucleosides;

[0856] The oligonucleotide of the present invention, wherein the oligonucleotide is an antisense oligonucleotide, siRNA, microRNA mimic or ribozyme;

[0857] A pharmaceutically acceptable salt of the oligonucleotide of the invention, especially a sodium salt or a potassium salt;

[0858] A conjugate comprising an oligonucleotide or a pharmaceutically acceptable salt of the invention and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety;

[0859] A pharmaceutical composition comprising an oligonucleotide, a pharmaceutically acceptable salt or a conjugate of the invention and a therapeutically inert carrier;

[0860] The oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention for use as a therapeutically active substance; and

[0861] Use of the oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention as a drug.

[0862] In some embodiments, as compared with the oligonucleotides connected with corresponding full thiophosphates, the oligonucleotides of the present invention have higher activity in regulating its target nucleic acid. In some embodiments, the present invention provides oligonucleotides with enhanced activity, enhanced efficacy, enhanced specific activity or enhanced cellular uptake. In some embodiments, the present invention provides oligonucleotides with changed external or internal action duration, such as extended external or internal action duration. In some embodiments, in the cell expressing the target nucleic acid, determine the higher activity of the target nucleic acid in vitro or in vivo.

[0863] In some embodiments, the oligonucleotides of the present invention have changed pharmacological properties, such as reduced toxicity, such as reduced nephrotoxicity, reduced hepatotoxicity or reduced immunostimulatory effects. Liver toxicity can be determined, for example, in vivo or by using the in vitro assay disclosed in WO2017 / 067970, and the document is thus incorporated herein by reference as a reference. Nephrotoxicity can be determined, for example, in vitro or by using the assay disclosed in PCT / EP2017 / 064770, and the document is thus incorporated herein by reference as a reference. In some embodiments, the oligonucleotides of the present invention include 5'CG 3' dinucleotides, such as DNA 5'CG 3' dinucleotides, wherein the internucleoside bond between C and G is a dithiophosphate internucleoside bond of formula (I) as defined above.

[0864] In some embodiments, the oligonucleotides of the invention have improved nuclease resistance, such as improved biostability in serum. In some embodiments, the 3' terminal nucleoside of the oligonucleotides of the invention has an A or G base, such as a 3' terminal LNA-A or LNA-G nucleoside. Suitably, the internucleoside bond between the two 3' last nucleosides of the oligonucleotide can be a dithiophosphate internucleoside bond according to formula (I) as defined above.

[0865] In some embodiments, the oligonucleotides of the invention have enhanced bioavailability. In some embodiments, the oligonucleotides of the invention have greater blood exposure, such as longer retention time in the blood.

[0866] Use phosphoramidite method to pass through solid phase synthesis, introduce non-bridging dithiophosphate modification to oligonucleotide.Use controlled pore glass (CPG) equipped with universal joint as support, synthesize.On this solid support, oligonucleotide is generally built by 3 ' to 5 ' direction by circulation successively, and described circulation successively is made up of the nucleoside phosphoramidite structural unit of coupling 5 'O-DMT protection, (thio) oxidation subsequently, capping and DMT group deprotection.Use suitable thiophosphoramidite structural unit, sulfur oxidation main intermediate subsequently, realize introducing non-bridging dithiophosphate.

[0867] Although corresponding DNA thiophosphoramidites are commercially available, corresponding LNA building blocks have not been described previously. They can be prepared, for example, from 5'-O-DMT-protected nucleoside 3'-ols by reaction with monobenzoyl-protected ethanedithiol and tripyrrolidin-1-ylphosphane.

[0868] The oligonucleotides of the invention can thus be prepared, for example, according to Scheme 2, wherein R 1 , R 2a , R 2b , R 4a , R 4b , R 5 , R x , R y and V are defined as follows.

[0869] Solution 2

[0870]

[0871] The present invention therefore also relates to a method for producing an oligonucleotide according to the invention, said method comprising the following steps:

[0872] (a) coupling a thiophosphoramidite nucleoside to the terminal 5' oxygen atom of a nucleotide or oligonucleotide to generate a thiophosphite triester intermediate;

[0873] (b) sulfur-oxidizing the thiophosphite triester intermediate obtained in step (a); and

[0874] (c) optionally further extending the oligonucleotide.

[0875] The present invention particularly relates to a method for producing an oligonucleotide according to the present invention, said method comprising the following steps:

[0876] (a1) a compound of formula (A)

[0877]

[0878] coupled to the 5' oxygen atom of a nucleotide or oligonucleotide of formula (B)

[0879]

[0880] (b1) sulfur-oxidizing the thiophosphite triester intermediate obtained in step (a1); and

[0881] (c1) optionally further extending the oligonucleotide;

[0882] in

[0883] R 2a and R 4a together form -XY- as defined above; or

[0884] R 4a is hydrogen and R 2a is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy and aminoalkoxy, especially aminoethoxy;

[0885] R 2b and R 4b together form -XY- as defined above; or

[0886] R 2b and R 4b are both hydrogen; or

[0887] R 4b is hydrogen and R 2b is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy and aminoalkoxy, especially aminoethoxy;

[0888] V is oxygen or sulfur; and

[0889] Where R 5 , R x , R y and Nu are defined below.

[0890] The present invention particularly relates to a method for producing an oligonucleotide according to the present invention, said method comprising the following steps:

[0891] (a2) coupling the compound of formula (II)

[0892]

[0893] to the 5' oxygen atom of a nucleotide or oligonucleotide of formula (IV)

[0894]

[0895] (b2) sulfur-oxidizing the thiophosphite triester intermediate obtained in step (a2); and

[0896] (c2) optionally further extending the oligonucleotide;

[0897] in

[0898] R 2b and R 4b together form -XY- as defined above; or

[0899] R 2b and R 4b are both hydrogen; or

[0900] R 4b is hydrogen and R 2b is selected from alkoxy, especially methoxy, halogen, especially fluorine, alkoxyalkoxy, especially methoxyethoxy, alkenyloxy, especially allyloxy and aminoalkoxy, especially aminoethoxy; and

[0901] Where R 5 , R x , R y and Nu are defined below.

[0902] The present invention also relates to an oligonucleotide produced according to the method of the present invention.

[0903] The present invention also relates to:

[0904] A gapmer oligonucleotide comprising at least one phosphorodithioate internucleoside bond of formula (I)

[0905]

[0906] wherein R is hydrogen or a phosphate protecting group;

[0907] A gapmer oligonucleotide as defined above, wherein the oligonucleotide is an antisense oligonucleotide capable of modulating expression of a target RNA in said cell expressing the target RNA;

[0908] A gapmer oligonucleotide as defined above, wherein the oligonucleotide is an antisense oligonucleotide capable of inhibiting the expression of a target RNA in a cell expressing said target RNA;

[0909] A gapmer oligonucleotide as defined above, capable of recruiting an RNase, such as human RNase H1;

[0910] The gapmer oligonucleotide of the present invention, wherein one of the two oxygen atoms of the at least one internucleoside bond of formula (I) is bonded to the adjacent nucleoside (A 1 ) and the other oxygen atom is connected to another nucleoside (A 2 ) is connected to the 5' carbon atom of the two nucleosides (A 1 ) and (A 2 ) is a 2'-sugar modified nucleoside;

[0911] The gapmer oligonucleotide of the present invention, wherein (A 1 ) and (A 2 ) one of which is a 2'-sugar modified nucleoside and the other is a DNA nucleoside;

[0912] The gapmer oligonucleotide of the present invention, wherein (A 1 ) and (A 2 ) are both 2'-modified nucleosides;

[0913] The gapmer oligonucleotide of the present invention, wherein (A 1 ) and (A 2 ) are both DNA nucleosides;

[0914] The gapmer oligonucleotide of the present invention, wherein the gapmer oligonucleotide comprises a continuous nucleotide sequence of the formula 5'-FG-F'-3', wherein G is a region having 5 to 18 nucleosides capable of recruiting RNase H, and the region G is flanked by flanking regions F and F' on the 5' and 3' sides, respectively, wherein region F and region F' independently comprise or consist of 1 to 7 2'-sugar-modified nucleotides, wherein the nucleosides of region F adjacent to region G are 2'-sugar-modified nucleosides and wherein the nucleosides of region F' adjacent to region G are 2'-sugar-modified nucleosides;

[0915] In the gapmer oligonucleotide of the present invention, the 2'-sugar modified nucleoside is independently selected from 2'-alkoxy-RNA nucleosides, 2'-alkoxyalkoxy-RNA nucleosides, 2'-amino-DNA nucleosides, 2'-fluoro-RNA nucleosides, 2'-fluoro-ANA nucleosides and LNA nucleosides;

[0916] The gapmer oligonucleotide of the present invention, wherein the 2'-alkoxyalkoxy-RNA is 2'-methoxyethoxy-RNA (2'-O-MOE);

[0917] The gapmer oligonucleotide of the present invention, wherein region F and region F' comprise or consist of 2'-methoxyethoxy-RNA nucleotides;

[0918] The gapmer oligonucleotide of the present invention, wherein both region F and region F' are composed of 2'-methoxyethoxy-RNA nucleotides, such as comprising the formula [MOE] 3-8 [DNA] 8-16 [MOE] 3-8 gapmers (e.g. [MOE]5[DNA] 10 [MOE]5) FG-F', i.e., wherein region F and region F' each consist of five 2'-methoxyethoxy-RNA nucleotides, and region G consists of 10 DNA nucleotides;

[0919] The gapmer oligonucleotide of the present invention, wherein at least one or all 2'-sugar modified nucleosides in region F or region F' or both region F and region F' are LNA nucleosides;

[0920] The gapmer oligonucleotide of the invention, wherein region F or region F' or both region F and region F' comprise at least one LNA nucleoside and at least one DNA nucleoside;

[0921] The gapmer oligonucleotide of the invention, wherein region F or region F' or both region F and region F' comprises at least one LNA nucleoside and at least one non-LNA 2'-sugar modified nucleoside, such as at least one 2'-methoxyethoxy-RNA nucleoside;

[0922] The gapmer oligonucleotide of the present invention, wherein the gap region comprises 5 to 16, particularly 8 to 16, more particularly 8, 9, 10, 11, 12, 13 or 14 consecutive DNA nucleosides;

[0923] The gapmer oligonucleotide of the present invention, wherein region F and region F' independently have a length of 1, 2, 3, 4, 5, 6, 7 or 8 nucleosides;

[0924] The gapmer oligonucleotide of the present invention, wherein region F and region F' each independently comprise 1, 2, 3 or 4 LNA nucleosides;

[0925] The gapmer oligonucleotide of the present invention, wherein the LNA nucleosides are independently selected from β-D-oxy LNA, 6'-methyl-β-D-oxy LNA and ENA;

[0926] The gapmer oligonucleotide of the present invention, wherein the LNA nucleoside is β-D-oxy LNA;

[0927] The gapmer oligonucleotide of the present invention, wherein the oligonucleotide or its consecutive nucleotide sequence (FG-F') has a length of 10 to 30 nucleotides, particularly 12 to 22, more particularly 14 to 20 oligonucleotides;

[0928] A gapmer oligonucleotide according to the invention, wherein the gapmer oligonucleotide comprises a contiguous nucleotide sequence of the formula 5'-D'-FG-F'-D"-3', wherein F, G and F' are as defined in any one of claims 4 to 17 and wherein regions D' and D" each independently consist of 0 to 5 nucleotides, in particular 2, 3 or 4 nucleotides, in particular DNA nucleotides (such as phosphodiester-linked DNA nucleosides);

[0929] The gapmer oligonucleotide of the present invention, wherein the gapmer oligonucleotide is capable of recruiting human RNase H1;

[0930] The gapmer oligonucleotide of the present invention, wherein the at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between adjacent nucleosides in region F or region F', between region F and region G, or between region G and region F';

[0931] The gapmer oligonucleotide of the present invention further comprises a phosphorothioate internucleoside linkage;

[0932] The gapmer oligonucleotide of the present invention, wherein the internucleoside bonds between the nucleosides of region G are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0933] The gapmer oligonucleotide of the present invention, wherein the internucleoside bonds between the nucleosides of region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0934] The gapmer oligonucleotide of the present invention, wherein the remaining internucleoside linkages are independently selected from phosphorothioate internucleoside linkages, phosphodiester internucleoside linkages and phosphorodithioate internucleoside linkages of formula (I) as defined above;

[0935] The gapmer oligonucleotide of the present invention, wherein the internucleoside bonds between nucleosides of region F and the internucleoside bonds between nucleosides of region F' are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0936] The gapmer oligonucleotide of the present invention, wherein each flanking region F and F' independently comprises 1, 2, 3, 4, 5, 6 or 7 phosphorodithioate internucleoside bonds of formula (I) as defined above.

[0937] A gapmer oligonucleotide of the invention, wherein the flanking regions F and F' together or individually comprise 1, 2, 3, 4, 5 or 6 phosphorodithioate internucleoside bonds of formula (I) as defined above, or all internucleoside bonds in region F and / or region F' are phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0938] The gapmer oligonucleotide of the present invention, wherein the flanking regions F and F' together comprise 1, 2, 3 or 4 phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0939] The gapmer oligonucleotide of the present invention, wherein the flanking regions F and F' each comprise 2 phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0940] The gapmer oligonucleotide of the present invention, wherein all internucleoside bonds of the flanking regions F and / or F' are phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0941] The gapmer oligonucleotide of the invention, wherein the gapmer oligonucleotide comprises at least one stereo-defined internucleoside linkage, such as at least one stereo-defined phosphorothioate internucleoside linkage;

[0942] The gapmer oligonucleotide of the invention, wherein the gap region comprises 1, 2, 3, 4 or 5 stereo-defined phosphorothioate internucleoside bonds;

[0943] The gapmer oligonucleotide of the present invention, wherein all internucleoside bonds between nucleosides in the gap region are stereo-defined phosphorothioate internucleoside bonds;

[0944] A gapmer oligonucleotide of the invention, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between nucleosides in region F, or between nucleosides in region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds within region F and region F', between region F and region G, and between region G and region F' are independently selected from stereothioate internucleoside bonds, stereorandom internucleoside bonds, phosphorodithioate internucleoside bonds of formula (I), and phosphodiester internucleoside bonds that define;

[0945] A gapmer oligonucleotide of the invention, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides of region F, or between two adjacent nucleosides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds between the nucleotides of region F and region F' are independently selected from phosphorothioate internucleoside bonds, phosphorodithioate internucleoside bonds of formula (I) and phosphodiester internucleoside bonds. The phosphorothioate internucleoside bonds of region F and region F' may be stereo-random or stereo-defined, or may be independently selected from stereo-random and stereo-chemically defined;

[0946] A gapmer oligonucleotide of the invention, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides of region F, or between at least two adjacent nucleosides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds between the nucleotides of region F and region F' are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I). The phosphorothioate internucleoside bonds of region F and region F' may be stereo-random or stereo-defined, or may be independently selected from stereo-random and stereo-chemically defined;

[0947] A gapmer oligonucleotide according to the invention, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides of region F, or between at least two adjacent nucleosides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds between nucleotides of region F and region F', between region F and region G, and between region G and region F' are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I); the phosphorothioate internucleoside bonds of region F and region F' may be stereo-random or stereo-defined, or may be independently selected from stereo-random and stereo-defined;

[0948] A gapmer oligonucleotide of the invention, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides of region F, or between at least two adjacent nucleosides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds between nucleotides of region F and region F' and between region F and region G and between region G and region F' are independently selected from stereo-defined phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (I);

[0949] A gapmer oligonucleotide of the invention, wherein at least one phosphorodithioate internucleoside bond of formula (I) as defined above is located between at least two adjacent nucleosides of region F, or between at least two adjacent nucleosides of region F', or between region F and region G, or between region G and region F', and the remaining internucleoside bonds within regions F and F', between regions F and region G, and between region G and region F' are phosphorothioate internucleoside bonds, which may be all stereo-irregular phosphorothioate internucleoside bonds, all stereo-defined phosphorothioate internucleoside bonds, or may be independently selected from stereo-irregular phosphorothioate internucleoside bonds and stereo-defined phosphorothioate internucleoside bonds;

[0950] A gapmer oligonucleotide of the invention, wherein the remaining internucleoside bonds within region F, within region F', or within both region F and region F' are phosphorodithioate internucleoside bonds of formula (I) as defined above;

[0951] The gapmer oligonucleotide of the present invention, wherein the internucleoside bonds between nucleosides of region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above and the remaining internucleoside bonds within region G are independently selected from stereo-defined phosphorothioate internucleoside bonds and stereo-irregular phosphorothioate internucleoside bonds;

[0952] The gapmer oligonucleotide of the present invention, wherein the internucleoside bonds between nucleosides of region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above and at least one of the remaining internucleoside bonds within region G or all of the remaining internucleoside bonds within region G are stereo-defined phosphorothioate internucleoside bonds;

[0953] A gapmer oligonucleotide of the invention, wherein the internucleoside bonds between nucleosides of region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above and the remaining internucleoside bonds within region G are phosphorothioate internucleoside bonds, such as stereo-irregular phosphorothioate internucleoside bonds;

[0954] A gapmer oligonucleotide of the invention, wherein at least one of region F or region F' comprises at least one phosphorodithioate internucleoside linkage of formula (I) as defined above and all internucleoside linkages within region G are phosphorothioate internucleoside linkages, such as stereo-irregular phosphorothioate internucleoside linkages;

[0955] A gapmer oligonucleotide of the invention, wherein at least one of region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above and all internucleoside bonds within region G are phosphorothioate internucleoside bonds, wherein at least one of the phosphorothioate internucleoside bonds within region G is a stereo-defined phosphorothioate internucleoside bond;

[0956] A gapmer oligonucleotide of the invention, wherein at least one of region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above and all internucleoside bonds within region G are stereo-defined phosphorothioate internucleoside bonds;

[0957] A gapmer oligonucleotide of the invention, wherein the internucleoside bond between regions F and G, or the internucleoside bond between regions G and F', or the internucleoside bonds between regions F and G and between regions G and F' are phosphorodithioate internucleoside bonds of formula (I) as defined above, and wherein, if only one of the internucleoside bonds between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above, the other internucleoside bond between regions F and G or between regions G and F' is a phosphorothioate internucleoside bond;

[0958] A gapmer oligonucleotide of the invention, wherein at least one of region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above, wherein the internucleoside bond between regions F and G, or between regions G and F', or between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above and wherein if only one of the internucleoside bonds between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above, the other internucleoside bond between regions F and G or between regions G and F' is a phosphorothioate internucleoside bond;

[0959] A gapmer oligonucleotide of the invention, wherein the internucleoside bonds between nucleosides of region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above and the remaining internucleoside bonds within region G are phosphorothioate internucleoside bonds, wherein the internucleoside bond between regions F and G, or the internucleoside bond between regions G and F', or the internucleoside bonds between regions F and G and between regions G and F' are phosphorodithioate internucleoside bonds of formula (I) as defined above and wherein if only one of the internucleoside bonds between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above, the other internucleoside bond between regions F and G or between regions G and F' is a phosphorothioate internucleoside bond;

[0960] A gapmer oligonucleotide of the invention, wherein at least one of region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above, wherein the internucleoside bonds between nucleosides of region G comprise 0, 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above and the remaining internucleoside bonds within region G are phosphorothioate internucleoside bonds, wherein the internucleoside bond between regions F and G, or the internucleoside bond between regions G and F', or the internucleoside bonds between regions F and G and between regions G and F' are phosphorodithioate internucleoside bonds of formula (I) as defined above, and wherein, if only one of the internucleoside bonds between regions F and G and between regions G and F' is a phosphorodithioate internucleoside bond of formula (I) as defined above, the other internucleoside bond between regions F and G or between regions G and F' is a phosphorothioate internucleoside bond;

[0961] A gapmer oligonucleotide of the invention, wherein region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above, or wherein the internucleoside bonds between region F and region G or between region G and region F' comprise at least one phosphorodithioate internucleoside bond of formula (I) as defined above, region G comprises 1, 2 or 3 phosphorodithioate internucleoside bonds of formula (I) as defined above, and the remaining internucleoside bonds within region G are phosphorothioate internucleoside bonds;

[0962] A gapmer oligonucleotide of the invention, wherein region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above, or wherein the internucleoside bonds between region F and region G or between region G and region F' comprise at least one phosphorodithioate internucleoside bond of formula (I) as defined above, all internucleoside bonds within region G are phosphorothioate internucleoside bonds, and wherein at least one of the phosphorothioate internucleoside bonds within region G is a stereo-defined phosphorothioate internucleoside bond;

[0963] A gapmer oligonucleotide of the invention, wherein region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above, or wherein the internucleoside bonds between region F and region G or between region G and region F' comprise at least one phosphorodithioate internucleoside bond of formula (I) as defined above, all internucleoside bonds within region G are phosphorothioate internucleoside bonds, and wherein all phosphorothioate internucleoside bonds within region G are stereo-defined phosphorothioate internucleoside bonds;

[0964] A gapmer oligonucleotide of the present invention, wherein except for at least one phosphorodithioate internucleoside bond of formula (I) as defined above, all remaining internucleoside bonds within the gapmer region FG-F' are phosphorothioate internucleoside bonds;

[0965] A gapmer oligonucleotide of the invention, wherein at least one of region F or region F' comprises at least one phosphorodithioate internucleoside bond of formula (I) as defined above and all internucleoside bonds within region G are stereo-defined phosphorothioate internucleoside bonds;

[0966] The gapmer oligonucleotide of the present invention, wherein except for at least one phosphorodithioate internucleoside bond of formula (I), all remaining internucleoside bonds within the gapmer region FG-F' are stereo-defined phosphorothioate internucleoside bonds;

[0967] The gapmer oligonucleotide of the present invention is an LNA gapmer, a mixed flank gapmer, an alternating flank gapmer or a gapbreaker gapmer.

[0968] A pharmaceutically acceptable salt of the gapmer oligonucleotide of the present invention, especially a sodium salt or a potassium salt;

[0969] A conjugate comprising a gapmer oligonucleotide or a pharmaceutically acceptable salt of the invention and at least one conjugate moiety covalently linked to said oligonucleotide or said pharmaceutically acceptable salt, optionally via a linker moiety, in particular via a biocleavable linker, in particular via 2 to 4 phosphodiester-linked DNA nucleosides (e.g. region D' or D");

[0970] A pharmaceutical composition comprising a gapmer oligonucleotide of the invention, a pharmaceutically acceptable salt or conjugate and a therapeutically inert carrier;

[0971] The gapmer oligonucleotide, pharmaceutically acceptable salt or conjugate of the present invention is used as a therapeutically active substance;

[0972] Use of a gapmer oligonucleotide, a pharmaceutically acceptable salt or a conjugate thereof as a medicament;

[0973] A method for regulating the expression of a target RNA in a cell, the method comprising administering an oligonucleotide or gapmer oligonucleotide of the present invention to a cell expressing the target RNA, thereby regulating the expression of the target RNA;

[0974] A method for inhibiting expression of a target RNA in a cell, the method comprising administering an oligonucleotide or a gapmer oligonucleotide of the present invention to a cell expressing the target RNA, thereby inhibiting expression of the target RNA; and

[0975] An in vitro method for regulating or inhibiting a target RNA in a cell, the method comprising administering an oligonucleotide or gapmer oligonucleotide of the invention to a cell expressing the target RNA, thereby regulating or inhibiting the target RNA in the cell.

[0976] The target RNA may, for example, be a mammalian mRNA, such as a pre-mRNA or a mature mRNA, a human mRNA, a viral RNA, or a non-coding RNA, such as a microRNA or a long non-coding RNA.

[0977] In some embodiments, the modulation is pre-mRNA splicing modulation resulting in an altered splicing pattern of the target pre-mRNA.

[0978] In some embodiments, the modulation effect is an inhibition that can occur through a target degradation process (e.g., by recruiting RNase H, such as RNase H1 or RISC), or the inhibition can occur through an occupancy-mediated mechanism that inhibits the normal biological function of the target RNA (e.g., the inhibition of microRNAs or long non-coding RNAs by mixed or full polymers).

[0979] The human mRNA may be mature RNA or pre-mRNA.

[0980] The present invention further relates to compounds of formula (II)

[0981]

[0982] in

[0983] X is oxygen, sulfur, -CR a R b -、-C(R a )=C(R b )-、-C(=CR a R b )-、-C(R a )=N-、-Si(R a )2-、-SO2-、-NR a -;-O-NR a -、-NR a -O-, -C(=J)-, Se, -O-NR a -、-NR a -CR a R b -、-N(R a )-O-or-O-CR a R b -;

[0984] Y is oxygen, sulfur, -(CR a R b ) n -、-CR a R b -O-CR a R b -、-C(R a )=C(R b)-、-C(R a )=N-、-Si(R a )2-、-SO2-、-NR a -, -C(=J)-, Se, -O-NR a -、-NR a -CR a R b -、-N(R a )-O-or-O-CR a R b -;

[0985] The condition is that -XY- is not -OO-, Si(R a )2-Si(R a )2-、-SO2-SO2-、-C(R a )=C(R b )-C(R a )=C(R b )、-C(R a )=NC(R a )=N-、-C(R a )=NC(R a )=C(R b )、-C(R a )=C(R b )-C(R a )=N- or -Se-Se-;

[0986] J is oxygen, sulfur, =CH2 or =N(R a );

[0987] R a and R b independently selected from hydrogen, halogen, hydroxy, cyano, sulfhydryl, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, alkoxy, substituted alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, aryl, heterocyclic, amino, alkylamino, carbamoyl, alkylaminocarbonyl, aminoalkylaminocarbonyl, alkylaminoalkylaminocarbonyl, alkylcarbonylamino, ureido, alkanoyloxy, sulfonyl, alkylsulfonyloxy, nitro, azido, alkylsulfhydryl, aryloxycarbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxycarbonyl, heteroaryloxy, heteroarylcarbonyl, -OC(=X a )R c 、-OC(=X a )NR c R d and-NR e C(=X a )NR c R d ;

[0988] or two R a and R b together form an optionally substituted methylene group;

[0989] or two R a and R b Together with the carbon atom to which they are attached, they form a cycloalkyl or halocycloalkyl group having only one carbon atom of -XY-;

[0990] wherein substituted alkyl, substituted alkenyl, substituted alkynyl, substituted alkoxy and substituted methylene are alkyl, alkenyl, alkynyl and methylene substituted with 1 to 3 substituents independently selected from halogen, hydroxy, alkyl, alkenyl, alkynyl, alkoxy, alkoxyalkyl, alkenyloxy, carboxyl, alkoxycarbonyl, alkylcarbonyl, formyl, heterocyclyl, aryl and heteroaryl;

[0991] X a is oxygen, sulfur or -NR c ;

[0992] R c , R d and R e are independently selected from hydrogen and alkyl;

[0993] n is 1, 2, or 3.

[0994] R 5 is a hydroxyl protecting group;

[0995] R x is phenyl, nitrophenyl, phenylalkyl, halophenylalkyl, cyanoalkyl, phenylcarbonylsulfanylalkyl, halophenylcarbonylsulfanylalkyl, alkylcarbonylsulfanylalkyl, or alkylcarbonylcarbonylsulfanylalkyl;

[0996] R y is dialkylamino or pyrrolidinyl; and

[0997] Nu is a nucleobase or a protected nucleobase.

[0998] The present invention also relates to:

[0999] A compound of formula (II), wherein -XY- is -CH2-O-, -CH(CH3)-O- or -CH2CH2-O-;

[1000] The present invention also provides a compound of formula (IIb)

[1001]

[1002] in

[1003] R5 is a hydroxyl protecting group,

[1004] R x is phenyl, nitrophenyl, phenylalkyl, halophenylalkyl, cyanoalkyl, phenylcarbonylsulfanylalkyl, halophenylcarbonylsulfanylalkyl, alkylcarbonylsulfanylalkyl, or alkylcarbonylcarbonylsulfanylalkyl;

[1005] R y is dialkylamino or pyrrolidinyl; and

[1006] Nu is a nucleobase or a protected nucleobase;

[1007] A compound of formula (II) having formula (III) or (IV)

[1008]

[1009] Where R 5 , R x , R y and Nu are as defined above.

[1010] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenyl, nitrophenyl, phenylmethyl, dichlorophenylmethyl, cyanoethyl, methylcarbonylsulfanylethyl, ethylcarbonylsulfanylethyl, isopropylcarbonylsulfanylethyl, tert-butylcarbonylsulfanylethyl, methylcarbonylcarbonylsulfanylethyl or difluorophenylcarbonylsulfanylethyl;

[1011] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenyl, 4-nitrophenyl, 2,4-dichlorophenylmethyl, cyanoethyl, methylcarbonylsulfanylethyl, ethylcarbonylsulfanylethyl, isopropylcarbonylsulfanylethyl, tert-butylcarbonylsulfanylethyl, methylcarbonylcarbonylsulfanylethyl or 2,4-difluorophenylcarbonylsulfanylethyl;

[1012] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenylcarbonylsulfanylalkyl;

[1013] A compound of formula (II), (IIb), (III) or (IV), wherein R x is phenylcarbonylsulfanylethyl;

[1014] A compound of formula (II), (IIb), (III) or (IV), wherein R y is diisopropylamino or pyrrolidinyl;

[1015] A compound of formula (II), (IIb), (III) or (IV), wherein R y It is pyrrolidinyl;

[1016] A compound of formula (II) having formula (V)

[1017]

[1018] Where R 5 and Nu is as defined above;

[1019] A compound of formula (IIb) having formula (Vb)

[1020]

[1021] Where R 5 and Nu is as defined above;

[1022] A compound of formula (II), (IIb), (III), (IV) or (V) or (Vb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracilyl or protected uracilyl;

[1023] A compound of formula (IIb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracilyl or protected uracilyl;

[1024] A compound of formula (Vb), wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracilyl, or protected uracilyl;

[1025] The compound of formula (II) is selected from

[1026]

[1027]

[1028] The compound of formula (IIb) is selected from

[1029]

[1030] The presence of impurities in compounds of formula (II) and (IIb) leads to by-products during the manufacture of oligonucleotides and hinders the success of the synthesis. In addition, in the presence of impurities, compounds of formula (II) or (IIb) are unstable when stored.

[1031] Compounds of formula (X1), (X2), X(11) and (X21)

[1032]

[1033] along with others are examples of such impurities.

[1034] For storage and oligonucleotide manufacturing purposes, it is therefore necessary to have the compound of formula (II) or (lib) in a sufficiently pure form.

[1035] The present invention therefore also relates to compounds of formula (II) (IIb) having a purity of at least 98%, in particular 99%, more in particular 100%.

[1036] The present invention therefore relates in particular to compounds of the formula (II) which comprise less than 1%, in particular 0%, of compounds of the formula (X1) and / or (X2) as impurities.

[1037] The present invention also relates to a process for making a compound of formula (II), said process comprising reacting a 5'-protected LNA nucleoside with a phosphine and a mono-protected dithiol in the presence of an acidic coupling agent and a silanizing agent.

[1038] The present invention also relates to a method for making a compound of formula (IIb), which comprises reacting a 5'-protected MOE nucleoside with a phosphine and a mono-protected dithiol in the presence of an acidic coupling agent and a silanizing agent.

[1039] The present invention relates to a method for producing a compound of formula (II), said method comprising making a compound of formula (C)

[1040]

[1041] With the formula P(R y )3 and the compound of formula HSR x The compound is reacted in the presence of an acidic coupling agent and a silanizing agent, wherein X, Y, R 5 、Nu、R x and R y As defined above.

[1042] The present invention also relates to a process for the manufacture of a compound of formula (II) as defined above, said process comprising reacting a compound of formula (C1)

[1043]

[1044] With the formula P(R y )3 and the compound of formula HSR x The compound of 5 、Nu、R x and R y As defined above.

[1045] The present invention also relates to a process for the manufacture of a compound of formula (IIb) as defined above, said process comprising subjecting a compound of formula (Cb) to

[1046]

[1047] With the formula P(R y )3 and the compound of formula HSR x The compound of 5 、Nu、R x and R y As defined above.

[1048] Examples of acidic coupling agents (also referred to as acidic activators) are azole-based activators such as tetrazole, 5-nitrophenyl-1H-tetrazole (NPT), 5-ethylthio-1H-tetrazole (ETT), 5-benzylthio-1H-tetrazole (BTT), 5-methylthio-1H-tetrazole (MTT), 5-sulfhydryl-tetrazoles (MCT), 5-(3,5-bis(trifluoromethyl)phenyl)-1H-tetrazole and 4,5-dicyanoimidazole (DCI), or acidic salts such as pyridinium chloride, trifluoroimidazolium, trifluorobenzimidazolium, trifluoro-5-nitrobenzimidazolium, or weak acids such as 2,4-dinitrobenzoic acid or 2,4-dinitrophenol. Tetrazole is a specific acidic coupling agent.

[1049] Examples of silanizing agents (also known as hydroxyl quenchers) are bis(dimethylamino)dimethylsilane, N,O-bis(trimethylsilyl)acetamide (BSA), N,O-bis(trimethylsilyl)carbamate (BSC), N,N-bis(trimethylsilyl)methylamine, N,O-bis(trimethylsilyl)trifluoroacetamide (BSTFA), N,N′-bis(trimethylsilyl)urea (BSU), bromotrimethylsilane (TMBS), N-tert-butyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA), chlorodimethyl(pentafluorophenyl)silane, chlorotriethylsilane (TESCI), chlorotrimethylsilane (TMCS), 1,3-dimethyl-1,1,3,3-tetraphenyldisilazane (TPDMDS), N,N-dimethyltrimethylsilylamine (TMSDMA), hexamethyldisilazane (HMDS), hexamethyldisiloxane (HMDSO), N-methyl-N-trimethylsilylacetamide (MSA), N-methyl-N-trimethylsilylheptafluorobutyramide (MSHFA), N-methyl-N-(trimethylsilyl)trifluoroacetamide (MSTFA), 1,1,3,3-tetramethyl-1,3-diphenyldisilazane (DPTMDS), 4-(trimethylsilyl)-3-pentan-2-one (TMS acac), 1-(trimethylsilyl)imidazole (TMSI) or trimethylsilylmethallylsulfinate (SILMAS-TMS). 1-(Trimethylsilyl)imidazole is a specific silanizing agent.

[1050] The present invention also relates to a process for the manufacture of a compound of formula (II), (IIb) or (III), wherein the crude compound of formula (II) or (IIb) is purified by preparative HPLC.

[1051] The present invention also relates to a process for making a compound of formula (II), (IIb) or (III), wherein the crude compound of formula (II), (IIb) or (III) is purified by preparative HPLC and eluted with a gradient of acetonitrile to ammonium hydroxide in water.

[1052] The ammonium hydroxide content of the water is particularly at least about 0.05% v / v, particularly between about 0.05% and 1% v / v, more particularly between about 0.05% and 0.5% v / v, more particularly about 0.05% v / v.

[1053] The acetonitrile gradient is particularly between 0% and 25% to between 75% and 100% acetonitrile, particularly in the range of 20 minutes to 120 minutes, more particularly between 10% and 20% to between 75% and 90% acetonitrile, particularly in the range of 25 minutes to 60 minutes, more particularly about 25% to 75% acetonitrile, particularly in the range of 30 minutes.

[1054] The present invention also relates to the use of a compound of formula (II), (IIb) or (III) in the manufacture of an oligonucleotide, in particular an oligonucleotide or a gapmer oligonucleotide of the present invention.

[1055] The invention will now be illustrated by the following examples, which have no limiting character. Example

[1056] Example 1: Monomer Synthesis

[1057] 1.1: S-(2-sulfanylethyl)benzenethiocarboxylate

[1058]

[1059] To a solution of 1,2-ethanedithiol (133.57 mL, 1592 mmol, 1 eq) and pyridine (64.4 mL, 796 mmol, 0.5 eq) in chloroform (200 mL) was added benzoyl chloride (92.4 mL, 796 mmol, 0.5 eq) in chloroform (200 mL) dropwise for 1 hour, and the reaction was stirred at 0°C for 1 hour. The mixture was washed with water (300 mL) and brine (300 mL). The organic phase was dried over Na2SO4 and concentrated to a yellow oil. The oil was distilled (135-145°C) to provide S-(2-sulfanylethyl)benzenethiocarboxylate (40 g, 202 mmol, 13% yield) as a colorless oil. 1 H NMR (400MHz, CDCl3) δ7.97 (d, J = 7.34Hz, 2H), 7.53-7.64 (m, 1H), 7.47 (t, J = 7. 58Hz, 2H), 3.31 (t, J = 7.34Hz, 2H), 2.77-2.86 (m, 2H), 1.70 (t, J = 8.56Hz, 1H).

[1060] 1.2: S-[2-[[(1R,3R,4R,7S)-1-[[Bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-3-(5-methyl-2,4-dioxo-pyrimidin-1-yl)-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphoalkyl]sulfanylethyl]phenylthiocarboxylate

[1061]

[1062] 1-[(1R,4R,6R,7S)-4-[[Bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]-5-methyl-pyrimidine-2,4-dione (2.29 g, 4.00 mmol, 1.0 equiv) was dissolved in 60 mL of anhydrous dichloromethane and a spatula of Molecular sieves. Tripyrrolidin-1-ylphosphane (960 mg, 3.98 mmol, 0.99 equiv) was added by syringe, followed by seven equal portions of 0.1 mmol tetrazole (at 200 μl) at 2-min intervals. 7*0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored over 100 molecular sieves). N-trimethylsilylimidazole (56.0 mg, 0.400 mmol, 0.1 eq) was then added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, followed immediately by S-(2-sulfanylethyl)benzenethiocarboxylate (1.04 g, 5.24 mmol, 1.31 eq). The reaction was allowed to proceed for 120 seconds. Four identical batches of reactions were combined and quenched by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was immediately washed with saturated sodium bicarbonate (800 mL), followed by 10% sodium carbonate (2*800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10-15 minutes, the drying agent was removed by filtration. Triethylamine (40mL) is added to solution, wherein the solution is concentrated into a slurry using a rotary evaporator. The slurry is dissolved in toluene (200mL) and triethylamine (40mL), and this solution is sucked in the heptane of 4500mL powerful stirring to separate out a soft white product. After decantation of most of heptane, filter through a medium sintered glass funnel, collect the white precipitate and dry under vacuum to produce a white solid subsequently. By preparative HPLC (Phenomenex Gemini C18, 250x50mm, 10mm post, 0.05% ammonium hydroxide / CH in water CN) purified solid, and freeze-dried to provide 4.58g of the target compound as a white solid. 31 P NMR (162MHz, CD3CN) δ167.6,164.2. 1H NMR(400MHz,CD3CN)δ9.16(br s,1H),7.93(t,J=7.41Hz,2H),7.60-7.71(m,1H),7.45-7.57(m,4H),7.24-7.45(m,7H),6.90(d,J=8.93Hz,4H),5.53-5.63(m,1H),4 .41-4.64(m,2H),3.74-3.88(m,8H),3.39-3.63(m,2H),3.03-3.32(m,5H),2.77-2.94(m,2H),1.66-1.84(m,4H),1.54-1.66(m,3H).

[1063] 1.3: S-[2-[[(1R,3R,4R,7S)-3-(6-benzamidopurin-9-yl)-1-[[bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphoalkyl]sulfanylethyl]phenylthiocarboxylate

[1064]

[1065] N-[9-[(1R,4R,6R,7S)-4-[[Bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]purin-6-yl]benzamide (2.74 g, 4.00 mmol, 1.0 equivalent) was dissolved in 60 mL of anhydrous dichloromethane and a spatula of Molecular sieves. Tripyrrolidin-1-ylphosphane (960 mg, 3.98 mmol, 0.99 equiv) was added by syringe, followed by seven equal portions of 0.1 mmol tetrazole (at 200 μl) at 2-min intervals. 7*0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored over 100 molecular sieves). 1-(Trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 equiv) was then added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, followed immediately by S-(2-sulfanylethyl)benzenethiocarboxylate (1.04 g, 5.24 mmol, 1.31 equiv). The reaction was allowed to proceed for 120 seconds. Four identical batches of reactions were combined and quenched by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was immediately washed with saturated sodium bicarbonate (800 mL), followed by 10% sodium carbonate (2*800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10-15 minutes, the drying agent was removed by filtration. Triethylamine (10mL) is added to solution, wherein the solution is concentrated into a slurry using a rotary evaporator. The slurry is dissolved in toluene (100mL) and triethylamine (20mL), and this solution is sucked in the heptane of 4500mL powerful stirring to separate out a soft white product. After decantation of most of heptane, filter through a medium sintered glass funnel, collect the white precipitate and dry under vacuum to produce a white solid. By preparative HPLC (Phenomenex Gemini C18, 250x50mm, 10mm post, 0.05% ammonium hydroxide / CH in water CN) purified solid, and freeze-dried to provide 5.26g of the target compound as a white solid. 31 P NMR (162MHz, CD3CN) δ165.6,164.7. 1 H NMR(400MHz,CD3CN)δ8.56(d,J=10.76Hz,1H),8.24(d,J=10.27Hz,1H),7.82 -7.93(m,2H),7.71-7.80(m,2H),6.92-7.54(m,14H),6.68-6.83(m,4H),6.0 3(d,J=6.48Hz,1H),4.70-4.90(m,2H),3.81-3.98(m,2H),3.59-3.68(m,7H) ,3.25-3.47(m,2H),2.81-3.02(m,6H),2.56-2.81(m,2H),1.44-1.72(m,4H).

[1066] 1.4: S-[2-[[(1R,3R,4R,7S)-3-(4-benzamide-5-methyl-2-oxo-pyrimidin-1-yl)-1-[[bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphoalkyl]sulfanylethyl]phenylthiocarboxylate

[1067]

[1068] N-[1-[(1R,4R,6R,7S)-4-[[Bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]-5-methyl-2-oxo-pyrimidin-4-yl]benzamide (2.70 g, 4.00 mmol, 1.0 equiv) was dissolved in 60 mL of anhydrous dichloromethane and a spatula of Molecular sieves. Trispyrrolidin-1-ylphosphane (965 mg, 4.00 mmol, 1.0 equiv) was added by syringe, followed by seven equal portions of 0.1 mmol tetrazole (at 200 μl) at 2-min intervals. 7*0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored on 100 molecular sieves). 1-(Trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 equiv) was then added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, followed immediately by S-(2-sulfanylethyl)benzenethiocarboxylate (1.04 g, 5.24 mmol, 1.31 equiv). The reaction was allowed to proceed for 120 seconds. Four identical batches of the reaction were quenched and combined by pouring the solution into 600 mL of dichloromethane containing 40 mL of triethylamine. The mixture was immediately washed with saturated sodium bicarbonate (800 mL), followed by 10% sodium carbonate (2*800 mL) and brine (800 mL). The organic layer was dried over Na2SO4. After 10-15 minutes, the drying agent was removed by filtration. Triethylamine (40mL) is added to solution, wherein the solution is concentrated into a slurry using a rotary evaporator. The slurry is dissolved in toluene (100mL) and triethylamine (30mL), and this solution is sucked in the heptane of 4500mL powerful stirring to separate out a soft white product. After decantation of most of heptane, filter through a medium sintered glass funnel, collect the white precipitate and dry under vacuum to produce a white solid subsequently. By preparative HPLC (Phenomenex Gemini C18, 250x50mm, 10mm post, 0.05% ammonium hydroxide / CH in water CN) purified solid, and lyophilized to provide 2.05 g of the target compound as a white solid. 31P NMR (162MHz, CD3CN) δ171.2,167.4. 1 H NMR (400MHz, CD3CN) δ8.18-8.32(m,2H),7.81-7.93(m,3H),7.35-7.60(m,14H),7.17-7.35(m,2H),6.93(d,J=8.93Hz,4H),5.65(d, J=15.04Hz,1H),4.56-4.72(m,2H),3.69-3.90(m,8H),3.45-3.61(m,2H),3.03-3.26(m,6H),2.76-3.02(m,2H),1.65-1.93(m,7H).

[1069] 1.5: S-[2-[[(1R,3R,4R,7S)-1-[[Bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-3-[2-[(E)-dimethylaminomethyleneamino]-6-oxo-1H-purin-9-yl]-2,5-dioxabicyclo[2.2.1]hept-7-yl]oxy-pyrrolidin-1-yl-phosphoalkyl]sulfanylethyl]phenylthiocarboxylate

[1070]

[1071] N'-[9-[(1R,4R,6R,7S)-4-[[Bis(4-methoxyphenyl)-phenyl-methoxy]methyl]-7-hydroxy-2,5-dioxabicyclo[2.2.1]hept-6-yl]-6-oxo-1H-purin-2-yl]-N,N-dimethyl-formamidine (2.62 mg, 4.00 mmol, 1.0 equiv) was dissolved in 200 mL of anhydrous dichloromethane and a spatula of Molecular sieves. Trispyrrolidin-1-ylphosphane (965 mg, 4.00 mmol, 1.0 equiv) was added by syringe, followed by seven equal portions of 0.1 mmol tetrazole (at 200 μl) at 2-min intervals. 7*0.4 mL of a 0.5 M solution in anhydrous acetonitrile stored over 100 molecular sieves). 1-(Trimethylsilyl)-1H-imidazole (56.0 mg, 0.400 mmol, 0.1 eq) was then added to the reaction. After 5 minutes, tetrazole (21.6 mL of a 0.5 M solution in anhydrous acetonitrile) was added, followed immediately by S-(2-sulfanylethyl)benzenethiocarboxylate (1.04 g, 5.24 mmol, 1.31 eq). The reaction was allowed to proceed for 180 seconds.

[1072] By pouring the solution into 600mL dichloromethane containing 40mL triethylamine, merge and quench four identical batches.Mixture is washed with saturated sodium bicarbonate (800mL) immediately, then with 10% sodium carbonate (2*800mL) and salt solution (800mL) washing.At Na2SO4 upper dry organic layer.After 10-15 minutes, remove desiccant by filtering.Triethylamine (40mL) is added to solution, wherein described solution is concentrated into slurry using rotary evaporator.This slurry is dissolved in toluene (100mL) and triethylamine (30mL), and this solution is sucked in the heptane of 4500mL strong stirring, to separate out soft white product.After decantation most of heptane, by passing through medium sintered glass funnel filtration, collect white precipitate and dry under vacuum subsequently to produce white solid. The solid was purified by preparative HPLC (Phenomenex Gemini C18, 250x50 mm, 10 mm column, 0.05% ammonium hydroxide / CH3CN in water) and lyophilized to afford 3.82 g of the target compound as a yellow solid. 31 PNMR(162MHz,CD3CN)δ167.1,162.2. 1 H NMR(400MHz,CD3CN)δ9.36(br s,1H),8.63(d,J=16.51Hz,1H),7.78-8.00(m,3H),7.66(t,J=7.62Hz,1 H),7.42-7.57(m,4H),7.24-7.40(m,7H),6.89(d,J=8.68Hz,4H),5.92- 5.98(m,1H),4.72-4.97(m,2H),3.86-4.05(m,2H),3.78(2s,6H),3.27- 3.70(m,3H),2.87-3.20(m,12H),2.67-2.82(m,2H),1.54-1.79(m,4H).

[1073] Example 2: Oligonucleotide Synthesis

[1074] Oligonucleotides were synthesized by Bioautomation using a MerMade 12 automated DNA synthesizer. Controlled pore glass supports carrying universal adapters were used. The synthesis was performed on a 1 μmol scale.

[1075] In a standard cycling procedure for coupling DNA and LNA phosphoramidites, DMT deprotection was performed with three 200 μL applications of 3% (w / v) trichloroacetic acid in CH2Cl2 for 30 seconds. MeThe corresponding phosphoramidite was coupled three times with 110 μL of 0.1 M 5-(3,5-bis(trifluoromethylphenyl))-1H-tetrazole solution in acetonitrile as activator and coupling time 180 seconds. For sulfur oxidation, 0.1 m 3-amino-1,2,4-dithiazole-5-thione in acetonitrile / pyridine 1:1 was used (3x190 μL, 55 seconds). Endcapping was performed using THF / lutidine / Ac2O 8:1:1 (CapA, 75 μmol) and THF / N-methylimidazole 8:2 (CapB, 75 μmol) for 55 seconds.

[1076] The synthetic cycle incorporating thiophosphoramidites included: deprotection of DMT using 3% (w / v) trichloroacetic acid in CH2Cl2 at 200 μL for 30 seconds in three applications. Coupling of commercial DNA thiophosphoramidites or freshly prepared LNA thiophosphoramidites was performed three times using 100 μL of a 0.15 M solution in 10% (v / v) CH2Cl2 in acetonitrile and 110 μL of a 0.1 M solution of 5-(3,5-bis(trifluoromethylphenyl))-1H-tetrazole in acetonitrile as activator with a coupling time of 600 seconds each. Sulfur oxidation was performed using three applications of 0.1 M 3-amino-1,2,4-dithiazole-5-thione in acetonitrile / pyridine for 55 seconds. Capping was performed using THF / lutidine / Ac2O 8:1:1 (CapA, 75 μmol) and THF / N-methylimidazole 8:2 (CapB, 75 μmol) for 55 sec.

[1077] Once the automated synthesis was completed, nucleobase protecting group removal and cleavage from the solid support was performed using a mixture of ammonia (32%):ethanol (3:1, v:v) containing 20 mM DTT at 55°C for 15-16 hours.

[1078] The crude DMT-loaded oligonucleotides were purified using solid phase extraction cartridges and repurified by ion exchange chromatography using a C18 column or by RP-HPLC purification followed by removal of DMT by precipitation with 80% aqueous acetic acid and ethanol.

[1079] In the following examples, we have used the following sulfhydryl chemistry:

[1080]

[1081] In the following examples, unless otherwise stated, the non-chiral dithiophosphate bond (also referred to as P2S) is a non-bridged dithioester (as shown in formula (IA) or (IB)) and is marked with *. The compounds used in the examples include compounds having the following nucleobase sequences:

[1082] SEQ ID NO 1: GCATTGGTATTCA

[1083] SEQ ID NO 2:TCTCCCAGCGTGCGCCAT

[1084] SEQ ID NO 3: GAGTTACTTGCCAACT

[1085] SEQ ID NO 4: TATTTAACCTGGTTGTT

[1086] SEQ ID NO 5: CAATCAGTCCTAG

[1087] The following molecules have been prepared following the above procedure.

[1088]

[1089] *Dithioester modification between adjacent nucleotides

[1090] A.G. m C and T represent LNA nucleotides

[1091] a, g, c, t represent DNA nucleotides

[1092] All other bonds were prepared as phosphorothioates

[1093] Example 3: In vitro efficacy experiment and cellular uptake experiment

[1094] Primary rat hepatocytes were plated in 96-well plates and treated in Williams medium E without antibiotics containing 10% FCS. Cells were treated with LNA solutions at the indicated concentrations in complete cell culture medium. After 24 and 72 h of incubation, cells were incubated with Ca 2+ and Mg 2+ PBS was washed 3 times and lysed with 165uL PureLink Pro lysis buffer. Total RNA was isolated using the PureLink PRO 96 RNA kit from Thermo Fisher according to the manufacturer's instructions, and RT-qPCR was performed using the LightCycler multiple RNA virus master mix (Roche) with the primer probe set of RnApoB (Invitrogen). The data obtained were normalized to Ribogreen.

[1095] The intracellular concentration of LNA oligonucleotides was determined using a hybridization-based ELISA assay for various compounds. All data points were performed in triplicate and the data are given as their average.

[1096] Figures 1 to 4 The results are displayed in .

[1097] Example 4: Thermal Melting (Tm) of Oligonucleotides Containing Phosphorodithioate Internucleoside Bonds Hybridized to RNA and DNA

[1098] The following oligonucleotides have been prepared. Phosphorothioate bonds are indicated by the S subscript; phosphorodithioate bonds of the present invention are indicated by the PS2 subscript.

[1099]

[1100] Compounds 1–6 have the sequence motif SEQ ID NO 1.

[1101] Thermal melting (Tm) of compounds 1-6 hybridized to RNA and DNA was measured according to the following procedure.

[1102] A solution of equimolar amounts of RNA or DNA and LNA oligonucleotides (1.5 μM) in a buffer (100 mM NaCl, 0.1 mM EDTA, 10 mM Na2HPO4, pH 7) was heated to 90°C for 1 minute and then allowed to cool to room temperature. UV absorbance at 260 nm was recorded using a Cary Series UV-Vis spectrophotometer (heating rate: 1°C / min; reading rate: once / min). The absorbance was plotted against temperature and the Tm value was calculated by taking the first derivative of each curve.

[1103] table below and Figure 5 The results are summarized in .

[1104]

[1105] Td: dissociation temperature (denaturation); Ta: binding temperature (renaturation)

[1106] The compounds of the invention retain high affinity for RNA and DNA controls.

[1107] Example 5: Serum stability of oligonucleotides containing phosphorodithioate internucleoside bonds

[1108] The stability of oligonucleotides 1-6 in serum from male Sprague-Dawl rats was measured according to the following procedure.

[1109] A 25 μM oligonucleotide solution in rat serum was mixed with nuclease buffer (30 mM sodium acetate, 1 mM zinc sulfate, 300 mM NaCl, pH 4.6) in a 3:1 ratio and incubated at 37°C for 0, 5, 25, 52, or 74 hours. 2 μL of sample was injected into the BEH C 18UPLC-MS analysis was performed on a Water Acquity UPLC with a 1.7 μm column. The % uncleaved oligonucleotide was established using the peak areas of the analogs measured at 260 nm compensated with the extension constants of the different degradation lengths.

[1110] UPLC eluent: A: 2.5% MeOH, 0.2M HEP, 16.3mM TEA B: 60% MeOH, 0.2M HEP, 16.3mM TEA

[1111] Time: minutes Flow rate: ML / min %A buffer %B buffer 0 0.5 90 10 0.5 0.5 90 10 5 0.5 70 30 6 0.5 70 30 7 0.5 0 100 8 0.5 0 100 9 0.5 90 10 14.9 0.5 90 10 15 0.5 90 10

[1112] Figure 6 The results are summarized in .

[1113] Compounds having at least one phosphorodithioate internucleoside linkage of the present invention have superior nuclease resistance compared to compounds having only phosphorothioate internucleoside linkages.

[1114] The initial oligonucleotide degradation seen after 5 hours in compounds 1-6 was found to be caused by the presence of the monothioester impurity.

[1115] Example 7: Dithioester modified gapmers: Exploration of dithioesters in the gap region of LNA gapmers.

[1116] Tested compounds

[1117]

[1118]

[1119] Experimental: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using naked uptake assay, incubated for 72 hours at a compound concentration of 2 μM. Target mRNA levels were subsequently measured using RT-PCR. Figure 7 The results are displayed in .

[1120] Figure 7 The results shown in show that single and multiple achiral phosphorodithioates are compatible in the gap region and the flanking regions. The use of more than 3 or 4 achiral phosphorodithioates in the gap region may tend to reduce the potency compared to the use of multiple achiral phosphorodithioates in the flanking regions.

[1121] Example 8: Position dependence of activity - design optimization

[1122] Tested compounds

[1123]

[1124] Experimental: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using naked uptake assay, incubated for 72 hours at a compound concentration of 2 μM. Target mRNA levels were subsequently measured using RT-PCR. Figure 8 The results are displayed in .

[1125] Example 9: Cellular Uptake of Achiral Phosphorodithioate Gapmers

[1126] Tested compounds

[1127]

[1128]

[1129] Compounds #1-#16 and the reference have the sequence motif shown in SEQ ID NO 1.

[1130] Capital letters: β-D-oxy LNA nucleosides; lowercase letters: DNA nucleosides;

[1131] * = achiral phosphorodithioate modified bond; all other bonds are phosphorothioate

[1132] Experimental: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using naked uptake assay, incubated for 72 hours at a compound concentration of 2 μM. Oligonucleotide content was determined using a hybridization-based ELISA assay. Fig. 9A and Fig. 9B The results are displayed in .

[1133] Without exception, the incorporation of achiral phosphorodithioates provides enhanced cellular uptake. However, there is diversity in the uptake improvement depending on the position of the achiral phosphorodithioate bond.

[1134] Example 10: Increasing achiral phosphorodithioate loading in the flanking regions of gapmers

[1135] Test compound (sequence motif = SEQ ID NO 1)

[1136]

[1137] Capital letters: β-D-oxy LNA nucleosides; lowercase letters: DNA nucleosides;

[1138] * = achiral phosphorodithioate modified bond; all other bonds are phosphorothioate

[1139] Experimental: The above compounds targeting ApoB mRNA were tested in primary rat hepatocytes using naked uptake assay, incubated for 72 hours at a compound concentration of 2 μM. Target mRNA levels were subsequently measured using RT-PCR. Fig. 10Aand Fig. 10B The results are displayed in .

[1140] The introduction of achiral phosphorodithioate modifications in the flanking regions of the gapmers invariably resulted in a significant increase in potency, IC 50 Interestingly, increasing the number of chiral phosphorodithioate modifications in the flanks resulted in an increase in IC 50 Lower.

[1141] Example 11: Effects of achiral phosphorodithioate bonds in different cell types in vitro

[1142] Test compound (sequence motif = SEQ ID NO 3)

[1143]

[1144] Capital letters: β-D-oxy LNA nucleosides; lowercase letters: DNA nucleosides;

[1145] * = achiral phosphorodithioate modified bond; all other bonds are phosphorothioate

[1146] The above compounds targeting Malat-1 were tested in three in vitro cell systems: human primary skeletal muscle, human primary bronchial epithelial cells, and mouse fibroblasts (LTK cells) using gymnotic uptake for 72 hours at a range of concentrations to determine compound potency (IC 50 ).

[1147] Concentration range of LTK cells: 50 μM, 1 / 2 log dilution, 8 concentrations.

[1148] Malat1 RNA levels were quantified using qPCR (normalized to GAPDH levels) and the IC 50 value.

[1149] Fig.11 Display IC 50 Results. Introduction of achiral phosphorodithioates provided reliable potency enhancement in skeletal muscle cells and generally conferred improved potency to mouse fibroblasts. The effects in human bronchial epithelial cells were more compound specific, however, some compounds (#5) were significantly more potent than the reference compound.

[1150] Example 12: Rat serum stability in vitro of 5' and 3' end protected LNA oligonucleotides.

[1151] Test compound (sequence motif = SEQ ID NO 1)

[1152] #1 PS / DNA oligonucleotides #2 GCattggtatTCA #3 G*CattggtatTCA #4 GCattggtatTC*A #5 G*CattggtatTC*A #6 G*CattggtatT*C*A #7 G*C*attggtatTC*A #8 G*C*attggtatT*C*A

[1153] Capital letters: β-D-oxy LNA nucleosides; lowercase letters: DNA nucleosides;

[1154] * = achiral phosphorodithioate modified bond; all other bonds are phosphorothioate

[1155] Experimental—See Example 5.

[1156] Fig.12 Results are shown in . We determined that the 3' end of LNA phosphorothioate oligonucleotides is more susceptible to serum nucleases than previously thought and that this appears to be related to the chiral phosphorothioate bond at the 3' end of the oligonucleotide - as shown by the rapid cleavage of 50% of the parent oligonucleotide #1. 5' end protection with an achiral phosphorodithioate provided improved protection. 3' end protection with an achiral phosphorodithioate provided complete protection against rat serum exonucleases - the slight reduction seen for compounds #4-#8 is related to the monothioester impurity.

[1157] It is therefore contemplated that 5' and / or 3' end protection of antisense oligonucleotides with achiral phosphorothioate linkages may provide a solution to the significant instability issues associated with stereorandom and stereodefined phosphorothioates.

[1158] Example 13: In vivo evaluation of gapmers with achiral phosphorodithioate bonds in the flanks.

[1159] Test compound (sequence motif = SEQ ID NO 1)

[1160]

[1161]

[1162] Capital letters: β-D-oxy LNA nucleosides; lowercase letters: DNA nucleosides;

[1163] * = achiral phosphorodithioate modified bonds; all other bonds are phosphorothioates. Note that the underlined bold nucleosides are joined at the 3' position by a stereo-defined phosphorothioate internucleoside bond. Compound #7 has a stereo-defined motif in the gap region of SSRSSRSR (S = Sp, R = Rp). Main chain motif of compound #9 = RRSPRSSPSPSS, where S = Sp, R = Rp, and P = achiral PS2 bond (*).

[1164] Experiment: Female C57BL / 6JBom mice were administered the above compounds targeting ApoB using a single intravenous administration of 1 mg / kg, and the mice were sacrificed on day 7, n=5. The reduced mRNA in the liver was measured using RT-PCR and Fig.13 The results are displayed in .

[1165] The result shows that, in general, introducing non-chiral dithiophosphate internucleoside bond provides improved effectiveness, and it is noteworthy that all compounds with non-chiral dithiophosphate bond in the flank region all show improved effectiveness.As described in vitro experiments, multiple dithiophosphate bonds (#8) are used to be tolerated in the gap region, and effectiveness does not have obvious loss simultaneously.Especially significant is the combined effect of the defined stereothiophosphate bond in the gap polymer design and the gap region, and the non-chiral dithiophosphate bond in the flank, which illustrates the synergistic effect of these bond technologies and antisense oligonucleotide combinations.

[1166] Example 14: In vivo tissue content of achiral phosphorodithioate gapmers with modified flanking and gap regions in the liver.

[1167] Compounds and Experiments—See Example 13. Fig.14A Results of tissue levels are shown in A and B (determined by hybridization-based ELISA to measure levels in liver and kidney samples from sacrificed animals). Note that there is experimental error for compound #1 - see Fig. 14B data.

[1168] result: Fig.14A All antisense oligonucleotides containing achiral phosphorodithioate bonds had higher tissue uptake / content compared to the reference compound. Fig. 14B The introduction of achiral phosphorodithioate bonds was shown to enhance the biodistribution (as determined by liver / kidney ratio) of all compounds tested.

[1169] Example 15: Metabolite Analysis from In Vivo Experiments

[1170] Compounds and Experiments - See Example 13. Metabolite analysis was performed using the methods disclosed in C. Husser et al., Anal. Chem. 2017, 89, 6821.

[1171] The results are shown in Figure 15. The phosphorodithioate modification effectively prevents 3'-exonucleolytic degradation in vivo. Some endonuclease cleavage still exists (note that the tested compounds #1-6 all have DNA phosphorothioate gap regions, so this is expected). Given the obvious exonuclease protection, it is believed that the use of achiral phosphorodithioate bonds inside antisense oligonucleotides can be used to prevent or limit endonuclease cleavage. The enhanced nuclease resistance of achiral phosphorodithioates is expected to provide obvious pharmacological benefits, such as enhanced activity and prolonged duration of action, and may avoid toxic degradation products.

[1172] Example 16: In vivo - Long-term liver activity (ApoB)

[1173] Test compound (sequence motif = SEQ ID NO 1):

[1174]

[1175] Capital letters: β-D-oxy LNA nucleosides; lowercase letters: DNA nucleosides;

[1176] * = achiral phosphorodithioate modified bonds; all other bonds are phosphorothioates. Note that the underlined bold nucleosides are joined at the 3' position by a stereo-defined phosphorothioate internucleoside bond. Compound #3 has a stereo-defined motif in the gap region of SSRSSRSR (S = Sp, R = Rp). Main chain motif of compound #2 = RRSSRSSRSRSS, where S = Sp, R = Rp, and P = achiral PS2 bond (*).

[1177] Experimental: As in Example 13, however, sacrifice was performed on day 7 or 21.

[1178] Fig.16 Results are shown in Figure 2. Compared with the phosphorothioate reference compound, the introduction of non-chiral dithiophosphate provides a prolonged duration of action in the liver, and this is associated with a higher tissue content at 21 days. Notably, the combination of a stereo-defined phosphorothioate bond in the flank region and the gap region of the phosphorothioate connection provides further benefits in terms of prolonged efficacy and duration of action, emphasizing once again the obvious synergistic effect of the non-chiral dithiophosphate internucleoside bond and the stereo-defined phosphorothioate bond combination in the antisense oligonucleotide.

[1179] Example 17: In vivo studies using achiral phosphorodithioate-modified gapmers targeting Malat-1.

[1180] Test compound (sequence motif = SEQ ID NO 3)

[1181]

[1182] ...

Claims

1. Use of a compound of formula (III), formula (IV) or formula (IIb) in the manufacture of an oligonucleotide, Where R 5 is a hydroxyl protecting group; R x is phenyl, nitrophenyl, phenylalkyl, halophenylalkyl, cyanoalkyl, phenylcarbonylsulfanylalkyl, halophenylcarbonylsulfanylalkyl, alkylcarbonylsulfanylalkyl, or alkylcarbonylcarbonylsulfanylalkyl; R y is dialkylamino or pyrrolidinyl; and Nu is a nucleobase or a protected nucleobase; wherein the oligonucleotide is an antisense gapmer oligonucleotide, at least one of the flanking regions of the gapmer oligonucleotide comprises a phosphorodithioate bond of formula (IA) or (IB) wherein in (IA), R is hydrogen or a phosphate protecting group, and in (IB), M+ is a cation, and wherein the oligonucleotide further comprises phosphorothioate internucleoside linkages.

2. The use according to claim 1, wherein R x It is phenyl, nitrophenyl, phenylmethyl, dichlorophenylmethyl, cyanoethyl, methylcarbonylsulfanylethyl, ethylcarbonylsulfanylethyl, isopropylcarbonylsulfanylethyl, tert-butylcarbonylsulfanylethyl, methylcarbonylcarbonylsulfanylethyl or difluorophenylcarbonylsulfanylethyl.

3. The use according to claim 1, wherein R x It is phenylcarbonylsulfanylalkyl.

4. The use according to claim 1, wherein R x It is phenylcarbonylsulfanylethyl.

5. The use according to claim 1, wherein R y It is diisopropylamino or pyrrolidinyl.

6. The use according to claim 1, wherein R y It is pyrrolidino.

7. The use according to any one of claims 1 to 6, wherein the M+ is a metal cation; or M+ is an ammonium cation.

8. The use according to claim 7, wherein the metal cation is an alkali metal cation.

9. The use according to claim 8, wherein the alkali metal cation is a Na+ or K+ cation.

10. The use according to any one of claims 1 to 9, wherein the compound is of formula (V) Where R 5 and Nu as defined in claim 1.

11. The use according to any one of claims 1 to 9, wherein the compound is of formula (Vb) Where R 5 and Nu as defined in claim 1.

12. The use according to any one of claims 1 to 11, wherein Nu is thymine, protected thymine, adenosine, protected adenosine, cytosine, protected cytosine, 5-methylcytosine, protected 5-methylcytosine, guanine, protected guanine, uracilyl or protected uracilyl.

13. The use according to any one of claims 1 to 12, wherein the compound is selected from 14. The use according to any one of claims 1 to 12, wherein the compound is selected from 15. The method according to any one of claims 1 to 14, wherein the other internucleoside bonds of the oligonucleotide are independently selected from phosphorothioate internucleoside bonds and phosphorodithioate internucleoside bonds of formula (IA) or (IB) as defined in claim 1.

16. The use according to any one of claims 1 to 15, wherein all internucleoside bonds between nucleosides in the gap region of the oligonucleotide are phosphorothioate internucleoside bonds.

Images