Quantitative Amplification Normalization Using a Quencher

Abstract

Compositions, kits and methods for quantitative polymerase chain reaction (PCR) amplification normalization are provided. Compositions, kits and methods for multiplex qPCR amplification of two or more target nucleic acids in the same well are also provided.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 62 / 643,506, filed on March 15, 2018, the entire contents of which are incorporated herein by reference. Background Art

[0003] Quantitative polymerase chain reaction (qPCR) under optimized conditions produces quantitative results based on the generation of fluorescence during the PCR reaction. The main methods of fluorescence generation are enzymatic cleavage of the probe or intercalation of the dye into double-stranded DNA. The accuracy of quantification can be affected by many factors, including reaction efficiency or the presence of inhibitors. Inaccurate reaction efficiency in experimental samples relative to controls can result in over- or under-quantification. SUMMARY OF THE INVENTION

[0005] In one aspect, compositions, kits, and methods for qPCR amplification normalization are provided. In some embodiments, the composition for qPCR amplification normalization comprises:

[0006] A fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise two or more quenchers, and the two or more quenchers are located within the primers such that the quenchers thereby quench all or substantially all fluorescence emitted by a control nucleic acid amplification product; and

[0007] A detectable probe that specifically associates with a control nucleic acid.

[0008] In some embodiments, the forward quencher primer and / or the reverse quencher primer comprises two quenchers. In some embodiments, the forward quencher primer and / or the reverse quencher primer comprises more than two quenchers (e.g., 3, 4, 5 or more quenchers). In some embodiments, the distance between the quenchers does not exceed 1 / 3 of the fluorophore to be quenched by the quencher. Critical Radius

[0009] In some embodiments, the composition comprises:

[0010] A fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer; and

[0011] A detectable probe that specifically associates with a control nucleic acid.

[0012] In some embodiments, the composition comprises:

[0013] A fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer;

[0014] a detectable probe that specifically associates with a control nucleic acid; and

[0015] The control nucleic acid comprises a forward primer binding site that binds to the forward quencher primer, a probe binding site that binds to the probe, and a reverse primer binding site that binds to the reverse quencher primer.

[0016] In some embodiments, for the forward quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end. In some embodiments, for the forward quencher primer, the first quencher and the second quencher are separated by at most about 25 bases. In some embodiments, for the reverse quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end. In some embodiments, for the reverse quencher primer, the first quencher and the second quencher are separated by at most about 25 bases. In some embodiments, the first quencher and the second quencher are BHQ-1 quenchers.

[0017] In some embodiments, the composition further comprises a fluorescent DNA intercalator. In some embodiments, the fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO. In some embodiments, the fluorescent DNA intercalator is SYBR Green I.

[0018] In some embodiments, the detectable probe specifically binds (eg, directly binds) to a control nucleic acid.

[0019] In some embodiments, the detectable probe is joined to an oligonucleotide. In some embodiments, the detectable probe is joined to one or both of the fluorescence quenching primers that specifically bind to the control nucleic acid. In some embodiments, the detectable probe is joined to a forward quenching primer. In some embodiments, the detectable probe is joined to a reverse quenching primer. In some embodiments, the detectable probe is joined to a forward quenching primer or a reverse quenching primer, and the composition further comprises an oligonucleotide that hybridizes with a portion of the primer, and the oligonucleotide comprises a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes a portion of the forward quenching primer or the reverse quenching primer. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes a portion of the forward quenching primer or the reverse quenching primer, and the primer hybridized by the oligonucleotide further comprises a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes a portion of the forward quenching primer or the reverse quenching primer, and the primer hybridized by the oligonucleotide further comprises a quencher that quenches the signal emitted by the detectable probe.

[0020] In some embodiments, the detectable probe comprises a fluorescent dye whose emission spectrum is distinguishable from the emission spectrum of the fluorescent DNA intercalator. In some embodiments, the detectable probe comprises a fluorescent dye selected from the following substances: Cy3, Cy5, FAM, HEX, JOE, QUASAR, Rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC. In some embodiments, the detectable probe comprises a QUASAR fluorescent dye. In some embodiments, the detectable probe comprises a hydrolysis probe.

[0021] In some embodiments, the composition further comprises one or more buffers, salts, nucleotides, primers, polymerases, and / or water.

[0022] In some embodiments, the composition is a solution. In some embodiments, the composition is a lyophilized composition.

[0023] In another aspect, a solid support for qPCR amplification normalization is provided. In some embodiments, the solid support comprises one or more partitions, each of which comprises a composition (eg, a lyophilized composition) described herein.

[0024] In another aspect, a kit for qPCR amplification normalization is provided. In some embodiments, the kit comprises a composition or a solid support as described herein.

[0025] In another aspect, a method for normalizing qPCR amplification relative to a control is provided. In some embodiments, the method comprises:

[0026] combining the target nucleic acid and the control nucleic acid with the following to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a target nucleic acid-specific primer set comprising a target nucleic acid-specific forward primer and a target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the control nucleic acid, and (iv) a fluorescence quenching primer set that specifically binds to the control nucleic acid, comprising a forward quencher primer and a reverse quencher primer, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, the two or more quenchers being located within the primer such that the quenchers thereby quench all or substantially all fluorescence emitted by a control nucleic acid amplification product (control nucleic acid amplicon);

[0027] incubating the reaction mixture under conditions suitable for producing a target nucleic acid amplicon and a control nucleic acid amplicon, the fluorescent DNA intercalator binds both the target nucleic acid amplicon and the control nucleic acid amplicon, and the control nucleic acid amplicon produced comprises a plurality of quenchers incorporated into the amplicon;

[0028] Exciting the fluorescent DNA intercalator (e.g., using an excitation light source), and the quencher incorporated into the control nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the control nucleic acid amplicon; and

[0029] The target nucleic acid amplicon and the control nucleic acid amplicon are detected, wherein the target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the control nucleic acid amplicon is detected by detecting a detectable probe.

[0030] In some embodiments, the method comprises:

[0031] combining the target nucleic acid and the control nucleic acid with the following to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a target nucleic acid-specific primer set comprising a target nucleic acid-specific forward primer and a target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the control nucleic acid, and (iv) a fluorescent quencher primer set that specifically binds to the control nucleic acid, comprising a forward quencher primer and a reverse quencher primer, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher located near the 3' end of the primer;

[0032] incubating the reaction mixture under conditions suitable for producing a target nucleic acid amplicon and a control nucleic acid amplicon, the fluorescent DNA intercalator binds both the target nucleic acid amplicon and the control nucleic acid amplicon, and the control nucleic acid amplicon produced comprises a plurality of quenchers incorporated into the amplicon;

[0033] Exciting the fluorescent DNA intercalator (e.g., using an excitation light source), and the quencher incorporated into the control nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the control nucleic acid amplicon; and

[0034] The target nucleic acid amplicon and the control nucleic acid amplicon are detected, wherein the target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the control nucleic acid amplicon is detected by detecting a detectable probe.

[0035] In some embodiments, for the forward quencher primer and / or the reverse quencher primer, the first quencher is located at the 5' end or within 5 bases of the 5' end, and the second quencher is within 5-10 bases of the 3' end. In some embodiments, for the forward quencher primer and / or the reverse quencher primer, the first quencher and the second quencher are separated by at most about 25 bases.

[0036] In some embodiments, the detectable probe comprises a fluorescent dye whose emission spectrum is distinguishable from the emission spectrum of the fluorescent DNA intercalator. In some embodiments, the fluorescent signal emitted by the detectable probe is distinguishable from the signal emitted by the fluorescent DNA intercalator, and the method further comprises exciting the detectable probe and detecting the fluorescent signal emitted by the detectable probe. In some embodiments, the fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO. In some embodiments, the detectable probe comprises a fluorescent dye selected from the following substances: Cy3, Cy5, FAM, HEX, JOE, QUASAR, Rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC.

[0037] In some embodiments, the detectable probe specifically binds to the control nucleic acid directly. In some embodiments, the detectable probe is joined to an oligonucleotide. In some embodiments, the detectable probe is joined to one or both of the fluorescence quenching primers that specifically bind to the control nucleic acid. In some embodiments, the detectable probe is joined to a forward quenching primer. In some embodiments, the detectable probe is joined to a reverse quenching primer. In some embodiments, the detectable probe is joined to a forward quenching primer or a reverse quenching primer, and the merging step further comprises merging the sample with an oligonucleotide as described below, which is hybridized to a portion of the primer and contains a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes to a portion of the forward quenching primer or the reverse quenching primer. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes to a portion of the forward quenching primer or the reverse quenching primer, and the primer to which the oligonucleotide is hybridized also contains a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is conjugated to an oligonucleotide that hybridizes to a portion of the forward quencher primer or the reverse quencher primer, and the oligonucleotide further comprises a quencher that quenches the signal emitted by the detectable probe.

[0038] In some embodiments, the detection step comprises determining the quantitative cycle number (Cq) of the target nucleic acid amplicon and the control nucleic acid amplicon. In some embodiments, the detection step comprises quantifying the amount of the fluorescent signal emitted by the fluorescent DNA intercalator and the amount of the signal emitted by the detectable probe.

[0039] In another aspect, compositions, kits, and methods for multiplex qPCR amplification of two or more target nucleic acids in the same well are also provided. In some embodiments, the composition for multiplex qPCR amplification of two target nucleic acids comprises:

[0040] a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer;

[0041] a second target nucleic acid specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to a second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, the two or more quenchers being located within the primers such that the quenchers thereby quench all or substantially all fluorescence emitted by a second target nucleic acid amplification product; and

[0042] A detectable probe that specifically associates with a second target nucleic acid.

[0043] In some embodiments, the composition comprises:

[0044] a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer;

[0045] a second target nucleic acid specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to a second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher at or near the 5' end of the primer and a second quencher near the 3' end of the primer; and

[0046] A detectable probe that specifically associates with a second target nucleic acid.

[0047] In some embodiments, the composition further comprises a fluorescent DNA intercalator. In some embodiments, the fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO. In some embodiments, the fluorescent DNA intercalator is SYBR Green I.

[0048] In some embodiments, the detectable probe specifically binds directly to the second nucleic acid target.

[0049] In some embodiments, the detectable probe is joined to an oligonucleotide. In some embodiments, the detectable probe is joined to one or both of the fluorescent quenching primers that specifically bind to the second target nucleic acid. In some embodiments, the detectable probe is joined to a forward quenching primer. In some embodiments, the detectable probe is joined to a reverse quenching primer. In some embodiments, the detectable probe is joined to a forward quenching primer or a reverse quenching primer, and the composition further comprises an oligonucleotide that hybridizes with a portion of the primer, and the oligonucleotide comprises a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes a portion of the forward quenching primer or the reverse quenching primer. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes a portion of the forward quenching primer or the reverse quenching primer, and the primer hybridized by the oligonucleotide further comprises a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes a portion of the forward quenching primer or the reverse quenching primer, and the primer hybridized by the oligonucleotide further comprises a quencher that quenches the signal emitted by the detectable probe.

[0050] In some embodiments, the detectable probe comprises a fluorescent dye whose emission spectrum is distinguishable from the emission spectrum of the fluorescent DNA intercalator. In some embodiments, the detectable probe comprises a fluorescent dye selected from the following substances: Cy3, Cy5, FAM, HEX, JOE, QUASAR, Rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC. In some embodiments, the detectable probe comprises a QUASAR fluorescent dye. In some embodiments, the detectable probe comprises a hydrolysis probe.

[0051] In some embodiments, a kit for multiplex qPCR amplification comprises a composition described herein.

[0052] In some embodiments, the method for multiplex qPCR amplification comprises:

[0053] combining a sample comprising a first target nucleic acid and a second target nucleic acid with the following substances to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the second target nucleic acid, and (iv) a second target nucleic acid-specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to the second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, the two or more quenchers being located within the primer such that the quenchers thereby quench all or substantially all fluorescence emitted by a second target nucleic acid amplification product;

[0054] incubating the reaction mixture under conditions suitable for producing a first target nucleic acid amplicon and a second target nucleic acid amplicon, the fluorescent DNA intercalator binds both the first target nucleic acid amplicon and the second target nucleic acid amplicon, and the produced second target nucleic acid amplicon comprises a plurality of quenchers incorporated into the amplicon;

[0055] Exciting the fluorescent DNA intercalator, and the quencher incorporated into the second target nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the second target nucleic acid amplicon; and

[0056] The first target nucleic acid amplicon and the second target nucleic acid amplicon are detected, wherein the first target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the second target nucleic acid amplicon is detected by detecting a detectable probe.

[0057] In some embodiments, the method for multiplex qPCR amplification comprises:

[0058] combining a sample comprising a first target nucleic acid and a second target nucleic acid with the following substances to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the second target nucleic acid, and (iv) a second target nucleic acid-specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to the second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer;

[0059] incubating the reaction mixture under conditions suitable for producing a first target nucleic acid amplicon and a second target nucleic acid amplicon, the fluorescent DNA intercalator binds both the first target nucleic acid amplicon and the second target nucleic acid amplicon, and the produced second target nucleic acid amplicon comprises a plurality of quenchers incorporated into the amplicon;

[0060] Exciting the fluorescent DNA intercalator, and the quencher incorporated into the second target nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the second target nucleic acid amplicon; and

[0061] The first target nucleic acid amplicon and the second target nucleic acid amplicon are detected, wherein the first target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the second target nucleic acid amplicon is detected by detecting a detectable probe.

[0062] In some embodiments, the forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher located near the 3' end of the primer. In some embodiments, for the forward quencher primer and / or the reverse quencher primer, the first quencher is located at or within 5 bases of the 5' end, and the second quencher is within 5-10 bases of the 3' end. In some embodiments, for the forward quencher primer and / or the reverse quencher primer, the first quencher and the second quencher are separated by at most about 25 bases.

[0063] In some embodiments, the fluorescent signal emitted by the detectable probe is distinguishable from the signal emitted by the fluorescent DNA intercalator, and the method further comprises exciting the detectable probe and detecting the fluorescent signal emitted by the detectable probe. In some embodiments, the detectable probe comprises a hydrolysis probe. In some embodiments, the detectable probe comprises a fluorescent dye selected from the following substances: Cy3, Cy5, FAM, HEX, JOE, QUASAR, Rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC. In some embodiments, the fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO.

[0064] In some embodiments, the detectable probe specifically binds directly to the second target nucleic acid. In some embodiments, the detectable probe is joined to an oligonucleotide. In some embodiments, the detectable probe is joined to one or both of the fluorescence quenching primers that specifically bind to the second target nucleic acid. In some embodiments, the detectable probe is joined to a forward quenching primer. In some embodiments, the detectable probe is joined to a reverse quenching primer. In some embodiments, the detectable probe is joined to a forward quenching primer or a reverse quenching primer, and the merging step further comprises merging the sample with an oligonucleotide as described below, the oligonucleotide hybridizing to a portion of the primer and comprising a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes to a portion of the forward quenching primer or the reverse quenching primer. In some embodiments, the detectable probe is joined to an oligonucleotide that hybridizes to a portion of the forward quenching primer or the reverse quenching primer, and the primer hybridized to the oligonucleotide also comprises a quencher that quenches the signal emitted by the detectable probe. In some embodiments, the detectable probe is conjugated to an oligonucleotide that hybridizes to a portion of the forward quencher primer or the reverse quencher primer, and the oligonucleotide further comprises a quencher that quenches the signal emitted by the detectable probe.

[0065] In some embodiments, the detection step comprises determining the quantitative cycle number (Cq) of the first target nucleic acid amplicon and the second target nucleic acid amplicon. In some embodiments, the detection step comprises quantifying the amount of fluorescent signal emitted by the fluorescent DNA intercalator and the amount of signal emitted by the detectable probe.

[0066] BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 : A general approach to developing control assays that can be run in parallel with target gene assays.

[0068] Figure 2A-2B :(A) Design of fluorescence quenching primers. In this design example, the primer contains two quenchers: one quencher is located at the 5' end of the primer, and the other quencher is close to the 3' end of the primer (within 7 bases of the 3' end). (B) PCR reaction product of control nucleic acid, in which the quencher of the fluorescence quenching primer is incorporated into the PCR reaction product, and the DNA intercalator is bound to the PCR reaction product.

[0069] Figures 3A-3C : (A) CCND1 detection without control detection. (B) CCND1 detection in the presence of quenching control detection. (C) CCND1 detection in the presence of non-quenching control detection.

[0070] Figure 4 : Example of product-specific quenching in qPCR. Although the endpoint intensity is different, the probe fluorescence (red) produces a single quantitative cycle number (Cq), as shown by the horizontal line. The SYBR Green fluorescence (green) of the non-quenched and quenched control detections differ by approximately 6-7 Cq. 6 Cq is roughly equivalent to a 40-80-fold (40-80x) decrease in the SYBR Green fluorescence intensity of the quenched detection.

[0071] Figure 5A-5B : Uniformity evaluation of quenched fluorescence qPCR assay. (A) The graph shows the probe signal (red) and SYBR Green fluorescence (green) in the absence of cDNA. (B) The graph shows the probe fluorescence and Cq values ​​corresponding to different standard deviation cutoffs.

[0072] Figure 6A-6B :The effect of heparin on SYBR Green fluorescence in the target gene p53 detection. (A) p53 detection without control detection. (B) p53 detection with the presence of quenching control detection.

[0073] Figure 7: Schematic diagram of product-mediated quenching detection, which uses a detectable probe coupled to a primer. In this method, the forward primer that binds to the target nucleic acid sequence contains a quencher (BHQ1) that quenches the intercalating dye and also contains a detectable probe, i.e., a fluorophore (Q705). The oligonucleotide that hybridizes to a portion of the forward primer contains a quencher (BHQ3) that is compatible with the detectable probe Q705. Primer binding and extension cause the forward primer to dissociate from the oligonucleotide that bound the primer. This dissociation, coupled with the incorporation of the primer into the final PCR product, results in the BHQ1 quencher quenching the intercalating dye and the detectable probe fluorophore Q705 fluorescing.

[0074] DETAILED DESCRIPTION OF THE INVENTION

[0075] I. Introduction

[0076] The present invention relates to compositions and methods for reducing the fluorescence emission of specific products in PCR reactions. When the PCR reaction produces a product, a fluorescent dye that binds to double-stranded DNA is usually used in qPCR to generate a signal. One example of such a molecule is SYBRGreen. SYBR Green binds to double-stranded DNA produced during the PCR reaction. When excited with light of an appropriate wavelength, SYBR Green bound to the PCR product emits fluorescence, thereby achieving real-time amplification of the target of the amplification. Although SYBR Green detection has the advantage of not requiring the detection of expensive hydrolysis probes, it is difficult to evaluate more than one product in the same reaction, so standardized detection or control detection cannot be performed simultaneously in the same reaction well.

[0077] On the one hand, the compositions, kits and methods provided herein allow for simultaneous amplification of control detection in the same well of a target detection using an intercalating dye to generate a signal. As described herein, the compositions and methods herein specifically quench at least a portion of the signal emitted by the double-stranded DNA binding dye (i.e., fluorescent DNA intercalator) bound to the control PCR product, but do not quench the double-stranded DNA binding dye signal emitted by the target PCR product. In some embodiments, the control detection includes a detectable probe, and the signal emitted by the detectable probe is distinguishable from the intercalating dye signal, and the detectable probe can be detected to monitor the reaction and determine whether the amplification reaction is good.

[0078] In another aspect, the compositions, kits and methods provided herein allow for the simultaneous amplification of two different target nucleic acids in the same well, wherein one target nucleic acid is detected using an intercalating dye and the other target nucleic acid is detected using a detectable probe that emits a signal that is distinguishable from the intercalating dye signal.

[0079] II. Definitions

[0080] Unless otherwise defined, the scientific and technological terms used herein have the same meaning as those of ordinary skill in the art.See, for example, Lackie, DICTIONARY OF CELL AND MOLECULAR BIOLOGY, Elsevier (4th edition 2007); Sambrook et al., MOLECULAR CLONING, ALABORATORY MANUAL, Cold Spring Harbor Laboratory Press (Cold Spring Harbor, New York 1989). The term "one" or "a kind of" etc. is intended to represent "one (species) or more (species)" etc. When the term "comprising" and its various variations such as "including" and "containing" are located before the steps or elements of the description, it is intended to indicate that the addition of other steps or elements is not excluded, and this increase is optional. The implementation of the present invention can adopt any method, device and material similar or equivalent to that described herein. The following definitions are used to help understand some common terms herein but are not intended to limit the scope disclosed herein.

[0081] In this article, "target nucleic acid" refers to a polynucleotide sequence to be detected. In some embodiments, the target is a gene or a portion of a gene. In some embodiments, the target is a polynucleotide sequence (e.g., a gene or a portion of a gene) with a disease-related mutation such as cancer. In some embodiments, the target is a polynucleotide sequence with a rare mutation associated with a disease such as cancer.

[0082] Herein, "nucleic acid" means DNA, RNA, single-stranded, double-stranded or higher-aggregation hybridization motifs and any chemically modified forms thereof. Modifications include, but are not limited to, those modifications that provide chemical groups to nucleic acid ligand bases or nucleic acid ligands as a whole, and the chemical groups introduce additional charge, polarizability, hydrogen bonds, electrostatic interactions, connection points and functional groups. Such modifications include, but are not limited to: peptide nucleic acids (PNA), phosphodiester group modifications (e.g., phosphorothioate, methylphosphonate), 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, exocyclic amine modifications, 4-thiouridine substitutions, 5-bromo or 5-iodo-uracil substitutions, backbone modifications, methylation, rare base pairing combinations such as isobases, isocytidines and isoguanidines, etc. Nucleic acids can also contain non-natural bases, such as nitroindole.

[0083] Herein, "fluorescent DNA intercalator" refers to a small molecule that reversibly binds or inserts between bases of a double-stranded nucleic acid (e.g., double-stranded DNA). The fluorescent DNA intercalator emits a fluorescent signal when it binds to a double-stranded nucleic acid, and emits no or less signal when it does not bind to a double-stranded nucleic acid. Examples of fluorescent DNA intercalators include, but are not limited to, SYBR Green I, SYBR Green II, SYBRGold, Yo-Yo, Yo-Pro, TOTO, picogreen, and EvaGreen.

[0084] Herein, "quencher" refers to a compound (e.g., a small molecule dye) that quenches a signal emitted by a fluorescent compound (e.g., a fluorescent DNA intercalator or a fluorescent detectable probe). In some embodiments, the quencher absorbs excitation energy from the fluorescent compound (e.g., a fluorescent DNA intercalator or a fluorescent detectable probe) and dissipates the energy absorbed from the fluorescent compound in the form of heat.

[0085] Herein, "primer" refers to a polynucleotide sequence that hybridizes with a sequence on a target nucleic acid or a control nucleic acid and serves as a starting point for nucleic acid synthesis. Primers can have a variety of lengths. In some embodiments, the primer length is less than 100 nucleotides, for example, a length of about 10 to about 50, about 15 to about 40, about 15 to about 30, about 20 to about 80, about 20 to about 60 nucleotides. The primer length and sequence used for an amplification reaction (such as PCR) can be designed according to principles known to those skilled in the art, see, for example, Innis et al., 1990, PCR Protocols: A Guide to Methods and Applications. In some embodiments, a primer comprises one or more modified nucleoside bases or non-natural nucleoside bases.

[0086] As used herein, a "quencher primer" refers to a primer containing one or more quenchers attached thereto. In some embodiments, a quencher primer contains two or more quenchers attached thereto, such as a first quencher attached to or near the 5' end of the primer and a second quencher attached to or near the 3' end of the primer.

[0087] Nucleic acid or its part "hybridizes" with another nucleic acid under certain conditions so that non-specific hybridization is minimized at a certain temperature in a physiological buffer. In some cases, nucleic acid or its part hybridizes with the common conserved sequence of the target nucleic acid group. In some cases, if there are at least about 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 continuous complementary nucleotides, including "universal" nucleotides complementary to more than one nucleotide partner, then primer or its part will hybridize with the primer binding site. Alternatively, if there are less than 1 or 2 complementary mismatches in at least about 12, 13, 14, 15, 16, 17, 18, 19, 20, 25 or 30 continuous complementary nucleotides, then primer or its part will hybridize with the primer binding site. In some embodiments, the temperature at which specific hybridization occurs is room temperature. In some embodiments, the temperature at which specific hybridization occurs is higher than room temperature. In some embodiments, the temperature at which specific hybridization occurs is at least about 37, 40, 42, 45, 50, 55, 60, 65, 70, 75, or 80° C., such as about 45° C.-60° C., such as about 55° C.-59° C. In some embodiments, the temperature at which specific hybridization occurs is about 5° C. lower than the calculated melting temperature of the primers.

[0088] The term "amplification reaction" herein refers to various in vitro means for linearly or exponentially multiplying copies of a target nucleic acid sequence. Such methods include, but are not limited to, polymerase chain reaction (PCR), real-time PCR, DNA ligase chain reaction (see U.S. Pat. Nos. 4,683,195 and 4,683,202; PCR Protocols: A Guide to Methods and Applications (Innis et al., 1990)) (LCR); QBeta RNA replicase-based and RNA transcription-based amplification reactions (e.g., amplifications including RNA polymerization initiated by T7, T3 or SP6), such as transcription amplification system (TAS), nucleic acid sequence-based amplification (NASBA) and self-directed sequence replication (3SR); isothermal amplification reactions (e.g., single primer isothermal amplification (SPIA)); or loop-mediated isothermal amplification (LAMP); and other methods known to those skilled in the art.

[0089] "Amplification" herein refers to a step in which a solution (e.g., in a reaction well) is placed under conditions sufficient to allow polynucleotide amplification to produce an amplified product or "amplicon." The components of an amplification reaction include, for example, primers, a polynucleotide template, a polymerase, nucleotides, etc. The term amplification generally refers to an exponential increase in a target nucleic acid (or a control nucleic acid). However, herein, amplification may also refer to a linear increase in the amount of a specific target sequence (or control sequence) of a nucleic acid, such as the result of cycle sequencing. In one exemplary embodiment, amplification refers to PCR amplification using a first and a second amplification primer.

[0090] The term "polymerase chain reaction" or "PCR" refers to a method that allows a specific segment or subsequence of a target double-stranded DNA to be amplified exponentially. PCR is well known to those skilled in the art; see, for example, U.S. Patent Nos. 4,683,195 and 4,683,202; and "PCR Protocol: A Guide to Methods and Applications", Innis et al., 1990. Exemplary PCR reaction conditions generally include two-step cycles or three-step cycles. A two-step cycle has a denaturation step followed by a hybridization / extension step. A three-step cycle includes a denaturation step, followed by a hybridization step, followed by a separate extension step.

[0091] III. Compositions for quantitative PCR normalization and multiplex quantitative PCR

[0092] In one aspect, a composition (e.g., a reaction mixture) for use in an amplification reaction, such as qPCR, is provided. In some embodiments, the composition can be used to normalize an amplification (e.g., a qPCR amplification) relative to a control. In some embodiments, the composition can be used to perform multiple amplification reactions (e.g., multiple qPCR) in the same partition (e.g., in the same reaction well).

[0093] In some embodiments, the composition for amplification normalization comprises a fluorescent quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise two or more quenchers, the two or more quenchers being located within the primer so that the quencher thereby quenches all or substantially all fluorescence emitted by the control nucleic acid amplification product; and a detectable probe specifically associated with the control nucleic acid. In some embodiments, the detectable probe directly binds to the control nucleic acid. In some embodiments, the detectable probe is joined to an oligonucleotide, for example, joined to one or both of the quenching primers that specifically bind to the control nucleic acid or joined to an oligonucleotide that hybridizes to a portion of the forward quenching primer or the reverse quenching primer.

[0094] In some embodiments, the composition for amplification normalization comprises a fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer; and a detectable probe that specifically associates with the control nucleic acid.

[0095] In some embodiments, the composition for amplification normalization comprises:

[0096] A fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer;

[0097] a detectable probe that specifically associates with a control nucleic acid; and

[0098] A control nucleic acid, wherein the control nucleic acid comprises a forward primer binding site to which the forward quencher primer binds, a probe binding site to which the probe binds, and a reverse primer binding site to which the reverse quencher primer binds.

[0099] In some embodiments, a composition for performing a multiplex amplification reaction of a first target nucleic acid and a second target nucleic acid comprises a second target nucleic acid-specific primer set, the primer set including a forward quencher primer and a reverse quencher primer that specifically bind to the second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, and the two or more quenchers are located within the primers so that the quenchers thereby quench all or substantially all fluorescence emitted by amplification products of the second target nucleic acid; and a detectable probe that specifically associates with the second target nucleic acid.

[0100] In some embodiments, a composition for performing a multiplex amplification reaction of a first target nucleic acid and a second target nucleic acid comprises a second target nucleic acid-specific primer set, the primer set including a forward quencher primer and a reverse quencher primer that specifically bind to the second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer; and a detectable probe that specifically associates with the second target nucleic acid.

[0101] In some embodiments, a composition for performing a multiplex amplification reaction comprises:

[0102] a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer;

[0103] a second target nucleic acid specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to a second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher at or near the 5' end of the primer and a second quencher near the 3' end of the primer; and

[0104] A detectable probe that specifically associates with a second target nucleic acid.

[0105] In some embodiments, the composition further comprises a fluorescent DNA intercalator. In some embodiments, the composition further comprises one or more other reagents (eg, primers and / or amplification reagents for target nucleic acids) as described herein.

[0106] Control nucleic acid

[0107] In some embodiments, the composition described herein (e.g., reaction mixture) comprises a control nucleic acid. In some embodiments, the control nucleic acid comprises an artificial sequence that has no significant sequence similarity to any known nucleic acid sequence (e.g., any nucleic acid sequence in any public nucleic acid database). Methods for generating artificial nucleic acid sequences are well documented in the art. See, e.g., Caballero et al., Nucl. Acids Res., 2014, 42(12):e99. In some embodiments, the control nucleic acid comprises a sequence described in the Examples section below or is substantially identical to a sequence described in the Examples section below.

[0108] The control nucleic acid can be single-stranded or double-stranded, or can contain both double-stranded and single-stranded sequence portions. For example, the nucleic acid sequence can be genomic DNA, cDNA, mRNA, or a combination or hybrid of DNA and RNA.

[0109] Fluorescence quenching primer

[0110] In some embodiments, the composition comprises a set of fluorescence quenching primers, which comprises a forward quenching primer and a reverse quenching primer. In some embodiments, the fluorescence quenching primer specifically binds to a control nucleic acid, such as described above. In some embodiments, the fluorescence quenching primer specifically binds to a second target nucleic acid, such as described above. Methods for designing amplification primers that specifically bind to a target sequence (e.g., a control nucleic acid) are known in the art. For example, see Thornton et al., Biochem. Mol. Biol. Educ., 2011, 39: 145-154.

[0111] In some embodiments, the quencher primer (e.g., forward quencher primer and / or reverse quencher primer) is at least 15 nucleotides in length, such as at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotides in length. In some embodiments, the quencher primer (e.g., forward quencher primer and / or reverse quencher primer) is about 15-100 nucleotides in length, such as about 20-80, about 15-50, about 20-30, or about 15-30 nucleotides in length.

[0112] In some embodiments, a quencher primer (e.g., a forward quencher primer and / or a reverse quencher primer) contains at least two quenchers. In some embodiments, a quencher primer contains more than two quenchers, for example, 3, 4, 5, 6, 7, 8, 9, or 10 quenchers. The number of quenchers used in a quencher primer may vary depending on the length of the primer. In some embodiments, the quencher is located inside the primer so that the quencher quenches all or substantially all of the fluorescence emitted by the amplification product (e.g., the amplification product of the control nucleic acid or the amplification product of the second target nucleic acid). In some embodiments, the distance between the quenchers on the primer does not exceed the distance of the fluorophore quenched by the quencher. Critical radius ( radius). In some embodiments, the quencher primer comprises a sufficient number of quenchers so that the quenchers are no more than 30 bases apart over the entire primer length, such as no more than 25 bases apart or no more than 20 bases apart. In some embodiments, each quencher in the quencher primer is the same quencher (e.g., each quencher in the primer is a BHQ-1 dye). In some embodiments, the quenchers in a set of quencher primers are all the same quencher (e.g., each quencher in the forward quencher primer is a BHQ-1 dye and each quencher in the reverse quencher primer is a BHQ-1 dye). In some embodiments, the quencher primer contains two or more quenchers that quench the same fluorescent DNA intercalator and additionally contains one or more quenchers that quench a fluorescent detectable probe, wherein the fluorescent DNA intercalator and the detectable probe have distinguishable emission spectra and are quenched by different quenchers.

[0113] In some embodiments, the quencher is a small molecule dye that absorbs the excitation energy from the fluorophore (also known as a "dark quencher" in the art). Quenchers are well documented in the art. Examples of quenchers include, but are not limited to: Black Hole ) dyes (e.g., BHQ-0, BHQ-1, BHQ-2, and BHQ-3; LGC Biosearch Technologies, Petaluma, Iowa Dark quenchers (such as Iowa FQ and Iowa RQ, Integrated DNA Technologies, Inc. (Skokie, IL), DABCYL, QXL TM Quencher (AnaSpec, Inc, Fremont, CA), QC-1 (LI-COR Biosciences) and quenchers described in WO 2001 / 086001 and US 2005 / 0164225. It will be appreciated by those skilled in the art that the choice of quencher depends on the fluorescent DNA intercalator used, and those skilled in the art can easily determine a suitable quencher to quench the fluorescence of the fluorescent DNA intercalator. For example, if the fluorescent DNA intercalator is SYBR Green I with an emission wavelength of 520 nm, suitable quenchers include, but are not limited to, BHQ-0, BHQ-1 or Iowa FQ.

[0114] In some embodiments, the first quencher is attached to the 5' end of the primer or near the 5' end. Herein, a quencher is "close to" the primer end if the quencher is within 10 bases of the primer end. In some embodiments, the first quencher attachment is within 1-10 bases of the 5' end of the primer, such as within 1-8 bases, within 1-5 bases, within 5-10 bases, or within 2-8 bases of the 5' end of the primer. In some embodiments, the first quencher is about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases from the 5' end of the primer. In some embodiments, the first quencher is located at the 5' end of the primer.

[0115] In some embodiments, the second quencher is attached near the 3' end of the primer. In some embodiments, the second quencher attachment is at least 1 base away from the 3' end of the primer, such as at least 2 bases, at least 3 bases, at least 4 bases, or at least 5 bases away from the 3' end of the primer. In some embodiments, the second quencher attachment is within 5-10 bases from the 3' end, such as within 5-8 bases from the 3' end of the primer. In some embodiments, the first quencher is about 2, 3, 4, 5, 6, 7, 8, 9 or 10 bases away from the 5' end of the primer.

[0116] Methods for attaching quenchers to polynucleotide sequences are well documented in the art, see, for example, WO 2001 / 086001 and US 2005 / 0164225. In some embodiments, the quencher is covalently attached to the primer.

[0117] DNA intercalators

[0118] In some embodiments, the composition further comprises a fluorescent DNA intercalator. A fluorescent DNA intercalator is a small molecule that emits fluorescence when intercalated or bound to a double-stranded nucleic acid. Typically, the level of fluorescence emitted by the fluorescent DNA intercalator when intercalated or bound to a double-stranded nucleic acid is significantly higher than the baseline fluorescence level when not bound. In some embodiments, the level of fluorescence emitted by the fluorescent DNA intercalator when not bound to a double-stranded nucleic acid is very low.

[0119] Examples of fluorescent DNA intercalators include, but are not limited to, 9-aminoacridine, ethidium bromide, phenanthridine dyes, EvaGreen, PICO GREEN (P-7581, Molecular Probes), propidium iodide (P-4170, Sigma), acridine orange (A-6014, Sigma), thiazole orange, oxazole yellow, 7-aminoactinomycin D (A-1310, Molecular Probes), cyanine dyes (e.g., TOTO, YOYO, BOBO, and POPO), SYTO, SYBR Green I (U.S. Patent No. 5,436,134: N',N'-dimethyl-N-[4-[(E)-(3-methyl-1,3-benzothiazol-2-ylidene)methyl]-1-phenylquinoxalin-1-ium-2-yl]-N-propylpropane-1,3-diamine), SYBR Green II (U.S. Patent No. 5,658,751), SYBR DX, OliGreen, CyQuant GR, SYTOX Green, SYTO9, SYTO10, SYTO17, SYBR14, FUN-1, DEAD Red, hexidium iodide, dihydroethidium, ethidium homodimer, 9-amino-6-chloro-2-methoxyacridine, DAPI, DIPI, indole dyes, imidazole dyes, hydroxystilbene (FluoroGold), LDS 751 (U.S. Pat. No. 6,210,885) and dyes described in the following documents: Georghiou, Photochemistry and Photobiology, 26:59-68, Pergamon Press (1977); Kubota et al., Biophys. Chem., 6:279-284 (1977); Genest et al., Nucleic Acids Res., 13:2603-2615 (1985); Asseline, EMBO J., 3:795-800 (1984); Richardson et al., U.S. Pat. No. 4,257,774 and Letsinger et al., U.S. Pat. No. 4,547,569. In some embodiments, the fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO. In some embodiments, the fluorescent DNA intercalator is SYBR Green I.

[0120] Detectable probe

[0121] In some embodiments, the detectable probe is specifically associated with a nucleic acid sequence to be amplified (e.g., a control nucleic acid or a second target nucleic acid). In some embodiments, the detectable probe specifically binds (e.g., directly binds) to a nucleic acid sequence. In some embodiments, the detectable probe is coupled to an oligonucleotide sequence (e.g., a primer) that may or may not bind to a nucleic acid sequence to be amplified, as described in detail below.

[0122] In some embodiments, the detectable probe comprises an oligonucleotide sequence that hybridizes to a region of the nucleic acid sequence to be amplified (e.g., a region of the control nucleic acid or a region of the second target nucleic acid). In some embodiments, the detectable probe comprises an oligonucleotide sequence having a length of about 15-100 nucleotides, such as about 15-75, 15-50, 18-50, 20-50, 15-30, or 18-30 nucleotides.

[0123] In some embodiments, the detectable probe is coupled to one or both of the fluorescent quenching primers that specifically bind to a nucleic acid (e.g., a forward quenching primer or a reverse quenching primer as described herein). In some embodiments, the detectable probe is coupled to a forward quenching primer. In some embodiments, the detectable probe is coupled to a reverse quenching primer. In some embodiments, the detectable probe is coupled to both a forward quenching primer and a reverse quenching primer. In some embodiments, the detectable probe is coupled to a forward quenching primer or a reverse quenching primer, and there is also an oligonucleotide that hybridizes to a portion of the forward quenching primer or the reverse quenching primer, and the oligonucleotide comprises a quencher that quenches the signal emitted by the detectable probe.

[0124] In some embodiments, detectable probe is engaged with an oligonucleotide of a part of a forward quencher primer or a reverse quencher primer. In some embodiments, detectable probe is engaged with an oligonucleotide of a part of a forward quencher primer or a reverse quencher primer, and the primer hybridized by the oligonucleotide also comprises a quencher of the signal that the detectable probe sends. In some embodiments, detectable probe is engaged with an oligonucleotide of a part of a forward quencher primer or a reverse quencher primer, and the oligonucleotide also comprises a quencher of the signal that the detectable probe sends. In some embodiments, the quencher is close enough to the detectable probe on the oligonucleotide to quench all or substantially all signals that the detectable probe sends. In some embodiments, the oligonucleotide is about 15-100 nucleotides long, for example, about 15-75, 15-50, 18-50, 20-50, 15-30 or 18-30 nucleotides.

[0125] In some embodiments, the detectable probe associated with the amplified product (e.g., a control nucleic acid amplicon) produces a detectable signal in the amplification reaction. In some embodiments, the detectable probe comprises a detectable substance, such as a fluorescent agent, a phosphorescent agent, a chemiluminescent agent, etc. In some embodiments, the detectable probe comprises a fluorescent agent. The fluorescent agent may include various organic and / or inorganic small molecules or various fluorescent proteins and derivatives thereof. In some embodiments, the substance is a fluorophore. A large number of fluorophores are reported in the literature and are known to those skilled in the art, and many can be easily purchased from suppliers in the field of biotechnology. Literature sources for fluorophores include Cardullo et al., Proc. Natl. Acad. Sci. USA 85:8790-8794 (1988); Dexter, DL, J. of Chemical Physics 21:836-850 (1953); Hochstrasser et al., Biophysical Chemistry 45:133-141 (1992); Selvin, P., Methods in Enzymology 246:300-334 (1995); Steinberg, I. Ann. Rev. Biochem., 40:83-114 (1971); Stryer, L. Ann. Rev. Biochem., 47:819-846 (1978); Wang et al., Tetrahedron Letters 31:6493-6496 (1990); and Wang et al., Anal. Chem. 67:1197-1203 (1995). Non-limiting examples of fluorophores include: cyanines (e.g., Cy3, Cy5), indolecarbocyanines (e.g., 570, 670 and 705) fluorescein (e.g., 5'-carboxyfluorescein (FAM), 6-carboxyfluorescein (6-FAM), 5- and 6-carboxyfluorescein (5,6-FAM), 2'-chloro-7'phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), 6-carboxy-4'-,5'-dichloro-2'-,7'-dimethoxyfluorescein (JOE), 4,7,2',4',5',7'-hexachloro-6-carboxyfluorescein (HEX), 4,7,2',7'-tetrachloro-6-carboxyfluorescein (TET), 2'-chloro-5'-fluoro-7',8'-benzo-1,4-dichloro-6-carboxyfluorescein (NED), Oregon Green and Alexa Fluor 488), rhodamines (e.g., N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA) and 5- and 6-carboxy-X-rhodamine (ROX)), tetramethylrhodamine and tetramethylrhodamine isothiocyanate (TRITC)), eosin, coumarins, pyrenes, tetrapyrroles, arylmethines and oxazines. In some embodiments, the detectable probe comprises a fluorescent dye selected from the group consisting of Cy3, Cy5, FAM, HEX, JOE, QUASAR, rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC.

[0126] In some embodiments, the detectable probe comprises a fluorescent dye having an emission spectrum that is distinguishable from the emission spectrum of the fluorescent DNA intercalator. One of ordinary skill in the art can readily determine the excitation and emission spectra of the fluorescent DNA intercalator and the fluorescent dye of the detectable probe, and can determine the fluorescent DNA intercalator and the fluorescent dye that produce distinguishable signals, for example, when using appropriate fluorescent filters. In some embodiments, the excitation and emission spectra of the fluorescent DNA intercalator do not substantially overlap with the excitation and emission spectra of the fluorescent dye of the detectable probe.

[0127] In some embodiments, the detectable probe is a hydrolysis probe (also known as TaqMan TM Probe). Typically, a hydrolysis probe is an oligonucleotide probe that has a fluorophore covalently attached to the 5' end of the oligonucleotide and a quencher attached to the 3' end. TaqMan TM The probe hybridizes to the complementary target sequence and relies on the 5'-3' exonuclease activity of DNA polymerase to specifically cleave the probe. The cleavage of the probe increases the fluorescence intensity of the reporter dye.

[0128] In some embodiments, the detectable probe is a molecular beacon probe. Typically, a molecular beacon probe is an oligonucleotide hybridization probe that can form a hairpin structure. At one end (5' or 3' end) of the hybridization probe there is a donor fluorophore and at the other end there is an acceptor portion. In some embodiments, the acceptor portion is a quencher that absorbs the energy of the donor but does not fluoresce itself. See Tyagi and Kramer, Nature Biotechnol.14:303-306 (1996). Therefore, when the beacon is in an open conformation, the fluorescence of the donor fluorophore is detectable, and when the beacon is in a hairpin (closed) conformation, the fluorescence of the donor fluorophore is quenched. When used for PCR, the molecular beacon probe hybridized to one strand of the PCR product is in an open conformation, so fluorescence can be detected, while those that are not hybridized do not produce fluorescence.

[0129] Other amplification reaction components

[0130] In some embodiments, the composition further comprises one or more other reagents, such as amplification reagents. In some embodiments, the composition further comprises one or more of the following substances: a buffer, a salt, a nucleotide, a stabilizer, a primer, a polymerase, or nuclease-free water.

[0131] In some embodiments, the composition comprises a DNA polymerase. The DNA polymerase used in the compositions and methods described herein can be any polymerase capable of replicating a DNA molecule. In some embodiments, the DNA polymerase is a thermostable polymerase. Thermostable polymerases are isolated from multiple thermophilic bacteria, such as Thermus aquaticus (Taq), Pyrococcus furiosus (Pfu), Pyrococcus woesei (Pwo), Bacillus sterothermophilus (Bst), Sulfolobus acidocaldarius (Sac), Sulfolobus solfataricus (Sso), Pyrodictium occultum (Poc), Pyrodictium abyssi (Pab), and Methanobacterium thermoautotrophicum (Mth), as well as other species. DNA polymerases are known in the art and are commercially available. In some embodiments, the DNA polymerase is Taq, Tbr, Tfl, Tru, Tth, Tli, Tac, Tne, Tma, Tih, Tfi, Pfu, Pwo, Kod, Bst, Sac, Sso, Poc, Pab, Mth, Pho, ES4, VENT TM 、DEEPVENT TM , or an active mutant, variant, or derivative thereof. In some embodiments, the DNA polymerase is Taq DNA polymerase. In some embodiments, the DNA polymerase is a high-fidelity DNA polymerase (e.g., iProof TM High-fidelity DNA polymerase, High-fidelity DNA polymerase, High-fidelity DNA polymerase, Taq high-fidelity DNA polymerase, In some embodiments, the DNA polymerase is a fast-start or hot-start polymerase (e.g., FastStart TM Taq DNA Polymerase, FastStart TM High-fidelity DNA polymerase or iTaq TM DNA polymerase).

[0132] In some embodiments, the composition comprises nucleotides. The nucleotides used in the compositions and methods described herein can be any nucleotides that can be used for nucleic acid polymerization. The nucleotides can be natural, rare, modified, derived or artificial. The nucleotides can be unlabeled, or can be detectably labeled by methods known to those skilled in the art (e.g., using radioisotopes, vitamins, fluorescent moieties or chemiluminescent moieties, digoxin (dioxigenin)). In some embodiments, the nucleotides are deoxynucleoside triphosphates ("dNTPs", such as dATP, dCTP, dGTP, dTTP, dITP, dUTP, α-thio-dNIT, biotin-dUTP, fluorescein-dUTP, digoxin-dUTP or 7-deaza-dGTP). dNTPs are also well known in the art and are commercially available. The nucleotides can be present in any suitable concentration. In some embodiments, the amount of the nucleotides is from about 1 μM to about 1000 μM, such as from about 10 μM to about 750 μM or from about 100 μM to about 500 μM.

[0133] In some embodiments, the composition comprises one or more buffers or salts. A large number of buffers and saline solutions and improved buffers are well known in the art. For example, in some embodiments, the buffer is TRIS, TRICINE, BIS-TRICINE, HEPES, MOPS, TES, TAPS, PIPES or CAPS. In some embodiments, the salt is potassium acetate, potassium sulfate, potassium chloride, ammonium sulfate, ammonium chloride, ammonium acetate, magnesium chloride, magnesium acetate, magnesium sulfate, manganese chloride, manganese acetate, manganese sulfate, sodium chloride, sodium acetate, lithium chloride or lithium acetate.

[0134] Buffer and / or salt can be present in any suitable concentration. In some embodiments, the amount of buffer is about 0.1mM to about 1000mM, such as about 1mM to about 500mM or about 5mM to about 250mM. In some embodiments, the amount of salt is about 0.01mM to about 1000mM, such as about 0.1mM to about 500mM or about 1mM to about 100mM. In some embodiments, the composition comprises a salt (e.g., potassium chloride or magnesium chloride) having a concentration of about 10mM to about 100mM.

[0135] In some embodiments, the composition comprises one or more stabilizers. Stabilizers used in the compositions and methods described herein include, but are not limited to, polyols (glycerol, threitol, etc.), polyethers including cyclic polyethers, polyethylene glycol, organic or inorganic salts, such as ammonium sulfate, sodium sulfate, sodium molybdate, sodium tungstate, organic sulfonates, etc., sugars, polyols, amino acids, peptides or carboxylic acids, mannitol, glycerol, reduced glutathione, superoxide dismutase, bovine serum albumin (BSA) or gelatin, spermidine, dithiothreitol (or mercaptoethanol) and / or detergents such as X-100 [Octophenol (ethylene glycol ether)], [Polyoxyethylene 9-lauryl ether (Polidocanol C 12 E 9 )], (polyoxyethylene sorbitan monolaurate 20, NP40) and -35 (polyoxyethylene 23 lauryl ether).

[0136] In some embodiments, the compositions described herein are in liquid form, such as solutions. In some embodiments, the compositions described herein are in lyophilized form. In some embodiments, the lyophilized form of the composition is reconstituted by the end user of the composition.

[0137] IV. Methods for Quantitative PCR Normalization

[0138] In another aspect, a method for normalizing qPCR amplification relative to a control is provided. In some embodiments, the method comprises:

[0139] combining the target nucleic acid and the control nucleic acid with the following to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a target nucleic acid-specific primer set comprising a target nucleic acid-specific forward primer and a target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the control nucleic acid, and (iv) a fluorescence quenching primer set that specifically binds to the control nucleic acid, comprising a forward quencher primer and a reverse quencher primer, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, wherein the two or more quenchers are located within the primers such that the quenchers thereby quench all or substantially all fluorescence emitted by a control nucleic acid amplification product;

[0140] incubating the reaction mixture under conditions suitable for producing a target nucleic acid amplicon and a control nucleic acid amplicon, the fluorescent DNA intercalator binds both the target nucleic acid amplicon and the control nucleic acid amplicon, and the control nucleic acid amplicon produced comprises a plurality of quenchers incorporated into the amplicon;

[0141] Exciting the fluorescent DNA intercalator, and the quencher incorporated into the control nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the control nucleic acid amplicon; and

[0142] The target nucleic acid amplicon and the control nucleic acid amplicon are detected, wherein the target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the control nucleic acid amplicon is detected by detecting a detectable probe.

[0143] In some embodiments, the method comprises:

[0144] combining the target nucleic acid and the control nucleic acid with the following to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a target nucleic acid-specific primer set comprising a target nucleic acid-specific forward primer and a target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the control nucleic acid, and (iv) a fluorescent quencher primer set that specifically binds to the control nucleic acid, comprising a forward quencher primer and a reverse quencher primer, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher located near the 3' end of the primer;

[0145] incubating the reaction mixture under conditions suitable for producing a target nucleic acid amplicon and a control nucleic acid amplicon, the fluorescent DNA intercalator binds both the target nucleic acid amplicon and the control nucleic acid amplicon, and the control nucleic acid amplicon produced comprises a plurality of quenchers incorporated into the amplicon;

[0146] Exciting the fluorescent DNA intercalator, and the quencher incorporated into the control nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the control nucleic acid amplicon; and

[0147] The target nucleic acid amplicon and the control nucleic acid amplicon are detected, wherein the target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the control nucleic acid amplicon is detected by detecting a detectable probe.

[0148] Target nucleic acid

[0149] The target nucleic acid sequence can be any gene, non-coding genomic region or sequence of interest. In some embodiments, the target nucleic acid sequence is a disease (e.g., cancer, neuromuscular disease, cardiovascular disease, developmental disease or metabolic disease) related gene or sequence. In some embodiments, the target nucleic acid sequence is a cancer-related gene or sequence, including but not limited to: bladder cancer, brain cancer, breast cancer, cervical cancer, colorectal cancer, endometrial cancer, esophageal cancer, gastric cancer, head and neck cancer, kidney cancer, leukemia, liver cancer, lung cancer, lymphoma, melanoma, ovarian cancer, pancreatic cancer, prostate cancer or thyroid cancer. In some embodiments, the target nucleic acid sequence is a disease-associated gene or sequence, including but not limited to: autism spectrum disorder, cardiomyopathy, ciliary disease, congenital glycosylation disorder, congenital myasthenic syndrome, epilepsy and seizure disorder, eye disease, glycogen storage disease, hereditary cancer syndrome, hereditary periodic fever syndrome, inflammatory bowel disease, lysosomal storage disease, multiple osteodysplasia, neuromuscular disease, Noonan syndrome and related diseases, peroxisome biogenesis disorder or skeletal dysplasia.

[0150] The target nucleic acid can be single-stranded or double-stranded, or can contain both double-stranded and single-stranded sequence portions. For example, the nucleic acid sequence can be genomic DNA, cDNA, mRNA, or a combination or hybrid of DNA and RNA.

[0151] In some embodiments, the target nucleic acid is obtained from a sample, such as a biological sample. The biological sample can be obtained from any organism, such as an animal, a plant, a fungus, a pathogen (such as a bacterium or a virus), or any other organism. In some embodiments, the biological sample is from an animal, such as a mammal (such as a human or non-human primate, a cow, a horse, a pig, a sheep, a cat, a dog, a mouse, or a rat), a bird (such as a chicken), or a fish. The biological sample can be any tissue or body fluid obtained from an organism, such as blood, blood components or blood products (such as serum, plasma, platelets, red blood cells, etc.), sputum or saliva, tissue (such as kidney, lung, liver, heart, brain, nervous tissue, thyroid, eye, skeletal muscle, cartilage, or bone tissue); cultured cells, such as primary cultures, explants and transformed cells, stem cells, feces, urine, etc.

[0152] In some embodiments, before the merging step, one or more processing steps are performed on the sample containing the target nucleic acid. For example, the sample can be purified, separated, enriched or filtered. In some embodiments, the nucleic acid in the sample is fragmented to produce one or more fragments of specific size, for example, by mechanical means (such as ultrasonic cutting, acoustic shearing, needle shearing or ultrasonic treatment), chemical methods or enzymatic treatment (such as endonucleases). In some embodiments, the fragmented nucleic acid (such as target nucleic acid) is subjected to a size selection step to obtain nucleic acid fragments with a specific size or size range. Size selection methods are known in the art. For example, fragmented nucleic acids can be separated by gel electrophoresis, spin columns or paramagnetic beads.

[0153] Reaction mixture

[0154] The target nucleic acid is combined in a reaction mixture with a control nucleic acid, a detectable probe specifically associated with the control nucleic acid, and a fluorescent quenching primer set that specifically binds to the control nucleic acid (such as in the composition described in Section III above), as well as a fluorescent DNA intercalator and a target nucleic acid-specific primer set comprising a target nucleic acid-specific forward primer and a target nucleic acid-specific reverse primer. In some embodiments, the detectable probe is joined to the fluorescent quenching primer, and the reaction mixture further comprises an oligonucleotide hybridized to a portion of the primer, the oligonucleotide comprising a quencher that quenches the signal emitted by the detectable probe.

[0155] In some embodiments, the length of the target nucleic acid-specific primer (e.g., forward target nucleic acid-specific primer and / or reverse target nucleic acid-specific primer) is at least 15 nucleotides, such as at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 nucleotides. In some embodiments, the length of the target nucleic acid-specific primer (e.g., forward target nucleic acid-specific primer and / or reverse target nucleic acid-specific primer) is about 15-100 nucleotides, such as about 20-80, about 15-50, about 20-30, or about 15-30 nucleotides.

[0156] In some embodiments, the reaction mixture further comprises one or more other amplification reagents (such as those described in Section III above), such as, but not limited to, one or more of the following: buffers, salts, nucleotides, stabilizers, primers, polymerases, or nuclease-free water.

[0157] Amplification

[0158] In some embodiments, the reaction mixture is incubated under conditions suitable for producing target nucleic acid amplicon and control nucleic acid amplicon. In some embodiments, the target nucleic acid amplicon and control nucleic acid are amplified by PCR amplification. Other amplification methods are also known in the art.

[0159] Generally speaking, in PCR amplification, the reaction mixture is cycled to amplify nucleic acids: (i) nucleic acid denaturation, (ii) oligonucleotide primer annealing, and (iii) nucleic acid polymerization (extension). Preferred reaction conditions for amplification include thermal cycling, i.e., changing the temperature of the reaction mixture to promote each step of the PCR cycle. PCR typically undergoes multiple rounds of denaturation, annealing, and replication, and is enhanced by extending the denaturation step at the beginning and the final extension (polymerization) step (this is optional and preferred). In some embodiments, the PCR reaction can be a "two-step PCR" in which the annealing and extension steps are combined into a single step.

[0160] Suitable PCR amplification conditions are easily determined by those of ordinary skill in the art and can be changed according to factors such as the amount and composition of the target to be amplified, the composition of the primers used, and the composition of other amplification reagents (e.g., DNA polymerase). Typically, the temperature range of thermal cycling is between about 23°C and about 100°C, for example, between about 37°C and about 95°C. Denaturation of nucleic acids typically occurs at about 90°C to about 100°C, for example, about 94°C. Annealing typically occurs at about 37°C to about 75°C, for example, about 58°C to about 60°C. Polymerization typically occurs at about 55°C to about 80°C, for example, about 72°C. The number of PCR cycles can be about 5 to about 99 rounds, for example, at least about 10, about 15, about 20, or about 25 rounds.

[0161] In some embodiments, the target nucleic acid amplicon produced in the amplification step includes a fluorescent DNA intercalator that is bound to the target nucleic acid amplicon. In some embodiments, the control nucleic acid amplicon produced in the amplification step includes a fluorescent DNA intercalator that is bound to the control nucleic acid amplicon, and also includes a plurality of quenchers incorporated into the amplicon. Therefore, although both the target nucleic acid amplicon and the control nucleic acid amplicon are bound to the fluorescent DNA intercalator, the control nucleic acid amplicon also contains a quencher, and the quencher is close to the fluorescent DNA intercalator on the control nucleic acid amplicon, so it specifically quenches the fluorescent DNA intercalator bound to the control nucleic acid amplicon.

[0162] Excitation and detection

[0163] During amplification, the fluorescent DNA intercalator is inserted into the nucleic acid being amplified (e.g., the target nucleic acid amplicon and the control nucleic acid amplicon). Generally, the fluorescent DNA intercalator exhibits stronger fluorescence when bound to the DNA than when not bound. Therefore, the presence of the amplified nucleic acid can be detected by detecting the fluorescence emitted by the DNA intercalator.

[0164] like Figure 1 As shown in Figure 2, the fluorescence emitted by the DNA intercalator can be used to specifically detect the presence of the amplified target nucleic acid, because the quenching primer that specifically binds to the control nucleic acid quenches at least a portion of the fluorescence signal emitted by the DNA intercalator that binds to the control nucleic acid. In contrast, when the quenching primer of the control nucleic acid is not present, the fluorescence emitted by the control nucleic acid amplicon bound to the DNA intercalator hinders the specific detection of the fluorescence emitted by the target nucleic acid bound to the DNA intercalator, see Figure 3.

[0165] In order to detect the fluorescence emitted by the DNA intercalator, the reaction mixture is subjected to a suitable excitation wavelength (e.g., using a light source such as a light emitting diode, a halogen lamp, or a laser). In some embodiments, an emission filter is used so that only a specific wavelength or wavelength range is applied to the reaction mixture. The excitation wavelength of the fluorescent DNA intercalator varies depending on the composition of the fluorescent DNA intercalator. One of ordinary skill in the art can easily determine the appropriate excitation wavelength of the fluorescent DNA intercalator and the resulting emission wavelength. As one of the non-limiting examples, SYBR Green I has an excitation wavelength of about 494 nm and an emission wavelength of about 521 nm; in some embodiments, blue light can be used to excite the emission of fluorescence.

[0166] In some embodiments, the detection step further comprises detecting a detectable probe bound to a control nucleic acid amplicon. The detectable probe may comprise any detectable substance, such as a fluorescent agent, a phosphorescent agent, or a chemiluminescent agent, such as described in Section III above. In some embodiments, the detectable probe comprises a fluorescent agent. In such embodiments, the detectable probe may be any fluorescent agent distinguishable from a fluorescent DNA intercalator. In some embodiments, if an optical filter (e.g., an emission filter) is capable of specifically transmitting the emission light of one substance (e.g., specifically transmitting the emission light of a fluorescent DNA intercalator) while blocking the emission light of other substances (e.g., blocking the transmission of the emission light of a detectable probe fluorescent agent), the detectable probe comprising a fluorescent agent may be distinguished from a fluorescent DNA intercalator. In some embodiments, the excitation spectrum and emission spectrum of the fluorescent DNA intercalator do not overlap with the excitation spectrum and emission spectrum of the fluorescent dye of the detectable probe. In some embodiments, the excitation spectrum and emission spectrum of the fluorescent DNA intercalator do not substantially overlap with the excitation spectrum and emission spectrum of the fluorescent dye of the detectable probe.

[0167] In some embodiments, fluorescence can be detected by a detection device equipped with a fluorophore absorbable excitation light generation module and a fluorophore emission light detection module. Light sources, filters, and devices for exciting fluorophores and detecting fluorescent signals are well known in the art. In some embodiments, a fluorescence detection module or device is integrated into an apparatus or device for performing an amplification reaction, such as a CFX real-time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, California). Fluorescence detection devices and systems are also shown in Section VI below.

[0168] In some embodiments, the detection step includes quantifying the amount of fluorescent signal emitted by the fluorescent DNA intercalator (i.e., target nucleic acid signal) and / or the amount of signal emitted by the detectable probe (i.e., control nucleic acid signal). In some embodiments, the detection step includes determining the quantitative cycle number (Cq) of the target nucleic acid amplicon and the control nucleic acid amplicon. Methods for determining the Cq of an amplification reaction are well documented in the art. See, for example, US 2016 / 0210406.

[0169] In some embodiments, the method includes normalizing the target nucleic acid signal relative to the control nucleic acid signal. In some embodiments, the target nucleic acid signal of a partition or a reaction well is normalized relative to the control nucleic acid signal of the same partition or the same reaction well. In some embodiments, the step of normalizing the target nucleic acid signal of a particular partition or reaction well includes detecting the Cq of the control nucleic acid signal of the partition or reaction well, determining whether the Cq of the control nucleic acid signal falls within a predetermined Cq limit for the detection, and if the Cq of the control nucleic acid signal is not within the predetermined Cq limit, then excluding the target nucleic acid signal of the partition or reaction well.

[0170] IV. Multiplex Quantitative PCR Method

[0171] On the other hand, the present invention provides a method for multiplex amplification (e.g., qPCR amplification) of two target nucleic acids in the same partition (e.g., reaction well). In some embodiments, the method comprises:

[0172] combining a sample comprising a first target nucleic acid and a second target nucleic acid with the following to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the second target nucleic acid, and (iv) a second target nucleic acid-specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to the second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, the two or more quenchers being located within the primer such that the quenchers thereby quench all or substantially all fluorescence emitted by a second target nucleic acid amplification product;

[0173] incubating the reaction mixture under conditions suitable for producing a first target nucleic acid amplicon and a second target nucleic acid amplicon, the fluorescent DNA intercalator binds both the first target nucleic acid amplicon and the second target nucleic acid amplicon, and the produced second target nucleic acid amplicon comprises a plurality of quenchers incorporated into the amplicon;

[0174] Exciting the fluorescent DNA intercalator (e.g., using a light source for excitation), and the quencher incorporated into the second target nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the second target nucleic acid amplicon; and

[0175] The first target nucleic acid amplicon and the second target nucleic acid amplicon are detected, wherein the first target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the second target nucleic acid amplicon is detected by detecting a detectable probe.

[0176] In some embodiments, the method comprises:

[0177] combining a sample comprising a first target nucleic acid and a second target nucleic acid with the following substances to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer, (iii) a detectable probe that specifically associates with the second target nucleic acid, and (iv) a second target nucleic acid-specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to the second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer;

[0178] incubating the reaction mixture under conditions suitable for producing a first target nucleic acid amplicon and a second target nucleic acid amplicon, the fluorescent DNA intercalator binds both the first target nucleic acid amplicon and the second target nucleic acid amplicon, and the produced second target nucleic acid amplicon comprises a plurality of quenchers incorporated into the amplicon;

[0179] Exciting the fluorescent DNA intercalator (e.g., using a light source for excitation), and the quencher incorporated into the second target nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the second target nucleic acid amplicon; and

[0180] The first target nucleic acid amplicon and the second target nucleic acid amplicon are detected, wherein the first target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the second target nucleic acid amplicon is detected by detecting a detectable probe.

[0181] In some embodiments, the fluorescent signal emitted by the detectable probe is distinguishable from the signal emitted by the fluorescent DNA intercalator, and the method further comprises exciting the detectable probe and detecting the fluorescent signal emitted by the detectable probe, such as described in Section IV above.

[0182] The first target nucleic acid sequence and the second target nucleic acid sequence can both be any gene, non-coding genomic region, or sequence of interest. In some embodiments, the first target nucleic acid sequence and the second target nucleic acid sequence are both disease (e.g., cancer, neuromuscular disease, cardiovascular disease, developmental disease, or metabolic disease) related genes or sequences, such as the diseases or cancers described in Part IV above. In some embodiments, the first target nucleic acid sequence and the second target nucleic acid sequence are genes or sequences associated with the same disease.

[0183] The first target nucleic acid and the second target nucleic acid can be single-stranded or double-stranded, or can contain both double-stranded portions and single-stranded sequence portions. In some embodiments, the first target nucleic acid and / or the second target nucleic acid is genomic DNA, cDNA, mRNA, or a combination or hybrid of DNA and RNA.

[0184] The first target nucleic acid and the second target nucleic acid can be taken from any suitable sample, such as the sample described in Section IV above. In some embodiments, the first target nucleic acid and the second target nucleic acid are from the same sample. In some embodiments, the first target nucleic acid and the second target nucleic acid are from different samples, such as samples from different subjects, samples of different cells or different tissues of the same subject, or samples of the same type of tissue or cell at different time points of the same subject. In some embodiments, the sample containing the target nucleic acid is subjected to one or more processing steps, such as described in Section IV above.

[0185] In some embodiments, a reaction mixture comprising the following substances is formed: a first target nucleic acid, a second target nucleic acid, a first primer set specific to the first target nucleic acid, a second primer set specific to the second target nucleic acid comprising a forward quenching primer and a reverse quenching primer that specifically bind to the second target nucleic acid, a fluorescent DNA intercalator, and a detectable probe that specifically binds to the second target nucleic acid. In some embodiments, the primer set, the fluorescent DNA intercalator, and the detectable probe are as described in Part III or Part IV above. In some embodiments, the reaction mixture further comprises one or more other amplification reagents (e.g., as described in Part III above), such as, but not limited to, one or more of the following substances: buffers, salts, nucleotides, stabilizers, primers, polymerases, or nuclease-free water.

[0186] In some embodiments, the reaction mixture is incubated under conditions suitable for producing a first nucleic acid amplicon and a second nucleic acid amplicon. In some embodiments, the incubation includes amplifying the first target nucleic acid amplicon and the second target nucleic acid by PCR amplification, such as described in Section IV above. In some embodiments, the first nucleic acid amplicon produced in the amplification step includes a fluorescent DNA intercalator that binds to the target nucleic acid amplicon. In some embodiments, the second nucleic acid amplicon produced in the amplification step includes a fluorescent DNA intercalator that binds to the amplicon, and further includes a plurality of quenchers incorporated into the amplicon.

[0187] In some embodiments, the first target nucleic acid amplicon and the second target nucleic acid amplicon are detected as described in Section IV above. In the multiplex detection described herein, the fluorescence emitted by the DNA intercalator can be used to specifically detect the presence of the first target nucleic acid, because the presence of the quenching primer that specifically binds to the second target nucleic acid quenches at least a portion of the fluorescent signal emitted by the DNA intercalator that binds to the second target nucleic acid. In some embodiments, the detection step includes quantifying the amount of fluorescent signal emitted by the fluorescent DNA intercalator and / or the amount of signal emitted by the detectable probe. In some embodiments, the detection step includes determining the quantitative cycle number (Cq) of the first target nucleic acid amplicon and the second target nucleic acid amplicon.

[0188] VI. Detection system

[0189] Also provided herein is a detection device and system for quantifying the amount of fluorescent signal emitted by a fluorescent DNA intercalator and the amount of signal emitted by a detectable probe. In some embodiments, a detection device equipped with a fluorophore absorbable excitation light generation module and a fluorophore emission light detection module can be used to detect fluorescence. Devices and systems for monitoring nucleic acid amplification reactions and detecting fluorescent signals emitted during the amplification reaction are well known in the art. For example, see US 6,814,934.

[0190] After obtaining the fluorescence detection data, a general purpose computer system (referred to herein as a "host") can be used to store and process the data. Computer executable logic can be used to perform functions such as subtracting background signals, assigning values ​​to targets and / or reference sequences, and quantifying data. The host can be used to display, store, retrieve, or calculate diagnostic results from nucleic acid detection; store, retrieve, or calculate raw data from nucleic acid detection; or display, store, retrieve, or calculate any sample or patient information that can be used in the methods of the present invention.

[0191] In some embodiments, the host or any other computer can be used to quantify the absolute amount or relative amount of the target nucleic acid amplicon or calculate the quantitative cycle number (Cq) of the target nucleic acid amplicon and / or the control nucleic acid amplicon. In some embodiments, the host or any other computer can be used to evaluate the detection consistency or determine whether the reaction sample falls within the acceptable detection variation limit.

[0192] The host computer can be configured with many different hardware components and can be made into a variety of sizes and styles (e.g., desktop PC, notebook, tablet PC, handheld computer, server, workstation, mainframe). It can include standard components such as monitor, keyboard, disk drive, CD and / or DVD drive, etc. When the host computer is connected to the network, the connection can be provided by any suitable transmission medium (e.g., wired, optical and / or wireless medium) and any suitable communication protocol (e.g., TCP / IP); the host computer can include suitable network hardware (e.g., modem, Ethernet card, WiFi card). The host computer can use any of a variety of operating systems, including UNIX, Linux, Microsoft Windows, MacOS, or any other operating system.

[0193] Computer code for implementing the various aspects of the present invention can be written in a variety of languages, including PERL, C, C++, Java, JavaScript, VBScript, AWK or any other script or programming language that can be executed on a host or compiled to be executed on a host. The code can also be written or distributed in a low-level language, such as assembly language or machine language.

[0194] The script or program incorporating the various features of the present invention may be encoded on a variety of computer-readable media for storage and / or transmission. Examples of suitable media include: magnetic disks or tapes, optical storage media such as compact disks (CDs) or DVDs (digital versatile disks), flash memory, and carrier signals suitable for transmission via wired, optical fiber, and / or wireless networks (including the Internet) conforming to various protocols.

[0195] VII. Solid Support and Kits

[0196] In some embodiments, the composition described herein is attached to or contained within a solid support having one or more partitions. In some embodiments, the solid support is a test plate, such as a multi-well plate, such as a 6-well, 12-well, 24-well, 48-well or 96-well plate.

[0197] In some embodiments, the composition comprises a primer (e.g., a fluorescent quenching primer), a detectable probe, and / or a control nucleic acid, as described above in Section III. In some embodiments, the composition is in a liquid form, such as a solution, and the composition is located in a partition (e.g., a well) of a solid support (e.g., a detection plate). In some embodiments, the composition is in a lyophilized form, and the composition is located in a partition (e.g., a well) of a solid support (e.g., a detection plate).

[0198] In another aspect, the present invention provides a kit for qPCR amplification normalization or performing multiple reactions in the same reaction well. In some embodiments, the kit comprises:

[0199] A fluorescence quenching primer set that specifically binds to a nucleic acid (e.g., a control nucleic acid or a target nucleic acid), the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise two or more quenchers, the two or more quenchers being located within the primers such that the quenchers thereby quench all or substantially all fluorescence emitted by a nucleic acid amplification product; and

[0200] A detectable probe that specifically associates with a nucleic acid.

[0201] In some embodiments, the kit is a kit for qPCR amplification normalization. In some embodiments, the kit for qPCR amplification normalization comprises the composition described in Section III above. In some embodiments, the kit comprises:

[0202] A fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein the forward quenching primer and the reverse quenching primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer;

[0203] a detectable probe that specifically associates with a control nucleic acid; and

[0204] A control nucleic acid, wherein the control nucleic acid comprises a forward primer binding site to which the forward quencher primer binds, a probe binding site to which the probe binds, and a reverse primer binding site to which the reverse quencher primer binds.

[0205] In some embodiments, the kit is a kit for performing multiple reactions in the same reaction well. In some embodiments, the kit for multiple reactions comprises the composition described in Section III above. In some embodiments, the kit comprises:

[0206] a first target nucleic acid-specific primer set comprising a first target nucleic acid-specific forward primer and a first target nucleic acid-specific reverse primer;

[0207] a second target nucleic acid specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to a second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher at or near the 5' end of the primer and a second quencher near the 3' end of the primer; and

[0208] A detectable probe that specifically associates with a second target nucleic acid.

[0209] In some embodiments, the kits described herein comprise primers (eg, fluorescence quenching primers or target-specific primers), detectable probes, and / or control nucleic acids, as described above in Sections III and IV.

[0210] In some embodiments, the kit further comprises a fluorescent DNA intercalator, as described in Section III above. In some embodiments, the fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO. In some embodiments, the fluorescent DNA intercalator is SYBR Green I or EvaGreen.

[0211] In some embodiments, the kit further comprises one or more other reagents, such as amplification reagents. In some embodiments, the kit further comprises one or more reagents selected from the following substances: salts, nucleotides, buffers, stabilizers, DNA polymerases, detectable substances, and nuclease-free water. Amplification reagents are described in Section III above.

[0212] In some embodiments, the kit comprises a solid support having one or more partitions, wherein the partitions comprise the composition described herein. In some embodiments, the solid support comprises a composition in solution form. In some embodiments, the solid support comprises a composition in lyophilized form. In some embodiments, the solid support is a multi-well assay plate, such as a 6-well, 12-well, 24-well, 48-well, or 96-well plate.

[0213] For a kit comprising a composition in lyophilized form or a solid support comprising a composition in lyophilized form, in some embodiments, the composition is reconstituted by the end user. Thus, in some embodiments, the kit further comprises instructions for reconstitution of the lyophilized composition.

[0214] In some embodiments, the kit further comprises explanatory materials, which include instructions for implementing the methods described herein (i.e., protocols), such as instructions for normalizing qPCR assays using the kit. Explanatory materials typically include written or printed materials, but are not limited thereto. The present invention includes all media capable of storing such instructions for use and communicating them to the user. Such media include, but are not limited to, electronic storage media (e.g., disks, tapes, ink cartridges, chips, etc.), optical media (e.g., CD-ROMs), etc. Such media may also include the address of an Internet site that provides such explanatory materials. Example

[0215] The following examples are provided to illustrate, but not to limit, the claimed invention.

[0216] Example 1: Development of control assays for qPCR normalization

[0217] Fluorescent DNA intercalators (e.g., SYBR Green) are commonly used for real-time quantitative analysis of PCR. However, since fluorescent DNA intercalators bind to any double-stranded nucleic acid sequence in the sample, it is difficult to evaluate more than one product in the same reaction well. Therefore, qPCR reagents were developed to use fluorescent DNA intercalators and normalize experimental samples relative to controls in the same reaction well, thereby enabling better quantification by qPCR.

[0218] Figure 1 A general method for forming a control test that can be run in parallel with a target gene test is shown. In this test, a target nucleic acid ("target gene") and a control nucleic acid ("control") are contained in a sample. The sample is incubated with a target gene-specific primer, a control-specific primer, and a fluorescent DNA intercalator. PCR amplification is performed to obtain PCR products of the target gene and the control that are combined with a fluorescent DNA intercalator (SYBR Green). Excitation with blue light results in fluorescence from SYBR Green for the target gene, but not for the control.

[0219] A control assay was formed in which an artificial DNA sequence having no significant sequence similarity to any publicly available nucleic acid sequence was used as a control DNA sequence:

[0220] TGGACATTGTCGATCCGCGTGAAAG TTAGGTGGAATCGCATCATAGCC CCGTTCTAGGCTCTCCGAC GG CACTATCTAAGGCTCTGTCA ACAAAACGTATCCAGTGGTATGCCGTGTATTGTAATG

[0221] In the sequence, the primer binding site is underlined and the binding site of the detectable probe is shown in italics. A hydrolysis probe containing Quasar 705 fluorescent dye and BHQ3 quencher was used as the detectable probe.

[0222] The fluorescence quenching control detection primer is formed to quench the fluorescence in the control PCR product. The quencher is incorporated into the control nucleic acid specific primer so that the quencher is incorporated into the control nucleic acid amplicon during the PCR amplification reaction. As a result, the fluorescence generated by the control nucleic acid amplicon adsorbing the DNA intercalator is reduced due to the quenching of the quencher in the control nucleic acid amplicon. Figure 2A An example fluorescence quenching control primer design is shown, with two quenchers ("Q"), one at the 5' end of the primer and the other near the 3' end of the primer. This example design can be used for both forward and reverse primers. Figure 2B The resulting PCR amplification product is shown, with multiple quenchers ("Q") incorporated into the product and DNA intercalators (green dots) bound to the product. Upon blue light excitation, the quenchers in proximity to the bound DNA intercalators absorb fluorescence and dissipate the energy as heat. The fluorescence emitted by the DNA intercalators in the control product is at least partially quenched, reducing the fluorescence intensity of the quenching assay.

[0223] Another method to quench fluorescence in control PCR products is Figure 7 As shown in . In this method, the forward primer that binds to a nucleic acid sequence (e.g., a control nucleic acid) contains a quencher (BHQ1) that quenches the intercalating dye and also contains a detectable probe, i.e., a fluorophore (Q70). The oligonucleotide that hybridizes to a portion of the forward primer contains a quencher (BHQ3) that is compatible with the detectable probe Q705. Primer binding and extension cause the forward primer to dissociate from the oligonucleotide that bound the primer. This dissociation, coupled with primer incorporation in the final PCR product, results in the BHQ1 quencher quenching the intercalating dye and the detectable probe fluorophore Q705 emitting fluorescence.

[0224] The quenching control assay was performed under the following three conditions. Condition 1 ( Figure 3A ) was performed as follows: the following components were mixed to obtain a 20 uL reaction volume: 100 nM each of CCND1 primers (Prime PCR product (cat: 10025636) obtained from Bio-Rad Laboratories), 2 uL of a 1:10 dilution of a HeLa cell cDNA preparation, and iTaq Universal SYBR Green Supermix (Bio-Rad, cat: 1725121). Condition 2 ( Figure 3B) was performed as follows: the reaction included all components of condition 1 plus 300 nM each of the control primers containing a quencher (BioSearch Technologies), 500 nM of a reporter hydrolysis probe containing Quasar 705 at the 5' end and BHQ3 at the 3' end (Biosearch Technologies), and a control template gBlock (Integrated DNA Technologies). Condition 3 ( Figure 3C ) were performed as follows: the reaction included all components of condition 1 plus 300 nM each of control primers without quencher (BioSearch Technologies), 500 nM reporter hydrolysis probe containing Quasar 705 at the 5' end and BHQ3 at the 3' end (Biosearch Technologies), and control template gBlock (Integrated DNA Technologies). The control template concentration for conditions 1 and 2 was approximately 5 ag / rxn. All reactions were performed on a CFX real-time qPCR instrument (Bio Rad) in white 96-well PCR plates (Bio Rad, Cat: 9651). The temperature protocol was thermal cycling between 95°C and 58°C and included a multicolor well read after each 58°C step. Analysis was performed using CFX Maestro software version 1.1 (Bio-Rad) and Microsoft Excel.

[0225] like Figure 3A-3B As shown in the figure, the quenching control assay enables accurate quantification of the target gene (CCND1) qPCR reaction. Figure 3A ), the Cq of the qPCR reaction was measured to be 22.5. As described above, when CCND1 detection was performed using fluorescent quenching primers in the presence of quenching control detection, the Cq of CCND1 detection was still 22.5 ( Figure 3B ). In contrast, as expected, Figure 3C Non-quenched control assays (using the same detectable probe and the same control primer sequence but with Figure 3B The probe and primers used (no quencher on the primers) did affect the Cq measurement of CCND1 (Cq = 21.5). Since Cq measurements are expressed as log2 values, a difference of 1 Cq constitutes a significant difference and will prevent accurate quantification of the target.

[0226] Figure 4Another analysis showing quenching compared to a non-quenched control assay. Two conditions were tested in this experiment. Condition 1: Prepare a 20uL reaction system containing 300nM each of the control primers containing a quencher (BioSearch Technologies), 500nM of a reporter hydrolysis probe containing Quasar 705 at the 5' end and BHQ3 at the 3' end (Biosearch Technologies), and a control template gBlock (Integrated DNA Technologies). Condition 2: Prepare a 20uL reaction system containing 300nM each of the control primers without a quencher (BioSearch Technologies), 500nM of a reporter hydrolysis probe containing Quasar 705 at the 5' end and BHQ3 at the 3' end (Biosearch Technologies), and a control template gBlock (Integrated DNA Technologies). The control template concentration for conditions 1 and 2 was approximately 5 ag / rxn. All reactions were performed on a CFX real-time qPCR instrument (Bio Rad) in white 96-well PCR plates (Bio Rad, Cat: 9651). The temperature protocol was thermal cycling between 95°C and 58°C and included a multicolor well read after each 58°C step. Analysis was performed using CFX Maestro software version 1.1 (Bio-Rad) and Microsoft Excel. Figure 4 As shown, the signal from the detectable probe is shown in red and the signal from the DNA intercalator is shown in green. Although the end point intensity is different, the probe fluorescence (red) still produces a single Cq, indicating that the reaction is running normally. The difference between the DNA intercalator fluorescence (green) detected by the non-quenched and quenched control is about 6-7 Cq. 6 Cq is roughly equivalent to a 40-80-fold (40-80x) reduction in the SYBR Green fluorescence intensity detected by the quenching.

[0227] The consistency of the control test was evaluated as shown in Figure 5. In this experiment, a 20uL reaction system was prepared, which contained 300nM of each control primer containing a quencher (BioSearch Technologies), 500nM of a reporter hydrolysis probe containing Quasar 705 at the 5' end and BHQ3 at the 3' end (Biosearch Technologies), and a control template gBlock (Integrated DNA Technologies). The concentration of the control template was about 5ag / rxn. A total of 16 wells were prepared in this way. The 16 wells contained 4 cDNA input levels, prepared from the HeLacDNA samples described above for Figure 3. The input values ​​of the cDNA dilution were 1 to 10, 1 to 100, 1 to 1000, and no cDNA. Each condition was represented equally on the plate (4 wells for each condition). All reactions were performed in a white 96-well PCR plate (Bio Rad, Cat: 9651) on a CFX real-time qPCR instrument (Bio Rad). The temperature protocol was thermal cycling between 95°C and 58°C and included a multi-well plate read after each 58°C step. Analysis was performed using CFX Maestro software version 1.1 (Bio-Rad) and Microsoft Excel. Figure 5A As shown, the control assay showed good agreement. Figure 5B The Cq values ​​corresponding to different standard deviation cutoffs and the probability that a "good" well (e.g., a well that is not inhibited) is randomly excluded for different standard deviation cutoffs are shown.

[0228] Example 2: Heparin titration inhibition study

[0229] Reaction inhibition can hinder accurate quantitation of qPCR assays. One of the known inhibitors of PCR reactions is heparin. Heparin titration studies were performed to determine whether the quenching control assay described herein could be used to detect heparin inhibition.

[0230] Figure 6 shows the effect of an inhibitor (heparin) on the fluorescence signal and demonstrates that the quenching control assay can be used to detect reaction inhibition. In this experiment, the effect of the PCR inhibitor heparin was tested under two reaction conditions. Condition 1 ( Fig. 6A ): Mix the following components to form a 20uL reaction volume: CCND1 primers (Prime PCR products (cat: 10025636) obtained from Bio-Rad Laboratories) 100nM each, 2uL of a 1:10 dilution of HeLa cell cDNA preparation, iTaq Universal SYBR Green Supermix (Bio-Rad, cat: 1725121). Condition 2 ( Figure 6B): The reaction mixture contained all the components of condition 1 plus 300 nM each of the control primers containing a quencher (BioSearch Technologies), 500 nM of a reporter hydrolysis probe containing Quasar 705 at the 5' end and BHQ3 at the 3' end (Biosearch Technologies), and a control template gBlock (Integrated DNA Technologies). The control template concentration for condition 2 was approximately 5 ag / rxn. For each condition, samples were treated with 0.5 ug / mL heparin (Sigma Aldrich) or an equal amount of blank. All reactions were performed on a CFX real-time qPCR instrument (Bio Rad) in white 96-well PCR plates (Bio Rad, Cat: 9651). The temperature protocol was thermal cycling between 95°C and 58°C and included a multicolor well plate read after each 58°C step. Analysis was performed using CFX Maestro software version 1.1 (Bio-Rad) and Microsoft Excel.

[0231] Figure 6A-6B The results showed that for the p53 target gene assay and the quenching control assay, there was a 3-5 Cq shift in the presence of heparin. Figure 6B In the experiment, both the detectable probe (Quasar) signal and the SYBR Green signal showed approximately equal Cq changes, indicating that the reaction was generally inhibited. Therefore, the quenching control assay can effectively detect reaction inhibition by the detectable probe assay and exclude the corresponding wells.

[0232] It should be understood that the embodiments and implementations described herein are for illustrative purposes only, and those skilled in the art should understand various modifications or changes made therefrom, and they are included in the subject matter and interests of this application and the scope of the appended claims. All publications, patents and patent applications cited herein are incorporated herein by reference in their entirety for all purposes.

Claims

1. A composition for quantitative polymerase chain reaction (PCR) amplification normalization, comprising: A fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein: The forward quencher primer and the reverse quencher primer each comprise two or more quenchers, and the two or more quenchers are positioned within the primers such that the quenchers thereby quench all or substantially all fluorescence emitted by a control nucleic acid amplification product; a detectable probe that specifically associates with a control nucleic acid; a control nucleic acid, wherein the control nucleic acid comprises a forward primer binding site that binds to the forward quencher primer, a probe binding site that binds to the detectable probe, and a reverse primer binding site that binds to the reverse quencher primer; and A fluorescent DNA intercalator, wherein the detectable probe comprises a fluorescent dye having an emission spectrum distinguishable from the emission spectrum of the fluorescent DNA intercalator.

2. The composition of claim 1, comprising: A fluorescence quenching primer set that specifically binds to a control nucleic acid, the primer set comprising a forward quenching primer and a reverse quenching primer, wherein: The forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer; a detectable probe that specifically associates with a control nucleic acid; and A control nucleic acid, wherein the control nucleic acid comprises a forward primer binding site that binds to the forward quencher primer, a probe binding site that binds to the detectable probe, and a reverse primer binding site that binds to the reverse quencher primer.

3. The composition of claim 2, wherein: For the forward quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end; and / or For the reverse quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end.

4. The composition of claim 1 or 2, wherein: The forward quencher primer comprises a first quencher and a second quencher separated by no more than 25 bases; and / or The reverse quencher primer includes a first quencher and a second quencher separated by no more than 25 bases.

5. The composition according to claim 1 or 2, wherein The detectable probe binds directly to the control nucleic acid.

6. The composition according to claim 1 or 2, wherein The detectable probe is coupled to the forward quencher primer and / or the reverse quencher primer.

7. The composition of claim 6, further comprising an oligonucleotide that hybridizes to the detectable probe binding portion of the primer, wherein the oligonucleotide comprises a quencher that quenches the signal emitted by the detectable probe.

8. The composition according to claim 1 or 2, wherein The detectable probe is joined to an oligonucleotide that hybridizes to a portion of the forward quencher primer or the reverse quencher primer.

9. The composition of claim 8, further comprising a quencher that quenches the signal emitted by the detectable probe, wherein The quencher that quenches the signal emitted by the detectable probe is bound to (i) the oligonucleotide to which the detectable probe is bound or (ii) the primer hybridized to the oligonucleotide.

10. The composition according to claim 1, wherein The fluorescent DNA intercalator is SYBR GreenI, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO.

11. The composition according to claim 10, wherein The fluorescent DNA intercalator is SYBR GreenI.

12. The composition according to claim 1 or 2, wherein The detectable probe comprises a fluorescent dye selected from the group consisting of Cy3, Cy5, FAM, HEX, JOE, QUASAR, Rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC.

13. The composition according to claim 1 or 2, wherein The detectable probe comprises a hydrolysis probe.

14. The composition of claim 1 or 2, further comprising one or more buffers, salts, nucleotides, primers, polymerases and / or water.

15. The composition of claim 1 or 2, which is a solution.

16. The composition of claim 1 or 2, which is a lyophilized composition.

17. A solid support comprising one or more partitions, each of the one or more partitions comprising the composition of any one of claims 1 to 16.

18. A kit comprising the composition of any one of claims 1 to 16 or the solid support of claim 17.

19. A method for normalizing qPCR amplification relative to a control, the method comprising: Combining the target nucleic acid and the control nucleic acid with the following substances to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a target nucleic acid specific primer set comprising a target nucleic acid specific forward primer and a target nucleic acid specific reverse primer, (iii) a detectable probe that specifically associates with the control nucleic acid, and (iv) a fluorescent quencher primer set that specifically binds to the control nucleic acid, comprising a forward quencher primer and a reverse quencher primer, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, the two or more quenchers being located within the primers such that the quenchers thereby quench all or substantially all fluorescence emitted by a control nucleic acid amplification product, and wherein the detectable probe comprises a fluorescent dye having an emission spectrum distinguishable from the emission spectrum of the fluorescent DNA intercalator; incubating the reaction mixture under conditions suitable for producing a target nucleic acid amplicon and a control nucleic acid amplicon, wherein the fluorescent DNA intercalator binds both the target nucleic acid amplicon and the control nucleic acid amplicon, and the control nucleic acid amplicon produced comprises a plurality of quenchers incorporated into the amplicon; Exciting the fluorescent DNA intercalator, and the quencher incorporated into the control nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the control nucleic acid amplicon; and The target nucleic acid amplicon and the control nucleic acid amplicon are detected, wherein the target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the control nucleic acid amplicon is detected by detecting a detectable probe.

20. The method of claim 19, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher located at or near the 5' end of the primer and a second quencher near the 3' end of the primer.

21. The method of claim 19 or 20, wherein: The detectable probe binds directly to the control nucleic acid.

22. The method of claim 19 or 20, wherein: (i) the detectable probe is coupled to the forward quencher primer and / or the reverse quencher primer; or (ii) the detectable probe is joined to an oligonucleotide that hybridizes to a portion of the forward quencher primer or the reverse quencher primer.

23. The method of claim 19 or 20, wherein: The detectable probe comprises a hydrolysis probe.

24. The method of claim 19 or 20, wherein: The detection step includes determining the quantitative cycle number (Cq) of the target nucleic acid amplicon and the control nucleic acid amplicon.

25. The method of claim 19 or 20, wherein: The detecting step includes quantifying the amount of the fluorescent signal emitted by the fluorescent DNA intercalator and the amount of the signal emitted by the detectable probe.

26. The method of claim 19 or 20, wherein: The fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO.

27. The method of claim 19 or 20, wherein: The detectable probe comprises a fluorescent dye selected from the group consisting of Cy3, Cy5, FAM, HEX, JOE, QUASAR, Rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC.

28. The method of claim 20, wherein: For the forward quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end; and / or For the reverse quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end.

29. The method of claim 19 or 20, wherein: The forward quencher primer comprises a first quencher and a second quencher separated by no more than 25 bases; and / or The reverse quencher primer includes a first quencher and a second quencher separated by no more than 25 bases.

30. A method for multiplex qPCR amplification of two target nucleic acids in the same well, the method comprising: Combining a sample comprising a first target nucleic acid and a second target nucleic acid with the following substances to form a reaction mixture: (i) a fluorescent DNA intercalator, (ii) a first target nucleic acid specific primer set comprising a first target nucleic acid specific forward primer and a first target nucleic acid specific reverse primer, (iii) a detectable probe that specifically associates with the second target nucleic acid, and (iv) a second target nucleic acid specific primer set comprising a forward quencher primer and a reverse quencher primer that specifically bind to the second target nucleic acid, wherein the forward quencher primer and the reverse quencher primer each comprise two or more quenchers, the two or more quenchers being located within the primer such that the quenchers thereby quench all or substantially all fluorescence emitted by a second target nucleic acid amplification product, and wherein the detectable probe comprises a fluorescent dye having an emission spectrum distinguishable from the emission spectrum of the fluorescent DNA intercalator; incubating the reaction mixture under conditions suitable for producing a first target nucleic acid amplicon and a second target nucleic acid amplicon, the fluorescent DNA intercalator binds both the first target nucleic acid amplicon and the second target nucleic acid amplicon, and the produced second target nucleic acid amplicon comprises a plurality of quenchers incorporated into the amplicon; Exciting the fluorescent DNA intercalator, and the quencher incorporated into the second target nucleic acid amplicon quenches at least a portion of the fluorescence emitted by the fluorescent DNA intercalator bound to the second target nucleic acid amplicon; and The first target nucleic acid amplicon and the second target nucleic acid amplicon are detected, wherein the first target nucleic acid amplicon is detected by detecting a fluorescent signal emitted by a fluorescent DNA intercalator, and the second target nucleic acid amplicon is detected by detecting a detectable probe.

31. The method of claim 30, wherein the forward quencher primer and the reverse quencher primer each comprise a first quencher at or near the 5' end of the primer and a second quencher near the 3' end of the primer.

32. The method of claim 30 or 31, wherein: The detectable probe directly binds to the second target nucleic acid.

33. The method of claim 30 or 31, wherein: (i) the detectable probe is coupled to the forward quencher primer and / or the reverse quencher primer; or (ii) the detectable probe is joined to an oligonucleotide that hybridizes to a portion of the forward quencher primer or the reverse quencher primer.

34. The method of claim 30 or 31, wherein: The detectable probe comprises a hydrolysis probe.

35. The method of claim 30 or 31, wherein: The detection step includes determining the quantitative cycle number (Cq) of the first target nucleic acid amplicon and the second target nucleic acid amplicon.

36. The method of claim 30 or 31, wherein: The detecting step includes quantifying the amount of the fluorescent signal emitted by the fluorescent DNA intercalator and the amount of the signal emitted by the detectable probe.

37. The method of claim 30 or 31, wherein: The fluorescent DNA intercalator is SYBR Green I, EvaGreen, picogreen, ethidium bromide, SYBR Gold, Yo-Yo, Yo-Pro, TOTO, BOXTO or BEBO.

38. The method of claim 30 or 31, wherein: The detectable probe comprises a fluorescent dye selected from the group consisting of Cy3, Cy5, FAM, HEX, JOE, QUASAR, Rhodamine, ROX, TAMRA, TET, Texas Red, TYE and VIC.

39. The method of claim 31, wherein: For the forward quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end; and / or For the reverse quencher primer, the first quencher is located at the 5' end or within 5 bases from the 5' end, and the second quencher is within 5-10 bases from the 3' end.

40. The method of claim 30 or 31, wherein: The forward quencher primer comprises a first quencher and a second quencher separated by no more than 25 bases; and / or The reverse quencher primer includes a first quencher and a second quencher separated by no more than 25 bases.

Images