Method for producing human A1 astrocytes, human A1 astrocytes, and method for evaluating test substances

Abstract

The present invention aims to provide a method for producing human A1 astrocytes, comprising inducing human A1 astrocytes from human astrocytes other than human A1 astrocytes; human A1 astrocytes obtained by the above method for producing human A1 astrocytes; and a method for evaluating a test substance using human A1 astrocytes. According to the present invention, there can be provided a method for producing human A1 astrocytes, comprising step a of culturing human astrocytes other than human A1 astrocytes in the presence of TNFα and IFNγ.

Description

Technical Field

[0001] The present invention relates to a method for producing human A1 astrocytes and human A1 astrocytes, and also to a method for screening a test substance using the produced human A1 astrocytes. Background Art

[0002] Astrocytes, a type of glial cells constituting the brain, play various roles in maintaining the homeostasis of the central nervous system, such as supplying nutrients to neurons, forming or eliminating synapses, and have attracted attention from the viewpoints of clarifying the mechanisms of diseases and discovering drugs.

[0003] It is known that astrocytes are activated by neurological diseases or aging. In recent years, it has been reported that there are two types of activated astrocytes: neurologically impaired A1 astrocytes and neuroprotective A2 astrocytes (Non-patent Document 1 and Patent Document 1). Considering the use in drug discovery research such as screening for drugs that inhibit nerve damage, human A1 astrocytes are of great value.

[0004] Regarding the activation of astrocytes, Non-Patent Document 1 describes that mouse (unactivated) astrocytes are induced into A1 astrocytes by the three components of TNFα, IL-1α, and C1q. However, it has been reported that there are species differences between mouse and human astrocytes (Non-Patent Document 2), and it is not clear whether human astrocytes can be induced in the same way.

[0005] Patent Document 2 states that inflammatory cytokines such as TNFα and IFNγ are involved in the activation of astrocytes, and that (unactivated) mouse astrocytes were activated by three components, TNFα, IFNγ, and MPTP. However, it is not clear whether the astrocytes are induced into A1 astrocytes or A2 astrocytes as a result of the activation of astrocytes, and it is not clear whether the same activation occurs in human astrocytes.

[0006] Non-Patent Document 3 describes that IFNγ and IL-1β are involved in the activation of human astrocytes. However, it is not clear whether astrocytes are induced into A1 astrocytes or A2 astrocytes as a result of activation.

[0007] Prior art literature

[0008] Patent Literature

[0009] Patent Document 1: US Patent Application Publication US2016 / 0340648

[0010] Patent Document 2: US Patent Application Publication No. US2010 / 0087504

[0011] Non-patent literature

[0012] Non-patent literature 1: Nature, 2017, Vol. 541, pp. 481-487

[0013] Non-patent document 2: Neuron, 2016, Vol. 89, No. 1, pp. 37-53

[0014] Non-patent document 3: Glia, 2014, Vol. 62, pp. 999-1013 Summary of the invention

[0015] Technical issues to be solved by the invention

[0016] From the perspective of drug discovery research, human A1 astrocytes are of great value, and a method for easily obtaining human A1 astrocytes is required. As described above, certain results have been achieved regarding the activation and induction of astrocytes, but a method for reliably inducing adult A1 astrocytes from human astrocytes has not yet been found. The problem to be solved by the present invention is to provide a method for producing human A1 astrocytes, including inducing human A1 astrocytes from human astrocytes other than human A1 astrocytes. The problem to be solved by the present invention is to also provide a human A1 astrocyte obtained by the above-mentioned method for producing human A1 astrocytes. The problem to be solved by the present invention is to also provide a method for evaluating a test substance using the above-mentioned human A1 astrocytes.

[0017] Means for solving technical problems

[0018] The present inventors have conducted intensive studies to solve the above problems and have found that human astrocytes other than human A1 astrocytes can be induced into human A1 astrocytes by culturing the human astrocytes in the presence of TNFα and IFNγ. The present invention has been completed based on these findings.

[0019] That is, according to the present invention, the following inventions can be provided.

[0020] <1> A method for producing human A1 astrocytes, comprising the step a of culturing human astrocytes other than human A1 astrocytes in the presence of TNFα and IFNγ.

[0021] <2> The method for producing human A1 astrocytes according to <1>, further comprising performing the step a in the presence of at least one cytokine selected from the group consisting of IL-1α, IL-1β, and C1q and / or complement.

[0022] <3> The method for producing human A1 astrocytes according to <1> or <2>, wherein the step a is performed in the presence of any of the following.

[0023] (1)TNFα, IFNγ, IL-1α, IL-1β

[0024] (2)TNFα, IFNγ, IL-1α, C1q

[0025] (3)TNFα, IFNγ, IL-1β, C1q

[0026] (4)TNFα, IFNγ, IL-1α, IL-1β, C1q

[0027] (5) TNFα, IFNγ

[0028] <4> The method for producing human A1 astrocytes according to any one of <1> to <3>, wherein

[0029] The above step a comprises: step a1, differentiating cells capable of differentiating into human pluripotent stem cells or human astrocytes into human astrocytes other than human A1 astrocytes; and step a2, culturing human astrocytes other than human A1 astrocytes obtained in step a1 in the presence of TNFα and IFNγ.

[0030] <5> The method for producing human A1 astrocytes according to any one of <1> to <4>, wherein

[0031] The human astrocytes other than the human A1 astrocytes cultured in the above step a are human A2 astrocytes.

[0032] <6> The method for producing human A1 astrocytes according to any one of <1> to <5>, wherein

[0033] The above step a is culturing in a serum-free medium.

[0034] <7> The method for producing human A1 astrocytes according to any one of <1> to <6>, wherein

[0035] In the above step a, the concentration of TNFα in the culture medium is 0.01 ng / mL to 30 ng / mL.

[0036] <8> The method for producing human A1 astrocytes according to any one of <1> to <7>, wherein

[0037] In the above step a, the concentration of IFNγ in the culture medium is 0.1 ng / mL to 20 ng / mL.

[0038] <9> The method for producing human A1 astrocytes according to any one of <1> to <8>, wherein

[0039] In the above step a, the ratio of the concentration of TNFα in the culture medium to the concentration of IFNγ in the culture medium is 100:1 to 1:100.

[0040] <10> A human A1 astrocyte, which is an isolated human A1 astrocyte obtained by the method for producing a human A1 astrocyte according to any one of <1> to <9>.

[0041] <11> A method for evaluating a test substance, comprising contacting the human A1 astrocytes described in <10> with the test substance.

[0042] <12> The method for evaluating a test substance according to <11>, wherein:

[0043] After the human A1 astrocytes described in <10> are brought into contact with a test substance, changes in neurological impairment of the human A1 astrocytes are evaluated.

[0044] Effects of the Invention

[0045] According to the present invention, human A1 astrocytes can be produced from human astrocytes. The human A1 astrocytes of the present invention and the method for evaluating a test substance of the present invention are useful in drug discovery research and the like. BRIEF DESCRIPTION OF THE DRAWINGS

[0046] Figure 1 The state after culturing human astrocytes in the presence of a specific combination of compounds is shown in FIG.

[0047] Figure 2 The state after culturing human astrocytes (induced from astrocyte precursor cells) in the presence of a specific combination of compounds is shown in FIG.

[0048] Figure 3 5 shows the results of quantification of GBP2 and CXCL10 expression after culturing human astrocytes in the presence of a specific combination of compounds.

[0049] Figure 4 The results of quantifying the expression of C3 after culturing human astrocytes in the presence of a specific combination of compounds are shown in FIG.

[0050] Figure 5 5 shows the results of quantifying the expression of C3 after culturing human astrocytes (induced from astrocyte precursor cells) in the presence of a specific combination of compounds.

[0051] Figure 6 5 shows the results of quantifying the expression of C3 after culturing human astrocytes (primary culture) in the presence of a specific combination of compounds.

[0052] Figure 7 ] The state of neural cells when neural cells (also referred to as neurons) were cultured together with untreated human astrocytes or together with human astrocytes cultured in the presence of a specific combination of compounds is shown in FIG.

[0053] Figure 8 2 shows the evaluation results of neural cell death when neural cells (also referred to as neurons) were cultured together with untreated human astrocytes or together with human astrocytes cultured in the presence of a specific combination of compounds.

[0054] Fig. 9 : Shown are the states of neurons and the length of neurites when neurons were cultured together with untreated human astrocytes (induced from astrocyte precursor cells) or together with human astrocytes (induced from astrocyte precursor cells) cultured in the presence of a specific combination of compounds. DETAILED DESCRIPTION

[0055] Hereinafter, embodiments of the present invention will be described in detail.

[0056] TNFα stands for Tumor Necrosis Factor α.

[0057] IFNγ stands for Interferon γ.

[0058] IL-1α stands for Interleukin-1α.

[0059] IL-1β stands for Interleukin-1β.

[0060] C1q denotes complement C1q.

[0061] MPTP stands for 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine.

[0062] EMP1 stands for epithelial membrane protein 1.

[0063] CD109 stands for Cluster of Differentiation 109.

[0064] GBP2 stands for guanylate binding protein 2.

[0065] C3 represents the complement molecule C3.

[0066] CXCL10 stands for CXC motif chemokine 10.

[0067] GAPDH stands for glyceraldehyde 3-phosphate dehydrogenase.

[0068] HBEGF stands for heparin binding-epidermal growth factor-like growth factor.

[0069] WST stands for Water Soluble Tetrazolium Salts.

[0070] The present invention relates to a method for producing human A1 astrocytes, comprising the step a of culturing human astrocytes other than human A1 astrocytes in the presence of TNFα and IFNγ.

[0071] Step a is a step of culturing human astrocytes other than human A1 astrocytes in the presence of TNFα and IFNγ or in the presence of at least one cytokine selected from the group consisting of IL-1α, IL-1β and C1q and / or complement in addition to TNFα and IFNγ.

[0072] The step a is preferably a step of culturing human astrocytes other than human A1 astrocytes in the presence of any of the following.

[0073] (1)TNFα, IFNγ, IL-1α, IL-1β

[0074] (2)TNFα, IFNγ, IL-1α, C1q

[0075] (3)TNFα, IFNγ, IL-1β, C1q

[0076] (4)TNFα, IFNγ, IL-1α, IL-1β, C1q

[0077] (5) TNFα, IFNγ

[0078] Particularly, step a is preferably a step of culturing human astrocytes other than human A1 astrocytes in the presence of any of the following.

[0079] (4)TNFα, IFNγ, IL-1α, IL-1β, C1q

[0080] (5) TNFα, IFNγ

[0081] The step a is preferably a step of culturing human astrocytes other than human A1 astrocytes in the absence of MPTP.

[0082] <Human astrocytes>

[0083] "Human astrocytes" refers to human astrocytes.

[0084] As a method for obtaining the "human astrocytes other than human A1 astrocytes" used in the present invention, for example, separation from the cerebral cortex or bone marrow obtained from a patient surgically, induction from cells capable of differentiating into human astrocytes, induction from human pluripotent stem cells, etc. can be cited. All of these human astrocytes can be used as the "human astrocytes other than human A1 astrocytes" in the method of the present invention.

[0085] As the “human astrocytes other than human A1 astrocytes” used in the present invention, preferably used are human astrocytes induced from human pluripotent stem cells and human astrocytes induced from cells capable of differentiating into human astrocytes.

[0086] Human astrocytes other than human A1 astrocytes can be used in the method of the present invention even in an isolated state or in a state mixed with other cells. In addition, it can be assumed that the induction from pluripotent stem cells to human astrocytes and the induction from human astrocytes to human A1 astrocytes are performed continuously. In this case, step a includes: step a1, differentiating cells capable of differentiating into human pluripotent stem cells or human astrocytes into human astrocytes other than human A1 astrocytes; and step a2, culturing human astrocytes other than human A1 astrocytes obtained in step a1 in the presence of TNFα and IFNγ.

[0087] Examples of human pluripotent stem cells include human iPS cells (human induced pluripotent stem cells), human ES cells (human embryonic stem cells), and human mesenchymal stem cells, but are not particularly limited.

[0088] Examples of cells that can differentiate into human astrocytes include neural stem cells, glial neural precursor cells, glial precursor cells, astrocyte precursor cells, and fibroblasts, but are not particularly limited.

[0089] <Activation of human astrocytes>

[0090] "Activated human astrocytes" refer to human astrocytes activated by the influence of neurological diseases, etc. Among activated human astrocytes, human A1 astrocytes characterized by neurological impairment and neuroprotective human A2 astrocytes are known. Activated human astrocytes are also included in the human astrocytes of the present invention.

[0091] <Human A1 astrocytes>

[0092] “Human A1 astrocytes” are a type of activated human astrocytes.

[0093] The human A1 astrocytes produced by the method of the present invention can be detected, confirmed, and isolated using, for example, morphological changes of the cells, characteristic properties of human A1 astrocytes, or specific markers.

[0094] Human A1 astrocytes have a characteristic hypertrophic appearance. Therefore, human A1 astrocytes can be detected by observation using a microscope.

[0095] Examples of markers specific for human A1 astrocytes include GBP2, CXCL10, and C3, but are not limited thereto.

[0096] Specific markers can be detected by immunological methods (detection using antibodies), but protein molecules can be detected by quantifying the amount of their mRNA.

[0097] Human A1 astrocytes show neuron-damaging properties, so human A1 astrocytes can be co-cultured with neurons to detect the neuron-damaging effects.

[0098] <Human A2 astrocytes>

[0099] “Human A2 astrocytes” are a type of activated human astrocytes.

[0100] A2 astrocytes have increased expression of various neurotrophic factors and play a protective role on nerve cells. Specific markers for A2 astrocytes include EMP1 and CD109, but are not limited to these.

[0101] Human A2 astrocytes have a star-shaped appearance.

[0102] In the present invention, human A2 astrocytes can be used as human astrocytes other than human A1 astrocytes cultured in step a.

[0103] <TNFα>

[0104] TNFα is a type of cytokine and is a substance widely involved in the activation of biological defense or immune mechanisms during inflammation. The method for achieving the culture condition "in the presence of TNFα" is not particularly limited, and can be achieved, for example, by adding TNFα to the culture medium, co-culturing with cells producing TNFα, or adding the culture supernatant of cells producing TNFα.

[0105] The concentration of TNFα is not particularly limited and may be appropriately determined. For example, it can be used in the range of 0.01 ng / mL to 30 ng / mL, preferably 0.5 ng / mL to 10 ng / mL.

[0106] <IFNγ>

[0107] IFNγ refers to a cytokine that controls the induction of cell-mediated immunity. The method for achieving the culture condition "in the presence of IFNγ" is not particularly limited, and can be achieved, for example, by adding IFNγ to the culture medium, co-culturing with cells producing IFNγ, or adding the culture supernatant of cells producing IFNγ.

[0108] The concentration of IFNγ is not particularly limited and may be appropriately determined. For example, it can be used in the range of 0.1 ng / mL to 20 ng / mL, preferably 0.5 ng / mL to 10 ng / mL.

[0109] The ratio of the concentration of TNFα to the concentration of IFNγ in the culture medium is not particularly limited, but is preferably 100:1 to 1:100, more preferably 10:1 to 1:10, further preferably 5:1 to 1:5, and particularly preferably 3:1 to 1:1.

[0110] <IL-1α>

[0111] IL-1α is a type of interleukin, a cytokine secreted from leukocytes. The method for achieving the culture condition "in the presence of IL-1α" is not particularly limited, and can be achieved, for example, by adding IL-1α to the culture medium, co-culturing with cells producing IL-1α, or adding the culture supernatant of cells producing IL-1α.

[0112] The concentration of IL-1α is not particularly limited and may be appropriately determined. For example, it can be used in the range of 1 pg / mL to 5 ng / mL, preferably 0.05 ng / mL to 3 ng / mL.

[0113] <IL-1β>

[0114] IL-1β is a type of interleukin, a cytokine secreted from leukocytes. The method for achieving the culture condition "in the presence of IL-1β" is not particularly limited, and can be achieved, for example, by adding IL-1β to the culture medium, co-culturing with cells producing IL-1β, or adding the culture supernatant of cells producing IL-1β.

[0115] The concentration of IL-1β is not particularly limited and may be appropriately determined. For example, it can be used in the range of 1 pg / mL to 10 ng / mL, preferably 0.5 ng / mL to 5 ng / mL.

[0116] <C1q>

[0117] C1q is one of the complements. One of the complement activation pathways is the classical pathway, and C1q is a factor that serves as the starting point of the pathway. The method for achieving the culture condition "in the presence of C1q" is not particularly limited, and it can be achieved, for example, by adding C1q to the culture medium, co-culturing with C1q-producing cells, or adding the culture supernatant of C1q-producing cells.

[0118] The concentration of C1q is not particularly limited and may be appropriately determined. For example, it can be used in the range of 10 ng / mL to 10 μg / mL, preferably 50 ng / mL to 300 ng / mL.

[0119] <Cultivation of human astrocytes>

[0120] The culture of human astrocytes in the present invention can be carried out by selecting a culture medium, temperature, and other conditions based on the source and state of the human astrocytes used, and in the presence of the above-mentioned various cytokines and / or complement. As long as it does not interfere with the culture of human astrocytes in the present invention, the culture medium may contain components other than the above-mentioned various cytokines and / or complement. The culture medium can be selected from a known culture medium or a commercially available culture medium. For example, MEM (minimum essential medium), DMEM (Dulbecco's modified Eagle medium), DMEM / F12, or a culture medium modified from these, which are conventional culture media, can be added with appropriate components (serum, protein, amino acids, sugars, vitamins, fatty acids, antibiotics, etc.) and used. As a culture medium, a culture medium that does not contain serum (serum-free culture medium) is preferably used.

[0121] As culture conditions, it is sufficient to select the conditions for normal cell culture. Examples include conditions of 37°C and 5% CO2. During the culture, the culture medium is preferably replaced at appropriate intervals (preferably once every 1 to 7 days, more preferably once every 2 to 3 days). When human astrocytes are used as materials and the method of the present invention is implemented, human A1 astrocytes are grown under conditions of 37°C and 5% CO2 for 1 day to 1 week.

[0122] Cell culture containers such as plates, dishes, cell culture inserts, cell culture flasks, and cell culture bags can be used in the culture of somatic cells. In addition, as cell culture bags, preferably have air permeability. When a large number of cells are required, large culture tanks can be used. Cultivation can be implemented in an open system or a closed system.

[0123] In the method of the present invention, human A1 astrocytes can be produced by culturing human astrocytes in a medium containing the above-mentioned various cytokines and / or complement.

[0124] <Human A1 astrocytes and evaluation method of test substances using human A1 astrocytes>

[0125] According to the present invention, there is provided isolated human A1 astrocytes obtained by the method for producing human A1 astrocytes according to the present invention.

[0126] The human A1 astrocytes produced by the method of the present invention can also be used for screening of candidate pharmaceutical compounds that act on human A1 astrocytes or for safety evaluation of candidate pharmaceutical compounds.

[0127] According to the present invention, a method for evaluating a test substance comprising contacting the human A1 astrocytes of the present invention with a test substance can be provided. For example, after contacting the human A1 astrocytes with the test substance, the test substance can be evaluated by evaluating the changes in the neuron barrier properties of the human A1 astrocytes. The changes in the neuron barrier properties of the human A1 astrocytes can be evaluated, for example, by co-culturing human A1 astrocytes with neurons according to the method described in the Examples described below, and utilizing the barrier effect on neurons.

[0128] The present invention will be specifically described by the following examples, but the present invention is not limited to the scope of the examples.

[0129] Example

[0130] Experimental Example 1: Induction of human astrocytes into human A1 astrocytes

[0131] (1) Human astrocytes

[0132] (1-1) Astrocytes derived from human iPS cells

[0133] Human astrocytes were purchased and used as iCell (registered trademark) Astrocytes (CDI, ASC-100-020-001-PT), which are human iPS cell-derived astrocytes from Cellular Dynamics International Japan Co., Ltd. iCell (registered trademark) Astrocytes were confirmed to be human astrocytes other than human A1 astrocytes based on their appearance.

[0134] (1-2) Astrocytes induced from astrocyte precursor cells

[0135] In addition, human astrocytes were obtained by inducing commercially available human astrocyte precursor cells (Axol Bioscience, AX0083) under conditions such as the kit attachment method. The induced human astrocytes were confirmed to be human astrocytes other than human A1 astrocytes based on their appearance.

[0136] (1-3) Primary cultured astrocytes from humans

[0137] Furthermore, commercially available primary cultured human astrocytes (LONZA, CC-2565) were also used.

[0138] (2) Induction of human A1 astrocytes

[0139] Induction into human A1 astrocytes was performed by induction method 1 in Examples 1 to 4 and Comparative Examples 1 to 4, and by induction method 2 in Example 5. In Examples 6 and 7, induction method 3 was performed.

[0140] Induction method 1

[0141] Matrigel (registered trademark) basement membrane matrix (Corning, 356234) diluted 120 times with DMEM (Life technologies, 11960-044) was added to a 6-well plate at 1.5 mL / well and allowed to stand at 4° C. After 24 hours, the medium was replaced with the following serum-free medium.

[0142] Composition of serum-free medium

[0143] Neurobasal (registered trademark) medium (50%, Life technologies, 21103049)

[0144] DMEM (50%)

[0145] Penicillin / Streptomycin (×100) (1×, Life technologies, 15140-122)

[0146] Sodium pyruvate (1 mM, Life technologies, 11360-070)

[0147] L-glutamine (sodium glutamate) (292 μg / mL, Life technologies, 25030-081)

[0148] N2 Supplement with Transferrin (Apo) (1×, Wako, 141-09041) N-acetyl cysteine ​​(5μg / mL, Sigma-Aldrich, A8199)

[0149] HBEGF(5ng / mL,Peprotech,100-47)

[0150] iCell (registered trademark) astrocytes were suspended in serum-free medium at 30×10 4 Cells were seeded into 6-well plates at a density of 10 cells / well and cultured at 37°C, 5% CO2 for 24 hours.

[0151] The above-mentioned astrocytes were replaced with a culture medium prepared by adding 2 to 5 of the compounds listed in Table 1 (TNFα (Cell Signaling Technology, 8902SC), IFNγ (R&D Systems, 285-IF), IL-1α (Sigma-Aldrich, SRP3310), IL-1β (R&D Systems, 201-LB), C1q (MyBioSource, MBS143105)) to a serum-free culture medium, and cultured at 37°C and 5% CO2 for 1 day.

[0152] Induction method 2

[0153] Matrigel (registered trademark) basement membrane matrix (Corning, 356234) diluted 120-fold with DMEM (Life technologies, 11960-044) was added to a 96-well plate at 65 μL / well and allowed to stand at 4° C. After 24 hours, the medium was replaced with the same serum-free medium as in induction method 1.

[0154] iCell (registered trademark) astrocytes were suspended in serum-free medium at 3x10 4 Cells were seeded into 96-well plates at a density of 1.5 cells / well and cultured at 37°C and 5% CO2 for 24 hours.

[0155] The astrocytes were replaced with a serum-free medium supplemented with two of the compounds listed in Table 1, and cultured at 37°C and 5% CO2 for 1 day.

[0156] Induction method 3

[0157] Matrigel (registered trademark) basement membrane matrix (Corning, 356234) diluted 120 times with DMEM (Life technologies, 11960-044) was added to a 96-well plate at 65 μL / well and allowed to stand at 4° C. and used after 24 hours.

[0158] In Example 6, astrocytes induced from commercially available human astrocyte precursor cells were cultured at 3×10 4 The cells were seeded at a density of 3 x 104 cells / well on a 96-well plate and cultured at 37°C, 5% CO2 for 24 hours. In Example 7, primary cultured human astrocytes were seeded at a density of 3 x 104 cells / well on a 96-well plate and cultured at 37°C, 5% CO2 for 24 hours.

[0159] The astrocytes were replaced with a medium supplemented with two of the compounds listed in Table 1, and cultured at 37°C and 5% CO2 for 1 day.

[0160] Immunostaining

[0161] In Example 6, GFAP staining as a marker of astrocytes was performed by immunostaining. 80% ethanol was added to astrocytes induced from human astrocyte precursor cells induced by induction method 3 at 100 μL / well and fixed at -30°C for 24 hours. After washing three times with PBS, a compound (1% BSA) prepared by adding 1% BSA to PBS was added for blocking, and cells prepared by diluting the primary antibody (Millipore, MAB3402) 3000 times in 1% BSA were treated at 4°C for 24 hours. After washing three times with PBS, cells prepared by diluting the secondary antibody (ThermoFisher Scientific, A11005) 1000 times in 1% BSA were treated for 1 hour at room temperature. After washing three times with PBS, images were obtained by photographing using IncuCyte S3 (Essen BioScience, 4647).

[0162] [Table 1]

[0163] Table 1: (The unit of the values ​​in the table is ng / mL)

[0164] TNFα IFNγ IL-1α IL-1β Q1 Example 1 7.5 5 0.75 2.5 100 Example 2 7.5 5 0.75 2.5 Example 3 7.5 5 0.75 100 Example 4 7.5 5 2.5 100 Example 5 7.5 5 Example 6 7.5 5 Example 7 7.5 5 Comparative Example 1 7.5 0.75 2.5 100 Comparative Example 2 5 0.75 2.5 100 Comparative Example 3 5 2.5 Comparative Example 4 7.5 0.75 100

[0165] (3) Evaluation of cell morphology

[0166] The morphology of the cultured cells was observed using a microscope or by taking images. Figure 1 , Figure 2 . And, from Figure 1 , Figure 2 The results of the morphological evaluation are shown in the following table. The morphological judgment was performed by selecting 10 typical cells / angle and comparing the major axis and minor axis. Cells with a major axis / minor axis ratio of less than 10 were defined as hypertrophic, cells with a major axis / minor axis ratio of more than 10 and a fibrous shape were defined as fibrous, and cells with a major axis / minor axis ratio of more than 10 and a shape with multiple protrusions were defined as star-shaped. The numerical values ​​of the major axis / minor axis evaluation results are shown in Figure 1 , Figure 2 .exist Figure 2 The cells enlarged and shown in the box are typical star-shaped (left side of the figure) and hypertrophic (right side of the figure) cells.

[0167] [Table 2]

[0168] Cell morphology Example 1 All are hypertrophic Example 2 All are hypertrophic Example 3 All are hypertrophic Example 4 All are hypertrophic Example 5 All are hypertrophic Example 6 All are hypertrophic Comparative Example 1 Fiber type, star type Comparative Example 2 Fiber type, star type Comparative Example 3 Fiber type, star type Comparative Example 4 Fiber type, star type

[0169] from Figure 1 , Figure 2From Table 2, it is known that in Examples 1 to 6, almost all cells showed the characteristic hypertrophic morphology of human A1 astrocytes. On the other hand, in Comparative Examples 1 to 4, it is known that there were no cells showing the hypertrophic morphology or there were very few cells.

[0170] (4) Evaluation of mRNA expression

[0171] The amount of gene expressed by the cultured cells was measured by quantitative PCR (Polymerase chain reaction). Quantitative PCR was performed by quantitative PCR method 1 in Examples 1 to 4 and Comparative Examples 1 to 4, and by quantitative PCR method 2 in Examples 5 to 7.

[0172] Quantitative PCR method 1

[0173] Total RNA was extracted from cells one day after induction. RNeasy (registered trademark) mini kit (Qiagen, 74104) was used for extraction of Total RNA according to the package instructions. PrimeScript (registered trademark) RT reagent Kit with gDNA Eraser (Perfect RealTime) (Takara Bio Inc., RR047A) was used for reverse blotting of Total RNA according to the package instructions. TB Green Premix ExTaqII (Tli RNaseH Plus) (Takara Bio Inc., RR820B) was used for quantitative PCR according to the attached protocol. Mx3005P (Stratagene) was used in the cycle program to perform one cycle at 95°C for 30 seconds, and 45 cycles at 95°C for 5 seconds and 60°C for 30 seconds. The sequences of the primers are as follows.

[0174] GBP2 forward primer: tttcaccctggaactggaag (SEQ ID NO: 1)

[0175] Reverse primer: gacgaagcacttcctcttgg (SEQ ID NO: 2)

[0176] CXCL10 forward primer: ccacgtgttgagatcattgc (SEQ ID NO: 3)

[0177] Reverse primer: cctctgtgtggtccatcctt (SEQ ID NO: 4)

[0178] GAPDH

[0179] Forward primer: gtcagtggtggacctgacct (SEQ ID NO: 5)

[0180] Reverse primer: tgctgtagccaaattcgttg (SEQ ID NO: 6)

[0181] Quantitative PCR method 2

[0182] According to the package instructions, the FastLane cell Multiplex NR Kit (Qiagen, 216513) was used to quantify mRNA from cells 1 day after induction. Primers and fluorescent probes were synthesized using the Dual Labeled Probe Design Kit (Takara Bio Inc.). In the cycle program, the CFX384 Touch Real-Time PCR Analysis System (Bio-Rad) was used to perform one cycle at 50°C for 20 minutes and 95°C for 15 minutes, and 45 cycles at 94°C for 45 seconds and 60°C for 75 seconds. The sequences of primers and fluorescent probes are shown below.

[0183] C3 probe: 5'-(FAM)CACAGCGGCACAGTTCATCACGGCA(BHQ1)-3'

[0184] (Serial No. 7)

[0185] Forward primer: GCCTATTACAACCTGGAGGAAAG (SEQ ID NO: 8)

[0186] Reverse primer: GTGACCTTGTCATCCGACTTTTG (SEQ ID NO: 9)

[0187] CXCL10 probe: 5'-(Cyanine5)TCTGACTCTAAGTGGCATTCAAGGAGTACCT(BHQ1)-3' (SEQ ID NO: 10)

[0188] Forward primer: GCCATTCTGATTTGCTGCCTTA (SEQ ID NO: 11)

[0189] Reverse primer: ACAGGTTGATTACTAATGCTGATGC (SEQ ID NO: 12)

[0190] GAPDH probe: 5'-(HEX)CATCAGCAATGCCTCCTGCACCACCAA(BHQ1)-3' (SEQ ID NO: 13)

[0191] Forward primer: GAACCATGAGAAGTATGACAACAGC (SEQ ID NO: 14)

[0192] Reverse primer: TGGGTGGCAGTGATGGCA (SEQ ID NO: 15)

[0193] GAPDH was used as an internal standard and the mRNA expression level was quantified by the ΔΔCt method (comparative Ct method). The results are shown in Figure 3 , Figure 4 , Figure 5 and Figure 6 .

[0194] from Figure 3 It was found that GBP2 and CXCL10 were sufficiently expressed in Examples 1 to 4. On the other hand, it was found that GBP2 and CXCL10 were hardly expressed in Comparative Examples 1 to 4, or even if expressed, they were less than those in the Examples. Figure 4 It is known that the expression of C3 is increased by stimulation in Examples 1 and 5. Figure 5 , Figure 6 It was found that in Examples 6 and 7, the expression of C3 was increased by stimulation.

[0195] Experimental Example 2: Co-culture of human A1 astrocytes and neural cells

[0196] (1) Seeding of human astrocytes on cell culture inserts

[0197] As human astrocytes, iCell (registered trademark) astrocytes were used in the same manner as in Experimental Example 1.

[0198] Matrigel (registered trademark) diluted 120 times with DMEM was added to the cell culture insert (Corning, 353104) at 100 μL / well and left to stand at 4°C. After 24 hours, the medium was replaced with the same serum-free medium as in induction method 1. iCell (registered trademark) astrocytes were suspended in serum-free medium at 5×10 4 Cell culture inserts were seeded at a density of 15 cells / well and cultured at 37°C in 5% CO2.

[0199] After 24 hours, the medium was replaced with serum-free medium or a medium prepared by adding IL-1α (0.75 ng / mL), TNFα (7.5 ng / mL), C1q (100 ng / mL), IL-1β (2.5 ng / mL), and IFNγ (5 ng / mL) to the serum-free medium.

[0200] (2) Seeding of neural cells in culture plates

[0201] Poly-L-Lysine solution (Sigma aldrich, P4707) diluted 10 times with phosphate buffer (PBS) was added to the 24-well plate at 500 μL / well and allowed to stand at room temperature. After 24 hours, iMatrix-511 (Nippi, 892012) diluted 166 times with PBS was added to the 24-well plate at 500 μL / well and incubated at 37°C for 1 hour before replacing with serum-free medium.

[0202] According to the method described in WO2014 / 148646A1, iPS cells were differentiated into neural cells by forced expression of Neurogenin 2. The obtained neural cells were suspended in serum-free medium at 10×10 4 Cells were seeded at a density of 10 cells / well in 24-well plates and cultured at 37°C and 5% CO2.

[0203] (3) Co-culture with neural cells

[0204] The culture medium of the cell culture insert seeded with human astrocytes and the culture plate seeded with neural cells was replaced with serum-free medium or serum-free medium supplemented with 5 compounds, and combined co-culture was started. As a control, neural cell single culture was also started at the same time. After culturing for 5 days at 37°C and 5% CO2, the state of the neural cells was observed. The results are shown in Figure 7 .

[0205] It was found that human astrocytes replaced with serum-free medium protected neurons, and compared with neurons alone, the number of live cells in the co-cultured neurons was large, and the neurites were also strong. On the other hand, human astrocytes replaced with serum-free medium supplemented with 5 compounds showed neurotoxicity, and compared with neurons co-cultured with astrocytes replaced with serum-free medium, the number of dead cells in the co-cultured neurons was larger, and the number of live cells and neurites was reduced.

[0206] (4) Quantitative evaluation of neuronal cell death

[0207] After 5 days of co-culture, live cells were quantitatively evaluated by WST test and calculation of live cell counts. The WST test was evaluated using Cell Counting Kit-8 (DOJINDO LABORAT ORIES, CK04). After removing the cell culture insert, 50 μL of Cell Counting Kit solution was added to the culture plate, and a color reaction was performed for 1 to 4 hours at 37°C and 5% CO2. Afterwards, the absorbance of 100 μL of the reaction solution at 450 nm and 650 nm was measured using an ELISA reader, and the value obtained by subtracting the value of 650 nm from the value of 450 nm was quantified. The sample after the WST test was used and the number of live cells was evaluated using Cellstain (registered trademark) CytoRed solution (DOJINDO LABORAT ORIES, C410) and IncuCyte (registered trademark) S3 (Essen BioScience, 4647). 0.5 μL of 1 mmol / L CytoRed solution was added to the culture plate, and a color development reaction was performed at 37°C and 5% CO 2 for 30 minutes to 2 hours to stain the living cells. Thereafter, the number of living cells was counted using IncuCyte (registered trademark) S3.

[0208] The results are shown in Figure 8 .

[0209] The WST test and the quantitative results of the number of live cells confirmed that the number of live cells of the neurons co-cultured with human astrocytes replaced with serum-free medium was greater than that of the neurons alone. On the other hand, it was confirmed that the number of live cells of the neurons co-cultured with human astrocytes replaced with serum-free medium supplemented with 5 compounds was reduced compared with the neurons co-cultured with astrocytes replaced with serum-free medium.

[0210] Test Example 3: Neurological impairment of various human astrocytes

[0211] (1) Seeding of astrocytes induced from human astrocyte precursor cells

[0212] Matrigel (registered trademark) basement membrane matrix (Corning, 356234) diluted 120 times with DMEM (Life technologies, 11960-044) was added to a 96-well plate at 65 μL / well and allowed to stand at 4°C. After 24 hours, 5×10 4 Astrocytes induced from commercially available human astrocyte precursor cells were seeded at a density of 1.544 cells / well.

[0213] (A) No stimulation, stimulation with (B) TNFα (7.5 ng / mL), IFNγ (5 ng / mL), or stimulation with (C) TNFα (7.5 ng / mL), IL-1α (0.75 ng / mL), C1q (100 ng / mL), and neural cells were seeded 48 hours later.

[0214] (2) Seeding of neural cells in culture plates

[0215] According to the method described in WO2014 / 148646A1, iPS cells were differentiated into neural cells by forced expression of Neurogenin2. The obtained neural cells were cultured at 3×10 4 The astrocytes were seeded at a density of 10 cells / well after A1 induction and cultured at 37°C and 5% CO2 for 3 days.

[0216] (3) Immunostaining

[0217] 80% ethanol was added to the cells cultured for 3 days at 100 μL / well and fixed at -30°C for 24 hours. After washing with PBS three times, 1% BSA was added for blocking, and the cells were treated with a primary antibody (covance, MRB-435P) diluted 2000 times in 1% BSA at 4°C for 24 hours. After washing with PBS three times, the cells were treated with a secondary antibody (Thermo Fisher Scientific, A11008) diluted 1000 times in 1% BSA at room temperature for 1 hour. After washing with PBS three times, images were obtained by taking pictures using IncuCyte S3 (Essen BioScience, 4647). The results are shown in Fig. 9 .

[0218] Compared with the neurons co-cultured with (A) unstimulated human astrocytes, (B) stimulated human astrocytes, and (C) stimulated human astrocytes, the neurons co-cultured with (B) showed a decrease in neurites. Sequence Listing <110> Fujifilm Corporation <120> Method for producing human A1 astrocytes, human A1 astrocytes, and method for evaluating test substances <130> 18F01625W1 <160> 15 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 1 tttcaccctg gaactggaag 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 2 gacgaagcac ttcctcttgg 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 3 ccacgtgttg agatcattgc 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 4 cctctgtgtg gtccatcctt 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 5 gtcagtggtg gacctgacct 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 6 tgctgtagcc aaattcgttg 20 <210> 7 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 7 cacagcggca cagttcatca cggca 25 <210> 8 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 8 gcctattaca acctggagga aag 23 <210> 9 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 9 gtgaccttgt catccgactt ttg 23 <210> 10 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 10 tctgactcta agtggcattc aaggagtacc t 31 <210> 11 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 11 gccattctga tttgctgcct ta 22 <210> 12 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 12 acaggttgat tactaatgctgatgc 25 <210> 13 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 13 catcagcaat gcctcctgca ccaccaa 27 <210> 14 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 14 gaaccatgag aagtatgaca acagc 25 <210> 15 <211> 18 <212> DNA <213> Artificial sequence <220> <223> Description of artificial sequences: Oligonucleotides <400> 15 tgggtggcag tgatggca 18

Claims

1. A method for producing human A1 astrocytes, comprising the step a of culturing human astrocytes other than human A1 astrocytes in the presence of TNFα and IFNγ, The step a is culturing in a serum-free medium, The human astrocytes other than human A1 astrocytes are astrocytes derived from human iPS cells, astrocytes induced from human astrocyte precursor cells, or primary cultured astrocytes derived from humans, In the step a, the concentration of TNFα in the culture medium is 7.5 ng / mL to 10 ng / mL, In the step a, the concentration of IFNγ in the culture medium is 5 ng / mL to 10 ng / mL. 2 . The method for producing human A1 astrocytes according to claim 1 , wherein the step a is further performed in the presence of at least one cytokine selected from the group consisting of IL-1α, IL-1β and C1q and / or complement. 3 .

3. The method for producing human A1 astrocytes according to claim 1 or 2, wherein the step a is performed in the presence of any of the following: (1) TNFα, IFNγ, IL-1α, IL-1β; (2) TNFα, IFNγ, IL-1α, C1q; (3) TNFα, IFNγ, IL-1β, C1q; (4) TNFα, IFNγ, IL-1α, IL-1β, C1q; (5)TNFα, IFNγ.

4. The method for producing human A1 astrocytes according to claim 1 or 2, wherein: The process a comprises: Step a1, differentiating human iPS cells or human astrocyte precursor cells into human astrocytes other than human A1 astrocytes; and Step a2 is to culture the human astrocytes other than the human A1 astrocytes obtained in step a1 in the presence of TNFα and IFNγ.

5. The method for producing human A1 astrocytes according to claim 1 or 2, wherein: In the step a, the ratio of the concentration of TNFα in the culture medium to the concentration of IFNγ in the culture medium is 2:1 to 1:1.

Images