Three pairs of sgRNAs specifically identifying porcine GDF11 gene and their applications

Abstract

The present invention belongs to the field of animal genome editing technology, and specifically relates to three pairs of sgRNAs that specifically recognize the pig GDF11 gene and their applications. The present invention utilizes the CRISPR / Cas9 system to knock out the sgRNA guide sequence of the pig GDF11 gene, and the specific sgRNA guide sequence targets the start codon ATG of the TGFB region of the pig GDF11 gene. By combining the sgRNA guide sequence provided by the present invention with the CRISPR / Cas9 system, the editing or knockout of the TGFB region of the GDF11 gene in pigs can be achieved, thereby achieving the marking or low expression of the GDF1 gene, laying the foundation for the preparation of GDF11 transgenic pigs.

Description

Technical Field

[0001] The present invention belongs to the field of animal genome editing technology, and specifically relates to an sgRNA sequence and its application for knocking out the porcine GDF11 gene using the CRISPR / Cas9 system. The present invention specifically relates to an sgRNA guide sequence and its application near the start codon ATG of the TGFB region of the porcine GDF11 gene. Background Art

[0002] Clustered regularly interspaced short palindromic repeats (CRISPR), an adaptive immune system from microorganisms, targets selected genomic sites through a short single-stranded guide RNA (sgRNA). This editing tool has quickly become the hottest technology in the biological science community with its convenience, low cost, and precision. After cutting the genome through the CRISPR / Cas9 system, it can not only be repaired by nonhomologous end joining (NHEJ) to obtain base deletions or insertions near the cutting site, but also can achieve site mutations and insertion and knockout of target fragments through homology-directed repair (HDR). Compared with ZFN and TALEN, CRISPR-Cas9 has a low probability of NHEJ, high efficiency of site-directed mutagenesis, and high efficiency of inducing biallelic genes, which can not only improve HDR efficiency, but also avoid the potential danger of off-target effects. So far, CRISPR technology has been applied in various fields. We can use this gene editing method to study gene function and construct animal disease models.

[0003] Growth differentiation factor 11 (GDF11, BMP11) belongs to the TGF-β superfamily, the myostatin / GDF11 subfamily and the BMP subfamily. It is a bone morphogenetic protein that plays an important role in early embryonic development and plays an important regulatory role in early embryonic development and the development of many tissues and organs. It plays a key role in the formation of the axial skeleton and the appendicular skeleton in vertebrates. Homozygous mice with GDF11 gene deletion show axial skeletal pattern defects accompanied by kidney and olfactory abnormalities; GDF11 gene knockout mice show elongated trunks and shortened or missing tails. Given the regulatory role of GDF11 in axial skeleton development, the increased number of thoracic and lumbar vertebrae in GDF11 gene knockout mice, and the conservation of the genome in evolution, it is speculated that the GDF11 gene is very likely to have the same regulatory role in pigs. There is variation in the number of thoracic and lumbar vertebrae in pigs, and the number of lumbar vertebrae in pigs has a high genetic correlation with carcass length (correlation coefficient is 0.75). The selection of multiple thoracic and lumbar vertebrae traits has important economic significance and application value for improving the quality of commercial pigs. By using the CRISPR / Ca9 system to modify the porcine GDF11 gene, the function of the GDF11 gene is studied in vivo and in vitro, which is of great significance for studying the function of the GDF11 gene in the development of pigs and the mechanism by which it works. The first step to obtain GDF11 transgenic animals is to find an sgRNA that can specifically target GDF11, that is, the sgRNA is used in combination with CRISPR / Cas9 to edit the target site. The present invention provides an sgRNA sequence that specifically targets the porcine GDF11 gene, laying the foundation for studying the functional mechanism of porcine GDF11 and preparing GDF11 transgenic pigs.

[0004] Currently, there are relatively few studies on GDF11 in mammals such as pigs. [1] , and finally obtain GDF11 gene knockout pigs or traceable transgenic pigs. The first step is to find sgRNA that can specifically target GDF11, and use sgRNA in combination with the CRISPR / Cas9 system to achieve targeted editing.

[0005] The present invention provides three pairs of sgRNA guide sequences that specifically target the porcine GDF11 gene. By combining these three guide sequences with the CRISPR / Cas9 system, not only can the random deletion or insertion of bases near the start codon ATG of exon 3 of the porcine GDF11 gene be caused by the non-homologous end repair mechanism, thereby causing the transcription and translation disorder of the GDF11 gene, and then studying the effect of the GDF11 gene deletion on the muscle development of the pig. Alternatively, by homologous recombination, the genome is recombined using an exogenously introduced template, and the target fragment can be inserted or knocked out upstream and downstream of the GDF11 gene ATG, thereby achieving the tracking of the GDF11 gene, thereby further studying the whereabouts of GDF11-labeled cells in pigs. The determination of the sgRNA guide sequence that specifically targets the position near the start codon ATG of exon 3 of the porcine GDF11 gene lays the foundation for studying the functional mechanism of the porcine GDF11 gene and preparing GDF11 transgenic pigs, and is of great significance for studying the function of the gene in the development process of pigs and the mechanism of its function. Summary of the invention

[0006] The purpose of the present invention is to overcome the defects of the prior art. In order to more conveniently produce and study GDF11 transgenic pigs, the main purpose of the present invention is to provide a sgRNA guide sequence and its application that can specifically target the start codon ATG near the TGFB region of the pig GDF11 gene. The guide sequence can be used for targeted modification of the TGFB region of the pig GDF11 gene, laying the foundation for the preparation of transgenic pigs.

[0007] The technical solution of the present invention is as follows:

[0008] (1) The present invention designs a sgRNA guide sequence that specifically targets the TGFB region of the porcine GDF11 gene, which is located near the start codon ATG of exon 3 of the GDF11 gene. The nucleotide sequence of the sgRNA guide sequence is shown in SEQ ID NO: 1 (see sequence SEQ ID NO: 1 in the "Specific Implementation Method", the initial bold word is the start codon "ATG").

[0009] (2) In view of the target sequence on the porcine GDF11 gene, the present invention designed four sgRNAs, and through screening, it was found that three sequences could specifically target the sgRNA near the start codon ATG of exon 3 of the porcine GDF11 gene. The applicant named these three sequences GDF11-sgRNA1 (SEQ ID NO: 2), GDF11-sgRNA2 (SEQ ID NO: 3), GDF11-sgRNA3 (SEQ ID NO: 4) and GDF11-sgRNA4 (SEQ ID NO: 5), respectively.

[0010] (3) When performing specific targeting verification, the present invention designed a pair of identification primers, and obtained a DNA fragment by specific amplification using the primers, and the fragment was named GDF11-ATG (i.e., the sequence shown in SEQ ID NO: 6).

[0011] The advantage of the present invention is that the targeting sequence is selected near the start codon ATG of exon 3 of the GDF11 gene. As long as the sgRNA targeting is successful, the transcription and translation of the GDF11 gene will be affected, thereby achieving effective modification and mutation of the GDF11 gene.

[0012] The experiment of the present invention proves that the present invention provides three sgRNAs that specifically target the ATG near the start codon of exon 3 of the pig GDF11 gene, which have strong specificity. When performing gene modification, it can effectively reduce CRISPR / Cas9 (please refer to the literature for the CRISPR / Cas9 system) [2] System-induced off-target phenomena. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 : Sequencing results of four pX330 vectors containing sgRNAs. Explanation of the accompanying figures: sgRNA1 is a Px330 vector containing GDF11-sgRNA1; sgRNA2 is a Px330 vector containing GDF11-sgRNA2; sgRNA3 is a Px330 vector containing GDF11-sgRNA3; sgRNA4 is a Px330 vector containing GDF11-sgRNA4.

[0014] Figure 2 : Sequencing results after plasmid transfection into cells. Explanation of the accompanying symbols: sgRNA1 is the DNA fragment GDF11-ATG obtained after the Px330 vector containing GDF11-sgRNA1 was transfected into cells; sgRNA2 is the DNA fragment GDF11-ATG obtained after the Px330 vector containing GDF11-sgRNA2 was transfected into cells; sgRNA3 is the DNA fragment GDF11-ATG obtained after the Px330 vector containing GDF11-sgRNA3 was transfected into cells; sgRNA4 is the DNA fragment GDF11-ATG obtained after the Px330 vector containing GDF11-sgRNA4 was transfected into cells, and the negative control control obtained after the NC plasmid (empty plasmid) was transfected into cells.

[0015] Figure 3 : Plasmid vector map. Figure 3 A is the Px330 vector; Figure 3 B is the Px330-GDF11-sgRNA1 vector containing GDF11-sgRNA1; Figure 3 C is a Px330-GDF11-sgRNA2 vector containing GDF11-sgRNA2; FIG3D is a Px330-GDF11-sgRNA1 vector containing GDF11-sgRNA3; Figure 3 E is the Px330-GDF11-sgRNA4 vector containing GDF11-sgRNA4. DETAILED DESCRIPTION

[0016] Description of the sequence listing:

[0017] The base sequence direction is all 5' to 3'

[0018] Sequence Listing SEQ ID NO: 1 is the first DNA fragment cloned in the present invention:

[0019] ATGGAGCTTCGAGTCCTAGAGAACACAAAACGGTCTCGGCGGAACCTG, the start codon is shown in bold in the sequence.

[0020] Sequence Listing SEQ ID NO: 2 is sgRNA1, the sequence is as follows:

[0021] GTCTCGGCGGAACCTGGGTC

[0022] Sequence Listing SEQ ID NO: 3 is sgRNA2, the sequence is as follows:

[0023] GCTCATCGCAGTCCAGACCC

[0024] Sequence Listing SEQ ID NO: 4 is sgRNA3, the sequence is as follows:

[0025] GCTGCCGATATCCCCTCACAG

[0026] Sequence Listing SEQ ID NO: 5 is sgRNA4, the sequence is as follows:

[0027] ACAGTGGACTTTGAGGCATT

[0028] Sequence Listing SEQ ID NO:6 is a DNA fragment cloned by the present invention, and the sequence is as follows:

[0029] TTGAGGGGCAGGTGACAAAAGAGCAGGGAGTGGGAGCTCTTCAGGGCTCTCTCACATGTCTTTCTTCTCTCCCTCACCCC AGCATCCTTTCATGGAGCTTCGAGTCCTAGAGAACACAAAACGGTCTCGGCGGAACCTGGGTCTGGACTGCGATGAGCACTCAAGTGAGTCCCGCTGCTGCCGATATCCCCTCACAGTGGACTTTGAGGCATTTGGCTGGGACTGGATCATCGCACCTAA ACGCTACAAGGCCAACTACTGCTCTGGCCAGTGCGAGTACATGTTCATGCAAAAGTACCCGCACACCCACTTGGTGCAACAGGCTAATCCAAGAGGCTCTGCTGGGCCCTGCTGTACCCCCACCAAGATGTCCCCAATCAACATGCTCTACTTCAATGAC AAGCAGCAAATTATCTACGGCAAGATCCCTGG

[0030] Oligonucleotide sequences corresponding to the four sgRNAs (two primers that form the sgRNA sequences);

[0031] Sequence Listing SEQ ID NO: 7 is the left primer of the two primers of the sgRNA1 sequence, and the sequence is as follows:

[0032] GDF11-sgRNA1-F:CACCGTCTCGGCGGAACCTGGGTC

[0033] Sequence Listing SEQ ID NO: 8 is the right primer of the two primers of the sgRNA1 sequence, and the sequence is as follows:

[0034] GDF11-sgRNA1-R:AAACGACCCAGGTTCCGCCGAGAC

[0035] Sequence Listing SEQ ID NO: 9 is the left primer of the two primers of the sgRNA2 sequence, and the sequence is as follows:

[0036] GDF11-sgRNA2-F:CACCGCTCATCGGAGTCCCAGACCC

[0037] Sequence Listing SEQ ID NO: 10 is the right primer of the two primers of sgRNA2 sequence, and the sequence is as follows:

[0038] GDF11-sgRNA2-R:AAACGGGTCTGGACTGCGATGAGC

[0039] Sequence Listing SEQ ID NO: 11 is the left primer of the two primers of the sgRNA3 sequence, and the sequence is as follows:

[0040] GDF11-sgRNA3-F:CACCGCTGCCGATATCCCCTCACAG

[0041] Sequence Listing SEQ ID NO: 12 is the right primer of the two primers of sgRNA3 sequence, and the sequence is as follows:

[0042] GDF11-sgRNA3-R:AAAACCTGTGAGGGGATATCGGCAGC

[0043] Sequence Listing SEQ ID NO: 13 is the left primer of the two primers of the sgRNA4 sequence, and the sequence is as follows:

[0044] GDF11-sgRNA4-F:CACCGACAGTGGACTTTGAGGCATT

[0045] Sequence Listing SEQ ID NO: 14 is the right primer of the two primers of sgRNA4 sequence, and the sequence is as follows:

[0046] GDF11-sgRNA4-R:AAACAATGCCTCAAAGTCCACTGTC

[0047] Primer sequences for sgRNA targeting identification:

[0048] Sequence Listing SEQ ID NO: 15 is the left primer among the primers for sgRNA targeting identification, and the sequence is as follows:

[0049] GDF11-ATG-F: AGGAAAGAAAGAGATCGCAGCA

[0050] Sequence Listing SEQ ID NO: 16 is the right primer in the primers for sgRNA targeting identification, and the sequence is as follows:

[0051] GDF11-ATG-R:ACAGCCGAGAAAGTAGCAGA

[0052] The preferred embodiments of the present invention will be described in detail below with reference to the examples. Unless otherwise specified, the test methods used in the following examples are all conventional methods in the art.

[0053] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0054] The present invention downloads the nucleotide sequence of the porcine GDF11 gene from the NCBI database, analyzes the sequence, and designs and screens sgRNA near the start codon ATG of exon 3 of the porcine GDF11 gene according to the design principle of sgRNA in CRISPR / Ca9, and finally screens and obtains three sgRNAs with specific targeting. The present invention is described below by taking the four sgRNAs designed by the present invention as an example.

[0055] Example 1 Acquisition of sgRNA

[0056] According to the genomic sequence of the porcine GDF11 gene (accession number AEMK02000033.1), four GDF11-sgRNAs were designed near the start codon ATG of exon 3, and the CACC base was added to the 5' end to obtain the GDF11-sgRNA-F primer sequence; at the same time, the corresponding DNA complementary chain was obtained according to the guide sequence, and the AAAC base was added to the 5' end to obtain the GDF11-sgRNA-R primer sequence; the above-mentioned GDF11-sgRNA-F and GDF11-sgRNA-R were synthesized separately, and the two synthesized oligonucleotides were placed in: 95°C denaturation for 10 min, 65°C annealing for 50 min, to form double-stranded DNA with sticky ends. The specific oligonucleotide sequences are shown in Table 1.

[0057] Table 1 Oligonucleotide sequences corresponding to the four sgRNAs

[0058]

[0059] Example 2 Construction of a vector expressing sgRNA

[0060] 1. Construction of linearized vector: Plasmid vector pX330 (Addgene, Figure 3 A) Digestion with BpiⅠ, the digestion system is 40uL: FastDigest enzyme BpiⅠ2uL, 10X FastDigest Buffer 4uL, plasmid 2ug, add double distilled water to 40uL. Digestion conditions: 37℃ digestion for 30min; after agarose gel electrophoresis of the digestion product, gel recovery is performed using a gel recovery kit (Omega Bio-tek). The recovery method is described in the instructions of the aforementioned kit.

[0061] 2. Ligation: The recovered pX330 after digestion was connected to the double-stranded DNA prepared in Example 1. The 10uL ligation system was: plasmid pX330 50ng, annealed double-stranded sgRNA 1uL, Solution I: 2.5uL, and made up to 10uL with double distilled water; the ligation conditions were 16°C for 60min.

[0062] 3. Transformation: The ligation product was transformed into the competent E. coli DH5α. The specific transformation method is as follows: take out the competent E. coli DH5α at -80℃ and place it on ice to dissolve; then blow it up and down with an electric pipette, take out 50uL of the competent E. coli into a new 1.5mL centrifuge tube, add 5uL of the above ligation product, mix well and place it in an ice bath for 5min; heat shock in a 42℃ water bath for 45s, and immediately place it in an ice bath for 2min; then evenly spread it all on a plate containing ampicillin antibiotics (100mg / mL, 1000X), place it upside down in a 37℃ constant temperature incubator, and culture it overnight.

[0063] 4. Screen positive colonies and perform sequencing identification: Pick a single colony obtained in step 3, perform bacterial solution PCR (95℃ 5min; 95℃ 15s; 60℃ 30s; 72℃ 15s; 72℃ 5min; 15℃ 2min, 35 cycles), and detect by agarose gel electrophoresis. Shake the qualified colonies, and send 1mL of bacterial solution to a relevant commercial sequencing company for sequencing. The sequencing primer is as follows: 5'-GCATATACGATACAAGGCTG-3'. Perform bacterial preservation and plasmid extraction on the bacterial solution samples with correct sequencing. The vectors containing four sgRNAs that were sequenced correctly were named as follows: sgRNA1 (Px330 vector containing GDF11-sgRNA1); sgRNA2 (Px330 vector containing GDF11-sgRNA2); sgRNA3 (Px330 vector containing GDF11-sgRNA3); sgRNA4 (Px330 vector containing GDF11-sgRNA4). The sequencing results are shown in Figure 1 shown.

[0064] Example 3 Specific targeting verification of four sgRNAs

[0065] (1) Cell culture and collection: 3D4-Cas9 cells (purchased from ATCC) were revived using complete culture medium and transfected after 2-3 passages. One day before transfection, 5×10 5 ~8×10 5 Cells were seeded into 6-well plates and transfected when the density reached 70%.

[0066] (2) Transfection: The specific steps of transfection were carried out according to the operating instructions of Lipo2000. The four vectors constructed in Example 2 were transfected with Lipo2000 (Invitrogen), and the cells were collected after 48 hours. The NC plasmid (empty plasmid) was used as a control.

[0067] (3) Screening of specific targeting sgRNA: According to the designed sgRNA sequence position, the identification primers were designed. The primer sequences are shown in Table 2. After 48 hours, the cell DNA was extracted and PCR amplification was performed with the identification primers. The reaction system was 30uL: ExTaq: 15uL, PF: 0.6uL, PR: 0.6uL, DNA: 60-150ng, and H2O was added to 30uL. The PCR reaction conditions were: 95°C pre-denaturation for 5min, 95°C denaturation for 30s, 60°C annealing for 30s, 72°C extension for 30s, a total of 35 cycles, and then 72°C extension for 5min. The obtained DNA fragment was named GDF11-ATG. The PCR product was recovered by a product recovery kit (purchased from Takara Biotech Dalian Co., Ltd.), and then the product was sequenced and analyzed.

[0068] (4) Sequencing analysis

[0069] The PCR recovered products were sequenced and analyzed. The sequencing results are shown in Figure 2 The results showed that the genome of cells transfected with pX330-GDF11-sgRNA1, pX330-GDF11-sgRNA2, and pX330-GDF11-sgRNA3 had a mutation in the DNA fragment GDF11-ATG ( Figure 2 The sequencing results of sgRNA1, sgRNA2 and sgRNA3 showed that there were double peaks near the PAM site), while there was no change in pX330-Pax7-sgRNA4 and the control group ( Figure 2 The sequencing results of sgRNA4 and control showed that all of them were single peaks near the PAM site).

[0070] Table 2 sgRNA specific targeting identification primers

[0071] Nucleotide sequence (5' to 3') GDF11-ATG-F AGGAAAGAAAGAGATCGCAGCA GDF11-ATG-R ACAGCCGAGAAAGTAGCAGA

[0072] In summary, the present invention successfully obtained three sgRNAs that specifically target the position near the start codon ATG of exon 3 of the porcine GDF11 gene. The targeting verification results show that the three sgRNAs all have the function of efficiently editing the GDF11 gene, providing a gene editing method for the functional study of the porcine GDF11 gene and its further application.

[0073] Main references

[0074] 1.Doudna JA, Charpentier E: The new frontier of genome engineering withCRISPR-Cas9. Science.2014,346:1077-1088

[0075] 2.Hsu PD, Lander ES, Zhang F. Development and Applications of CRISPR-Cas9 for Genome Engineering. Cell, 2014, 157: 1262-127. Sequence Listing <110> Huazhong Agricultural University <120> Three pairs of sgRNAs specifically identifying porcine GDF11 gene and their applications <141> 2020-12-12 <160> 16 <170> SIPOSequenceListing 1.0 <210> 1 <211> 48 <212> DNA <213> Pig (Sus scrofa) <220> <221> gene <222> (1) ..(48) <400> 1 atggagcttc gagtcctaga gaacacaaaa cggtctcggc ggaacctg 48 <210> 2 <211> 20 <212> DNA <213> Pig (Sus scrofa) <220> <221> gene <222> (1) ..(20) <400> 2 gtctcggcgg aacctgggtc 20 <210> 3 <211> 20 <212> DNA <213> Pig (Sus scrofa) <220> <221> gene <222> (1) ..(20) <400> 3 gctcatcgca gtccagaccc 20 <210> 4 <211> 21 <212> DNA <213> Pig (Sus scrofa) <220> <221> gene <222> (1) ..(21) <400> 4 gctgccgata tcccctcaca g 21 <210> 5 <211> 20 <212> DNA <213> Pig (Sus scrofa) <220> <221> gene <222> (1) ..(20) <400> 5 acagtggact ttgaggcatt 20 <210> 6 <211> 432 <212> DNA <213> Pig (Sus scrofa) <220> <221> gene <222> (1) ..(432) <400> 6 ttgaggggca ggtgacaaaa gagcagggag tgggagctct tcagggctct ctcacatgtc 60 tttcttctct ccctcacccc agcatccttt catggagctt cgagtcctag agaacacaaa 120 acggtctcgg cggaacctgg gtctggactg cgatgagcac tcaagtgagt cccgctgctg 180 ccgatatccc ctcacagtgg actttgaggc atttggctgg gactggatca tcgcacctaa 240 acgctacaag gccaactact gctctggcca gtgcgagtac atgttcatgc aaaagtaccc 300 gcacacccac ttggtgcaac aggctaatcc aagaggctct gctgggccct gctgtacccc 360 caccaagatg tccccaatca acatgctcta cttcaatgac aagcagcaaa ttatctacgg 420 caagatccct gg 432 <210> 7 <211> 24 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(24) <400> 7 caccgtctcg gcggaacctg ggtc 24 <210> 8 <211> 24 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(24) <400> 8 aaacgaccca ggttccgccg agac 24 <210> 9 <211> 24 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(24) <400> 9 caccgctcat cgcagtccag accc 24 <210> 10 <211> 24 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(24) <400> 10 aaacgggtct ggactgcgat gagc 24 <210> 11 <211> 25 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(25) <400> 11 caccgctgcc gatatcccct cacag 25 <210> 12 <211> 25 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(25) <400> 12 aaacctgtga ggggatatcg gcagc 25 <210> 13 <211> 25 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(25) <400> 13 caccgacagt ggactttgag gcatt 25 <210> 14 <211> 25 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(25) <400> 14 aaacaatgcc tcaaagtcca ctgtc 25 <210> 15 <211> 22 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(25) <400> 14 aaacaatgcc tcaaagtcca ctgtc 25 <210> 15 <211> 22 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(22) <400> 15 aggaaagaaa gagatcgcag ca 22 <210> 16 <211> 20 <212> DNA <213> Pig (Sus scrofa) <220> <221> primer_bind <222> (1) ..(20) <400> 16 agagccagaga aagtgagaga 20

Claims

1. An sgRNA specifically targeting the TGFB region of the porcine GDF11 gene, characterized in that: include: GDF11-sgRNA1, GDF11-sgRNA2, GDF11-sgRNA3, the sequence of GDF11-sgRNA1 is as described in SEQ ID NO.2, the sequence of GDF11-sgRNA2 is as described in SEQ ID NO.3, and the sequence of GDF11-sgRNA3 is as described in SEQ ID NO.

4.

2. Use of GDF11-sgRNA1, GDF11-sgRNA2 and GDF11-sgRNA3 and their recombinant expression vectors as described in claim 1 in constructing a porcine GDF11 gene mutation library.

Images