Method for detecting canine distemper virus based on SHERLOCK

Abstract

The invention relates to a method for detecting a canine distemper virus based on SHERLOCK. According to the method, any RPA primer group comprising RPAF1, RPAR1, RPAF2 and RPAR2, crRNA of crRNAs IVT-1Template and crRNAs IVT-2 Template are used, or a reagent prepared based on the any RPA primer group or the crRNA is used. The invention further relates to a kit for detecting the canine distemper virus based on SHERLOCK. The method for detecting the canine distemper virus based on the SHELOCK method is good in specificity and high in sensitivity, visual detection of the novel canine distemper virus can be achieved, conventional PCR detection and SHELOCK detection are conducted on a clinical sample from a treated sample, and the accuracy of detection results of the two methods is consistent.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological diagnosis, and in particular relates to a method for detecting canine distemper virus based on SHERLOCK. Background Art

[0002] Canine distemper virus (CDV) is an important pathogen of respiratory, intestinal and nervous system diseases in puppies. CDV can spread rapidly through direct contact between infected dogs and other dogs. The rapid diagnostic methods currently used at home and abroad include serological diagnostic methods based on antigen-antibody reactions and pathogen detection technologies based on nucleic acid amplification. Specifically, the ELISA technology uses the recombinant antigen of the virus as a target molecule to coat the surface of the plastic well, and then adds a blood sample to allow the specific antibodies (IgG or IgM) in it to specifically bind to the coated antigen. The rapid diagnostic methods currently used in clinical veterinary medicine are costly, have low sensitivity and poor specificity.

[0003] SHERLOCK, which consists of recombinase polymerase nucleic acid preamplification (RPA) and CRISPR-Cas13a, mainly activates the nonspecific "side-cutting activity" of lwCas13a by specifically recognizing the conserved sequence of CDV RNA through crRNA, thereby degrading the reporter RNA (EAST-SELETSKY et al., 2016; SMARGON et al., 2017). The fluorescent signal generated by the cleavage of the reporter molecule is collected by a real-time fluorescence quantitative PCR (qPCR) system or a lateral flow test strip, and its visual results are displayed. Compared with traditional detection methods, this method has great potential in the clinical detection of canine distemper virus (CDV). At present, there are no reports on the use of the SHERLOCK method in related fields. Summary of the invention

[0004] One of the purposes of the present invention is to provide an RPA primer for detecting canine distemper virus, comprising any one of the following groups:

[0005] Group 1:

[0006] Sequence 1RPAF1:

[0007] GAAATTAATACGACTCACTATAGGGATCCCCAGGGAACAAG CCTAGTATTGCTGA;

[0008] Sequence 2RPAR1:

[0009] ATAGTCAAGATGAAAACTAGCCAATCCAGCT;

[0010] Group 2:

[0011] Sequence 3RPAF2:

[0012] GAAATTAATACGACTCACTATAGGGGATTGCTGAGGACCTA TCTTTGAGGCGATT;

[0013] Sequence 4RPAR2:

[0014] CATTTCAGCAATACTAGGCTTTGTTCCCTGG.

[0015] The second aspect of the present invention is to provide a crRNA for detecting canine distemper virus, including any of the following crRNAs:

[0016] Sequences of 5crRNAs for IVT-1 Tempaltes:

[0017] ATGATTTGTGATATAGATAACTACATTGGTTTTAGTCCCCTTC GTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTT C;

[0018] Sequences of 6crRNAs for IVT-2 tempaltes:

[0019] TGGTGGCACTCATCTTGGACATCAAACGGTTTTAGTCCCCT TCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAAT TTC.

[0020] The third aspect of the present invention is to propose a canine distemper virus detection reagent based on SHERLOCK, including the above-mentioned RPA primer, the above-mentioned crRNA, and Cas13a protein, the crRNA concentration is 2-5ng / ul, and the Cas13a protein concentration is 2-4ng / ul.

[0021] The fourth aspect of the present invention is to provide a kit for detecting canine distemper virus, comprising the above-mentioned RPA primer, the above-mentioned crRNA, and the above-mentioned reagent.

[0022] The fifth aspect of the present invention is to propose a method for detecting canine distemper virus based on the SHELOCK method, wherein the method uses the above-mentioned RPA primers, the above-mentioned crRNA, or the above-mentioned reagents.

[0023] The fifth aspect of the present invention is to propose the use of the above-mentioned RPA primers, the above-mentioned crRNA, or the above-mentioned reagents in the detection of canine distemper virus by the SHELOCK method.

[0024] Compared with the prior art, the method of the present invention has better sensitivity, specificity and accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 : PCR results of target fragment in Example 3; wherein, M represents: DL2000 DNA marker; 1 represents: negative control, 2 represents: target gene;

[0026] Figure 2 :Screening of RT-RPA primers and CRISPR RNA, simple was the positive control group, and NTC was the negative control group;

[0027] Figure 3 : Screening of RT-RPA primers and CRISPR RNA assays using lateral flow strips; wherein two pairs of primers were screened with crRNA by lateral flow strips (+ positive sample input, - negative control);

[0028] Figure 4A : Exploration of the optimal final concentration of crRNA, where ns represents: P>0.05, * represents: P<0.05, ** represents: P<0.01, *** represents: P<0.001, **** represents: P<0.0001;

[0029] Figure 4B : Exploration of the optimal final concentration of Cas13a protein, where ns represents: P>0.05, * represents: P<0.05, ** represents: P<0.01, *** represents: P<0.001, **** represents: P<0.0001;

[0030] Figure 5 :Verification results of CDV method using lateral flow test strips;

[0031] Fig. 6A : Sensitivity of RT-RPA-CRISPR based lateral flow strips;

[0032] Figure 6B :Specificity of RT-RPA-CRISPR based on lateral flow strips;

[0033] Fig. 7A : PCR method to detect clinical samples;

[0034] Figure 7B :SHERLOCK method for detecting clinical samples. DETAILED DESCRIPTION

[0035] First of all, the following terms in the relevant field need to be explained.

[0036] HUDSON refers to the use of heating and chemical reduction methods to treat clinical samples to eliminate nucleases and lyse viral particles. The treated samples can be directly used as templates for RPA reactions.

[0037] RPA: Recombinase polymerase amplification is a new nucleic acid isothermal amplification technology developed by Piepenburg et al. in 2006 using protein recombination and repair involved in cell DNA synthesis. Unlike PCR, which requires an instrument for cyclic amplification, RPA operates at 37-42°C and requires only a small amount of sample preparation. It can amplify as low as 1-10 DNA copies within 10 minutes. It has the advantages of high sensitivity, selectivity, portability, rapidity, and the ability to perform multiple amplification.

[0038] PCR: Polymerase chain reaction (PCR) is a molecular biology technique used to amplify specific DNA fragments.

[0039] LF-polyU: FAM RNA biotin reporter gene, sequence is shown in Table 3.

[0040] The following examples are provided to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the methods, steps or conditions of the present invention are within the scope of the present invention.

[0041] It should be noted that in the following examples, the clinical sample of CDV virus is CDV N-CDV strain. In the following examples, the main reagents and instruments used include: Virus DNA / RNA extraction kit purchased from OMEGA BioTek, USA; Cas13a (Lwa) purchased from Guangzhou Bolais Biotechnology Co., Ltd.; HiScribe T7 Quick High Yield RNA Synthesis Kit, RNA Cleanup Kit (500 μg) and RNase inhibitor Murine were purchased from New England Biolabs; Milenia HybriDetect 1 was purchased from TwistDx; TaKaRa ExTaq was purchased from TaKaRa; RT-fluorescence nucleic acid amplification kit was purchased from Hangzhou Zhongce Biotechnology Co., Ltd.; DEPC sterile water was purchased from Beijing Solebow Technology Co., Ltd. CFX96 Touch real-time fluorescence quantitative PCR instrument was purchased from Bio-Rad, USA.

[0042] The viral DNA or RNA of CPIV, CAV 2, CHV, CHPV, CCOV and CDV were extracted according to the instructions of the viral DNA extraction kit and the viral RNA extraction kit, respectively. All extracted viral nucleic acids were stored at -80°C and avoided repeated freezing and thawing.

[0043] Example 1 Synthesis of RPA primers and crRNA

[0044] The CDV reference sequence was aligned using the bioinformatics software DNASTAR, a conserved region was selected and RPA primers were designed. To maximize amplification success, the primer length should be 25-35 nt, the total amplicon size 80-140 bp, the primers are usually designed to have a melting temperature of 54 to 67 ° C, and the T7 promoter sequence is attached to the 5' end of the RPA forward primer.

[0045] The following four principles are followed for the design of crRNA: it cannot overlap with the RPA primer sequence; it is reverse complementary to the target site in the transcribed RNA; the 28nt spacer sequence can be set at any position in the RPA amplification product; the spacer sequence is connected to the 5'direct repeat (DR) sequence to produce a complete crRNA, and its DNA template is attached with a T7 promoter sequence.

[0046] According to the design principles, two crRNAs and their corresponding two pairs of RPA primers were designed (Table 1-2). After optimization of subsequent experimental conditions and visual effect judgment, a pair of RPA primers and its corresponding crRNA were finally selected as the commonly used primers and sequences. The DNA templates of RPA primers and crRNA were synthesized by Jilin Kumei Biotechnology Co., Ltd.

[0047] Table 1. RPA primer sequences

[0048]

[0049] In the above table, GAAATTAATACGACTCACTATAGGG is the T7 promoter sequence.

[0050] Table 2. CRISPR RNA sequences

[0051]

[0052]

[0053] Example 2 Synthesis of CRISPR RNA

[0054] The DNA template of crRNA was annealed into double-stranded DNA using the TaKaRa Ex Taq kit. The annealing system: crRNAsIVT tempaltes (100uM) 1ul, T7-3G IVT (100uM) 1ul, 10×PCR stdbuffer 1ul, dNTP (2.5mM) 0.8ul, Ex Taq 0.05ul, and DEPC H2O was added to the total system of 10ul. Annealing reaction was performed. The annealing program was: 95℃5min; 94℃ to 4℃ (0.5℃ / s); 72℃1min. According to the instructions of the HiScribe T7Quick HighYield RNA Synthesis Kit, 10ul NTP buffer mix, 2ul T7 RNA polymerasemix and 18ul DEPC H2O were added to the annealing product obtained in the previous step. The double-stranded DNA was transcribed into crRNA by incubation at 37℃ overnight. According to the manufacturer's instructions, use Purify crRNA with RNA Cleanup Kit and adjust the concentration to 10 ng / ul using DEPC H2O (dispense 20 ul per tube and store at -80°C).

[0055] Example 3 Preparation of Standards

[0056] Using the cDNA of the N-CDV strain as a template, PCR amplification was performed using primers RPAZL F1 / R1. The nucleotide sequence of the primer pair is as follows:

[0057] RPAZLF15'-ACAGGATTGCTGAGGACCTAT-3'

[0058] RPAZL R15'-CAAGATAACCATGTACGTGC-3'

[0059] The reaction system is as follows:

[0060] 2×Taq PCR StarMix 10μL, upstream primer (10μM) 1μL, downstream primer (10μM) 1μL, cDNA template 1μL, ddH2O supplemented to 20μL; reaction conditions: 94℃5min; 94℃30s, 60℃30s, 72℃20s, 30cycles; 72℃10min; 12℃ unlimited time. PCR reaction was performed with annealing temperature of 60℃. The pMD-19T vector clone was connected and the plasmid was named pMD-19T-RPAZL after correct identification and stored at -80℃ for future use. The concentration of pMD-19T-RPAZL was determined and a 10-fold gradient dilution was performed as a standard for sensitivity experiments in the CRISPR–Cas13a visualization detection method.

[0061] like Figure 1 A single band of 287 bp was obtained. The product was purified by gel recovery and then cloned and sequenced. The results were completely consistent with expectations. The successfully constructed positive plasmid was named pMD-19T-RPAZL and stored at -80°C for future use. The concentration of the plasmid standard was determined by a spectrophotometer to be 345 ng / ul. According to the formula: copy number (copies / μL) = (6.02×10 23 × concentration × 10 -9 ) / (660×number of bases), the copy number of pMD-19T-RPAZL was calculated to be 1.6×10 11 copies / ul.

[0062] Example 4 One-step recombinase polymerase nucleic acid preamplification (RT-RPA)

[0063] According to the instructions of the RT-RAA domestic kit, add 40.9 ul of Buffer A, 2 ul of upstream and downstream primers RPAF1 / R1 (10uM), 2 ul of viral genome template, and 2.5 ul of Buffer B to each tube of reaction dry powder to form a 50 ul reaction mixture. After adding, cover the tube, turn it upside down and mix it thoroughly 5-6 times, centrifuge it at low speed for 10 seconds, and react at 42℃ for 30 minutes to perform viral nucleic acid pre-amplification.

[0064] Example 5 Optimal Fluorescence Kinetic Detection Reaction System

[0065] The RT-RPA experiment was performed using CDV genomic RNA extracted from the N-CDV strain as a template. 2 μL of amplified product was used as input for CRISPR-Cas13a fluorescence kinetic detection to perform system optimization experiments ( Figure 4A ,B), and finally determined the optimal working concentrations of crRNA (5ng / ul) and Cas13a protein (4ng / ul). The optimized fluorescence kinetic detection reaction system: RT-RPA product 2ul, T7 RNA polymerase mix 0.5ul, Rnase inhibitor murine 1ul, NTP buffermix 0.8ul, 10×PCR std buffer 2ul, Cas13a (50μm) 1ul, crRNA 1ul, probe-polyU (10μm) 2ul, DEPC water 10.7ul.

[0066] Prepare reagents according to the following formula: 2ul of RT-RPA product of Example 4, 0.5ul of T7 RNA polymerase mix, 1ul of RNase inhibitormurine, 0.8ul of NTPbuffermix, 2ul of 10×PCR std buffer, 1ul of Cas13a (50μm), 1ul of crRNA, 2ul of probe-polyU (10μm), and 10.7ul of DEPC water.

[0067] Prepare the kit with each reagent.

[0068] Experimental Example 1 Screening of RT-RPA Primers and CRISPR RNA

[0069] The best pre-amplification primers and corresponding crRNA were screened by combining the two pairs of RT-RPA primers synthesized in Example 1 with their respective crRNAs for fluorescence kinetic detection and visual effects of lateral flow test strip color development reaction.

[0070] Combination of results Figure 2 and Figure 3 It can be seen that primers F1 / R1 with crRNA-1 and primers F2 / R2 with crRNA-2 have obvious fluorescence collection and color bands appear on the test line of the lateral flow detection strip, proving that the above-mentioned multiple pairs of primers and crRNA are effectively designed, among which primers F1 / R1 (amplified fragment length is 92bp, Tm=66.55°C) are used with crRNA-1 to collect the highest fluorescence intensity and the best color development effect, which are used as common primers and sequences for subsequent experiments (Table 3).

[0071] Based on this primer, a pair of primers without T7 promoter sequence was designed for the construction of standard plasmid. This result also proves that the CRISPR-Cas13a lateral flow detection method can directly detect CDV by vision.

[0072] Table 3. Sequences of primers, crRNA, and reporter RNA with the best color development effect

[0073]

[0074] Experimental Example 2 CRISPR-Cas13a Detection Reaction System

[0075] The RT-RPA pre-amplification product of Example 4 was used as a template, and 2ul was added to a total of 20ul of the reaction system. The crRNA transcribed by T7 in Example 2 and the lwCas13a protein purchased by the reagent company were diluted 2 times in RNase-free water to obtain crRNA with a final concentration of 0.625ng / ul, 1.25ng / ul, 2.5ng / ul, 5ng / ul, 10ng / ul and Cas13a protein with a final concentration of 2ng / ul, 4ng / ul, 8ng / ul, 10ng / ul.

[0076] Using the checkerboard method, under 2ul LF-polyU conditions, fluorescence kinetics detection was performed on crRNA and Cas13a proteins with different final concentrations in turn to find their optimal working concentration.

[0077] The optimized reaction system was used to explore the amount of LF-polyU and the reaction time to obtain the best working conditions.

[0078] Results: The optimal working concentrations of crRNA (5 ng / ul) and Cas13a protein (4 ng / ul) were finally determined.

[0079] The optimal fluorescence kinetic detection reaction system (ie, Example 5) was determined: RT-RPA product 2ul, T7RNA polymerase mix 0.5ul, RNase inhibitormurine 1ul, NTPbuffermix 0.8ul, 10×PCRstdbuffer 2ul, Cas13a (50μm) 1ul, crRNA 1ul, probe-polyU (10μm) 2ul, DEPC water 10.7ul.

[0080] Test Example 3 Detection method of CRISPR-Cas13a

[0081] The prepared reaction system of Experimental Example 2 (ie, Example 5) was placed in a Bio-Rad CFX96 real-time fluorescence quantifier, and fluorescence was collected at 37°C for 2 hours, and the fluorescence value was read every 5 minutes, thereby achieving the purpose of fluorescence kinetic detection. The fluorescence intensity differences between the samples in the final cycle were statistically analyzed using GraphPad Prism8 software and analyzed by t-test. The results are shown in Figure 4.

[0082] Experimental Example 4: Lateral flow test strip detection combined with CRISPR Cas13a

[0083] In order to perform the lateral flow chromatography test strip detection reaction of CRISPR-lwCas13a, FAM was labeled at the 5' end of poly U and biotin was labeled at the 3' end of poly U. The poly U was added to the reaction system as a reporter gene, and the other components remained unchanged. After half an hour of constant temperature reaction at 37°C, 20μL of the reaction product was transferred to a nuclease-free 2ml EP tube and mixed thoroughly with 80μL HybriDetect 1 analysis buffer. The diluted reaction solution was added dropwise to the sample pad of the Milenia HybriDetect 1 test strip and the color development was observed after 5 minutes. To preserve the best visual effect, the test strip was placed on a white background and photographed immediately.

[0084] For negative samples, the anti-FAM antibody of the test strip is fully coupled to FAM-RNA-biotin as a reporter gene, and the conjugate is intercepted by the biotin ligand in the control line (C).

[0085] In the positive sample reaction, Cas13a cut the reporter gene, and the gold particle-anti-FAM antibody-FAM conjugate accumulated in the Test (T) line and decreased in the C line.

[0086] Four CDV strains were selected as reference strains for verification. Figure 5 As shown, in the visual reading, obvious bands were observed at the T line for the four CDV-positive samples, while the negative samples only showed a band at the C line.

[0087] Test Example 5 Sensitivity and specificity of lateral flow test strips

[0088] To validate the feasibility of lateral flow strip-based CRISPR-Cas13a detection, it is critical to evaluate the sensitivity and specificity of this method. In the sensitivity test, the lowest copy number with no visible band along the T line was considered the detection limit. The results showed that the sensitivity was as low as 10 2 copies / μL, consistent with the fluorescence kinetics detection ( Fig. 6A ).

[0089] In the specific test, six viral genomes including CDV, CPIV, CAV 2, CHV, CHPV, and CCOV were used as templates for RPA-CRISPR lateral flow test strip detection. Figure 6B As shown, there is an obvious positive band only on the test strip for CDV. The test strips for other viruses were all judged to be negative. The results show that the CDV detection method combining RPA-CRISPR-Cas13a with lateral flow test strips has good sensitivity and specificity.

[0090] Test Example 6 Clinical Sample Testing

[0091] For 20 clinical samples known to be positive or negative (7 positive, 13 negative) collected from Heilongjiang Provincial Pet Hospital, 2 μL was taken from each of the processed samples for direct RPA reaction (without dilution or purification) and lateral flow test strip detection and color reaction was observed. The 20 clinical samples were clinically tested by conventional PCR and SHERLOCK combined with HUDSON.

[0092] The first group was treated with SHERLOCK combined with HUDSON. According to the HUDSON method, TCEP and EDTA were added to 20 tissue homogenates at final concentrations of 100 mM and 1 mM, respectively. Incubate at 42 °C for 20 minutes in a water bath, then incubate at 64 °C for 5 minutes to inactivate it. Take 2 μL of the treated product and add it directly as a template to the CRISPR-Cas13a lateral flow test strip established in the reaction system of Example 5, and collect the results.

[0093] The second group served as a control, and the same 20 clinical samples were tested using conventional PCR methods, and the test results were compared.

[0094] The results are as follows Fig. 7A As shown in Figure 7, the agreement between the two detection methods is 100%. Combined with the data in Figure 7 and Table 4, it can be shown that the combination of SHERLOCK platform and HUDSON can be used as an effective method for local clinical detection of CDV.

[0095] Table 4. SHERLOCK combined with HUDSON, conventional PCR detection of 20 clinical samples

[0096]

[0097] The detection limit of this method was 1.6×10 2 The RPA-CRISPR assay can detect 100 copies / μL of the virus and has no cross-reaction with other waterfowl infectious viruses. From sample collection to result output, the entire RPA-CRISPR reaction can be completed within two hours. RPA-CRISPR can be amplified at room temperature without the need for viral nucleic acid extraction. It is suitable for rapid testing of clinical samples and can work well in the field or in grassroots laboratories. It can get rid of the limitations of detection instruments and complex operations and is suitable for rapid batch testing on site.

[0098] Although the present invention has been described in detail above by general description, specific implementation methods and experiments, it is obvious to those skilled in the art that some modifications or improvements can be made to the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. An RPA primer for detecting canine distemper virus, characterized in that, Includes any of the following groups: Group 1: Sequence 1RPAF1: GAAATTAATACGACTCACTATAGGGATCCCCAGGGAACAAG CCTAGTATTGCTGA; Sequence 2RPA R1: ATAGTCAAGATGAAAACTAGCCAATCCAGCT; Group 2: Sequence 3RPAF2: GAAATTAATACGACTCACTATAGGGGATTGCTGAGGACCTA TCTTTGAGGCGATT; Sequence 4RPA R2: CATTTCAGCAATACTAGGCTTTGTTCCCTGG.

2. The RPA primer for detecting canine distemper virus according to claim 1, characterized in that, The RPA primer set is: Sequence 1RPAF1: GAAATTAATACGACTCACTATAGGGATCCCCAGGGAACAAG CCTAGTATTGCTGA Sequence 2RPA R1: ATAGTCAAGATGAAAACTAGCCAATCCAGCT 3. A crRNA for detecting canine distemper virus, characterized in that, Including any of the following crRNAs: Sequence 5crRNAs IVT-1Tempalte: ATGATTTGTGATATAGATAACTACATTGGTTTTAGTCCCCTTCGTT TTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC; Sequence 6crRNAs IVT-2tempalte: TGGTGGCACTCATCTTGGACATCAAACGGTTTTAGTCCCCTTCG TTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC.

4. The crRNA for detecting canine distemper virus according to claim 3, characterized in that, The crRNA is: crRNAs IVT-1 Tempaltes: ATGATTTGTGATATAGATAACTACATTGGTTTTAGTCCCCTTCGTT TTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC.

5. A canine distemper virus detection reagent based on SHERLOCK, characterized in that: Including the RPA primer as claimed in claim 1 or 2, the crRNA as claimed in claim 3 or 4, and also including Cas13a protein, the crRNA concentration is 2-5ng / ul, and the Cas13a protein concentration is 2-4ng / ul.

6. The canine distemper virus detection reagent based on SHERLOCK according to claim 5, characterized in that, The crRNA concentration was 5 ng / ul, and the Cas13a protein concentration was 4 ng / ul.

7. The canine distemper virus detection reagent based on SHERLOCK according to claim 5, characterized in that, Including RT-RPA product 2ul, T7 RNApolymerase mix 0.5ul, Rnase inhibitormurine 1ul, NTPbuffermix0.8ul, 10×PCR stdbuffer 2ul, Cas13a (50μm) 1ul, crRNA 1ul, probe-polyU (10μm) 2ul, DEPC water 10.7ul.

8. A kit for detecting canine distemper virus, characterized in that: It comprises the RPA primer according to claim 1 or 2, the crRNA according to claim 3 or 4, and the reagent according to any one of claims 5 to 7.

9. A method for detecting canine distemper virus based on the SHELOCK method, characterized in that: The method uses the RPA primer described in claim 1 or 2, the crRNA described in claim 3 or 4, or the reagent described in any one of claims 5 to 8.

10. Use of the primer according to claim 1 or 2, the crRNA according to claim 3 or 4, and the reagent according to any one of claims 5 to 8 in detecting canine distemper virus by the SHELOCK method.

Images