Composition for inhibiting trypsin activity containing bacteria belonging to the genus Parapus as an active ingredient

Abstract

A composition for inhibiting trypsin activity, comprising bacteria belonging to the genus Paraprevotella as an active ingredient.

Description

Technical Field

[0001] The present invention relates to a composition for inhibiting trypsin activity containing bacteria belonging to the genus Paraprevotella as an active ingredient. In addition, the present application claims priority to U.S. Provisional Application No. 62 / 728908 (filed on September 10, 2018) and U.S. Provisional Application No. 62 / 794145 (filed on January 18, 2019), the disclosures of which are incorporated herein by reference. Background Art

[0002] It is believed that there are about 100 trillion intestinal bacteria living in the human digestive tract. This results in intestinal bacteria far exceeding the approximately 37 trillion human cells coexisting with us, forming the intestinal flora. Since the advocacy of intestinal bacteriology, various studies have been conducted. In fact, recent experiments using germ-free animals have shown that the intestinal flora has various effects on the maturation of the host immune system and the function of the host. For example, intestinal bacteria contribute to the inhibition of colonization and proliferation of pathogenic microorganisms by competing with pathogenic microorganisms for niches. In addition, obese people have fewer Bacteroidetes in their intestinal bacteria, and germ-free mice transplanted with their feces have increased body fat.

[0003] In addition, due to the popularization of phylogenetic biotechnology, detailed studies on the effects of various bacterial species in the entire intestinal bacteria on the host immune system have also begun to be reported. For example, 17 strains of the Clostridia group isolated from healthy people induce regulatory T cells in the mouse colon and alleviate host inflammation (non-patent document 1). In addition, segmented bacteria (segmented filamentous bacteria (SFB)) living in the small intestine of mice strongly induce Th17 cells by adhering to the small intestinal epithelium (non-patent document 2). Furthermore, Klebsiella pneumonia isolated from the saliva of Crohn's disease (Crohn's disease, CD) patients colonizes in the mouse colon ectopically, thereby strongly inducing Th1 cells and causing colitis (non-patent document 3). In this way, there are more studies on intestinal bacteria and the host immune system, but on the other hand, there are fewer detailed studies focusing on various intestinal bacterial species and host-derived proteins present in feces (non-patent documents 4 to 7).

[0004] In addition, in the protein of host origin, trypsin is known as one of the proteolytic enzymes secreted by the pancreas. Recently, it is shown that the survival of active trypsin far from the large intestine participates in the morbidity and deterioration of various diseases. Specifically, it is reported that in the feces of inflammatory bowel disease (Inflammatory Bowel Disease, IBD) patients, particularly CD patients, trypsin survives in the state of maintaining its activity (non-patent literature 8, 9). In addition, it is suggested that the Bacteroides (Bacteroides), which is known as the large constituent element of the intestinal bacteria of the people, is reduced in IBD patients (non-patent literature 9), and certain bacteria constituting the Bacteroides (Bacteroides) participate in the inactivation of trypsin in feces (non-patent literature 10), but there is no detailed research basically.

[0005] In view of the above situation, if bacteria capable of inhibiting trypsin activity could be isolated, the possibility of developing a bacterial therapy that inhibits trypsin activity as a new treatment strategy for IBD could be expected, but such bacteria have not yet been isolated.

[0006] Prior art literature

[0007] Non-patent literature

[0008] Non-patent document 1: Atarashi, K. et al. Nature 500, 232-236, doi: 10.1038 / nature12331 (2013).

[0009] Non-patent document 2: Atarashi, K. et al. Cell 163, 367-380, doi: 10.1016 / j.cell.2015.08.058 (2015).

[0010] Non-patent document 3: Atarashi, K. et al. Science 358, 359-365, doi: 10.1126 / science.aan4526 (2017).

[0011] Non-patent document 4: Palm, N. Wet al. Cell 158, 1000-1010, doi: 10.1016 / j.cell.2014.08.006 (2014).

[0012] Non-patent document 5: Kawamoto, S. et al. Immunity 41, 152-165, doi: 10.1016 / j.immuni.2014.05.016 (2014).

[0013] Non-patent document 6: Planer, J.D. et al. Nature 534, 263-266, doi: 10.1038 / nature17940 (2016).

[0014] Non-patent literature 7: Bunker, JJ et al. Immunity 43, 541-553, doi: 10.1016 / j.immuni2015.08.007 (2015).

[0015] Non-patent document 8: van de Merwe, JP & Mol, GJ Digestion 24, 1-4, doi: 10.1159 / 000198767 (1982).

[0016] Non-patent literature 9: Midtvedt, T. et al. PLoS One 8, e66074, doi: 10.1371 / journal.pone.0066074 (2013).

[0017] Non-patent document 10: Ramare, F., Hautefort, I., Verhe, F., Raibaud, P. & Iovanna,. Appl Environ Microbiol 62, 1434-1436 (1996). Summary of the invention

[0018] Problems to be solved by the invention

[0019] The present invention has been made in view of the above problems of the prior art, and an object of the present invention is to isolate bacteria capable of inhibiting trypsin activity and to provide a composition for inhibiting trypsin activity containing the bacteria as an active ingredient.

[0020] Means for solving problems

[0021] The present inventors have repeatedly conducted intensive studies to achieve the above-mentioned purpose. As a result, they conducted a comprehensive protein analysis (proteome analysis) of the cecal contents of SPF mice and germ-free mice (Germ-Free mice, GF mice), and identified 713 host-derived proteins. Compared with SPF mice, 45 proteins were significantly more present in the cecal contents of GF mice. Among them, the protease trypsin (Anionic trypsin-2: PRSS2) was observed to have a particularly significant difference in the amount of protein degrading enzyme.

[0022] Trypsin is a digestive enzyme secreted by the exocrine glands of the pancreas. It is a strong proteolytic enzyme and has been suggested to be associated with unexplained IBD. Therefore, the expression and secretion of trypsinogen, a precursor of trypsin, in pancreatic tissue were studied, but no difference was confirmed between SPF mice and GF mice. On the other hand, for trypsin activity in intestinal contents, no significant difference was confirmed for the small intestine, but a significant decrease in activity was confirmed in SPF mice beyond the cecum. Based on the above considerations, intestinal bacteria are factors that reduce trypsin activity beyond the cecum.

[0023] Next, fecal samples from six healthy volunteers were administered to GF mice to produce mice colonized with human flora. As a result, the trypsin activity in the feces of each sample group was different. Therefore, the identification of strains that reduce the trypsin activity in the feces was carried out. The cecal contents of the human flora colonized mice with the greatest reduction in trypsin activity were administered to other GF mice, and the trypsin activity in the feces was evaluated while administering antibiotics of various antibacterial spectra. As a result, a significant reduction in trypsin activity in the feces was confirmed in the group of mice administered with ampicillin. Among them, for the mice with the greatest reduction in trypsin activity, the bacteria contained in the cecal contents were cultured under anaerobic conditions, and 35 strains of bacteria with reduced trypsin activity were isolated. Furthermore, the responsible bacteria for reducing trypsin activity were identified. Based on the above-mentioned Spearman ordinal correlation analysis of the relative occupancy of intestinal bacteria in mouse feces and the trypsin activity value when various antibiotics with antimicrobial spectra were administered, strains were locked, and it was found that three strains, Paraprevotella clara (P.clara), Parabacteroides merdae (P.merdae, Parabacteroides merdae), and Bacteroides uniformis (B.uniformis, Bacteroides uniformis, Bacteroides uniformis), reduced trypsin activity. In addition, it was finally discovered that P.clara was the responsible bacterium for the inhibition of trypsin activity.

[0024] Furthermore, another bacterium (P. xylaniphila) belonging to the genus Paraprevotella was evaluated, and the results showed that it was able to inhibit trypsin activity in the same manner as P. clara.

[0025] The present invention has been made based on this finding, and relates to a composition for inhibiting trypsin activity, comprising bacteria belonging to the genus Paraprevotella as an active ingredient, and provides the following invention in more detail.

[0026] <1> A composition for inhibiting trypsin activity, comprising bacteria belonging to the genus Paraprevotella as an active ingredient.

[0027] <2> The composition according to <1>, wherein the bacterium belonging to the genus Paraprevotella is at least one bacterium selected from Paraprevotella clara and Paraprevotella xylaniphila.

[0028] <3> The composition according to <1>, wherein the bacterium belonging to the genus Paraprevotella is at least one bacterium having a DNA consisting of a base sequence described in any one of SEQ ID NOs. 1 to 3 or a base sequence having at least 90% identity with the base sequence.

[0029] <4> The composition according to <1>, wherein the bacteria belonging to the genus Paraprevotella is selected from

[0030] The bacterial strain Paraprevotella clara 1C4 belonging to Paraprevotella clara identified by the accession number NITE BP-02775,

[0031] Paraprevotella clara JCM14859 T Zhuhe

[0032] Paraprevotella xylaniphila JCM14860 T strain

[0033] at least one bacterial strain.

[0034] <5> The composition according to any one of <1> to <4>, further comprising at least one bacteria selected from the group consisting of Parabacteroides merdae and Bacteroides uniformis.

[0035] <6> According to the composition described in <5>, the Parabacteroides merdae is at least one bacterium having a DNA consisting of a base sequence recorded in sequence number 4 or a base sequence that is at least 90% identical to the base sequence, and the Bacteroides uniformis is at least one bacterium having a DNA consisting of a base sequence recorded in sequence number 5 or a base sequence that is at least 90% identical to the base sequence.

[0036] <7> The composition according to <5>, wherein the Parabacteroides merdae is a bacterial strain (Parabacteroides merdae 1D4 strain) belonging to Parabacteroides merdae specified by the accession number NITE BP-02776, and the Bacteroides uniformis is a bacterial strain (Bacteroides uniformis 3H3 strain) belonging to Bacteroides uniformis specified by the accession number NITE BP-02777.

[0037] <8> A bacterial strain belonging to Paraprevotella clara identified by accession number NITE BP-02775 (Parapprevotella clara 1C4 strain).

[0038] <9> A bacterial strain belonging to Parabacteroides merdae (Parabacteroides merdae 1D4 strain) specified by accession number NITE BP-02776.

[0039] <10> A bacterial strain belonging to Bacteroides uniformis (Bacteroides uniformis 3H3 strain) specified by accession number NITE BP-02777.

[0040] In addition, it has been suggested that the active trypsin remaining in the large intestine is related to the onset and worsening of symptoms of IBD known as ulcerative colitis and Crohn's disease. Therefore, the inventors used colitis model mice to verify the relief of inflammation based on the effect of inhibiting trypsin activity of the above three strains. In a model of inducing colitis by infecting IL-10 gene-deficient mice with Enterobacter aerogenes, it was confirmed that the tendency of the onset of the disease was suppressed by administering the above three strains. In addition, in the DSS-induced colitis model, the onset of colitis was significantly suppressed.

[0041] Therefore, based on this finding, the present invention also provides a pharmaceutical composition and method for treating, ameliorating or preventing the following diseases caused by trypsin activity.

[0042] <11> A pharmaceutical composition for treating, ameliorating or preventing a disease caused by trypsin activity, comprising as an active ingredient at least one bacterium selected from bacteria belonging to the genus Paraprevotella, Parabacteroides merdae and Bacteroides uniformis.

[0043] <12> The pharmaceutical composition according to <11>, wherein the bacterium belonging to the genus Paraprevotella is at least one bacterium selected from Paraprevotella clara and Paraprevotella xylaniphila.

[0044] <13> The pharmaceutical composition according to <11>, wherein the bacterium belonging to the genus Paraprevotella is at least one bacterium having a DNA consisting of a base sequence described in any one of SEQ ID NOs: 1 to 3 or a base sequence having at least 90% identity with the base sequence.

[0045] <14> The pharmaceutical composition according to <11>, wherein the bacteria belonging to the genus Paraprevotella are selected from

[0046] A bacterial strain belonging to Paraprevotella clara identified by accession number NITE BP-02775 (Parapprevotella clara 1C4 strain),

[0047] Paraprevotella clara JCM14859T strain and

[0048] Paraprevotella xylaniphila strain JCM14860T

[0049] at least one bacterial strain.

[0050] <15> The pharmaceutical composition according to any one of <11> to <14>, wherein the Parabacteroides merdae is at least one bacterium having a DNA consisting of the base sequence described in SEQ ID NO: 4 or a base sequence having at least 90% identity with the base sequence.

[0051] <16> The pharmaceutical composition according to any one of <11> to <14>, wherein the Parabacteroides merdae is a bacterial strain belonging to Parabacteroides merdae specified by accession number NITE BP-02776 (Parabacteroides merdae 1D4 strain).

[0052] <17> The pharmaceutical composition according to any one of <11> to <16>, wherein the Bacteroides uniformis is at least one type of bacteria having a DNA consisting of the base sequence recorded in SEQ ID NO: 5 or a base sequence having at least 90% identity with the base sequence.

[0053] <18> The pharmaceutical composition according to any one of <11> to <16>, wherein the Bacteroides uniformis is a bacterial strain belonging to Bacteroides uniformis specified by accession number NITE BP-02777 (Bacteroides uniformis 3H3 strain).

[0054] <19> The pharmaceutical composition according to any one of <11> to <18>, wherein the disease caused by trypsin activity is inflammatory bowel disease.

[0055] <20> The pharmaceutical composition according to <19>, wherein the inflammatory bowel disease is any one of ulcerative colitis (UC) and Crohn's disease (CD).

[0056] <21> A method for treating, ameliorating or preventing a disease caused by trypsin activity in a subject, comprising causing the subject to ingest at least one bacterium selected from the group consisting of bacteria belonging to the genus Paraprevotella, Parabacteroides merdae and Bacteroides uniformis.

[0057] <22> The method according to <21>, wherein the bacterium belonging to the genus Paraprevotella is at least one bacterium selected from Paraprevotella clara and Paraprevotella xylaniphila.

[0058] <23> The method according to <21>, wherein the bacterium belonging to the genus Paraprevotella is at least one bacterium having a DNA consisting of a base sequence recorded in any one of SEQ ID NOs. 1 to 3 or a base sequence having at least 90% identity with the base sequence.

[0059] <24> The method according to <21>, wherein the bacteria belonging to the genus Paraprevotella are selected from

[0060] A bacterial strain belonging to Paraprevotella clara identified by accession number NITE BP-02775 (Parapprevotella clara 1C4 strain),

[0061] Paraprevotella clara JCM14859T strain and

[0062] Paraprevotella xylaniphila strain JCM14860T

[0063] at least one bacterial strain.

[0064] <25> The method according to any one of <21> to <24>, wherein the Parabacteroides merdae is at least one type of bacterium having a DNA consisting of the base sequence described in SEQ ID NO: 4 or a base sequence having at least 90% identity with the base sequence.

[0065] <26> The method according to any one of <21> to <24>, wherein the Parabacteroides merdae is a bacterial strain belonging to Parabacteroides merdae specified by accession number NITE BP-02776 (Parabacteroides merdae 1D4 strain).

[0066] <27> The method according to any one of <21> to <26>, wherein the Bacteroides uniformis is at least one type of bacteria having a DNA consisting of the base sequence recorded in SEQ ID NO: 5 or a base sequence that is at least 90% identical to the base sequence.

[0067] <28> The method according to any one of <21> to <26>, wherein the Bacteroides uniformis is a bacterial strain belonging to Bacteroides uniformis specified by accession number NITE BP-02777 (Bacteroides uniformis 3H3 strain).

[0068] <29> The method according to any one of <21> to <28>, wherein the disease caused by trypsin activity is inflammatory bowel disease.

[0069] <30> The method according to <29>, wherein the inflammatory bowel disease is any one of ulcerative colitis and Crohn's disease.

[0070] Effects of the Invention

[0071] According to the present invention, trypsin activity can be inhibited, and in particular, trypsin activity in the intestine can be inhibited. BRIEF DESCRIPTION OF THE DRAWINGS

[0072] Figure 1 This is a graph showing the results of evaluating the trypsin activity in the cecal contents (feces) of SPF mice from different breeding facilities. In the graph, "GF", "Riken", "SLC", "Clea" and "Charles" recorded on the horizontal axis represent germ-free mice (GF mice), SPF mice maintained by Riken, SPF mice maintained by Japan Escellence Co., Ltd., SPF mice maintained by Japan Clea Co., Ltd., and SPF mice maintained by Japan Charls Liber Co., Ltd., and the vertical axis represents the trypsin activity in each cecal content.

[0073] Figure 2 Figure showing the result of trypsin activity in the feces (A, B, C, CII, D, E, H and G) of healthy volunteers from Japan. The horizontal axis in the figure represents each healthy volunteer, and the vertical axis represents the trypsin activity in feces. In addition, the provider of feces C and CII is the same healthy volunteer.

[0074] Figure 3 The graph shows the results of evaluating fecal trypsin activity by orally and intragastrically administering feces (A to F) of Japanese healthy volunteers to GF mice to create humanized mice (A to F). The horizontal axis of the graph shows the humanized mice and GF mice, and the vertical axis shows fecal trypsin activity.

[0075] Figure 4This is a graph showing the results of evaluating the trypsin activity in feces over time for mice to which fecal CII of healthy volunteers was orally administered intragastrically to GF mice, and then 24 hours later, ampicillin (Amp), tylosin (Tylosin) or metronidazole (MNZ) as antibiotics (Abx) were administered freely through drinking water. The horizontal axis in the figure represents the number of days after the administration of the antibiotics, and the vertical axis represents the trypsin activity in the feces. In addition, the figure also shows the results of evaluating GF mice (Control) to which only fecal CII of healthy volunteers was administered (without antibiotics), and GF mice (GF) to which neither feces nor antibiotics were administered. The number of individuals evaluated is as follows. Control: Amp: MNZ: Tylosin: GF = 4: 5: 5: 4: 2. Since the activity changes when Amp was administered showed the same tendency as the antibiotic-unadministered group (Control), it is speculated that the bacterial flora that contributes to the reduction in activity is Amp-resistant bacteria. Then, the fecal samples of the Amp-administered group were used to isolate and culture the bacteria, and the following Figure 5 A total of 35 strains are shown. Next, the bacterial flora of each individual on the 12th day after the antibiotic administration was derived by Meta 16S rDNA analysis. Furthermore, the relative occupancy of each bacterial species constituting the bacterial flora and the trypsin activity value of each individual were correlated and analyzed to infer the bacterial species that contribute to the reduction of trypsin activity.

[0076] Figure 5 Yes Display Figure 4 The phylogenetic tree of 35 strains isolated from stool samples of the Amp-administered group based on 16S rDNA sequence homology is shown. The numbers in the figure indicate the species name, representative OTU No. of 16S rDNA analysis, and the named isolated strain in order from the left.

[0077] Figure 6 This is a graph showing the results of temporal evaluation of trypsin activity in the feces of mice colonized with the 35 isolated bacteria. The horizontal axis in the graph represents the number of days after the administration of bacteria or feces, and the vertical axis represents the trypsin activity in feces. The 35 isolated bacteria were administered to GF mice ("35mix" in the figure) and the intestinal trypsin activity was evaluated. The results showed that the effect was equal to or better than that of the feces transplantation derived from the bacteria ("CII human faces" in the figure).

[0078] Figure 7This is a graph showing the Spearman's correlation between bacterial flora and trypsin activity. More specifically, it is a graph showing the results of expressing the correlation coefficient ρ in ascending order for bacterial species that satisfy the P value of the no correlation test P < 0.05. The strains that correlate the trypsin activity value and the amount of trypsin in the feces of each individual are estimated by Spearman's correlation. Among them, the 9 strains with strong negative correlation (9 strains from the left) are focused on.

[0079] Figure 8 It shows that for the colonization Figure 7 The graph shown in FIG. 1 is a graph showing the results of evaluating the trypsin activity in feces of mice of 9 strains (9-mix) over time, in which a strong negative correlation was confirmed in the Spearman's correlation. Fig. 9 The mice colonized with the indicated 6-strain (6-mix) or 3-strain (3-mix) were evaluated in the same manner. The horizontal axis in the figure represents the number of days after administration of each bacterial cocktail, and the vertical axis represents the trypsin activity in feces.

[0080] Fig. 9 Show in Figure 7 The phylogenetic tree of the 9 strains with strong negative correlation was confirmed in the Spearman's correlation. As shown in the figure, the 9 strains are divided into 3 strains belonging to the genus Bacteroides ("Bacteroides" in the figure) and 6 strains other than the genus Bacteroides ("Non-Bacteroides" in the figure).

[0081] Fig.10 The photographs show the results of evaluating the degradation of trypsin protein produced by isolated cultured bacteria. The cecal contents of GF mice containing trypsin were mixed with various bacteria, and after anaerobic culture, the presence of trypsin protein was evaluated by Western blotting. In the figure, "Pc" indicates the results of evaluating the pancreatic contents of mice (containing active trypsin), and "w / o bacteria" indicates the results of evaluating the cecal contents of GF mice (not mixed with bacteria). "6-mix" and "3-mix" indicate the results of evaluating the cecal contents of GF mice (not mixed with bacteria). Figure 8 and 9The results of evaluating the cecal contents of mice obtained by mixing the above 6 strains and 3 strains are shown. "6strains" shows the results of evaluating the cecal contents of mice obtained by mixing the above 6 strains (1B2~671B8) separately. "3strains" shows the results of evaluating the cecal contents of mice obtained by mixing the above 3 strains (1C4~3H3) separately. The disappearance of trypsin protein was confirmed in 3mix and P.clara alone, which is one of the constituent bacteria of 3mix. In other words, it is considered that trypsin activity is inhibited by decomposing trypsin by P.clara bacteria.

[0082] Fig.11 This is a graph showing the results of evaluating the inhibition of the occurrence of ulcerative colitis (UC)-like inflammation caused by colonization of a cocktail of trypsin activity-inhibiting bacteria. After administering the above-mentioned trypsin activity-inhibiting bacteria 3mix or trypsin activity-non-inhibiting bacteria 6mix to IL10- / - mice, they were infected with Ka11E12 that induces UC-like enteritis, and the trypsin activity in the mouse feces was detected over time. In the figure, the horizontal axis shows the time elapsed after the administration of each bacterial cocktail. The vertical axis represents the trypsin activity in the feces. "11E12" represents the result of administering only Ka11E12 to IL10- / - mice, and "11E12+6mix" and "11E12+3mix" show the results of administering Ka11E12 to IL10- / - mice after administering 3mix and 6mix, respectively. "GF" represents the result of evaluating germ-free mice. "3mix" represents the result of administering only 3mix to IL10- / - mice.

[0083] Fig.12 It is displayed in Fig.11 The scatter plot shows the results of evaluating the intestinal inflammation level in mice 3 weeks after administration of Ka11E12. Fig.11 The vertical axis represents the concentration of inflammatory markers (lipocalin-2, LCN2) in feces.

[0084] Fig.13 The photographs show the results of evaluating the degradation of trypsin proteins produced by P. clara and its related species. In the figure, "Pc" indicates the results of evaluating the pancreatic contents of mice (containing active trypsin), and "w / o bacteria" indicates the results of evaluating the cecal contents of GF mice (not mixed with bacteria). "1C4" indicates the results of evaluating the contents of the cecum of GF mice (not mixed with bacteria) mixed with the P. clara strain 1C4 isolated in the present invention (refer to Fig.10"JCM14859" indicates the results of evaluating the cecal contents of mice mixed with strains of P. clara different from 1C4. "JCM14860" indicates the results of evaluating the cecal contents of mice mixed with strains of P. xylaniphila, which is a relative of P. clara. Fig.13 As shown, trypsin degradation activity was confirmed in all strains. Of the bacteria belonging to the genus Paraprevotella, only the above-mentioned two species, JCM14859 and JCM14860, are known. From this, it is estimated that trypsin degradation activity is a common activity in the genus Paraprevotella.

[0085] Fig.14 The photographs show the results of cross-linking tests between trypsin (mPRSS2) and proteins derived from P. clara bacteria by Western blotting using trypsin as the detection target, and then the results of analysis. In the figure, "mPRSS2+P.clara" indicates the results of analyzing the cell lysate of P. clara bacteria obtained by incubation with mPRSS2 alone, "mPRSS2+P.clara Crosslink" indicates the results of analyzing the cell lysate of P. clara bacteria obtained by incubation with mPRSS2 and then cross-linking, "P.clara" indicates the results of analyzing the cell lysate of P. clara bacteria without incubation with mPRSS2, and "P.clara Crosslink" indicates the results of analyzing the cell lysate of P. clara bacteria without incubation with mPRSS2 and cross-linking. "mPRSS2+EGEF" indicates the results of analyzing the EGEF medium to which mPRSS2 was added, "mPRSS2+P.clara" indicates the results of analyzing the EGEF medium after incubating mPRSS2 and P.clara, and "P.clara only" indicates the results of analyzing the EGEF medium after incubating only P.clara. In the figure, "mPRSS2" indicates the position of the band of mPRSS2 detected by protein blotting (Western Blotting), and "Reaction complex (approx. 250kD)" indicates the position of the band of the complex with the protein (approx. 220kDa) derived from P.clara bacteria that is adsorbed or bound to mPRSS2 (approximately 32kDa). "Non-specific" indicates the position of the non-specific band detected by protein blotting (Western Blotting).

[0086] Fig.15 The photographs show the results of a trypsin activity inhibition test. Specifically, the photographs show the results of incubating human PRSS2 (hPRSS2) treated with a trypsin activity inhibitor ("TLCK(+)" in the figure) or untreated hPRSS2 ("TLCK(-)" in the figure) with each bacterium (P. Clara 1C4, P. merdae 1D4 or P. xylaniphila), and detecting hPRSS2 by Western blotting. In addition, "none" in the figure indicates the results of incubating only trypsin in the absence of bacteria. DETAILED DESCRIPTION

[0087] As shown in the Examples described below, it was found that bacteria belonging to the genus Paraprevotella inhibit the activity of trypsin. Therefore, the present invention provides a composition for inhibiting trypsin activity, comprising bacteria belonging to the genus Paraprevotella as an active ingredient.

[0088] "Trypsin" is a type of endopeptidase and serine protease. In addition, it is a type of digestive enzyme contained in pancreatic juice, and has the activity of hydrolyzing the peptide bond on the carboxyl side of basic amino acids. The trypsin whose activity is inhibited in the present invention is not particularly limited, and is preferably anionic trypsin, and more preferably Anionic-trypsin-2 (PRSS2). If PRSS2 is typically of human origin, a polypeptide consisting of an amino acid sequence specified by the NCBI reference sequence: NP_002761 (a polypeptide consisting of an amino acid sequence encoded by a base sequence specified by the NCBI reference sequence: NM_002770) can be listed, and if it is of mouse origin, a polypeptide consisting of an amino acid sequence specified by the NCBI reference sequence: NP_033456 (a polypeptide consisting of an amino acid sequence encoded by a base sequence specified by the NCBI reference sequence: NM_009430) can be listed. In addition, the PRSS2 involved in the present invention is not limited to the polypeptides specified by these typical amino acid sequences, but also includes functionally active derivatives thereof, functionally active fragments thereof, homologs thereof, and variants encoded by nucleic acids that hybridize with nucleic acids encoding these polypeptides under high stringency conditions or low stringency conditions. In addition, such derivatives, fragments, homologs or variants include polypeptides that have at least 60% (preferably 70%, more preferably 80%, further preferably 90%, more preferably 95%, and particularly preferably 99%) homology with the specific amino acid sequence.

[0089] About "trypsin activity", as mentioned above, it generally refers to the activity of hydrolyzing the peptide bond on the carboxyl side of basic amino acids (lysine, arginine). However, as shown in the embodiments described later, in the present invention, the inhibition of trypsin activity is achieved by the decomposition of trypsin. In addition, it is also shown in the embodiments described later that the decomposition is induced by the promotion of the autodecomposition (autodigestion) of trypsin. Therefore, in the "trypsin activity" inhibited in the present invention, the activity of autodecomposition is excluded. In addition, in the present invention, "inhibition of trypsin activity" can also be said to be the promotion of trypsin decomposition and the promotion of trypsin autodecomposition.

[0090] Regarding "inhibition of trypsin activity", those skilled in the art can, for example, evaluate the degree of degradation of a labeled substrate peptide by detecting the label (for example, "Protease Activity Assay Kit (Abcam ab111750)" shown in the examples described later). In addition, as shown in the examples described later, the degree of degradation of trypsin can be evaluated by an immunoassay method (for example, Western Blotting) using trypsin as a detection object. In addition, "inhibition" in the present invention also includes complete inhibition (repression).

[0091] The "bacteria belonging to the genus Paraprevotella" contained as an active ingredient in the composition of the present invention for inhibiting trypsin activity is a bacterium belonging to the phylum Bacteroidetes, class Bacteroidia, order Bacteroidales, family Prevotellaceae, and genus Paraprevotella, and examples thereof include Paraprevotella clara (P.clara) and Paraprevotella xylaniphila (P.xylaniphila).

[0092] Examples of P. clara include a bacterial strain belonging to Paraprevotella clara specified by accession number NITE BP-02775 (Parapprevotella clara 1C4 strain), Paraprevotella clara JCM14859, T strain.

[0093] Examples of P. xylaniphila include Paraprevotella xylaniphila JCM14860 T strain.

[0094] In addition, “Paraprevotella clara JCM14859 T strains” and “Paraprevotella xylaniphila JCM14860 T strain” was obtained from the JCM Laboratory of Microbial Materials (JCM), RIKEN BRC.

[0095] In addition, examples of bacteria belonging to the genus Paraprevotella include at least one bacterium having a DNA consisting of a base sequence described in any one of SEQ ID NOs. 1 to 3 or a base sequence having at least 90% identity with the base sequence. In addition, the base sequences described in SEQ ID NOs. 1 to 3 represent the above-mentioned Paraprevotella clara 1C4 strain, Paraprevotella clara JCM14859, and Paraprevotella clara JCM14859, respectively. T Paraprevotella xylaniphila JCM14860 T The 16S rRNA sequence of the strain.

[0096] In addition, the composition for inhibiting trypsin activity of the present invention may further contain at least one bacterium selected from Parabacteroides merdae and Bacteroides uniformis in addition to the aforementioned bacteria belonging to the genus Paraprevotella from the viewpoint of facilitating colonization of the bacteria in the intestine.

[0097] As "Parabacteroides merdae", for example, a bacterial strain belonging to Parabacteroides merdae specified by the accession number NITE BP-02776 (Parabacteroidesmerdae 1D4 strain) can be cited. In addition, as Parabacteroides merdae, at least one bacterium having a DNA consisting of a base sequence recorded in sequence number 4 or a base sequence having at least 90% identity with respect to the base sequence can be cited. In addition, the base sequence recorded in sequence number 4 represents the sequence of 16SrRNA of the above-mentioned Parabacteroides merdae 1D4 strain.

[0098] As Bacteroides uniformis, for example, a bacterial strain belonging to Bacteroides uniformis specified by accession number NITE BP-02777 (Bacteroides uniformis 3H3 strain) can be cited. In addition, as Bacteroides uniformis, at least one bacterium having a DNA consisting of a base sequence recorded in sequence number 5 or a base sequence having at least 90% identity with respect to the base sequence can be cited. The base sequence recorded in sequence number 5 represents the sequence of 16SrRNA of the above-mentioned Bacteroides uniformis 3H3 strain.

[0099] Furthermore, "at least 90% identity" in the present invention means that the identity with respect to each base sequence is preferably 95% or more (e.g., 96% or more, 97% or more, 98% or more), particularly preferably 99% or more.

[0100] The bacteria contained in the composition of the present invention may be live bacteria or dead bacteria. In addition, it may be substances contained in the above-mentioned bacteria (proteins, nucleic acids, lipids, carbohydrates, sugar chains, etc.), secretory products of the bacteria, and metabolites produced by the bacteria. In addition, the composition of the present invention may be used in combination, and in the case of ingestion or absorption as a result of combined use (in the case of combined use of the composition), the aforementioned bacteria may also be present separately in two or more compositions.

[0101] The composition for inhibiting trypsin activity of the present invention can be in the form of a reagent for a pharmaceutical composition (medicine, quasi-drug, etc.), a diet (including animal feed), or a research purpose (e.g., an in vitro or in vivo experiment). In addition, the composition of the present invention inhibits trypsin activity and can be used as a pharmaceutical composition or a diet for the treatment, prevention, or improvement of a disease caused by the activity.

[0102] The composition of the present invention can be formulated by known pharmacy methods. For example, it can be used as capsules, tablets, pills, liquids, powders, granules, fine particles, film coatings, pellets, troche, sublingual, chewable, buccal, paste, syrup, suspension, elixir, emulsion, coating, ointment, plaster, mud dressing, percutaneous absorption type preparation, lotion, attractant, aerosol, injection, suppository, etc., for administration by comprising oral, parenteral (for example, intestinal, intramuscular, intravenous, intratracheal, intranasal, percutaneous, intradermal, subcutaneous, intraocular, vaginal, intraperitoneal, rectal or inhalation) or their multiple combinations.

[0103] In these preparations, suitable combinations can be made of carriers that are pharmacologically or acceptable as food and beverage products, specifically sterile water, physiological saline, buffer, culture medium, vegetable oil, solvent, base, emulsifier, suspending agent, surfactant, stabilizer, flavoring agent, aromatic agent, excipient, vehicle, preservative, binder, diluent, isotonic agent, pain-relieving agent, extender, disintegrating agent, buffer, coating, lubricant, coloring agent, sweetener, thickener, flavoring agent, dissolution aid or other additives.

[0104] In addition, in these formulations, from the viewpoint of more effectively inducing trypsin activity in the intestine, especially in formulations for the purpose of oral administration, a composition capable of efficiently delivering the composition of the present invention to the intestine can also be combined. There is no particular limitation on such a composition that can be delivered to the intestine, and a known composition can be appropriately used, for example, a pH-sensitive composition, a composition that inhibits release to the intestine (cellulose polymers, acrylic acid polymers and copolymers, vinyl acid polymers and copolymers, etc.), a bioadhesive composition that specifically adheres to the intestinal mucosa (for example, polymers described in the specification of U.S. Patent No. 6368586), a composition containing a protease inhibitor, and a composition that is specifically decomposed by an enzyme in the intestine).

[0105] When used as a pharmaceutical composition, it may further contain a known substance for treating, preventing or improving a disease caused by trypsin activity (eg, an anti-inflammatory agent, an immunosuppressant), or it may be used in combination with such a substance.

[0106] When the composition of the present invention is used as a food and drink, the food and drink can be, for example, a health food, a functional food, a specific health food, a nutritional functional food, a functional labeling food, a nutritional supplement, a patient's food, or an animal feed. As a specific example of food and drink, liquid foods such as fermented beverages, products containing oil, soups, milk beverages, refreshing drinks, tea beverages, alcoholic beverages, beverages, and jelly beverages can be cited, foods containing carbohydrates, livestock processed foods, and aquatic processed foods; vegetable processed foods, semi-solid foods, fermented foods, snacks, retort products, microwave oven corresponding foods, etc. can also be cited as healthy food and drinks prepared into powders, granules, tablets, capsules, liquid, paste or jelly. Wherein, the manufacture of the food and drink in the present invention can be carried out by manufacturing techniques known in the art. In the food and drink, effective ingredients (for example, nutrients, etc.) for improving or preventing diseases caused by trypsin activity can also be added. In addition, multifunctional food and drinks can also be made by combining with other ingredients or other functional foods that play functions other than the improvement, etc.

[0107] The product (drug, quasi-drug, food and drink, reagent, etc.) of the composition of the present invention or its instructions may be accompanied by a mark for the purpose of inhibiting trypsin activity, or for treating, improving or preventing diseases caused by trypsin activity. In addition, regarding food and drink, it can be a food and drink obtained by attaching a mark of health function to the product of the composition of the present invention, etc., as a health function food (specific health food, nutritional function food, functionally labeled food), in order to distinguish it from general food in terms of form and object, etc. "additional mark on the product or instructions" refers to additional mark on the body, container, packaging, etc. of the product, or additional mark on the instructions, additional documents, propaganda, other printed materials, etc. that disclose the information of the product. In addition, the composition of the present invention can also be in the form of a kit.

[0108] In addition, as described above, the above-mentioned bacteria, etc. can be used to prepare pharmaceutical compositions by known formulation techniques. Therefore, the present invention also provides the use of the intestinal bacteria, etc. of the present invention for preparing pharmaceutical compositions for treating, ameliorating or preventing diseases caused by trypsin activity.

[0109] <Treatment methods for diseases caused by trypsin activity, etc.>

[0110] The present invention also provides a method for inhibiting trypsin activity in a subject, a method for inhibiting immunity in the subject, or a method for treating, ameliorating or preventing a disease caused by trypsin activity in the subject, characterized in that the subject is caused to ingest the above-mentioned composition, or the above-mentioned bacteria that are the active ingredients of these compositions (hereinafter also referred to as "the pharmaceutical composition of the present invention, etc. or the active ingredients of these compositions, etc.").

[0111] In the present invention, "diseases caused by trypsin activity" refers to diseases induced by trypsin activity, and examples thereof include inflammatory bowel diseases (ulcerative colitis, Crohn's disease, chronic inflammatory bowel diseases such as inflammatory bowel disease, etc.).

[0112] In the present invention, "treatment and improvement" include not only complete recovery from the above-mentioned disease, but also alleviation of the symptoms of the above-mentioned disease, or inhibition of its progression. "Prevention" includes inhibition or delay of the onset of the above-mentioned disease, and inhibition of its recurrence.

[0113] The pharmaceutical compositions of the present invention or their active ingredients can be used for animals including humans, and there is no particular limitation on animals other than humans, and various livestock, poultry, pets, experimental animals, etc. can be used as subjects. In addition, the subjects for ingestion of the pharmaceutical compositions of the present invention or their active ingredients include not only subjects suffering from diseases caused by trypsin activity, but also subjects who may suffer from the diseases, and subjects whose symptoms of the diseases are relieved or disappear (relieved).

[0114] The method for taking the pharmaceutical compositions of the present invention or their active ingredients is not particularly limited, and may be oral administration or parenteral administration (for example, administration into the intestine). In the case of oral administration, from the viewpoint of further improving the effects of the pharmaceutical compositions of the present invention or their active ingredients, the subject of ingestion of the pharmaceutical compositions of the present invention or their active ingredients is preferably one that has previously reduced gastric acid production by taking a proton pump inhibitor (PPI) or the like.

[0115] In addition, when taking the pharmaceutical compositions of the present invention or the active ingredients of these compositions, a person skilled in the art can appropriately select the intake amount according to the age, weight, symptoms of the disease, health status, type of composition (drugs, food, etc.), intake method, etc. of the subject.

[0116] Preferred embodiments of the composition or method for treating, ameliorating, or preventing a disease caused by trypsin activity of the present invention have been described above, but the composition or method is not limited to the above embodiments.

[0117] As shown in the examples described below, administration of bacteria belonging to the genus Paraprevotella, Parabacteroides merdae, and Bacteroides uniformis confirmed a tendency to suppress the onset of colitis in a model in which IL-10 gene-deficient mice were infected with Enterobacter aerogenes to induce colitis. In addition, the onset of colitis was significantly suppressed in a DSS-induced colitis model.

[0118] Therefore, the present invention also provides a pharmaceutical composition and method for treating, ameliorating or preventing the following diseases caused by trypsin activity.

[0119] A pharmaceutical composition for treating, ameliorating or preventing a disease caused by trypsin activity, comprising as an active ingredient at least one bacterium selected from bacteria belonging to the genus Paraprevotella, Parabacteroides merdae and Bacteroides uniformis.

[0120] A method for treating, ameliorating or preventing a disease caused by trypsin activity in a subject by causing the subject to ingest at least one bacterium selected from the group consisting of bacteria belonging to the genus Paraprevotella, Parabacteroides merdae and Bacteroides uniformis.

[0121] <New bacteria>

[0122] As shown in the examples described below, the following three strains are Staphylococcus aureus strains isolated and cultured for the first time by the present inventors. In addition, their usefulness is also as described above. Therefore, the present invention also provides the following strains.

[0123] A bacterial strain belonging to Paraprevotella clara identified by accession number NITE BP-02775 (Parapprevotella clara 1C4 strain).

[0124] A bacterial strain (Parabacteroides merdae 1D4 strain) belonging to Parabacteroides merdae identified by accession number NITE BP-02776.

[0125] A bacterial strain belonging to Bacteroides uniformis (Bacteroides uniformis 3H3 strain) specified by accession number NITE BP-02777.

[0126] In addition, any bacterial strain was entrusted to the National Institute of Technology Evaluation (NITE) Patent Microbial Collection Center ( Preserved in Room 122, 2-5-8, Kazusa-Kamatari, Kisarazu City, Chiba Prefecture.

[0127] Example

[0128] Hereinafter, the present invention will be described in more detail based on examples, but the present invention is not limited to the following examples. In addition, this example was carried out using the materials and methods shown below.

[0129] (Germ-free mice)

[0130] C57BL / 6N Jcl gnotobiotic mice (Japan Kuraia Co., Ltd., 4 to 8 weeks old) were housed in a plastic isolator for breeding (sterile isolator, ICM-1B, Ishiem Co., Ltd.) with free access to food and water for more than one week to acclimate to the environment.

[0131] (SPF mice)

[0132] C57BL / 6N SPF mice (4-8 weeks old) were obtained from the RIKEN Bioresource Research Center, Japan SLC Co., Ltd., Japan Cura Co., Ltd., or Japan Chills Liber Co., Ltd. and housed in an SPF environment with free access to food and water for more than one week to acclimate them to the environment.

[0133] (Proteome analysis of cecal contents)

[0134] The mice were killed under isoflurane anesthesia, and the cecal contents were collected and stored at -80°C. The frozen samples were thawed on ice, and 5 times the weight of RIPA Lysis Buffer with protease inhibitor cocktail (Cosmo Bio Co., Ltd.; AKR-190) was added and stirred thoroughly. The supernatant containing dissolved proteins was obtained by centrifugation at 4°C and 15,000×g for 20 minutes.

[0135] The protein solution was mixed with an equal volume of 30% trichloroacetic acid (TCA) solution (NAKALI TESQUE; 37211-55), left to stand at 4°C for 30 minutes, and then centrifuged at 4°C and 15,000 × g for 20 minutes to remove the supernatant to obtain a protein precipitate. Redispersion and reprecipitation in acetone were repeated twice to purify the precipitate.

[0136] 100 mM Tris-HCl pH 9.0 buffer (Nikon; 316-90385) dissolved with 12 mM sodium deoxycholate (SDC, Nakalai Test; 02889-72) and 12 mM sodium lauryl sulfate (SLS, Nakalai Test; 31623-32) was added to make the protein concentration 2.0 μg / μL, and 5 seconds of ultrasonic treatment was repeated 4 times for re-dissolution. The protein concentration was quantified by the BCA method using TaKaRa BCA Protein Assay Kit (TaKaRa Bio; T9300A), and the volume was fixed to 1.0 μg / μL.

[0137] 2 μL of 100 mM dithiothreitol (NAKALI TESQUE; 14128-91) aqueous solution was added to 20 μL of 1.0 μg / μL protein solution, and heated at 50°C for 30 minutes to reduce disulfide bonds. 2 μL of 375 mM iodoacetamide (NAKALI TESQUE; 19302-54) aqueous solution was further added and reacted at room temperature for 30 minutes to alkylate the thiol groups. 4 μL of 400 mM cysteine ​​(NAKALI TESQUE; 11548-52) aqueous solution was added and reacted for 10 minutes to quench the remaining iodoacetamide. 80 μL of a 50 mM ammonium bicarbonate (NAKALI TESQUE; 08887-54) aqueous solution, 2 μL of a 200 ng / μL lysine endopeptidase (Wako Pure Chemical Industries, Ltd.; 125-05061) solution, and 2 μL of a 200 ng / μL trypsin (Wako Pure Chemical Industries, Ltd.; 202-15951) solution were added and reacted overnight at 37°C to fragment the protein into peptides.

[0138] 30 μL of 5% trifluoroacetic acid (TFA, Nakalai Test; 34901-21) aqueous solution was added, and then 200 μL of ethyl acetate (Nakalai Test; 14747-65) was used for liquid-liquid extraction to remove SDC and SLS. The dissolved organic solvent was removed by treatment with a centrifugal evaporator. 100 μL of 0.1% TFA aqueous solution was added, and the insoluble matter was removed by centrifugation at room temperature at 15,000 × g for 15 minutes. After desalting with C18 Tips (Surfactant Science; 87782), the solution was dissolved in a 3% acetonitrile (Nacarian Test; 00430-25) and 0.1% formic acid (Nacarian Test; 08965-82) aqueous solution. LC-MS was performed using the SCIEX TripleTOF5600 system, and proteomic analysis was performed using SWATH Acquisition.

[0139] (obtained from mouse feces or feces of healthy human volunteers)

[0140] The feces of healthy volunteers #A to G or the feces of mice were diluted to 5 times their weight with 20% glycerol dissolved in PBS, filtered with a 100 μm diameter filter, and the obtained product was stored at -80°C as a storage solution.

[0141] (Determination of trypsin activity in feces)

[0142] The frozen stool samples were thawed at room temperature and then dispersed in a 0.9% NaCl aqueous solution. The trypsin activity of the supernatant was measured according to the protocol of the Protease Activity Assay Kit (Abcam ab111750).

[0143] (Preparation of mice colonized with bacteria derived from feces of healthy human volunteers)

[0144] The storage solution prepared above (obtained from mouse feces or feces of healthy human volunteers) was melted at room temperature and diluted to 10 times the volume with PBS. 200 μL of the dilution was orally administered to the stomach of sterile mice. The mice were then raised in a sterile isolation box with free drinking water and food for 1 month to allow the bacteria in the transplanted feces to colonize in the mice. In addition, for these mice, the trypsin activity was measured using the method described in the above (Measurement of trypsin activity in feces).

[0145] (Preparation of mice colonized with bacteria derived from feces of healthy human volunteers and elimination of colonized bacteria by administration of antibiotics)

[0146] In the above (Preparation of mice colonized with bacteria derived from feces of healthy human volunteers), the free drinking water was changed to a 200 mg / L aqueous solution of ampicillin, metronidazole or tylosin, and the mice were further raised for 1 month to eliminate bacteria that were not resistant to each antibiotic. Fecal samples of mice in the administration process were obtained by the method described in the above (Obtaining feces from mice or feces from healthy human volunteers), and trypsin activity was measured by the method described in the above (Measurement of trypsin activity in feces).

[0147] (DNA extraction from mouse feces)

[0148] 800 μl of 10 mM Tris / 10 mM EDTA buffer (pH 8.0, hereinafter referred to as TE10) in which 15 mg of lysozyme (Sigma-Aldrich, Lysozyme from chicken egg white; L4919) and 5 μl of RNase (ThermoFisher Scientific, PureLink RNase A (20 mg / mL); 12091-021) were dissolved was added to 100 μl of the stool sample solution filtered through a 100 μm diameter filter, and the mixture was shaken at 37°C for 1 hour. Next, 2000 U of ACHROMOPEPTIDASE (registered trademark, colorless peptidase) (Wako; 015-09951) was added, and the mixture was shaken at 37°C for 30 minutes to lyse the bacteria.

[0149] 50 μL of a 20% SDS TE10 solution and 50 μL of a TE10 solution containing 20 mg / ml proteinase K (Roche, Proteinase K, recombinant, PCR Grade; 03115852001) were added, and the mixture was shaken at 55°C for 60 minutes.

[0150] DNA was extracted by liquid-liquid extraction using phenol / chloroform / isoamyl alcohol (25:24:1) (Wako; 311-90151), and bacterial genomic DNA was obtained by ethanol precipitation.

[0151] (Bacterial flora analysis of mouse feces)

[0152] For bacterial genomic DNA, PCR reaction was performed using TaKaRa ExTaq (タカラバイオ; RR001A) to prepare 16S rDNA amplicon for Illumina Miseq sequencing. The primer sequences are as follows (Nishijima S et al DNA Res 23 125-133 2016).

[0153] 27Forward-mod:

[0154] (5'-AATGATACGGCGACCACCGAGATCTACAC**index**ACACTCTTTCCCTACACGACGCTCTTCCGATCTAGRGTTTGATYMTGGCTCAG-3')

[0155] Two sequences adjacent to the index sequence are shown in sequence numbers 10 and 11.

[0156] 338Reverse:

[0157] (5'-CAAGCAGAAGACGGCATACGAGAT**index**GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTGCTGCCTCCCGTAGGAGT-3')

[0158] Two sequences adjacent to the index sequence are shown in sequence numbers 12 and 13.

[0159] The amplicon was purified using Agencourt AMPure (registered trademark) XP (Beckman Coder; A63882) and MinElute PCR Purification Kit (Keygen; 28004), and the DNA concentration of the amplicon was quantified using Quant-iT PicoGreen (registered trademark) dsDNA Assay Kit (Sample Science; P7589) and KAPA library Quantification kit (Roche Diagnosis; 07960166001). The average DNA length of each amplicon mixture was measured using the Agilent 2100 Bioanalyzer High Sensitivity DNA Kit (Agilent Technology; 5067-4626), and the molar concentration of the amplicon was calculated. The library was denatured and the hybridization solution was prepared according to the Miseq 16SrDNA genome analysis protocol of Illumina, and sequencing was performed using Miseq (Illumina; SY-410-1003) and Miseq Reagent Kit v3 (Illumina; MS-102-3003).

[0160] For the obtained sequence data, 3000 reads with high quality were randomly selected for each sample, and bacterial community data were obtained by using the database analysis method of the operational taxonomic unit (OTU) representative sequence to assign bacterial species. The databases used were NCBI (https: / / www.ncbi.nlm.nih.gov / taxonomy) and RDP (https: / / rdp.cme.msu.edu / ), and the result with the highest homology in the TOP-HIT of GLSEARCH (https: / / nebc.nox.ac.uk / bioinformatics / docs / glsearch.html) for each database was used for bacterial species assignment (Nishijima S et al DNA Res 23 125-133 2016).

[0161] (Isolation of bacteria)

[0162] The feces sample was diluted with PBS 12 days after administration and incubated in 10% CO using the following medium: 2 The cells were cultured under anaerobic conditions and the formed colonies were isolated.

[0163] EG ext. medium, mGAM medium, Schaedler medium (Wako; 517-45805), BL medium (Nissui; 5430) CM0619 medium (Wilkins TD and Chalgren S. (1976) Antimicrob. Agents Chemother. 10. 926-928.) was used as a basic medium, and an agar plate was used in which a medium containing horse blood or horse defibrinated blood was added to a final concentration of 5%. In particular, for CM0619 medium, SR0107 selection medium or SR0108 selection medium (https: / / www.oxoid.com / UK / blue / prod_detail / prod_detail.asp?pr=CM0619) supplemented with a predetermined supplement was also used.

[0164] (Creation of phylogenetic tree)

[0165] The ape package of the statistical analysis software R (https: / / www.r-project.org / ) was used to create a phylogenetic tree based on the similarity of the 16S rDNA sequences of the 35 isolated bacteria, based on the representative sequences of the OTUs used for the classification of the bacterial community.

[0166] (Inhibition of trypsin activity in the intestine using 35 isolated bacterial species)

[0167] The isolated bacteria described above (Isolation of bacteria) were cultured in EG ext. medium, mGAM medium, Schaedler medium, BL medium or CM0619 medium at 37°C and 10% CO 2 Culture under anaerobic conditions for 1 to 3 days. Mix the bacterial solutions that have reached the stable phase in equal volumes, and orally administer 200 μL to the stomach of the germ-free mice of Example 1. Raise the mice in a sterile isolation box with free access to water and food to allow bacterial colonization. In addition, measure the trypsin activity as described above (Measurement of trypsin activity in feces).

[0168] (Spearman's rank correlation analysis)

[0169] Spearman's ordinal correlation analysis was performed on the relative occupancy of each constituent bacteria obtained by intestinal flora analysis based on 16SrDNA 12 days after feces administration and the trypsin activity value of the feces. The bacterial flora with a correlation coefficient ρ of ρ≤-0.5 between the relative occupancy of bacteria and the trypsin activity value and a P value of P<0.05 in the no correlation test was inferred to be a candidate for trypsin activity inhibitory bacteria.

[0170] (Inhibition of intestinal trypsin activity using a selected bacterial cocktail)

[0171] For the 9 strains presumed as candidate trypsin activity inhibitory bacteria in the (Spearman's rank correlation analysis), bacterial colonization mice were prepared and their intestinal trypsin activity was measured according to the method described in the above (inhibition of intestinal trypsin activity by separating 35 bacterial colonizations). In addition, the 9 strains were divided into 3 strains of the genus Bacteroides and 6 strains of non-Bacteroides, and bacterial colonization mice were prepared and their intestinal trypsin activity was measured.

[0172] (Inhibition of the occurrence of ulcerative colitis (UC)-like inflammation by colonization 6 with a trypsin activity inhibitory bacteria cocktail)

[0173] IL10- / - mice (4-8 weeks old, Jaxon Labrador) were aseptically raised according to the method described above (germ-free mice). In addition, according to the method described above (inhibition of intestinal trypsin activity using a cocktail of selected bacteria), three isolated strains of the genus Bacteroides or six strains of non-Bacteroides were orally administered to colonize them. One week after the oral administration, UC-like inflammation was induced according to the following steps. The K. aeromobilis 11E12 strain isolated from a UC patient (Atarashi K. et al Science 358, 359 2017) was cultured in Schaedler medium at 37°C and 10% CO 2 After 1-3 days of anaerobic culture, the bacterial solution will reach the stable stage with 1-2×10 8 CFU / 200μl was orally administered to the stomach of mice. Next, the mice were further raised for 3 weeks in a sterile isolation box with free access to water and food to allow bacterial colonization. The intestinal trypsin activity was measured 3 weeks after the administration of the 11E12 strain according to the method described in the above (Measurement of trypsin activity in feces). In addition, as an indicator of inflammation, the level of lipocalin-2 in the feces was measured by ELISA (abcam; Mouse Lipocalin-2 ELISA Kit; ab199083).

[0174] (Inhibition of trypsin activity using cultured bacteria)

[0175] At 37 °C, 10% CO 2The culture medium of each of the nine bacterial species selected in the above (Spearman's rank correlation analysis) that reached a stable period after culturing for 1 to 3 days under an anaerobic environment was mixed with an equal volume of a trypsin-containing solution obtained by diluting the cecal contents of germ-free mice 50 times with sterile water, and then cultured for 12 hours under the same conditions.

[0176] Centrifuge at 10000×g for 15 minutes to obtain a supernatant that does not contain bacteria. Mix with loading buffer (BioRad; 1610739) and perform SDS-TRICINE-PAGE after mercaptoethanol reduction and heat denaturation. Next, apply voltage in Tris-glycine buffer and transfer to Immobilon-P Transfer Membrane (Merck; ISEQ07850). Use anti-Anionic trypsin-2 rabbit antibody as the primary antibody and Anti-IgG (H+L chain) (Rabbit) pAb-HRP (MBL; Code No. 458) as the secondary antibody, and use chemiluminescence through Chemi-Lumi One Super (NAKALI TESK; 02230-14) to confirm the presence or absence of Anionic trypsin-2 protein.

[0177] (Inhibition of trypsin activity by Paraprevotella)

[0178] JCM14859 (P. clara strain) and JCM14860 (P. xylaniphila strain) were obtained from the Microbial Material Development Laboratory (JCM) of the RIKEN BRC, and cultured in EG ext. medium at 37°C and 10% CO2 anaerobic environment for 1 to 3 days. The bacterial solution that reached the stable phase was treated according to the method described in the above (inhibition of trypsin activity of cultured bacteria), and the trypsin degradation activity was evaluated from the results of Western blotting.

[0179] (Cross-linking test of protein from P.clara with trypsin)

[0180] 25 μl of 150 μg / ml mPRSS2 / PBS solution, 150 μl of P.clara 1C4 strain (OD600>1.0) cultured in EGEF medium under anaerobic conditions and reaching the stable phase, and 75 μl of fresh EGEF medium were mixed and incubated at 37°C for 35 minutes. Centrifuge at room temperature and 4000×g for 5 minutes to collect the supernatant (equivalent to Fig.14The bacteria were redispersed in 800 μl of PBS and centrifuged at 4000×g at room temperature to remove the supernatant to remove the unadsorbed mPRSS2 protein. The bacteria were redispersed in 250 μl of 10 mM DSSO / PBS aqueous solution and allowed to stand at room temperature for 15 minutes to form random covalent cross-links between the bacterial structure and the adsorbate. Furthermore, 30 μl of 200 mM Tris-HCl aqueous solution (pH 8.0) was added and allowed to stand at room temperature for 5 minutes to quench the unreacted DSSO. The mixture was centrifuged at 4000×g at room temperature for 5 minutes and the supernatant was removed. The bacteria were redispersed in 800 ul of PBS and then centrifuged under the same conditions to remove the supernatant for washing. The cells were disrupted by adding a cell lysis solution consisting of 1% SDS / 10 mM Tris-HCl (pH 8.0) / 5 mM EDTA, and then centrifuged at 4°C and 20,000 × g for 5 minutes to obtain a cell disruption solution (equivalent to Fig.14 The supernatant sample and the Pellet sample were subjected to Western blotting, and the mPRSS2-specific antibody was detected by chemiluminescence to detect the protein bound to mPRSS2. In addition, the reagents used in this method are as follows.

[0181] mPRSS2: Mouse recombinant PRSS2 protein (His Tag) (Sino biological 50383-M08H)

[0182] DSSO: bis(succinimidyl sulfoxide) (A33545 from Thermo Fisher Scientific)

[0183] SDS: Prepared from 10%-SDS solution (Nakura Corporation 30562-04)

[0184] Tris-HCl: prepared from 1 mol / l Tris-HCl buffer (pH 8.0) (Nacalai Test Co., Ltd. 06938-44)

[0185] EDTA: prepared from 0.5 mol / l-EDTA solution (pH 8.0) (Nacalai Test Co., Ltd. 06894-14)

[0186] PBS: Dulbecco's phosphate buffered saline (without Ca and Mg) (Nacalai Test Co., Ltd. 14249-95)

[0187] Primary antibodies for WB detection: Anti-6-His, Rabbit-Poly (Funacosi A190-114A, used at a 400-fold dilution)

[0188] Secondary antibody for WB detection: Anti-IgG (Rabbit) pAb-HRP (MBL Code No. 458, used at a 400-fold dilution)

[0189] Reagents for WB detection: Kemin L (Nanotech Co., Ltd. 07880-54).

[0190] (Trypsin activity inhibition test)

[0191] A DMSO solution of 5 times the molar amount of TLCK was added to a 1 mg / ml hPRSS2 / PBS aqueous solution, and the mixture was allowed to stand at room temperature for 3 hours to prepare TLCK-hPRSS2 modified with TLCK and without trypsin activity. Unreacted TLCK was removed by Sephadex-G25 column chromatography, and TCLK-hPRSS2 was purified by concentration using an ultrafiltration membrane. P. clara bacteria that had reached a stable period by culturing in EGEF medium under anaerobic conditions were centrifuged at room temperature and 4000×g for 5 minutes, and the bacteria were redispersed in PBS, and then centrifuged and supernatant removed under the same conditions were repeated once to obtain bacteria from which the EGEF medium components had been removed. The bacteria dispersed in PBS were mixed with a TCLK-hPRSS2 / PBS solution and allowed to stand for 3 hours at 37°C under anaerobic conditions with 20 ng / μl TLCK-hPRSS2 and a bacterial concentration of OD=0.9. The bacterial solution was centrifuged at room temperature and 4000×g for 5 minutes, and hPRSS2 in the supernatant was detected by Western blotting. The reagents used in this method are as follows.

[0192] hPRSS2: Human PRSS2 / trypsin 2 protein (recombinant) (LSBio LS-G20167-5)

[0193] TLCK: Trypsin inhibitor tosyl-L-lysyl-chloromethane hydrochloride (ABCAM ab144542)

[0194] Sephadex-G25: Pyrotechnic PD-10 column (GE Pharmaceuticals 17085101)

[0195] Primary antibody for WB detection: Anti-PRSS2 / Trypsin 2antibody IHC-plus (LS-B15185-50 from LSBio, used at a 400-fold dilution)

[0196] Secondary antibody for WB detection: Anti-IgG (Rabbit) pAb-HRP (MBL Code No. 458, used at a 400-fold dilution)

[0197] Reagents for WB detection: Kemin L (Nanotech Co., Ltd. 07880-54).

[0198] (Example 1)

[0199] [Active trypsin is more abundant in the feces of germ-free mice]

[0200] Comprehensive protein analysis (shotgun proteomics, proteome analysis) of the cecal contents of SPF mice (RIKEN SPF mice) and GF mice maintained at the RIKEN Institute of Physical and Chemical Research was performed.

[0201] Although the results are not shown in the figure, 713 host-derived proteins were detected, of which 45 proteins were significantly abundant in the cecal contents of GF mice. Among these, the protease trypsin (Anionic trypsin-2: PRSS2) was particularly abundant and reported to be associated with IBD.

[0202] Next, the trypsin activity in the feces of RIKEN SPF mice and GF mice was measured and the amount of protein was evaluated by Western blotting (WB).

[0203] Although the results are not shown in the figure, trypsin activity was significantly higher in GF mice than in RIKEN SPF mice. In addition, the amount of trypsin protein was higher in GF mice. Furthermore, the intestinal sections of the distal large intestine of RIKEN SPF mice and GF mice were observed by immunohistochemical staining, and the results showed that trypsin was present in large quantities in GF mice.

[0204] From the above, it was found that a larger amount of active trypsin was present in the large intestine beyond the cecum of GF mice than in RIKEN SPF mice.

[0205] [Active trypsin is abundant in feces of inflammatory bowel disease and inflammation model mice]

[0206] The activity of trypsin and the amount of protein thereof were measured in stool samples of IBD patients suffering from ulcerative colitis (UC) and Crohn's disease (CD) in Japan. As a comparison object, stool samples of healthy volunteers in Japan were evaluated. Although the results are not shown in the figure, significantly more active trypsin was found in the stool of patients with UC and CD compared with the stool of healthy volunteers.

[0207] In addition, the trypsin activity in the feces of IL-10 gene-deficient mice (IL10- / - mice) known as colitis model mice during inflammation was evaluated, and the result showed that the trypsin activity was significantly higher than that in the feces of WT mice. It was reported that the active trypsin remaining in the large intestine may be related to the onset of IBD and the deterioration of its morbidity. The above series of results support the existing reports.

[0208] [Active trypsin activity in GF mice remains beyond the cecum]

[0209] The trypsin activity in different parts of the digestive tract of Riken SPF mice and GF mice was compared. Although the results are not shown in the figure, no significant difference was found between the two in the small intestine, but the GF mice had significantly higher levels in the cecum and beyond. In addition, the expression and secretion of trypsin precursor trypsinogen (PRSS2) in the pancreatic tissue, which is mainly responsible for the secretion of trypsin, were confirmed by RT-qPCR and WB, and no significant difference was found between the two.

[0210] Based on a series of results, the hyperactivity of trypsin in the cecum of GF mice is caused by the abnormal residual trypsin normally secreted by pancreatic tissue. As one of the main causes, the involvement of intestinal bacteria colonized in the cecum is considered. That is, it is assumed that in SPF mice, intestinal bacteria colonized in the cecum have the function of reducing active trypsin, and in GF mice, since there are no intestinal bacteria, active trypsin remains.

[0211] [Intestinal flora beyond the cecum of mice affects their trypsin activity]

[0212] It is known that the intestinal flora of SPF mice is maintained uniquely according to each breeding facility. Therefore, in order to evaluate the correlation between the intestinal bacteria colonized beyond the cecum and their trypsin activity, the trypsin activity and its flora in the cecal contents were evaluated for SPF mice from different breeding facilities. Riken SPF mice were compared with SPF mice maintained by Japan Escellence Co., Ltd., Japan Charls Liber Co., Ltd., and Japan Clea Co., Ltd. (hereinafter, SLC SPF mice, Charles SPF mice, and Clea SPF mice).

[0213] The results are as follows Figure 1As shown, trypsin activity in cecal contents was at a similarly low level in RIKEN SPF mice and SLC SPF mice, but significantly higher in Charles SPF and Clea SPF mice than in the mice from the former two facilities. In addition, although not shown, significant differences in UniFrac-PCoA were found between the two groups of RIKEN SPF mice and SLC SPF mice, and the two groups of Charles SPF mice and Clea SPF mice. Based on the above, differences in intestinal flora accompanied by differences in feeding environments affect trypsin activity beyond the cecum. This suggests that specific intestinal bacterial species may reduce trypsin activity.

[0214] [Healthy intestinal bacteria reduce trypsin activity in mice]

[0215] The above studies suggest that specific intestinal bacterial species may reduce trypsin activity beyond the cecum, which is suspected to be involved in colon inflammation, in mice. Based on the hypothesis, by colonizing specific intestinal bacterial species beyond the cecum, trypsin activity can be inhibited, and colon inflammation is expected to be alleviated. Therefore, in anticipation of future clinical applications, the control of trypsin activity using human-derived intestinal bacteria was studied.

[0216] First, feces of Japanese healthy volunteers (donors A to F) were orally and intragastrically administered to GF mice to prepare humanized mice (A to F), and trypsin activity in the feces was evaluated.

[0217] The results are as follows Figure 3 As shown, except for B, the trypsin activity in the mouse feces was at a level as low as that of the RIKEN SPF mice. This indicates that there are intestinal bacteria of human origin that reduce the activity of mouse trypsin.

[0218] (Example 2)

[0219] [35 strains derived from feces of healthy people reduce trypsin activity in mouse feces]

[0220] The feces of healthy volunteer C, which showed particularly low trypsin activity in the above study, were used to search for bacterial species that reduce trypsin activity beyond the cecum. Feces of healthy volunteer C were orally and intragastrically administered to GF mice, and antibiotics such as ampicillin (Amp), tylosin (Tylosin), or metronidazole (MNZ) were freely administered through drinking water starting 24 hours later.

[0221] The results are as follows Figure 4As shown in the results, in the antibiotic non-administration group and the ampicillin administration group, the trypsin activity in the feces was significantly reduced compared to before the administration of bacteria. On the other hand, in the tylosin administration group and the metronidazole administration group, the trypsin activity in the feces was maintained at a high level. From the above results, it was determined that the intestinal bacterial species that reduced the trypsin activity were the species that were resistant to ampicillin and sensitive to tylosin and metronidazole.

[0222] Next, the cecal contents of the individual with the greatest reduction in trypsin activity in the ampicillin-administered group were cultured in an anaerobic chamber in culture media of different compositions, and a total of 432 colonies were obtained. The results of strain comparison based on 16S rRNA analysis are shown in Figure 2. Figure 5 As shown, 35 strains of human intestinal bacteria derived from the feces of donor C were identified.

[0223] Since the isolated 35 strains accounted for about 80% of the bacterial species constituting the intestinal flora of the feces of donor C, it was expected that administration to GF mice would form a flora and environment similar to that in the intestine of donor C. Therefore, a bacterial solution obtained by culturing and mixing the 35 strains (hereinafter referred to as 35-mix) was orally and intragastrically administered to GF mice, and the trypsin activity beyond the cecum was evaluated over time.

[0224] The results are as follows Figure 6 As shown in the figure, the trypsin activity value in the feces decreased significantly 2 days after the administration of 35-mix. Even on the 9th day after the administration, the amount of active trypsin in the feces was maintained at a low level. From the above results, it can be judged that the activity of trypsin in the cecum and beyond of mice is reduced when 35-mix is ​​administered.

[0225] [Nine strains isolated from feces of healthy individuals reduce trypsin activity in mouse feces]

[0226] Among the 35 strains that have the function of reducing trypsin activity, the responsible bacteria for this function were identified. Specifically, in a study in which GF mice were colonized with bacteria derived from the feces of a healthy volunteer donor C while various antibiotics were administered, a Spearman ordinal correlation analysis was performed between the relative occupancy of intestinal bacteria based on 16SrRNA analysis and the trypsin activity value in the feces 12 days after the antibiotic administration.

[0227] The result is Figure 7Among the strains that showed a negative correlation with trypsin activity in feces in the Spearman ordinal correlation analysis shown in the figure, 9 strains with a significant probability of correlation coefficient p < 0.05 were particularly focused on. Next, the bacterial solution obtained by culturing and mixing the 9 strains (hereinafter referred to as 9-mix) was orally administered to GF mice, and the trypsin activity and protein content in feces were evaluated. The results are as follows Figure 8 As shown, in the 9-mix administration group, the trypsin activity in the feces was significantly reduced. In addition, although not shown in the figure, the amount of active trypsin protein was reduced to below the detection limit of WB. The above results suggest that the responsible bacteria are included in the 9 strains.

[0228] [Three strains isolated from the feces of healthy individuals reduce trypsin activity in mouse feces]

[0229] The above 9 strains Fig. 9 As shown, it can be classified into a group containing 3 strains of Bacteroides and 6 strains of non-Bacteroides. Considering that the function of reducing the activity of trypsin is systematically conservative, the responsible bacteria should only be included in the group of either party. Therefore, similarly to the above-mentioned study, the group of Bacteroides administered with the former (hereinafter, 3-mix administered group) and the group of non-Bacteroides administered with the latter (hereinafter, 6-mix administered group) were evaluated.

[0230] The results are as follows Figure 8 As shown, trypsin activity in feces decreased significantly in the 3-mix administration group, but did not decrease in the 6-mix administration group. The above results suggest that the responsible bacteria are included in the above three strains.

[0231] [Paraprevotella clara isolated from feces of healthy subjects reduces the amount of trypsin in mice]

[0232] In order to further identify the responsible bacteria, trypsin was allowed to coexist with bacteria cultured alone in vitro, and changes in the amount of trypsin protein were evaluated.

[0233] First, His-tag modified recombinant mouse trypsin was co-cultured with 9-mix, 6-mix or 3-mix identified as the candidate responsible bacteria in an anaerobic chamber, and the amount of trypsin protein in the culture solution after 12 hours was evaluated.

[0234] Although the results are not shown in the figure, a reduction in trypsin was confirmed in the co-culture with 9-mix or 3-mix, but not in the co-culture with 6-mix. This result is consistent with the results of the above-mentioned in vivo study on the locking of the responsible bacteria. That is, it is believed that this in vitro evaluation method is effective for further locking of the responsible bacteria. In addition, the results of the in vitro evaluation are consistent with the results of the above-mentioned in vivo evaluation, suggesting that in the mechanism of reduced trypsin activity, the host's large intestinal tissue is not involved, only bacteria are involved.

[0235] Next, each of the bacteria constituting the 9-mix was co-cultured with trypsin as a single bacterium and evaluated in the same manner. Fig.10 As shown, a decrease in the amount of trypsin protein was observed only in the case of co-culture with the P. clara 1C4 strain constituting 3-mix.

[0236] Based on a series of evaluation results, it was determined that the P. clara 1C4 strain derived from the feces of donor C was the responsible bacterium for reducing the amount of trypsin protein in mice.

[0237] [Paraprevotella clara reduces the amount of human trypsin protein]

[0238] As mentioned above, it was confirmed in vitro that the P.clara 1C4 strain isolated from the feces of healthy people reduces the amount of active trypsin in mice. Next, the aforementioned in vitro experimental system was applied to human trypsin to verify the effectiveness of its function. That is, in an anaerobic chamber, the P.clara 1C4 strain cultured alone was co-cultured with recombinant human trypsin, and the amount of trypsin after 12 hours was evaluated by WB. Although the results are not shown in the figure, only in the case of co-culture with the P.clara 1C4 strain, the reduction in the amount of human trypsin protein was confirmed. From the above results, it is clear that the P.clara 1C4 strain isolated from the feces of healthy people reduces the amount of human trypsin protein.

[0239] (Example 3)

[0240] [Inflammation of colon tissue is suppressed by administering a bacterial cocktail that reduces trypsin activity]

[0241] Using colitis model mice, the possibility of relieving inflammation of the three strains (3-mix) identified was studied. The IL10- / - colitis onset model and the DSS-induced model were selected for colitis model mice. For the former, a model was used in which IL10- / - mice were sterilized and then infected with the Enterobacter aerogenes 11E12 strain, which is a colitis-inducing bacterium isolated from the feces of UC patients.

[0242] 3-mix, which reduces trypsin activity, or 6-mix, which does not participate in trypsin activity, was orally administered to IL10- / -GF mice intragastrically, and 7 days later, a culture solution of Enterobacter aerogenes 11E12 strain was similarly administered to induce colitis. Trypsin activity in feces was evaluated until 3 weeks after administration. In addition, the degree of inflammation induced until 3 weeks after administration was evaluated by the concentration of lipocalin in the feces and the inflammation score based on the histological observation of the large intestine.

[0243] The results are as follows Fig.11 As shown in the figure, high trypsin activity in feces was confirmed in the 11E12 strain-administered group and the 11E12 strain and 6-mix-administered group, whereas trypsin activity was suppressed to a low level in the 11E12 strain and 3-mix-administered group. Fig.12 As shown, the lipocalin concentration in the feces of the 3-mix administration group tended to be lower than that of the 6-mix administration group. Furthermore, although not shown in the figure, the histological inflammation score was also significantly low.

[0244] The same study was conducted on DSS-induced model mice. GF mice were administered 3-mix or 6-mix, and from 14 days later, 2.0% DSS aqueous solution was administered through free drinking water for 7 days to induce colitis. The degree of inflammation induced until 10 days after DSS administration was evaluated by changes in body weight, inflammation scores based on histological observations of the large intestine, and the expression levels of inflammatory markers. As a result, the proportion of weight loss in the 3-mix administration group was lower than that in the 6-mix administration group. In addition, the expression levels of various inflammatory marker genes represented by TNF-α and IL6 were also significantly low.

[0245] Judging from the above research results, the inflammation of the large intestine tissue is suppressed when 3-mix is ​​administered.

[0246] (Example 4)

[0247] [Paraprevotella reduces trypsin activity]

[0248] The function of reducing trypsin activity identified in P. clara strain 1C4 was evaluated for conservation in related strains.

[0249] The ability to reduce trypsin activity in vitro was verified for P. clara JCM14859 strain obtained from the Microbial Material Development Laboratory of RIKEN BRC and Paraprevotella xylaniphila (P. xylaniphila) JCM14860 strain, the other of the two species belonging to the genus Paraprevotella in the phylogenetic tree classification as of November 2018. The trypsin solution derived from the cecal contents of mice was mixed with the culture solution of each bacteria, incubated under anaerobic conditions for 12 hours, and then the amount of active trypsin protein was evaluated by WB.

[0250] The results are as follows Fig.13 As shown, the amount of trypsin protein was below the detection limit of WB in the case of mixing with any Paraprevotella strain.

[0251] Based on the above results, all bacterial species classified as Paraprevotella in the phylogenetic tree classification as of November 2018 reduced the amount of mouse-derived active trypsin.

[0252] (Example 5)

[0253] [Cross-linking test]

[0254] like Fig.14 As shown, when mPRSS2 and P.clara bacteria were mixed, a band was detected around 250 kDa only when cross-linking was formed with DSSO. Since this was not included in mPRSS2 and was not confirmed when cross-linking was formed, it was presumed to be a complex protein composed of mPRSS2 and the constituent proteins of P.clara bacteria. Considering that mPRSS2 is a protein of about 32 kDa, it is considered that trypsin is preferentially adsorbed or bound to the protein of about 220 kDa constituting P.clara bacteria.

[0255] From these results, it is considered that the protein degradation phenomenon of trypsin is induced on specific proteins possessed by Paraprevotella bacteria, accompanied by the binding phenomenon of trypsin.

[0256] [Trypsin activity inhibition test]

[0257] like Fig.15As shown, when hPRSS2 without modification of LCK inhibitor was mixed with Paraprevotella bacteria, the hPRSS2-derived band became thinner and the degradation of hPRSS2 was induced. On the other hand, in the case of TLCK-hPRSS2 that was modified with TLCK and lost the trypsin activity, the degradation of hPRSS2 was not induced. Considering that TLCK is a trypsin activity inhibitor based on irreversible binding, it is believed that the degradation of trypsin produced by Paraprevotella bacteria is achieved by promoting the self-degradation of trypsin.

[0258] From the results of the above [crosslinking test] and [trypsin activity inhibition test], it is considered that the degradation by trypsin produced by Paraprevotella bacteria is induced by the binding of trypsin protein to a specific protein of the bacteria based on the promoting effect of trypsin's own degradation.

[0259] Industrial Availability

[0260] As described above, according to the present invention, trypsin activity can be inhibited, and therefore, it is useful for the treatment and prevention of diseases caused by trypsin activity (inflammatory bowel diseases such as ulcerative colitis and Crohn's disease).

[0261] Accession number

[0262] (1) Identification mark: 1C4

[0263] (2) Accession number: NITE BP-02775

[0264] (3) Storage date: August 30, 2018

[0265] (4) Depository: National Institute of Technology Evaluation

[0266] (1) Identification mark: 1D4

[0267] (2) Accession number: NITE BP-02776

[0268] (3) Storage date: August 30, 2018

[0269] (4) Depository: National Institute of Technology Evaluation

[0270] (1) Identification mark: 3H3

[0271] (2) Accession number: NITE BP-02777

[0272] (3) Storage date: August 30, 2018

[0273] (4) Depository: National Institute of Technology Evaluation

Claims

1. Use of a bacterium belonging to the genus Paraprevotella for the manufacture of a composition for inhibiting trypsin activity, The bacteria belonging to the genus Paraprevotella are selected from A bacterial strain belonging to Paraprevotella clara identified by the accession number NITE BP-02775, Paraprevotella clara JCM14859 T Zhuhe Paraprevotella xylaniphila JCM14860 T strain at least one bacterial strain.

2. The method according to claim 1, further comprising using at least one bacterium selected from Parabacteroides merdae and Bacteroides uniformis, The Parabacteroides merdae is a bacterial strain belonging to Parabacteroides merdae specified by the deposit number NITE BP-02776, and the Bacteroides uniformis is a bacterial strain belonging to Bacteroides uniformis specified by the deposit number NITE BP-02777.

Images