Vector containing target nucleic acid of AIMP2-DX2 and miR-142 and its use

Abstract

The present invention relates to recombinant vectors comprising AIMP2 splice variants and miR-142 target nucleic acids and various applications thereof. The AIMP2 variants can be specifically expressed in neuronal cells and brain tissue, and thus can be beneficially applied in related industries.

Description

[0001] References to electronically submitted sequence listings

[0002] An electronically submitted ASCII text file sequence listing is submitted with this application, and the contents of the sequence listing (name: 2493-0003WO01-Sequence Listing_ST25.txt; size: 6Kb; creation date: March 16, 2020) are incorporated herein by reference in their entirety. Technical Field

[0003] Disclosed herein are vectors comprising target sequences of AIMP2-DX2 and miR-142 and uses thereof. Background Art

[0004] The mammalian brain undergoes a series of processes, including the division, differentiation, survival, and death of neuronal stem cells, as well as synapse formation, to establish a systematic neural network to perform complex functions. Neurons in the animal brain continuously produce large amounts of substances necessary for neural growth, even in their mature state, thereby inducing the growth of axons and dendrites. Furthermore, synaptic remodeling and synaptic connections within the neural network are constantly occurring whenever new learning and memory is performed, so it can be said that neurons are continuously undergoing differentiation. If neurons fail to receive target-derived survival factors (such as nerve growth factor) during cell differentiation and synapse formation, they will undergo apoptosis. Apoptosis caused by stress and cytotoxic agents is a major cause of degenerative brain diseases. Unlike the central nervous system, when an animal's peripheral nervous system is injured, axons regenerate over a long period of time. Axons on the dorsal side of the damaged nerve degenerate through a process called Wallerian degeneration, while the nerve cell body resumes axonal regrowth. Simultaneously, Schwann cells regenerate after undergoing a regenerative process, including survival and death after further division and differentiation, identifying the target nerve.

[0005] Worldwide, with the rapid increase of the elderly population, the occurrence of neurodegenerative diseases has a trend of continuous increase every year. Since clear prevention and treatment methods have not yet been found, there is still no medicine with excellent efficacy in treating such diseases. In addition, the existing drugs and therapies for these diseases often show the side effects and toxicity caused by long-term administration. In addition, since they only have the effect of temporarily alleviating the degree of symptoms or delaying the progression of symptoms rather than completely treating the disease, there is an urgent need to dig and develop substances with decisive therapeutic effects while reducing side effects and toxicity.

[0006] Since the first clinical trials began in 1990, approximately 600 gene therapy clinical trials have been conducted on human subjects as of 2002, and many are still ongoing. With the completion of the human genome sequence in 2003, the discovery of various genes will accelerate the development of new gene therapies. However, 75% of approved gene therapies to date target single-gene diseases, such as cancer or cystic fibrosis, and there is no active development of gene therapy drugs for neurological disorders or regeneration (Recombinant DNA consultation paper of NIH, USA (2002); Gene Therapy Clinical Trials, J. Gene Med. (2002) www.wiley.co.uk / genmed). However, attempts have been made to develop gene therapies for treating and regenerating sensory neurons in Parkinson's disease by using nerve growth factors such as NT-3 and glial cell line-derived neurotrophic factor (GDNF). (GDNF family ligands activate multiple events during axonal growth in mature sensory neurons (Mol. Cell. Neurosci. 25: 4453-4459 (2004)). Since overall neuroscience research on brain functions related to nervous system disorders has been slow, the development of therapeutic drugs for various chronic nervous system disorders has also faced difficulties.

[0007] AIMP2-DX2, an alternatively spliced ​​variant of AIMP2 (AIMP2 is a tumor suppressor associated with apoptosis in many ways), is known to inhibit apoptosis by hindering AIMP2's function. This is achieved by controlling TNF-α-induced apoptosis caused by AIMP2 / p38-mediated TRAF2 ubiquitination. AIMP2-DX2, a spliced ​​variant of AIMP2 / p38, acts as a competitive inhibitor of AIMP2, suppressing TNF-α-induced apoptosis by inhibiting TRAF2 ubiquitination and suppressing the expression of the inflammatory marker Cox-2, thereby promoting tumorigenesis. Furthermore, AIMP2-DX2 has been reported to be a known lung cancer inducer, and existing studies have shown that AIMP2-DX2 (a variant of AIMP2) is widely present in cancer cells and induces cancer by interfering with AIMP2's cancer-suppressing function. Furthermore, it has been found that the presence of AIMP2-DX2 in normal cells can cause cells to become cancerous, while inhibiting the presence of AIMP2-DX2 can inhibit cancer growth, demonstrating a therapeutic effect.

[0008] It has also been determined that AIMP2-DX2 can be used to treat neuronal diseases (KR10-2015-0140723 (2017) and US2019 / 0298858 (published on October 23, 2019). Summary of the Invention

[0009] Recombinant vectors containing miR-142 targeting sequences (eg, miR-142-3p and / or miR-142-5p target nucleic acids) can selectively control the expression of AIMP2 splice variants in neurons and brain tissues.

[0010] Disclosed herein are recombinant vectors comprising an AIMP2 variant with exon 2 deletion (AIMP2-DX2) gene and a miR-142 target nucleic acid.

[0011] The vector may further comprise a promoter operably linked to AIMP2-DX2. The promoter may be a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, a RPE65 promoter, or an opsin promoter.

[0012] The miR-142 target nucleic acid may be at the 3' end of the AIMP2-DX2 gene. The miR-142 target nucleic acid may be at the 5' end of the AIMP2-DX2 gene.

[0013] The AIMP2-DX2 gene may have a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2. The AIMP2-DX2 gene may have a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2.

[0014] The AIMP2-DX2 gene may have a nucleotide sequence that is at least 90% identical to the nucleotide sequence of SEQ ID NO: 1. The AIMP2-DX2 gene may have a nucleotide sequence of SEQ ID NO: 1.

[0015] The miR-142 target nucleic acid may comprise a nucleotide sequence comprising ACACTA.The miR-142 target nucleic acid may comprise a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO:5.

[0016] The miR-142 target nucleic acid may comprise a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA; miR-142-3p). The miR-142 target nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 5.

[0017] The miR-142 target nucleic acid may comprise a nucleotide sequence comprising ACTTTA.The miR-142 target nucleic acid may comprise a nucleotide sequence comprising ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO:7.

[0018] The miR-142 target nucleic acid may comprise a nucleotide sequence that is at least 50% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG; miR-142-5p).The miR-142 target nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 7.

[0019] The miR-142 target nucleic acid can be repeated 2-10 times.

[0020] The vector can be a viral vector. The viral vector can be an adenovirus, an adeno-associated virus, a lentivirus, a retrovirus, a human immunodeficiency virus (HIV), MLV (murine leukemia virus), ASLV (avian sarcoma / leukemia), SNV (spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus) or a herpes simplex virus vector. The viral vector can be an adeno-associated virus (AAV), an adenovirus, a lentivirus, a retrovirus, a vaccinia virus or a herpes simplex virus vector.

[0021] Also disclosed herein are methods of treating a neuronal disease in a subject in need thereof comprising administering any of the vectors described herein.

[0022] The neuronal disease can be amyotrophic lateral sclerosis (ALS), Alzheimer's disease, Parkinson's disease, retinal degeneration, mild cognitive impairment, multi-infarct dementia, frontotemporal dementia, Lewy body dementia, Huntington's chorea, degenerative neurological disease, metabolic brain disease, depression, epilepsy, multiple sclerosis, cortical basal degeneration, multiple system atrophy, progressive supranuclear palsy, dentate red nucleus pallidum Lewy body atrophy, spinocerebellar ataxia, primary lateral sclerosis, spinal muscular atrophy or stroke. The neuronal disease can be ALS.

[0023] Treatment may improve motor activity or extend the lifespan of the subject.

[0024] The vector can be administered to the brain or spinal cord.The vector can be administered to the brain by stereotactic injection.

[0025] The purpose of the present invention is to provide a recombinant vector containing the target sequence of miR-142-3p.

[0026] In addition, the present invention can provide a gene carrier comprising a recombinant vector comprising a target sequence of miR-142-3p.

[0027] In addition, the present invention can provide a method for delivering and expressing a heterologous gene in neurons, the method comprising the step of introducing a recombinant vector into an individual.

[0028] In addition, the present invention can provide 1) a promoter; 2) a base sequence encoding a target protein operably linked to the promoter; and 3) an expression cassette, wherein the expression cassette includes the target base sequence of miR-142-3p inserted into the 3'UTR of the base sequence.

[0029] Furthermore, the present invention can provide a preventive or therapeutic agent for neurodegenerative diseases, comprising a base sequence encoding an AIMP-2 splice variant with exon 2 deletion and a target base sequence of miR-142-3p linked to the 3'UTR of the base sequence.

[0030] In order to achieve the above object, the present invention provides a recombinant vector containing the target sequence of miR-142-3p.

[0031] In addition, the present invention provides a gene delivery vehicle comprising a recombinant vector comprising a target sequence of miR-142-3p.

[0032] Additionally, the present invention provides a method for delivering and expressing a heterologous gene in neurons, the method comprising the step of delivering a recombinant vector to an individual.

[0033] In addition, the present invention provides 1) a promoter; 2) a base sequence encoding a target protein operably linked to the promoter; and 3) an expression cassette, wherein the expression cassette includes a base sequence targeting miR-142-3p inserted into the 3'UTR of the base sequence.

[0034] Furthermore, the present invention provides an agent for preventing or treating a neurodegenerative disease, comprising a base sequence encoding an AIMP-2 splice variant with a deletion of exon 2 and a base sequence targeting miR-142-3p linked to the 3'UTR of the base sequence.

[0035] The recombinant vector of the present invention has the following effects: by inserting the target sequence of miR-142-3p into the terminus of AIMP2, its expression in CD45-derived cells, particularly in the lymphatic system and leukocytes, can be inhibited, thereby controlling the side effects of tumor overexpression of AIMP2 splice variants. Because AIMP2 splice variants are specifically expressed only in neurons and, among various tissues in the human body, selectively expressed only in brain tissue, they can be beneficially applied in related industries. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 The recombinant vectors of the present invention are depicted.

[0037] Figure 2 The results show that the recombinant vector of the present invention has a neuron-specific expression effect in vitro.

[0038] Figure 3 The results show that the recombinant vector of the present invention has a neuron-specific expression effect in an in vivo environment.

[0039] Figure 4 The miR142-3p target sequence with four repeats of miR142-3pT (underlined) is shown.

[0040] Figure 5A Schematic diagram of miR142-3p target sequences with 1x, 2x, and 3x repeats and mutations is shown. Figure 5B Suppression of DX2 expression by miR142-3p with 1x, 2x, and 3x repeats of miR142-3pT is shown.

[0041] Figure 6 This shows that the core binding sequence is important in DX2 inhibition. A vector with Tseq x3 repeats showed significant inhibition of DX2 ( Figure 5B DX2 construct was used as a control. Treatment with 100 pmol miR-142-3p significantly inhibited the expression of Tseq x3 vector, but not DX2 and mutant sequences.

[0042] Figure 7 Shown, qRT-PCR was performed on total RNA extracted from the spinal cord after intrathecal injection of scAAV2-DX2-miR142-3p.

[0043] Figure 8 The results show that the expression vector of the present invention has a neuron-specific expression effect in vitro. DETAILED DESCRIPTION

[0044] AIMP2-DX2 is an alternatively spliced ​​variant of the apoptosis-associated tumor suppressor AIMP2. AIMP2-DX2 is known to inhibit tumor apoptosis by suppressing the function of AIMP2.

[0045] KR 10-1067816 (2011) describes that inhibitors of AIMP2-DX2 can treat inflammatory diseases. KR 10-1067816 (2011) also discloses that AIMP2 / p38 promotes the ubiquitination of TRAF2 to regulate TNF-α-induced apoptosis, and that the splice variant of AIMP2-p38, AIMP2-DX2, acts as a competitive inhibitor of AIMP2 to inhibit the ubiquitination of TRAF2, thereby inhibiting TNF-α-induced apoptosis, thereby promoting tumorigenesis and suppressing the expression of the inflammatory marker Cox-2.

[0046] Additionally, AIMP2-DX2 has been previously identified as a lung cancer inducer. This study found that a variant of AIMP2, AIMP2-DX2, is common in cancer cells and interferes with AIMP2's cancer-suppressing function, leading to cancer. It was also found that expression of AIMP2-DX2 in normal cells leads to cancerous transformation, while inhibiting AIMP2-DX2 production inhibits cancer cell growth, resulting in a therapeutic effect. Furthermore, the study demonstrated, using animal models, that inhibition of the AIMP2-DX2 target can treat ovarian cancer that is unresponsive to conventional anticancer drugs such as paclitaxel and cisplatin. However, AIMP2-DX2 itself does not have the ability to transform normal cells into cancer.

[0047] It has also been determined that AIMP2-DX2 can treat neuronal diseases (US2019 / 0298858 A1).

[0048] Disclosed herein is a recombinant vector comprising an AIMP2 variant (AIMP2-DX2) gene with exon 2 deletion and a miR-142 target nucleic acid. The vectors described herein can specifically express DX2 in neuronal cells, but are not expressed in hematopoietic cells such as leukocytes and lymphoid cells. Therefore, the vectors described herein can be used to specifically target neuronal cells to treat neuronal diseases.

[0049] The AIMP2-DX2 polypeptide (SEQ ID NO: 2) is a splice variant of AIMP2 (SEQ ID NO: 3), in which the second exon of AIMP2 (SEQ ID NO: 4) is deleted. Specifically, the AIMP2-DX2 gene has the base sequence shown in SEQ ID NO: 1, and the AIMP2-DX2 polypeptide has the amino acid sequence shown in SEQ ID NO: 2.

[0050] In some embodiments, the AIMP2-DX2 gene can have a nucleotide sequence that encodes an amino acid sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any intervening range of % identity to SEQ ID NO: 2. The AIMP2-DX2 gene can have a nucleotide sequence that encodes the amino acid sequence of SEQ ID NO: 2.

[0051] The AIMP2-DX2 gene may have a nucleotide sequence that is at least 90% identical, at least 93% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical, at least 99% identical, or any intervening range of % identity to the nucleotide sequence of SEQ ID NO: 1. The AIMP2-DX2 gene may have the nucleotide sequence of SEQ ID NO: 1.

[0052] The miR-142 target nucleic acid can comprise a nucleotide sequence comprising ACACTA. The miR-142 target nucleic acid can comprise a nucleotide sequence comprising ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO: 5. For example, the miR-142 target nucleic acid can comprise a nucleotide sequence comprising ACACTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17 additional nucleotides that are contiguous 5' or 3' to ACACTA as shown in SEQ ID NO: 5.

[0053] The miR-142 target nucleic acid may comprise a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to the nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA; miR-142-3p). The miR-142 target nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 5.

[0054] The miR-142 target nucleic acid can comprise a nucleotide sequence comprising ACTTTA. The miR-142 target nucleic acid can comprise a nucleotide sequence comprising ACTTTA and 1-15 additional consecutive nucleotides of SEQ ID NO: 7. For example, the miR-142 target nucleic acid can comprise a nucleotide sequence comprising ACTTTA and a total of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 additional nucleotides that are consecutive 5' or 3' to the ACTTTA shown in SEQ ID NO: 7.

[0055] The miR-142 target nucleic acid may comprise a nucleotide sequence that is at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to the nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG; miR-142-5p). The miR-142 target nucleic acid may comprise the nucleotide sequence of SEQ ID NO: 7.

[0056] MicroRNA (miRNA) is a non-coding RNA molecule that controls gene expression. MiRNAs act by base pairing with complementary sequences within mRNA molecules. MiRNAs can bind to target messenger RNA (mRNA) transcripts of protein-coding genes and negatively control their translation or cause mRNA degradation. Currently, more than 2,000 human miRNAs have been identified, and the miRbase database is publicly available. Many miRNAs are expressed in a tissue-specific manner and play an important role in maintaining tissue-specific function and differentiation.

[0057] Disclosed herein are recombinant vectors that, by inserting target sequences for miR-142-3p and / or miR-142-5p into the termini of AIMP2-DX2, inhibit AIMP2-DX2 expression in CD45-positive cells, particularly in the lymphatic system and leukocytes, thereby controlling the tumor-related side effects of overexpression of AIMP2-DX2 variants. Thus, AIMP2-DX2 variants can be expressed only in neuronal cells or selectively in brain tissue, while excluding expression in other cell types or tissues.

[0058] The present invention provides a recombinant vector containing a target sequence of miR-142-3p and / or miR-142-5p. Disclosed herein is a recombinant vector containing an AIMP2 variant (AIMP2-DX2) gene with exon 2 deletion and a miR-142-3p and / or miR-142-5p target nucleic acid.

[0059] The term "recombinant vector" refers to a vector that can express a target protein or RNA in an appropriate host cell and a gene construct containing operably linked necessary control elements to enable the appropriate expression of the inserted gene.

[0060] In the present invention, the term "operably linked" refers to a functional connection between a nucleic acid expression control sequence and a nucleic acid sequence encoding a target protein or RNA to perform a general function. For example, a promoter can be operably linked to a nucleic acid sequence encoding a protein or RNA to affect the expression of the encoding nucleic acid sequence. Operable linkage with a recombinant vector can be performed using genetic recombination techniques well known in the art, as well as using site-specific DNA cleavage and ligases generally known in the art.

[0061] The recombinant vector may further comprise a promoter operably linked to AIMP2-DX2. In some embodiments, the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, a RPE65 promoter, or an opsin promoter.

[0062] The term "microRNA (miRNA)" is a non-coding RNA consisting of about 20, 21, 22, 23 or 24 nucleotides that plays a role in controlling gene expression. In the case of mammals, miRNA acts at the post-transcriptional stage of genes, and it is known that about 60% of gene expression is controlled by miRNA. miRNA plays an important role in various processes in organisms and has been disclosed to be associated with cancer, heart disease and neurological diseases. MiRNA is a single-stranded RNA, and as long as the target sequence of the miRNA can lead to the inhibition of the expression of the target gene in the pre-mature double-stranded RNA, the target sequence can be used. For example, miR-142-3p and miR-142-5p are present in miR-142, and their target nucleic acids can be used in the present invention. "miR-142" refers to both miR-142-3p and miR-142-5p, and miR-142-3p may be desired.

[0063] The miR-142 target nucleic acid can be located at the 5' or 3' end of the AIMP2-DX2 gene.

[0064] miR-142-3p is found in regions where gene translocations occur in aggressive B-cell leukemias and is known to be expressed in hematopoietic tissues (bone marrow, spleen, and thymus). Furthermore, miR-142-3p is known to be involved in the differentiation of the hematopoietic system and has been confirmed to be expressed in fetal mouse liver (a hematopoietic tissue in mice).

[0065] In some embodiments, the miR-142-3p and / or miR-142-5p target nucleic acid is repeated at least 2-10 times, at least 2-8 times, at least 2-6 times, at least 4 times, or any range or number therebetween.

[0066] As an example of implementing the present invention, miR-142-3p may include the base sequence represented by SEQ ID NO: 3. Furthermore, the sequence targeted by miR-142-3p may include the base sequence represented by SEQ ID NO: 4, which binds complementary to miR-142-3p. The miR-142-3p target sequence of the present invention comprising a complementary sequence is the base sequence represented by SEQ ID NO: 5, but is not limited thereto.

[0067] The recombinant vector may further comprise a heterologous promoter and a heterologous gene operably linked to the promoter.

[0068] The "heterologous gene" of the present invention may include a coding sequence for a target product, such as a protein or polypeptide having a biologically suitable activity, an immunogenic or antigenic protein or polypeptide, or a therapeutically active protein or polypeptide.

[0069] Polypeptides can compensate for expression defects or expression deficiencies of endogenous proteins in host cells. Gene sequences can be produced from a variety of sources, including DNA, cDNA, synthetic DNA, RNA, or combinations thereof. Gene sequences can include genomic DNA, which may or may not contain natural introns. In addition, genomic DNA can be obtained together with promoter sequences or polyadenylation sequences. Genomic DNA or cDNA can be obtained by various methods. Genomic DNA can be extracted and purified from suitable cells by methods known in the art. Alternatively, cDNA can be produced by reverse transcription or other methods using mRNA isolated from cells. Alternatively, the polynucleotide sequence can include a sequence complementary to the RNA sequence, such as an antisense RNA sequence, and the antisense RNA can be administered to an individual to inhibit expression of the complementary polynucleotide in the individual's cells.

[0070] For purposes of the present invention, the heterologous gene is an AIMP-2 splice variant having a deletion of exon 2, and the miR-142-3p target sequence of the present invention can be linked to the 3'UTR of the heterologous gene. The sequence of AIMP2 protein (312aa version: AAC50391.1 or GI: 1215669; 320aa version: AAH13630.1, GI: 15489023, BC0 13630.1) is disclosed in the literature (312aa version: Nicolaides, NC, Kinzler, KWand Vogelstein, B. Analysis of the 5' region of PMS2 reveals heterogeneous transcripts and a novel overlapping gene, Genomics 29(2), 329-334(1995); 320aa version: Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences, Proc. Natl. Acad. Sci. USA 99(26), 16899-16903(2002)).

[0071] As used herein, the term "AIMP2 splice variant" refers to a variant resulting from the partial or complete loss of exon 2 within exons 1 to 4. This variant can form heterodimers with the AIMP2 protein, interfering with the normal function of AIMP2. Furthermore, when overexpressed in cells or tissues, this AIMP2 splice variant may induce cancer. Therefore, it is desirable to induce tissue-specific expression to inhibit cancer induction.

[0072] The recombinant vector of the present invention may include SEQ ID NOs: 1 and 5.

[0073] The expressions "% sequence homology", "% identity" or "% identical" in relation to nucleotide or amino acid sequences can be determined, for example, by comparing two optimally aligned sequences in a comparison window, where some base sequences in the comparison window may include additions or deletions (i.e., gaps) compared to a reference sequence (excluding additions or deletions) at the optimal alignment of the two sequences.

[0074] Within the scope of the present invention, the protein of the present invention includes not only proteins having a native amino acid sequence but also proteins having a variant amino acid sequence.

[0075] Variants of the proteins of the present invention are proteins that differ in sequence from the native amino acid sequence by one or more amino acid residues due to deletion, insertion, non-conservative or conservative substitution, or a combination thereof. Amino acid exchanges in proteins and peptides that do not generally alter the activity of the molecule are known in the art (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979).

[0076] The protein or its variant can be produced by natural extraction or synthesis (Merrifield, J. Amer. Chem. Soc. 85: 2149-2156, 1963) or by DNA sequence-based gene recombination methods (Sambrook et al., Molecular Cloning, Cold Spring Harbour Laboratory Press, New York, USA, 2nd edition, 1989).

[0077] Amino acid mutations can be made based on the relative similarity of amino acid side chain substituents, such as hydrophilicity, hydrophobicity, charge, and size. Analysis of the size, shape, and type of amino acid side chain substituents indicates that arginine, lysine, and histidine are positively charged residues; alanine, glycine, and serine are similar in size; and phenylalanine, tryptophan, and tyrosine are similar in shape. Therefore, based on these considerations, arginine, lysine, and histidine; alanine, glycine, and serine; and phenylalanine, tryptophan, and tyrosine can be considered biologically functional equivalents.

[0078] When introducing one or more mutations, the hydropathic index of the amino acids can be considered. The hydropathic index is assigned to each amino acid based on hydrophobicity and charge: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine ​​(+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamic acid (-3.5); glutamine (-3.5); aspartic acid (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).

[0079] The hydrophobicity index of amino acids is very important in conferring interactive biological functions on proteins. It is a well-known fact that similar biological activities can only be achieved when amino acids with similar hydrophobicity indices are substituted. When introducing mutations with reference to the hydrophobicity index, substitutions are ideally made between amino acids that differ in hydrophobicity index within ±2, more preferably within ±1, and even more preferably within ±0.5.

[0080] On the other hand, it is also known that substitutions between amino acids having similar hydrophilicity values ​​result in proteins with equivalent biological activity. As noted in U.S. Patent No. 4,554,101, the following hydrophilicity values ​​are assigned to each amino acid residue: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0±1); glutamic acid (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4).

[0081] In cases where one or more mutations are introduced with reference to hydrophilicity values, substitutions are ideally made between amino acids whose hydrophilicity values ​​differ by within ±2, more ideally within ±1, and even more ideally within ±0.5.

[0082] Amino acid exchanges in proteins that do not generally alter the activity of the molecule are known in the art (H. Neurath, RL Hill, The Proteins, Academic Press, New York, 1979). The most common exchanges are between the following amino acid residues: Ala / Ser, Val / Ile, Asp / Glu, Thr / Ser, Ala / Gly, Ala / Thr, Ser / Asn, Ala / Val, Ser / Gly, Thy / Phe, Ala / Pro, Lys / Arg, Asp / Asn, Leu / Ile, Leu / Val, Ala / Glu, and Asp / Gly. The vector system of the present invention can be constructed by a variety of methods known in the art. Specific methods are described in Sambrook et al. (2001), Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, which is incorporated herein by reference.

[0083] Generally, vector of the present invention can be constructed as a vector for cloning or expression. In addition, prokaryotic or eukaryotic cells can be used as host to construct vector of the present invention. When vector of the present invention is an expression vector and uses prokaryotic cells as a host, it generally includes a strong promoter (such as tac promoter, lac promoter, lacUV5 promoter, 1pp promoter, pLX promoter, pRX promoter, rac5 promoter, amp promoter, recA promoter, SP6 promoter, trp promoter and T7 promoter etc.) for performing transcription, and a ribosome bind site and transcription / translation termination sequence for transcription initiation. When Escherichia coli (e.g., HB101, BL21, DH5a, etc.) is used as a host cell, the promoter and operator site of the Escherichia coli tryptophan biosynthesis pathway (Yanofsky, C. (1984), J. Bacteriol., 158: 1018-1024) and the left promoter of bacteriophage λ (pLλ promoter, Herskowitz, I. and Hagen, D. (1980), Ann. Rev. Genet., 14: 399-445) can be used as control sites.

[0084] Meanwhile, the vector usable in the present invention may be at least one selected from viral vectors, linear DNA, and plasmid DNA.

[0085] In the present invention, "viral vector" refers to a viral vector that can deliver genes or genetic materials to desired cells, tissues and / or organs.

[0086] The viral vector may include at least one selected from the group consisting of, but not limited to, adenovirus, adeno-associated virus, lentivirus, retrovirus, HIV (human immunodeficiency virus), MLV (murine leukemia virus), ASLV (avian sarcoma / leukemia), SNV (spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus), and herpes simplex virus. In some embodiments, the viral vector may be an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, or herpes simplex virus vector.

[0087] Retroviruses have the ability to integrate into the host cell genome and are harmless to humans. Retroviruses have characteristics, including: inhibiting normal cellular functions upon integration, being able to infect a variety of cells, being easily proliferated, accommodating external genes of approximately 1-7 kb, and producing replication-defective viruses. However, retroviruses have disadvantages, including difficulty infecting post-mitotic cells, difficulty in in vivo gene delivery, and the need for in vitro proliferation of somatic cells. Furthermore, because retroviruses can integrate into proto-oncogenes, they carry the risk of inducing mutations, thereby increasing the possibility of cell necrosis.

[0088] On the other hand, adenovirus has multiple advantages as a cloning vector, including: ability to replicate in the nucleus, clinically non-toxic, medium-sized, stable even after insertion of external genes, no gene rearrangement or deletion, ability to transform eukaryotic organisms, and even when integrated into the host cell chromosome, high-level stable expression. Good host cells for adenovirus are cells that cause human hematopoiesis, lymphoma, and myeloma. However, because it is linear DNA, it is difficult to proliferate and is not easy to recycle infected viruses, resulting in a low viral infection rate. In addition, the expression of the delivered gene is most extensive within 1-2 weeks, and expression only lasts for 3-4 weeks in some cells. Another problem is that it has high immunogenicity.

[0089] Adeno-associated virus (AAV) has been preferred in recent years because it can overcome the above problems and has many advantages as a gene therapy agent. It is also known as adenosatellite virus. The diameter of the AAV particle is 20nm and it is known to be almost harmless to the human body. Therefore, it has been approved for sale as a gene therapy product in Europe.

[0090] AAV is a single-stranded provirus that requires a helper virus for replication. The AAV genome has 4,680bp and can be inserted into a specific region of chromosome 19 of the infected cell. The transgene is inserted into the plasmid DNA and connected to two inverted terminal repeat (ITR) sequence parts (145bp each) and the signal sequence part. It is transfected together with other plasmid DNAs expressing the AAV rep and cap parts, and adenovirus is added as a helper virus. The advantages of AAV are a wide range of host cells to which genes can be delivered, low immune side effects when repeatedly administered, and a long gene expression period. Moreover, even if the AAV genome is integrated into the chromosomes of the host cell, it is safe and does not change or rearrange the host's gene expression.

[0091] There are four known serotypes of adeno-associated viruses. Among the many adeno-associated virus serotypes that can be used for target gene delivery, the most widely studied vector is adeno-associated virus serotype 2, which is currently used to deliver clinical genes for cystic fibrosis, hemophilia, and Canavan disease. In addition, recently, the potential of recombinant adeno-associated virus (rAAV) in the field of cancer gene therapy is increasing [4]. Adeno-associated virus serotype 2 is also used in the present invention. However, suitable viral vectors can be selected and applied, and are not limited to this.

[0092] In addition, when the vector of the present invention is an expression vector and a eukaryotic cell is used as a host, a promoter derived from the genome of a mammalian cell (e.g., a metallothionein promoter) or a promoter derived from a mammalian virus (e.g., adenovirus late promoter, vaccinia virus 7.5K promoter, SV40 promoter, cytomegalovirus promoter, and HSV TK promoter) can be used. Specifically, it can include one or more of the following promoters, but is not limited thereto: LTR of a retrovirus, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1α promoter, UB6 promoter, chicken β-actin promoter, CAG promoter, RPE65 promoter, and opsin promoter. In addition, it usually has a polyadenylation sequence as a transcription termination sequence.

[0093] The vector of the present invention can be fused with other sequences as needed to make protein purification easier. For example, glutathione S-transferase (Pharmacia, USA), maltose binding protein (NEB, USA), FLAG (IBI, USA) and 6xHis (hexahistidine; Quiagen, USA) fusion sequences can be used, but are not limited to these. In addition, the expression vector of the present invention can include antibiotic resistance genes commonly used in the art as selective markers, including, for example, ampicillin, gentamicin, carbenicillin, chloramphenicol, streptomycin, kanamycin, geneticin, neomycin and tetracycline.

[0094] In addition, the present invention provides a gene delivery vector comprising a recombinant vector containing a target sequence of miR-142 (eg, miR-142-3p and / or miR-142-5p).

[0095] As used herein, the term "gene transfer" generally encompasses the delivery of genetic material to cells for transcription and expression. Such methods are well-suited for protein expression and therapeutic purposes. Numerous delivery methods are known, such as DNA transfection and viral transduction. Virus-mediated gene transfer is mentioned because of its high delivery efficiency and high expression levels of the delivered gene, as well as the ability to target specific receptors and / or cell types, if desired, through natural affinity or pseudotyping.

[0096] The gene carrier can be a transformant that has been transformed with the recombinant vector of the present invention, and transformation can include any method for introducing nucleic acid into an organism, cell, tissue or organ, as known in the art, and can be implemented by selecting appropriate standard techniques according to the host cell. These methods include electroporation, protoplast fusion, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, mixing with silicon carbide fibers, Agrobacterium-mediated transformation, PEG, dextran sulfate and liposome transfection, but are not limited to these.

[0097] The purpose of gene vectors is to express heterologous genes in neurons. Thus, they inhibit heterologous gene expression in CD45-derived cells and can increase heterologous gene expression in brain tissue. CD45 is a transmembrane protein tyrosine phosphatase located on most hematopoietic cells. Cells can be defined based on molecules located on their surface, and CD45 is a cell marker for all white blood cell populations and B lymphocytes. The gene vectors of the present invention may not be expressed in cells derived from CD45, particularly in lymphoid and leukocyte cells.

[0098] The gene vector may additionally include a pharmaceutically acceptable carrier, excipient, or diluent.

[0099] Additionally, the present invention provides a method for delivering and expressing a heterologous gene in neurons, the method comprising the step of introducing a recombinant vector into an individual.

[0100] The method can increase the expression of heterologous genes in brain tissue and can control the expression of heterologous genes in other tissues.

[0101] In addition, the present invention provides 1) a promoter; 2) a base sequence encoding a target protein operably linked to the promoter; and 3) an expression cassette, the expression cassette comprising a base sequence targeting miR-142-3p linked to the 3'UTR of the base sequence. The present invention provides 1) a promoter; 2) a base sequence encoding a target protein operably linked to the promoter; and 3) an expression cassette, the expression cassette comprising a base sequence targeting miR-142-5p linked to the 3'UTR of the base sequence.

[0102] In the present invention, the term "expression cassette" refers to a unit cassette, which includes a gene encoding a target protein and a base sequence encoding a promoter and a signal peptide, and can express and secrete the target protein operably linked downstream of the signal peptide. The secretory expression cassette of the present invention can be used interchangeably with the term "secretion system." Various factors that can contribute to the efficient production of the target protein can be included within or outside the expression cassette.

[0103] Furthermore, the present invention provides an agent for preventing or treating a neurodegenerative disease, comprising a base sequence encoding an AIMP-2 splice variant with a deletion of exon 2 and a base sequence targeting miR-142-3p linked to the 3'UTR of the base sequence.

[0104] Therefore, also disclosed herein is a method for treating neuronal diseases in a subject in need, comprising administering any carrier as described herein. Neurodegenerative diseases can be selected from one or more following diseases, but are not limited thereto: Alzheimer's, Parkinson's, amyotrophic lateral sclerosis (ALS), retinal degeneration, mild cognitive impairment, multiple infarct dementia, frontotemporal dementia, Lewy body dementia, Huntington's chorea, degenerative neurological diseases, metabolic brain disorders, depression, epilepsy, multiple sclerosis, cortical basal degeneration, multiple system atrophy, progressive supranuclear palsy, dentate nucleus rubral nucleus pallidum Lewy body atrophy, spinocerebellar ataxia, primary lateral sclerosis, spinal muscular atrophy and stroke. In some embodiments, neuronal diseases are ALS. Treatment can improve memory, dyskinesia, motor activity and / or the life-extending of the subject suffering from neuronal diseases such as ALS, Alzheimer's or Parkinson's. In some embodiments, treatment can improve motor activity and / or extend lifespan in a subject suffering from a neuronal disease, such as ALS.

[0105] The vectors disclosed herein can achieve, but are not limited to, apoptosis inhibition, movement disorder improvement, and / or oxidative stress inhibition, and thus prevent or treat neuronal diseases.

[0106] In the present invention, the term "treatment" includes not only complete treatment of neurodegenerative diseases but also partial treatment, improvement and alleviation of overall symptoms of neurodegenerative diseases as a result of applying the agent according to the present invention to individuals suffering from degenerative brain diseases.

[0107] In the present invention, the term "prevention" means preventing the occurrence of overall symptoms of neurodegenerative diseases in advance by applying the agent according to the present invention to an individual suffering from a degenerative brain disease, by suppressing or blocking symptoms or phenomena such as cognitive impairment, behavioral disorders and brain nerve damage.

[0108] In addition to the active ingredient, the agent according to the present invention may further contain an adjuvant. Although any adjuvant may be used without limitation as long as it is known in the art, immunity can be improved, for example, by further including complete and incomplete Freund's adjuvants.

[0109] The active ingredient can be mixed with a pharmaceutically acceptable carrier to produce the medicament according to the present invention. Herein, pharmaceutically acceptable carriers include carriers, excipients and diluents commonly used in the pharmaceutical field. Pharmaceutically acceptable carriers that can be used for the medicament according to the present invention include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil, but are not limited to these.

[0110] The medicament according to the present invention can be prepared into various forms for use according to the corresponding general preparation methods, including oral administration types such as powders, granules, pills, capsules, suspensions, emulsions, syrups and aerosols, as well as external use, suppositories or sterile injections, etc.

[0111] When being prepared into preparation, can use commonly available diluent or excipient in preparation, such as filler, extender, adhesive, wetting agent, disintegrant and surfactant etc..Including pill, tablet, powder, granule and capsule for solid preparation of oral administration, these solid preparations can be prepared by mixing one or more excipients (such as starch, calcium carbonate, sucrose, lactose and gelatin) with active ingredient.In addition, except simple excipient, lubricant, such as magnesium stearate and talc can also be used.Including suspension, internal solution, oil and syrup etc. for liquid preparation of oral administration, including various excipients except water and paraffin that are usually used as diluent, such as wetting agent, sweetener, flavoring agent and preservative etc..Including sterile aqueous solution, non-aqueous solvent, suspending agent, oil, lyophilized agent and suppository for preparation of parenteral administration.Can use vegetable oil (such as propylene glycol, polyethylene glycol and olive oil) and injectable ester (such as ethyl ester) as non-aqueous solvent and suspension. Agents used for suppositories may include Vibitol, Tween 61, cocoa butter, laurel oil, and glycerin gelatin, among others.

[0112] The medicament according to the present invention can be administered to an individual by a variety of routes. Any form of administration can be considered, such as oral administration, intravenous, intramuscular, subcutaneous and intraperitoneal injection.

[0113] The desired administration dose of the therapeutic agent according to the present invention varies depending on various factors including the preparation production method, administration form, age, weight and sex of the patient, degree of disease symptoms, food, administration period, administration route, excretion rate and reaction sensitivity, etc. Nevertheless, it can be appropriately selected by the corresponding manufacturer.

[0114] However, for therapeutic effects, a skilled physician can determine and prescribe an effective dose for the intended treatment. For example, therapeutic agents include intravenous, subcutaneous, and intramuscular injections, as well as targeted injections into the cerebral ventricles or spinal cord using microneedles. Multiple injections and repeated administrations are possible. For example, in the case of a vector, an effective dose is 0.05 to 15 mg / kg, and in the case of a recombinant virus, an effective dose is 5 x 10 11 to 3.3X 10 14 Virus particles (2.5× 10 12 to 1.5X 10 16 IU) / kg, in the case of cells, 5X 10 2 Up to 5X 10 7 Ideally, the dose is 0.1 to 10 mg / kg in the case of vectors and 5 x 10 cells / kg in the case of recombinant viruses. 12 to 3.3X 10 13 Particles (2.5X 10 13 to 1.5X 10 15 IU) / kg, in the case of cells it is 5×10 3 Up to 5X 10 6 cells / kg, at a rate of 2 to 3 times per week. The dosage is not strictly limited. Rather, it can be adjusted according to the patient's condition and the degree of manifestation of the neurological disorder. The effective dose for other subcutaneous fat and intramuscular injections and direct application to the affected area is 9 x 10 10 to 3.3X 10 14 Recombinant virus particles, 10 cm apart, weekly The dosage is not strictly limited. Rather, it can be modified according to the patient's condition and the degree of manifestation of the neurological disorder. More specifically, the medicament according to the present invention comprises 1×10 10 to 1×10 12 vg (viral genome) / mL of recombinant adeno-associated virus, and it is usually recommended to inject 1X 10 every 2 days for 2 weeks. 12 vg. It can be administered once daily, or the dose can be divided for administration several times a day.

[0115] Pharmaceutical preparations can be produced in a variety of oral and parenteral administration forms. In some embodiments, the vectors disclosed herein can be administered to the brain or spinal cord. In some embodiments, the vectors disclosed herein can be administered to the brain by stereotactic injection.

[0116] Oral administration agents include pills, tablets, hard and soft capsules, liquids, suspensions, oils, syrups and granules. In addition to the active ingredient, these agents may include diluents (e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine) and lubricants (glydents) (e.g., silicon dioxide, talc and stearic acid and its magnesium or calcium salts and / or polyethylene glycol). In addition, the pills may contain a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth gum, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine, and, as appropriate, a disintegrant such as starch, agar, alginic acid or its sodium salt or similar mixtures and / or absorbents, colorants, flavorings and sweeteners. The medicaments may be prepared by conventional mixing, granulation or coating methods.

[0117] In addition, injection is a representative form of non-oral administration preparation. The solvent for this injection includes water, Ringer's solution, isotonic saline and suspension. The sterile fixed oil of injection can be used as solvent or suspension medium, and any non-irritating fixed oil including monoglyceride and diglyceride can be used for this purpose. In addition, injection can use fatty acid, such as oleic acid.

[0118] The following are other implementations AX.

[0119] A. Recombinant vector containing the miR-142-3p targeting sequence.

[0120] B. The recombinant vector of embodiment A, wherein miR-142-3p is as shown in base sequence number 3.

[0121] C. The recombinant vector of embodiment A, wherein the miR-142-3p targeting sequence is a sequence that binds complementary to the miR-142-3p sequence.

[0122] D. The recombinant vector of embodiment A, wherein the miR-142-3p targeting sequence is represented by base sequence number 4.

[0123] E. The recombinant vector of embodiment A, wherein the miR-142-3p targeting sequence is represented by base sequence number 5.

[0124] F. The recombinant vector of embodiment A, wherein the miR-142-3p targeting sequence has at least 90% homology to the base sequence shown in base sequence number 4.

[0125] G. The recombinant vector of embodiment A, wherein the miR-142-3p targeting sequence has at least 90% homology to the base sequence shown in base sequence number 5.

[0126] H. The recombinant vector of embodiment A, wherein the recombinant vector further comprises a heterologous promoter and a heterologous gene operably linked to the promoter.

[0127] I. The recombinant vector of embodiment H, wherein the miR-142-3p targeting sequence is inserted into the 3'UTR of the heterologous gene.

[0128] J. The recombinant vector of embodiment H, wherein the heterologous gene is an AIMP2 variant having exon 2 deleted.

[0129] K. The recombinant vector of embodiment H, wherein the heterologous promoter is selected from a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, and an opsin promoter.

[0130] L. The recombinant vector of embodiment A, wherein the recombinant vector is one or more selected from viral vectors, linear DNA and plasmid DNA.

[0131] M. The recombinant vector of embodiment L, wherein the viral vector is a vector derived from one or more selected from the group consisting of: adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), MLV (murine leukemia virus), ASLV (avian sarcoma / leukemia), SNV (spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus) and herpes simplex virus.

[0132] N. The recombinant vector of embodiment A, wherein the recombinant vector comprises the base sequence shown in sequence number 7.

[0133] O. A gene vector comprising a recombinant vector containing a target sequence of miR-142-3p.

[0134] P. The gene vector of embodiment O, wherein the gene vector expresses the heterologous gene in neurons.

[0135] Q. The gene vector of embodiment O, wherein the gene vector inhibits the expression of a heterologous gene in CD45-derived cells.

[0136] R. The gene vector of embodiment O, wherein the gene vector increases expression of a heterologous gene in brain tissue.

[0137] S. A method for delivering and expressing heterologous genes to and in neurons, the method comprising the step of administering the recombinant vector of embodiment A above to an individual.

[0138] T. The method of embodiment S, wherein the expression of the heterologous gene is increased in neurons and the expression of the heterologous gene in other tissues is controlled.

[0139] U. Implementation plan, including:

[0140] 1) Promoter;

[0141] 2) a base sequence encoding a target protein operably linked to a promoter; and

[0142] 3) An expression cassette comprising a miR-142-3p target base sequence inserted into the 3'UTR of the base sequence.

[0143] V. The expression cassette of embodiment U, wherein the target protein is an AIMP-2 variant protein having an exon 2 deletion.

[0144] W. A preparation for preventing or treating a neurodegenerative disease, comprising a base sequence encoding an AIMP-2 variant having an exon 2 deletion and comprising a miR-142-3p target base sequence inserted into the 3'UTR of the base sequence.

[0145] X. The method of embodiment W, wherein the neurodegenerative disease is one or more selected from the group consisting of Alzheimer's disease, Parkinson's disease, Lou Gehrig's disease (amyotrophic lateral sclerosis), retinal degeneration, mild cognitive impairment, multi-infarct dementia, frontotemporal dementia, dementia with Lewy bodies, Huntington's disease, degenerative neurological diseases, metabolic brain disorders, depression, epilepsy, multiple sclerosis, corticobasal degeneration, multiple system atrophy, progressive supranuclear palsy, dentatorubral pallidum atrophy with Lewy bodies, spinocerebellar ataxia, primary lateral sclerosis, spinal muscular atrophy, and stroke, and is not limited to these diseases.

[0146] The present invention will be explained in more detail by using the following examples. However, the following examples are only for the purpose of illustrating the contents of the present invention, and the application of the present invention is not limited to these examples.

[0147] Example

[0148] Example 1 Construction of recombinant vector

[0149] CD45 is a transmembrane protein tyrosine phosphatase of most hematopoietic cells. Based on this molecule on the cell surface, CD45 can be used to define cells. CD45 is a marker for all white blood cell populations and B lymphocytes. The present inventors have produced a recombinant vector that is not expressed in CD45-derived cells, particularly lymphoid and leukocyte lineage cells, but is specifically and only expressed in neurons. The recombinant vector contains a splice variant of AIMP2 (in which exon 2 of the aminoacyl-tRNA synthetase complex-interacting multifunctional protein 2 (AIMP2) is deleted) and inserts a miRNA that can control the expression of the AIMP2 splice variant.

[0150] It was confirmed that the AIMP2 splice variant is overexpressed in tumors. Due to the splicing of AIMP2, this AIMP2 splice variant does not have the function of degrading TRAF2 (TNF receptor-associated factor 2) related to tumor signaling. It can compete with AIMP2 for binding to TRAF2, thereby hindering the function of AIMP2 and interfering with the tumor inhibitory effect of AIMP2.

[0151] Therefore, the recombinant vector of the present invention was generated as described above so as to induce specific expression of AIMP2 splice variants only in neurons and inhibit tumor expression of AIMP2 splice variants.

[0152] Generation of 1-1AIMP2 variants

[0153] AIMP2 is one of the proteins involved in the formation of aminoacyl-tRNA synthetases (ARS) and functions as a tumor suppressor. To construct a plasmid expressing a variant lacking exon 2 of AIMP2, the cDNA of an AIMP2 splice variant was cloned using pcDNA3.1-myc. After amplification of the AIMP2 splice variant using primers with EcoR1 and Xho 1 linkers ligated to H322 cDNA, subcloning was performed in pcDNA3.1-myc using EcoR1 and Xho 1.

[0154] The AIMP2 variant of the present invention has the nucleotide sequence of SEQ ID NO: 1 and the amino acid sequence of SEQ ID NO: 2.

[0155] 1-2 miRNA sorting and target sequence selection

[0156] As described above, it was confirmed that the AIMP2 variants of the present invention are overexpressed in tumors. Thus, miRNAs and their targets capable of controlling the expression of AIMP2 variants were selected to inhibit the expression of AIMP2 variants in leukocytes and lymphoid-related cells while achieving safe expression in neuronal target cells.

[0157] To this end, miR-142-3p, which is specifically expressed only in hematopoietic cells that produce leukocytes and lymphoid-related cells, was selected as a target. In order to generate a sequence that targets only miR-142-3p, microarray data of mouse B cells and computer programming of miR-142-3p-targeted genes (mirSVR scoring) were used. miR-142-3p is the base sequence shown in sequence number 3. The sequence targeting miR-142-3p is represented by the base sequence of sequence number 4, which complementarily binds to miR-142-3p. The miR-142-3p target sequence may have the nucleotide sequence of SEQ ID NO: 5.

[0158] The miR-142-3p target sequence of the present invention includes a restriction enzyme (Nhe 1 and Hind III, Bmt 1) site sequence (ccagaagcttgctagc) and a restriction enzyme (Hind H) site sequence (aagcttgtag) for cloning. It includes the nucleotide sequence of SEQ ID NO: 5, which is repeated 4 times and connected to each other with linkers (tcac and gatatc) ( Figure 4 ; SEQ ID NO: 6).

[0159] 1-3 Production of recombinant vectors

[0160] To generate the recombinant vector of the present invention, the miR-142-3p target sequence (SEQ ID NO: 5) was inserted into the 3'UTR of the AIMP2 variant of the present invention (SEQ ID NO: 1). The connection between the AIMP-2 variant and the miR-142-3p target sequence is shown in base sequence number 6, specifically, by cutting and inserting using the Nhe I and Hind III sites. The recombinant vector is shown in FIG. Figure 1 Example 2 Confirmation of the neuronal cell-specific expression of the recombinant vector

[0161] 2-1 Confirmation of neuron-specific expression effects under in vitro conditions

[0162] Since miR142-3p is specifically expressed only in hematopoietic cells, the AIMP2 variant of the present invention was knocked down according to the miR142-3p target sequence expressed by the recombinant vector of the present invention, and the expression level of the AIMP2 variant in specific cells was confirmed.

[0163] Specifically, the groups were divided into a group not treated with the recombinant vector of the present invention (SHAM), a group treated with an invalid / control vector (NC vector), a group treated with a single AIMP2 variant vector (pscAAV_DX2), and a group treated with the recombinant vector of the present invention (pscAAV-DX2-miR142-3pT). The concentrations of all vectors were measured in ug / ul, and each group was treated with 2.5ul (2.5ug). In each treatment group, THP-1 cell lines (human leukemia mononuclear cells) and SH-SY5Y cell lines (neuroblastoma) were treated to confirm the knockdown of AIMP2 variants. qPCR was performed using the primers in Table 1 below (denaturation for 15 seconds, followed by 40 cycles of annealing and extension at 60°C for 30 seconds).

[0164] As a result, it was confirmed that the AIMP2 variant was not expressed in the SHAM and NC vector groups. In addition, it was confirmed that the AIMP2 variant vector alone was expressed in both the THP-1 cell line and the SH-SY5Y cell line in the group treated with the AIMP2 variant vector (pscAAV-DX2), thus confirming that no neural cell-specific expression was induced. On the other hand, it was confirmed that the AIMP2 variant was specifically expressed only in the SH-SY5Y cell line in the group treated with the recombinant vector of the present invention ( Figure 2 ).

[0165] Table 1

[0166] AIMP2 variants Primers SEQ ID NO: Forward CTGGCCACGTGCAGGATTACGGGG (human only) 8 Reverse AAGTGAATCCCAGCTGATAG (human only) 9

[0167] 2-2 Confirmation of neuronal cell-specific expression effects under in vivo conditions

[0168] Specifically, the groups were divided into an invalid / control vector-treated group (NC vector), a single AIMP2 variant vector-treated group (pscAAV-DX2), and a group treated with the recombinant vector of the present invention (pscAAV-DX2-miR142-3pT). 8 vg / ul of each virus 10ul (10 9 vg) for intraparenchymal administration. Following intracranial injection into each treatment group of mice, AIMP2 expression was confirmed in colon, lung, brain, liver, kidney, thymus, spleen, and peripheral blood mononuclear cells (PBMCs) one week later. qPCR was performed using the primers listed in Table 1 below (denaturation for 15 seconds, followed by 40 cycles of annealing and extension at 60°C for 30 seconds).

[0169] The results confirmed that in the group treated with the recombinant vector of the present invention, the expression of AIMP2 variant increased specifically only in brain tissue with highly concentrated neurons ( Figure 3 ). On the other hand, it was confirmed that the expression of AIMP2 variants was blocked in tissues other than brain tissues.

[0170] Example 3 Materials and Methods

[0171] 3-1.qRT-PCR

[0172] Total RNA was isolated from the spinal cord using TRIzol (Invitrogen, Waltham, MA, USA) according to the manufacturer's protocol. The extracted RNA was quantified using a spectrophotometer (ASP-2680, ACTgene, USA) for quantification. To prepare cDNA, reverse transcription was performed using SuperScript III First-Strand (Invitrogen) according to the manufacturer's protocol. The resulting cDNA was used for real-time PCR using SYBR green PCR premix (ThermoFisher Scientific, USA). Expression data from duplicate results were used for 2-ΔΔCt statistical analysis, and GADPH expression was used for normalization.

[0173] 3-2 Animals

[0174] hSOD1 G93A transgenic mice (B6.Cg-Tg(SOD1*G93A)1Gur / J) used in this study were purchased from Jackson Laboratory (Bar Harbor, ME, USA). Age-matched WT control mice were also used. These animals were housed in individual cages at the Seoul National University Animal Facility in South Korea under specific pathogen-free conditions and constant environmental conditions (temperature 21–23°C, 50–60% humidity, and a 12-h light / dark cycle). All experimental procedures were performed in accordance with the guidelines of the Seoul National University Institutional Animal Care and Use Committee (SNUIACUC, August 7, 2017). This study was approved by our local ethics committee, SNUIACUC (approval number SNU-170807-1). Female mice of the same age were injected with AAV-GFP and DX2 vectors at the presymptomatic stage. AAV-DX2 transduction was performed intrathecally via direct lumbar puncture. A total of 8 μl (4 μl / point) of AAV-GFP or DX2 vector was slowly injected (1 μl / min) at two points using a Hamilton syringe (Hamilton, Switzerland), while the needle was slowly withdrawn to prevent loss of the injected vector.

[0175] 3-3. miR142-3p inhibition experiment

[0176] The inhibition of DX2 expression by miR-142-3p was observed from the x1 miR-142-3p target sequence. HEK293 cells were transiently transfected with a vector containing the miR-142-3p target sequence with x1, x2, and x3 repeats and 100 pmol of miR-142-3p using lipofectamine 2000 (Invitrogen, US) and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. The inhibition of DX2 expression by miR-142-3p was observed from the Tseq x1 repeat miR142-3p target sequence ( Figure 5B ).

[0177] Example 4

[0178] 4-1 Generation of three types of vectors for inhibition of core binding sequences

[0179] Tseq x1 contains 1 core binding sequence, Tseq x2 contains 2 core binding sequences, and Tseq x3 contains 3 core binding sequences ( Figure 5A ).

[0180] Inhibition of DX2 expression by miR142-3p (100 pmol) was observed starting from the x1 repeat of the miR142-3p target sequence. HEK293 cells were transiently transfected with x1, x2, and x3 repeats of the miR-142-3p target sequence vector and 100 pmol of miR-142-3p using lipofectamine 2000 (Invitrogen, US), and then incubated for 48 hours. The amount of DX2 mRNA was analyzed by PCR. When the number of core binding sequences in the miR142-3p target sequence increased, the inhibition of DX2 expression by miR142-3p also increased. The vector containing the Tseq x3 core sequence showed significant inhibition ( Figure 5B ).

[0181] 4-2 core sequence mutation

[0182] Using mouse B cell microarray data and mirSVR scores of miR-142-3p target genes, the core sequence was predicted. Four regions of the core sequence were replaced as follows: (5'-AACACTAC-3'→5'-CCACTGCA-3') (original sequence see Figure 4 , see the schematic diagram Figure 5A ).

[0183] The 4-3 core binding sequence is important for DX2 inhibition

[0184] Four core sequences were replaced ( Figure 5AHEK293 cells were transiently transfected with DX2-miR-142-3p Tseq x3 repeat vector (Tseq3x) or core sequence mutant vector (mut) and 100 pmol miR-142-3p using lipofectamin 2000 (Invitrogen, US) and then incubated for 48 hours. DX2 mRNA expression was analyzed by PCR. The Tseq x3 repeat vector showed significant inhibition of DX2 ( Figure 5B ), and the DX2 construct was used as a control. Treatment with 100 pmol of miR142-3p significantly inhibited the Tseq x3 vector, but the DX2 and mut sequences were not inhibited ( Figure 6 ).

[0185] Tissue distribution data in the 4-4ALS mouse model

[0186] After intrathecal injection of scAAV2-DX2-miR142-3p, total RNA was extracted from the spinal cord. qRT-PCR was performed. DX2 expression should be limited to the local injection site, the spinal cord. hSOD1 G93A transgenic mice were intrathecally injected with scAAV-DX2-miR142-3p. Control vehicle injection showed expression only in the spinal cord, but not in the brain or sciatic nerve. Figure 7 ).

[0187] Example 5

[0188] In Example 2, HEK293T cells were co-transfected with three plasmids from Oxgene, UK encoding all the components required for the production of recombinant AAV2 particles.

[0189] HEK293T cells were also transfected with pSF-AAV-ITR-CMV-EGFP-ITR-KanR (Oxgene, UK) alone, into which the AIMP2-DX2 or DX2-miR142 target nucleic acid was inserted, as an expression vector without the production of AAV particles.

[0190] DX2 encoding vector (2 μg) and DX2-miR142 target sequence encoding vector (2 μg) were transfected into THP-1 cells (human monocytes, CD45+ cells) and SH-SY5Y cells (neuronal cells). After 48 hours, the cells were harvested and mRNA was isolated. DX2 expression was analyzed by real-time PCR using synthesized cDNA.

[0191] SH-SY5Y cells transfected with the DX2 encoding vector and the DX2-miR142 target sequence encoding vector had similar DX2 expression levels, whereas THP-1 cells transfected with the DX2-miR142 target sequence encoding vector had significantly reduced DX2 expression. Therefore, miR142-3p only functions in THP-1 cells ( Figure 8 ).

[0192] The foregoing specific embodiments sufficiently reveal the general nature of the present invention so that other modifications and / or changes can be easily made by applying knowledge within the technical scope of the art to carry out various applications without departing from the general concept of the present invention. Therefore, based on the teachings and guidance set forth herein, such changes and modifications are intended to be encompassed within the meaning and scope of the equivalent forms of the disclosed embodiments. It should be understood that the wording or terminology herein is for descriptive and not limiting purposes, and therefore the terms or wording of this specification will be interpreted by the skilled person based on the teachings and guidance.

[0193] The scope of the present invention should not be limited by any of the above-described exemplary embodiments, but should be defined only in accordance with the following claims and their equivalents.

[0194] All aspects, embodiments, and options described herein may be combined in any and all variations.

[0195] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.

Claims

1. A recombinant vector comprising an AIMP2 variant (AIMP2-DX2) gene with exon 2 deletion and a miR-142-3p target nucleic acid, wherein the AIMP2-DX2 gene can be expressed in neural cells, and wherein the AIMP2-DX2 gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2, and the miR-142-3p target nucleic acid comprises the nucleotide sequence of SEQ ID NO: 5 and is located 3' of the AIMP2-DX2. 2 . The vector according to claim 1 , further comprising a promoter operably linked to the AIMP2-DX2.

3. The vector of claim 2, wherein the promoter is a retrovirus (LTR) promoter, a cytomegalovirus (CMV) promoter, a Rous sarcoma virus (RSV) promoter, a MT promoter, an EF-1α promoter, a UB6 promoter, a chicken β-actin promoter, a CAG promoter, an RPE65 promoter, or an opsin promoter. The vector according to claim 1 , wherein the AIMP2-DX2 gene has a nucleotide sequence encoding the amino acid sequence of SEQ ID NO:

2. The vector according to claim 4 , wherein the AIMP2-DX2 gene has the nucleotide sequence of SEQ ID NO:

1.

6. The vector of claim 1, wherein the miR-142-3p target nucleic acid comprises a nucleotide sequence comprising ACACTA.

7. The vector according to claim 1, wherein the miR-142-3p target nucleic acid is repeated 2-10 times.

8. The vector according to claim 1, wherein the vector is a viral vector.

9. The vector of claim 8, wherein the viral vector is an adenovirus, an adeno-associated virus, a lentivirus, a retrovirus, a human immunodeficiency virus (HIV), MLV (murine leukemia virus), ASLV (avian sarcoma / leukemia virus), SNV (spleen necrosis virus), RSV (Rous sarcoma virus), MMTV (mouse mammary tumor virus), or a herpes simplex virus vector.

10. The vector of claim 8, wherein the viral vector is an adeno-associated virus (AAV), adenovirus, lentivirus, retrovirus, vaccinia virus, or herpes simplex virus vector.

11. Use of the vector according to any one of claims 1 to 10 in the preparation of a medicament for treating amyotrophic lateral sclerosis (ALS) or Parkinson's disease.

12. The use according to claim 11, wherein the neuronal disease is ALS.

13. The use according to claim 12, wherein the treatment improves motor activity or prolongs the lifespan of the subject.

14. The use according to claim 11, wherein the medicament is formulated for administration of the vector to the brain or spinal cord.

15. The use according to claim 14, wherein the medicament is formulated for administration of the vector to the brain by stereotactic injection.

Images