Modified filamentous fungal host cells

Abstract

The present invention relates to a mutated filamentous fungal host cell producing a secreted polypeptide of interest, wherein the native putative steroid dehydrogenase is modified, truncated, partially or completely inactivated, present at a reduced level compared to the non-mutated parent cell or eliminated, and wherein the native putative steroid dehydrogenase comprises at least one conserved amino acid motif selected from the group consisting of: YGAR and / or VPHS[W / Y]F and / or QC[A / V / S]RRL and / or LKKYTLP and / or CPHYT, and a method of producing a secreted polypeptide of interest in said cell, as well as a method of producing said cell.

Description

[0001] References to sequence listings

[0002] This application contains a sequence listing in computer readable form. This computer readable form is incorporated herein by reference. Technical Field

[0003] The present invention relates to modified filamentous fungal cells, and methods for producing such cells, as well as methods for producing secreted polypeptides of interest therein. Background Art

[0004] Filamentous fungal host cells are widely used for the industrial production of a variety of polypeptides of interest. Considerable research efforts have been directed to improving the production of polypeptides of interest in filamentous fungal host cells, in particular to improving productivity and / or yield. Summary of the invention

[0005] The present inventors have found that modification of the gene encoding the predicted putative steroid dehydrogenase in an enzyme-producing host cell can improve the productivity and / or yield of the enzyme.

[0006] Therefore, in a first aspect, the present invention relates to a mutant filamentous fungal host cell producing a secreted polypeptide of interest, wherein the native putative steroid dehydrogenase is modified, truncated, partially or completely inactivated, present at a reduced level compared to the non-mutated parent cell or eliminated, and wherein the native putative steroid dehydrogenase comprises at least one conserved amino acid motif selected from the group consisting of: YGAR and / or VPHS[W / Y]F and / or QC[A / V / S]RRL and / or LKKYTLP and / or CPHYT; preferably, the native putative steroid dehydrogenase comprises at least two conserved motifs; more preferably, at least three or four conserved motifs; most preferably, the native putative steroid dehydrogenase comprises all five conserved motifs.

[0007] The steroid dehydrogenase of natural presumption can be modified, truncated, deactivated, reduced in level or completely eliminated by any suitable method known in the art, for example, by replacing the natural promoter of the gene with a heterologous promoter (preferably, a regulated promoter) to reduce the expression of the coding gene. Another strategy to reduce the steroid dehydrogenase level of presumption can be to add a destabilization domain, such as a ubiquitin domain, to the protein, thereby reducing the half-life of the protein. Another way to deactivate the steroid dehydrogenase of natural presumption, reduce its level or completely eliminate the steroid dehydrogenase of natural presumption is coexpression or adding one or more steroid dehydrogenase inhibitors. The example of the convenient way to eliminate expression completely is gene deletion, gene replacement or gene interruption, for example, by introducing nonsense mutation in the coding sequence. Another way to modify the coding sequence can be to introduce internal deletion by disturbing intron processing by missing some coding sequences or by mutating the coding sequence. Yet another way to inactivate the putative steroid dehydrogenase may be to silence its expression using RNA interference or siRNA or by inserting a construct containing a promoter and possibly lacking a terminator, the transcription direction of which is towards the end of the gene encoding the putative steroid dehydrogenase, resulting in steric hindrance of transcription of the gene encoding the putative steroid dehydrogenase (due to collision with RNA polymerase) or possible mRNA destabilization (due to the formation of mRNA molecules with complementary sequences).

[0008] Thus, in a second aspect, the present invention relates to a method for producing a mutant filamentous fungal host cell having an improved yield of a secreted polypeptide of interest compared to a non-mutated parental host cell, the method comprising the following steps in no particular order:

[0009] a) transforming a filamentous fungal host cell with a polynucleotide construct encoding a secreted polypeptide of interest; and

[0010] b) mutating the host cell to modify, truncate, partially or completely inactivate, reduce the level of or eliminate a native putative steroid dehydrogenase, wherein the native putative steroid dehydrogenase comprises at least one conserved amino acid motif selected from the group consisting of: YGAR and / or VPHS[W / Y]F and / or QC[A / V / S]RRL and / or LKKYTLP and / or CPHYT; preferably, at least two conserved motifs; more preferably, at least three or four conserved motifs; most preferably, the native putative steroid dehydrogenase comprises all five conserved motifs.

[0011] A final aspect of the present invention relates to a method for producing a secreted polypeptide of interest, the method comprising the following steps:

[0012] a) cultivating the mutant filamentous fungal host cell of any preceding claim under conditions favorable for production of the secreted polypeptide; and, optionally

[0013] b) recovering the secreted polypeptide of interest. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 A plasmid map of pNJOC577 is shown.

[0015] Figure 2 A plasmid map of pNJOC383 is shown.

[0016] FIG3 shows a multiple alignment of four putative steroid dehydrogenases identified in SEQ ID NO: 3, 6, 9 and 26. Identical residues are indicated by black boxes. Residues that are conserved in three of the four proteins are indicated by gray boxes. The proteins were aligned using the MUSCLE algorithm version 3.8.31 and default parameters (Edgar, RC (2004). Nucleic Acids Research, 32(5), 1792-1797).

[0017] Figure 4 A plasmid map of pNJOC569 is shown.

[0018] Figure 5 The relative lysozyme productivity / yield (LSU(F) / ml) of strains NJOC587 (control) and NJOC618-81D (steroid dehydrogenase mutant) are shown. The LSU(F) / ml data of the control at the end of the fermentation were used to normalize the data. In the figures, commas are used as decimal separators instead of the traditional decimal point.

[0019] Figure 6 The plasmid map of pTmmD-Tl_lipase is shown.

[0020] Figure 7 The relative lipase productivity / yield (LU(LXP) / ml) of strains NJOC600-2A (control) and NJOC609-1A (steroid dehydrogenase mutant) are shown. The LU(LXP) / ml data of the control at the end of the fermentation were used to normalize the data. In the figures, commas are used as decimal separators instead of the traditional decimal point.

[0021] Figure 8 The plasmid map of pSMai326 is shown.

[0022] Fig. 9Relative xanthanase productivity / yields of strains NJOC608-1B (control) and NJOC617-77C (steroid dehydrogenase mutant) are shown. The xanthanase productivity of the control at the end of fermentation was used to normalize the data. In the figures, commas are used as decimal separators instead of the traditional decimal point.

[0023] Fig.10 The plasmid map of pTmmD-Mf_lysozyme is shown.

[0024] Fig.11 Relative Mf lysozyme productivity / yield (LSU(A) / ml) of strains NJOC601-5A (control) and NJOC610-2B (steroid dehydrogenase mutant) are shown. The lysozyme productivity of the control at the end of the fermentation was used to normalize the data. In the figures, commas are used as decimal separators instead of the traditional decimal point.

[0025] Fig.12 The plasmid map of pIHAR473 is shown.

[0026] Fig.13 The plasmid map of pAT3631 is shown.

[0027] Fig.14 The relative phytase productivity / yield of strains AT3091 (control) and AT3944 (steroid dehydrogenase mutant) are shown. The phytase productivity of the control at the end of fermentation was used to normalize the data. In the figures, commas are used as decimal separators instead of the traditional decimal point.

[0028] definition

[0029] cDNA: The term "cDNA" means a DNA molecule that can be prepared by reverse transcription from a mature, spliced ​​mRNA molecule obtained from a eukaryotic or prokaryotic cell. cDNA lacks intron sequences that may be present in the corresponding genomic DNA. The initial primary RNA transcript is a precursor to mRNA that is processed through a series of steps, including splicing, before appearing as mature, spliced ​​mRNA.

[0030] Coding sequence: The term "coding sequence" means a polynucleotide that directly specifies the amino acid sequence of a polypeptide. The boundaries of the coding sequence are usually determined by an open reading frame, which begins with a start codon (e.g., ATG, GTG, or TTG) and ends with a stop codon (e.g., TAA, TAG, or TGA). The coding sequence may be genomic DNA, cDNA, synthetic DNA, or a combination thereof.

[0031] Control sequences: The term "control sequences" means nucleic acid sequences necessary for the expression of a polynucleotide encoding a mature polypeptide of the present invention. Each control sequence may be native (i.e., from the same gene) or exogenous (i.e., from a different gene) to the polynucleotide encoding the polypeptide, or native or exogenous to each other. Such control sequences include, but are not limited to, leader sequences, polyadenylation sequences, propeptide sequences, promoters, signal peptide sequences, and transcription terminators. At a minimum, control sequences include promoters, and transcription and translation termination signals. For the purpose of introducing specific restriction sites that facilitate connection of control sequences to the coding region of a polynucleotide encoding a polypeptide, these control sequences may be provided with multiple linkers.

[0032] Expression: The term "expression" includes any step involved in the production of the polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

[0033] Expression vector: The term "expression vector" means a linear or circular DNA molecule that comprises a polynucleotide encoding a polypeptide and is operably linked to control sequences that provide for its expression.

[0034] Host cell: The term "host cell" means any cell type that is susceptible to transformation, transfection, transduction, etc. with a nucleic acid construct or expression vector comprising a polynucleotide of the present invention. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication.

[0035] Isolated: The term "isolated" means a substance that is in a form or environment that does not exist in nature. Non-limiting examples of isolated substances include (1) any non-naturally occurring substance, (2) any substance including but not limited to any enzyme, variant, nucleic acid, protein, peptide or cofactor that is at least partially removed from one or more or all of the naturally occurring components associated with its properties; (3) any substance that has been artificially modified relative to the substance found in nature; or (4) any substance that has been modified by increasing the amount of the substance relative to other components with which it is naturally associated (e.g., recombinant production in a host cell; multiple copies of a gene encoding the substance; and use of a stronger promoter than the promoter naturally associated with the gene encoding the substance).

[0036] Mature polypeptide: The term "mature polypeptide" refers to a polypeptide in its final form after translation and any post-translational modifications (such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc.). It is known in the art that a host cell can produce a mixture of two of a plurality of different mature polypeptides (i.e., having different C-terminal and / or N-terminal amino acids) expressed by the same polynucleotide. It is also known in the art that different host cells process polypeptides differently, and thus one host cell expressing a polynucleotide can produce different mature polypeptides (e.g., having different C-terminal and / or N-terminal amino acids) when compared to another host cell expressing the same polynucleotide.

[0037] Mature polypeptide coding sequence: The term "mature polypeptide coding sequence" means a polynucleotide that encodes a mature polypeptide.

[0038] Nucleic acid construct: The term "nucleic acid construct" means a single-stranded or double-stranded nucleic acid molecule that is isolated from a naturally occurring gene, or modified in a manner not originally found in nature to contain a segment of nucleic acid, or is synthetic, and that contains one or more control sequences.

[0039] Operably linked: The term "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to the coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

[0040] Sequence identity: The degree of association between two amino acid sequences or between two nucleotide sequences is described by the parameter "sequence identity". For purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J.Mol.Biol. [Journal of Molecular Biology] 48: 443-453) implemented in the Needle program of the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. [Genetics Trend] 16: 276-277) (preferably 5.0.0 version or later) is used to determine the sequence identity between two amino acid sequences. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and an EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle's "longest identity" (obtained using the nobrief option) was used as the percent identity and calculated as follows:

[0041] (number of identical residues x 100) / (alignment length - total number of gaps in the alignment)

[0042] For purposes of the present invention, the sequence identity between two deoxyribonucleotide sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, the same) implemented in the Needle program of the EMBOSS software package (EMBOSS: European Molecular Biology Open Software Suite, Rice et al., 2000, the same) (preferred 5.0.0 version or updated version). The parameters used are gap opening penalty 10, gap extension penalty 0.5 and EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output (obtained using non-simplified (-nobrief) option) of the "longest identity" marked by Needle is used as the identity percentage and is calculated as follows:

[0043] (number of identical deoxyribonucleotides x 100) / (alignment length - total number of gaps in the alignment) DETAILED DESCRIPTION

[0044] Host cells

[0045] The present invention relates to recombinant host cells comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the production and secretion of a heterologous polypeptide of interest.

[0046] The construct or vector comprising the polynucleotide is introduced into the host cell so that the construct or vector is maintained as a chromosomal integrant or as an autonomously replicating extrachromosomal vector, as described earlier. The term "host cell" encompasses any progeny of a parent cell that is not identical to the parent cell due to mutations that occur during replication. The choice of a host cell will depend to a large extent on the gene encoding the polypeptide and its source.

[0047] The host cell may be a fungal cell. "Fungi" as used herein includes Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota, as well as Oomycota and all mitotic spore fungi (as defined by Hawksworth et al. in Ainsworth and Bisby's Dictionary of The Fungi, 8th ed., 1995, CAB International, University Press, Cambridge, UK).

[0048] The fungal host cells of the present invention are filamentous fungal cells. "Filamentous fungi" include all filamentous forms of the subphylum Eumycota and Oomycota (as defined by Hawksworth et al., 1995 (supra)). Filamentous fungi are generally characterized by a mycelial wall composed of chitin, cellulose, glucan, chitosan, mannan and other complex polysaccharides. Vegetative growth is carried out by hyphal extension, and carbon catabolism is obligate aerobic.

[0049] The filamentous fungal host cell can be a Acremonium, Aspergillus, Pullulan, Nicotiana, Ceroplasts, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Ustilago, Fusarium, Humicola, Pyrrospora, Mucor, Myceliophthora, Neotrichia, Neurospora, Paecilomyces, Penicillium, Pseudoceratium, Radius, Chytrid, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Tolylcorrhiza, Trametes, or Trichoderma cell.

[0050] For example, the filamentous fungal host cell can be Aspergillus aculeatus, Aspergillus aculetinus, Aspergillus awamori, Aspergillus braziliensis, Aspergillus odoratus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus ryukyuus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Black-thorned tobacco pipe fungus, Dry wax fungus, Carnegie wax fungus, pale yellow wax fungus, Pannohita wax fungus, ring-banded wax fungus, red wax fungus, insect wax fungus, narrow-margin golden spore, horny golden spore, Lukenovinsi golden spore, fecal golden spore, rent spore, queen Ledum golden spore, tropical golden spore, brown thin golden spore, gray capped cap mushroom, hairy cap mushroom , rod-shaped Fusarium, cereal Fusarium, Kuwei Fusarium, sword Fusarium, graminearum Fusarium, graminearum red Fusarium, heterosporic Fusarium, albizia Fusarium, sharp spore Fusarium, multi-branched Fusarium, pink Fusarium, elder Fusarium, skin-colored Fusarium, pseudo-branched Fusarium, sulfur-colored Fusarium, round Fusarium, pseudo-thread-spored Fusarium, embellished Fusarium, Humicola insolens, Humicola lanuginosa, Mucor miehei, thermophilic Myceliophthora, Neurospora crassa, Penicillium purpurogenum, Psoralea chrysosporium, Radiation Pleurotus, Pleurotus eryngii, terrestrial Thielavia shell mold, long-domain hairy Trametes, color-changing Trametes, Trichoderma harzianum, Trichoderma koningii, long-branched Trichoderma, Trichoderma reesei, or Trichoderma viride cells.

[0051] Fungal cells can be transformed in a manner known per se by methods involving protoplast formation, protoplast transformation, and cell wall regeneration. Suitable procedures for transforming Aspergillus and Trichoderma host cells are described in EP 238023, Yelton et al., 1984, Proc. Natl. Acad. Sci. USA [Proceedings of the National Academy of Sciences of the United States] 81: 1470-1474 and Christensen et al., 1988, Bio / Technology [Biology / Technology] 6: 1419-1422. Suitable methods for transforming Fusarium species are described by Malardier et al., 1989, Gene [Gene] 78: 147-156 and WO 96 / 00787.

[0052] In one aspect, the present invention relates to a mutant filamentous fungal host cell that produces a secreted polypeptide of interest, wherein the native putative steroid dehydrogenase is modified, truncated, partially or completely inactivated, present at a reduced level compared to a non-mutated parent cell, or eliminated, and wherein the native putative steroid dehydrogenase comprises at least one conserved amino acid motif selected from the group consisting of: YGAR and / or VPHS[W / Y]F and / or QC[A / V / S]RRL and / or LKKYTLP and / or CPHYT; preferably, the native putative steroid dehydrogenase comprises at least two conserved motifs; more preferably, at least three or four conserved motifs; most preferably, the native putative steroid dehydrogenase comprises all five conserved motifs.

[0053] In preferred embodiments of various aspects of the invention, the filamentous fungal host cell belongs to a genus selected from the group consisting of: Acremonium, Aspergillus, Short-stalked Morphoblast, Tobaccopithecus, Ceroplastes, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Ustilagoraceae, Fusarium, Humicola, Pyricularia, Mucor, Myceliophthora, Neotrichia, Neurospora, Penicillium, Penicillium, Psoralea, Radius , Ruminochytrium, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Toxoplasma, Trametes or Trichoderma; even more preferably, the filamentous fungal host cell is Aspergillus aculeatus, Aspergillus aculetinus, Aspergillus awamori, Aspergillus brasiliensis, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus ryukyuus, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus nigricans, Aspergillus carnegiei, Aspergillus flavosum, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Aspergillus nigricans, Aspergillus carnegiei, Aspergillus flavosum, Aspergillus nigricans ... Fungi, Pannohita wax fungus, annular wax fungus, slightly red wax fungus, insect wax fungus, narrow-edged golden spore, horny golden spore, Lukenowens golden spore, fecal golden spore, rent spore, Queen Ledum golden spore, tropical golden spore, brown thin golden spore, gray capped parasol, hairy leather cap, rod-shaped fusarium, cereal fusarium, Kuwei fusarium, broadsword fusarium, gramineous fusarium, gramineous fusarium, heterospore fusarium, albizzia fusarium, sharp spore fusarium, Fusarium spp., pink Fusarium spp., elder Fusarium spp., colored Fusarium spp., spore-forming Fusarium spp., sulfur-colored Fusarium spp., round Fusarium spp., spore-forming Fusarium spp., embellishing Fusarium spp., Humicola insolens, Humicola lanuginosa, Mucor miehei, Myceliophthora thermophila, Neurospora crassa, Penicillium purpurogenum, Pseudomonas chrysosporium, Pleurotus eryngii, Thielavia terrestris, Trametes spp., Trametes versicolor, Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei, or Trichoderma viride cells.

[0054] Preferably, the secreted polypeptide of interest is native or heterologous; preferably, the secreted polypeptide is an enzyme; preferably, the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase or transferase, such as an aminopeptidase, an amylase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, an α-galactosidase, a β-galactosidase, a glucoamylase, an α-glucosidase, a β-glucosidase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phospholipase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, a xylanase, or a β-xylosidase.

[0055] In a preferred embodiment of the present invention, the native putative steroid dehydrogenase comprises or consists of an amino acid sequence that is at least 60% identical to the mature amino acid sequence shown in SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, and / or SEQ ID NO:12; preferably, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% identical, or most preferably, at least 99% identical to the mature amino acid sequence shown in SEQ ID NO:3, SEQ ID NO:6, SEQ ID NO:9, and / or SEQ ID NO:12.

[0056] Preferably, the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence that is at least 60% identical to the genomic DNA sequence shown in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7, and / or SEQ ID NO: 10; preferably, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% identical, or most preferably, at least 99% identical to the genomic DNA sequence shown in SEQ ID NO: 1, SEQ ID NO: 4, SEQ ID NO: 7, and / or SEQ ID NO: 10.

[0057] Alternatively, the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 60% identity to the cDNA sequence shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, and / or SEQ ID NO:11; preferably, at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% identity, or most preferably, at least 99% identity to the cDNA sequence shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:8, and / or SEQ ID NO:11.

[0058] In preferred embodiments, the native putative steroid dehydrogenase is modified, truncated, partially or completely inactivated, present at reduced levels compared to a non-mutated parent cell, or eliminated by a nonsense or frameshift mutation in the encoding gene, by a partial or complete deletion of the encoding gene, or by silencing of the encoding gene.

[0059] In a second aspect, the present invention relates to a method for producing a mutant filamentous fungal host cell having an improved yield of a secreted polypeptide of interest compared to a non-mutated parental host cell, the method comprising the following steps in no particular order:

[0060] a) transforming a filamentous fungal host cell with a polynucleotide construct encoding a secreted polypeptide of interest; and

[0061] b) mutating the host cell to modify, truncate, partially or completely inactivate, reduce the level of or eliminate a native putative steroid dehydrogenase, wherein the native putative steroid dehydrogenase comprises at least one conserved amino acid motif selected from the group consisting of: YGAR and / or VPHS[W / Y]F and / or QC[A / V / S]RRL and / or LKKYTLP and / or CPHYT; preferably, at least two conserved motifs; more preferably, at least three or four conserved motifs; most preferably, the native putative steroid dehydrogenase comprises all five conserved motifs.

[0062] Nucleic acid construct

[0063] The present invention also relates to nucleic acid constructs comprising a polynucleotide of the present invention operably linked to one or more control sequences that direct the expression of the coding sequence in a suitable host cell under conditions compatible with the control sequences.

[0064] The polynucleotide can be manipulated in many ways to provide expression of the polypeptide. Depending on the expression vector, it may be desirable or necessary to manipulate the polynucleotide prior to its insertion into the vector. Techniques for modifying polynucleotides using recombinant DNA methods are well known in the art.

[0065] The control sequence may be a promoter, i.e., a polynucleotide that is recognized by the host cell for expression of a polynucleotide encoding a polypeptide of the present invention. The promoter comprises a transcriptional control sequence that mediates the expression of the polypeptide. The promoter may be any polynucleotide that exhibits transcriptional activity in the host cell, including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides that are homologous or heterologous to the host cell.

[0066] Examples of suitable promoters for directing transcription of the nucleic acid constructs of the invention in a filamentous fungal host cell are promoters obtained from the genes for Aspergillus nidulans acetamidase (amdS), Aspergillus oryzae neutral alpha-amylase (e.g., amyB), Aspergillus oryzae acid-stable alpha-amylase (asaA), Aspergillus oryzae or Aspergillus awamori glucoamylase (glaA), Aspergillus oryzae TAKA amylase, Aspergillus oryzae alkaline protease (alpA), Aspergillus oryzae triose phosphate isomerase (tpiA), Fusarium oxysporum trypsin-like protease (WO 96 / 00787), Fusarium venenatum amyloglucosidase (WO 00 / 56900), Fusarium venenatum Daria (WO 00 / 56900), Fusarium venenatum Quinn (WO 00 / 56900), Rhizomucor miehei (WO 00 / 56900), and Aspergillus oryzae acetamidase (amdS). miehei) lipase, Rhizomucor miehei aspartic proteinase, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase and Trichoderma reesei translation elongation factor , and NA2-tpi promoter (a modified promoter from an Aspergillus neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from an Aspergillus triose phosphate isomerase gene; non-limiting examples include a modified promoter from an Aspergillus oryzae neutral α-amylase gene in which the untranslated leader sequence has been replaced with an untranslated leader sequence from an Aspergillus nidulans or Aspergillus oryzae triose phosphate isomerase gene); and mutant, truncated, and hybrid promoters thereof. Other promoters are described in U.S. Pat. No. 6,011,147.

[0067] The control sequence may also be a transcription terminator that is recognized by the host cell to terminate transcription. The terminator may be operably linked to the 3'-end of the polynucleotide encoding the polypeptide. Any terminator that is functional in the host cell may be used in the present invention.

[0068] Preferred terminators for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans acetamidase, Aspergillus nidulans anthranilate synthase, Aspergillus oryzae glucoamylase, Aspergillus oryzae alpha-glucosidase, Aspergillus oryzae TAKA amylase, Fusarium oxysporum trypsin-like protease, Trichoderma reesei β-glucosidase, Trichoderma reesei cellobiohydrolase I, Trichoderma reesei cellobiohydrolase II, Trichoderma reesei endoglucanase I, Trichoderma reesei endoglucanase II, Trichoderma reesei endoglucanase III, Trichoderma reesei endoglucanase V, Trichoderma reesei xylanase I, Trichoderma reesei xylanase II, Trichoderma reesei xylanase III, Trichoderma reesei β-xylosidase, and Trichoderma reesei translation elongation factor.

[0069] The control sequence may also be an mRNA stabilizer region downstream of the promoter and upstream of the coding sequence of the gene, which increases the expression of the gene.

[0070] The control sequence may also be a leader sequence, i.e., a non-translated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5'-end of the polynucleotide encoding the polypeptide. Any leader sequence that is functional in the host cell may be used.

[0071] Preferred leaders for filamentous fungal host cells are obtained from the genes for Aspergillus oryzae TAKA amylase and Aspergillus nidulans triose phosphate isomerase.

[0072] The control sequence may also be a polyadenylation sequence, a sequence operably linked to the 3'-terminus of the polynucleotide and, when transcribed, recognized by the host cell as a signal to add polyadenylic acid residues to transcribed mRNA. Any polyadenylation sequence functional in the host cell may be used.

[0073] Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes for Aspergillus nidulans anthranilate synthase, Aspergillus oryzae glucoamylase, Aspergillus oryzae alpha-glucosidase, Aspergillus oryzae TAKA amylase, and Fusarium oxysporum trypsin-like protease.

[0074] The control sequence can also be a signal peptide coding region that encodes a signal peptide connected to the N-terminus of the polypeptide and directs the polypeptide to enter the secretory pathway of the cell. The 5' end of the coding sequence of the polynucleotide itself can contain a signal peptide coding sequence that is naturally connected to the coding sequence segment of the coded polypeptide in the translation reading frame. Alternatively, the 5' end of the coding sequence can contain a signal peptide coding sequence that is exogenous to the coding sequence. In the case where the coding sequence does not naturally contain a signal peptide coding sequence, an exogenous signal peptide coding sequence may be required. Alternatively, an exogenous signal peptide coding sequence can simply replace the natural signal peptide coding sequence to enhance the secretion of the polypeptide. However, any signal peptide coding sequence that directs the expressed polypeptide to enter the secretory pathway of the host cell can be used.

[0075] An effective signal peptide coding sequence for a filamentous fungal host cell is one obtained from the genes for Aspergillus oryzae neutral amylase, Aspergillus oryzae glucoamylase, Aspergillus oryzae TAKA amylase, Humicola insolens cellulase, Humicola insolens endoglucanase V, Humicola lanuginosa lipase, and Rhizomucor miehei aspartic proteinase.

[0076] The control sequence can also be a propeptide coding sequence encoding a propeptide at the N-terminus of a polypeptide. The resulting polypeptide is referred to as a proenzyme or propolypeptide (or in some cases as a zymogen). Propolypeptides are generally inactive and can be converted into active polypeptides by catalytic cleavage or autocatalytic cleavage of the propeptide from the propolypeptide. The propeptide coding sequence can be obtained from the following genes: Bacillus subtilis alkaline protease (aprE), Bacillus subtilis neutral protease (nprT), Myceliophthora thermophila laccase (WO 95 / 33836), Rhizomucor miehei aspartic protease and Saccharomyces cerevisiae α-factor.

[0077] Where both a signal peptide sequence and a propeptide sequence are present, the propeptide sequence is located immediately adjacent to the N-terminus of the polypeptide and the signal peptide sequence is located immediately adjacent to the N-terminus of the propeptide sequence.

[0078] It may also be desirable to add regulatory sequences that regulate the expression of polypeptides associated with host cell growth. Examples of regulatory sequences are those that cause gene expression to be turned on or off in response to chemical or physical stimuli (including the presence of regulatory compounds). In filamentous fungi, Aspergillus oryzae glucoamylase promoter, Aspergillus oryzae TAKA α-amylase promoter and Aspergillus oryzae glucoamylase promoter, Trichoderma reesei cellobiohydrolase I promoter and Trichoderma reesei cellobiohydrolase II promoter may be used. Other examples of regulatory sequences are those that allow gene amplification. In eukaryotic systems, these regulatory sequences include dihydrofolate reductase genes amplified in the presence of methotrexate and metallothionein genes amplified with heavy metals. In these cases, the polynucleotide encoding the polypeptide may be operably connected to the regulatory sequence.

[0079] Expression vector

[0080] The present invention further relates to a recombinant expression vector comprising a polynucleotide of the present invention, a promoter, and a transcription and translation termination signal. A plurality of nucleotides and control sequences can be linked together to produce a recombinant expression vector, and the recombinant expression vector can include one or more convenient restriction sites to allow the insertion or replacement of the polynucleotide encoding the polypeptide at such sites. Alternatively, the polynucleotide can be expressed by inserting a polynucleotide or a nucleic acid construct comprising the polynucleotide into a suitable vector for expression. When producing an expression vector, the encoding sequence is so located in the vector that the encoding sequence is operably connected to the suitable control sequence for expression.

[0081] The recombinant expression vector can be any vector (e.g., a plasmid or virus) that can be easily subjected to recombinant DNA procedures and can cause expression of the polynucleotide. The choice of vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0082] The vector can be an autonomously replicating vector, i.e. a vector existing as an extrachromosomal entity, which replicates independently of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome or an artificial chromosome. The vector can contain any means for ensuring self-replication. Alternatively, the vector can be a vector that is integrated into the genome and replicates with one or more chromosomes into which it has been integrated when it is introduced into the host cell. In addition, a single vector or plasmid or two or more vectors or plasmids can be used, which contain the total DNA to be introduced into the host cell genome together, or a transposon can be used.

[0083] The vector preferably contains one or more selectable markers that permit easy selection of transformed cells, transfected cells, transduced cells, etc. A selectable marker is a gene whose product provides biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, etc.

[0084] Selectable markers for use in filamentous fungal host cells include, but are not limited to, adeA (phosphoribosylamidoimidazole-succinylcarboxamide synthase), adeB (phosphoribosylamidoimidazole synthase), amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hph (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), and trpC (anthranilate synthase), and their equivalents. Preferred for use in Aspergillus cells are the Aspergillus nidulans or Aspergillus oryzae amdS and pyrG genes and the Streptomyces hygroscopicus bar gene. Preferred for use in Trichoderma cells are the adeA, adeB, amdS, hph, and pyrG genes.

[0085] The selectable marker may be a dual selectable marker system as described in WO 2010 / 039889. In one aspect, the dual selectable marker is the hph-tk dual selectable marker system.

[0086] The vector preferably contains one or more elements that permit integration of the vector into the host cell's genome or autonomous replication of the vector in the cell independent of the genome.

[0087] For being integrated into the host cell genome, the vector can rely on the polynucleotide sequence encoding the polypeptide or any other element of the vector for being integrated into the genome by homologous or non-homologous recombination.Alternately, the vector can contain other polynucleotides at the precise position in the chromosome that is integrated into the host cell genome for guiding by homologous recombination.In order to increase the possibility of integration at the precise position, the integration element should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs and 800 to 10,000 base pairs, and these nucleic acids have a high degree of sequence identity with the corresponding target sequence to enhance the probability of homologous recombination.The integration element can be any sequence homologous to the target sequence in the host cell genome.In addition, the integration element can be a non-coding or coded polynucleotide.On the other hand, the vector can be integrated into the genome of the host cell by non-homologous recombination.

[0088] Another effective way to ensure site-specific genomic integration is to use FRT sites, such as FRT-F and FRT-F3, which are inserted at each genomic locus to perform site-specific targeted integration of expression cassettes using Saccharomyces cerevisiae flippase (FLP) and FRT flippase recognition sequences, as described in WO 2012 / 160093 and US 2018 / 0037897.

[0089] For autonomous replication, the vector may further comprise an origin of replication, which enables autonomous replication of the vector in the host cell in question. The origin of replication may be any plasmid replicon mediating autonomous replication that functions in the cell. The term "origin of replication" or "plasmid replicon" means a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0090] Examples of origins of replication useful in filamentous fungal cells are AMA1 and ANS1 (Gems et al., 1991, Gene 98: 61-67; Cullen et al., 1987, Nucleic Acids Res. 15: 9163-9175; WO 00 / 24883). Isolation of the AMA1 gene and construction of a plasmid or vector containing the gene can be accomplished according to the method disclosed in WO 00 / 24883.

[0091] More than one copy of the polynucleotide of the present invention can be inserted into the host cell to increase the production of the polypeptide. The increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene together with the polynucleotide, wherein cells containing an amplified copy of the selectable marker gene and thus additional copies of the polynucleotide can be selected by culturing the cells in the presence of an appropriate selective agent.

[0092] The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to those skilled in the art (see, eg, Sambrook et al., 1989, supra).

[0093] Remove or reduce activity

[0094] The present invention also relates to a method comprising the following steps: mutating a host cell to modify, truncate, partially or completely inactivate, reduce the level of or eliminate a putative steroid dehydrogenase, wherein the native putative steroid dehydrogenase comprises at least one conserved amino acid motif selected from the group consisting of: YGAR and / or VPHS[W / Y]F and / or QC[A / V / S]RRL and / or LKKYTLP and / or CPHYT; preferably, at least two conserved motifs; more preferably, at least three or four conserved motifs; most preferably, the native putative steroid dehydrogenase comprises all five conserved motifs.

[0095] Mutant cells can be constructed by reducing or eliminating the expression of the polynucleotide or its homologue using methods well known in the art, such as inserting, destroying, substituting or lacking. In preferred aspects, the expression of the polynucleotide is changed, reduced or eliminated. For example, the polynucleotide to be changed, reduced or eliminated can be mutated or modified in the coding region or a part thereof required for activity or in the regulatory element required for the expression of the coding region. The example of this regulation or control sequence can be a promoter sequence or its functional part, i.e., a part that is enough to affect the expression of the polynucleotide. Other control sequences that can be modified include but are not limited to leader sequences, polyadenylation sequences, propeptide sequences, signal peptide sequences, transcription terminators and transcription activators.

[0096] The modification or inactivation of the polynucleotide can be carried out by subjecting the parental cell to mutagenesis, and selecting a mutant cell in which the expression of the polynucleotide is reduced or eliminated. The mutagenesis can be specific or random, for example, by using a suitable physical or chemical mutagen, by using a suitable oligonucleotide, or by carrying out a mutagenesis produced by PCR to the dna sequence. In addition, mutagenesis can be carried out by using any combination of these mutagens.

[0097] Examples of physical or chemical mutagens suitable for the purposes of the present invention include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), o-methylhydroxylamine, nitrous acid, ethylmethanesulfonic acid (EMS), sodium bisulfite, formic acid and nucleotide analogs.

[0098] When such agents are used, mutagenesis is generally performed by incubating the parental cells to be mutagenized in the presence of the selected mutagenizing agent under appropriate conditions and screening and / or selecting for mutant cells that exhibit reduced or no expression of the gene.

[0099] The modification or inactivation of this polynucleotide or its homologue can be completed by inserting, replacing or lacking one or more Nucleotide in gene or in the regulatory element required for its transcription or translation.For example, Nucleotide can be inserted or removed thereby cause the introduction of termination codon, the removal of start codon or the variation of open reading frame or intron processing.This type of modification or inactivation can be completed by the mutagenesis produced by site-directed mutagenesis or PCR according to methods known in the art.Although in principle, modification can be carried out in vivo, i.e., directly on the cell expressing the polynucleotide to be modified, it is preferred to modify in vitro as exemplified below.

[0100] Methods for deleting or disrupting targeted genes are described, for example, by Miller et al. (1985. Mol. Cell. Biol. 5: 1714-1721); WO 90 / 00192; May, G. (1992. Applied Molecular Genetics of Filamentous Fungi. JR Kinghorn and G. Turner, eds., Blackie Academic and Professional, pp. 1-25); and Turner, G. (1994. Vectors for Genetic Manipulation. SD Martinelli and JR Kinghorn, eds., Elsevier, pp. 641-665).

[0101] Examples of convenient ways to eliminate or reduce the expression of polynucleotides are based on gene replacement, gene deletion, gene editing or gene disruption techniques. For example, in a gene disruption method, a nucleic acid sequence corresponding to an endogenous polynucleotide is induced in vitro to produce a defective nucleic acid sequence, which is then transformed into a parent cell to produce a defective gene. By homologous recombination, the defective nucleic acid sequence replaces the endogenous polynucleotide. It may be desirable that the defective polynucleotide also encodes a marker that can be used to select a transformant in which the polynucleotide has been modified or destroyed. In one aspect, the polynucleotide is destroyed with a selective marker such as those described herein.

[0102] The present invention also relates to a method for inhibiting the expression of an active polypeptide in a cell, comprising administering a double-stranded RNA (dsRNA) molecule to the cell or expressing a double-stranded RNA (dsRNA) molecule in the cell, wherein the dsRNA comprises a subsequence of a polynucleotide or a homologue thereof. In a preferred aspect, the dsRNA is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more duplex nucleotides in length.

[0103] The dsRNA is preferably a small interfering RNA (siRNA) or a microRNA (miRNA). In a preferred aspect, the dsRNA is a small interfering RNA for inhibiting transcription. In another preferred aspect, the dsRNA is a microRNA for inhibiting translation.

[0104] The present invention also relates to such double-stranded RNA (dsRNA) molecules, comprising a portion of the mature polypeptide coding sequence of SEQ ID NO: 1 and / or SEQ ID NO: 4 and / or SEQ ID NO: 7 and / or SEQ ID NO: 10 for inhibiting the expression of the polypeptide in a cell. Although the present invention is not limited to any specific mechanism of action, the dsRNA can enter the cell and cause the degradation of single-stranded RNA (ssRNA) (including endogenous mRNA) of similar or identical sequence. When cells are exposed to dsRNA, mRNA from homologous genes is selectively degraded by a process called RNA interference (RNAi); see, for example, U.S. Pat. No. 5,190,931.

[0105] The dsRNA of the present invention can be used for gene silencing. In one aspect, the present invention provides methods for selectively degrading RNA using the dsRNAi of the present invention. The process can be performed in vitro, ex vivo or in vivo. In one aspect, these dsRNA molecules can be used to produce loss-of-function mutations in cells, organs or animals. Methods for preparing and using dsRNA molecules to selectively degrade RNA are well known in the art; see, for example, U.S. Patent Nos. 6,489,127; 6,506,559; 6,511,824 and 6,515,109.

[0106] These protease-deficient mutant cells are particularly useful as host cells for the expression of heterologous secreted polypeptides.

[0107] The methods for culturing and purifying the target product can be performed by methods known in the art.

[0108] Generation method

[0109] Host cells are cultured in a nutrient medium suitable for producing polypeptides using methods known in the art. For example, cells can be cultured by shaking bottles or in small or large-scale fermentations (including continuous, batch, fed-batch or solid-state fermentation) in a laboratory or industrial fermentor, which are cultured in a suitable medium and under conditions that allow expression and / or separation of polypeptides. Using procedures as known in the art, cultivation occurs in a suitable nutrient medium comprising carbon and nitrogen sources and inorganic salts. Suitable culture medium can be obtained from commercial suppliers or can be prepared according to disclosed composition (for example, in the catalog of the American Type Culture Collection). If polypeptide is secreted into the nutrient medium, the polypeptide can be directly recovered from the medium. If polypeptide is not secreted, it can be recovered from cell lysate.

[0110] The polypeptide can be detected using methods known in the art that are specific for the polypeptide. These detection methods include, but are not limited to, the use of specific antibodies, the formation of an enzyme product, or the disappearance of an enzyme substrate. For example, an enzyme assay can be used to determine the activity of a polypeptide.

[0111] The polypeptide can be recovered using methods known in the art. For example, the polypeptide can be recovered from the nutrient medium by conventional methods, including but not limited to collection, centrifugation, filtration, extraction, spray drying, evaporation or precipitation. In one aspect, the fermentation broth containing the polypeptide is recovered.

[0112] The polypeptide may be purified by a variety of procedures known in the art, including, but not limited to, chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic chromatography, focusing chromatography, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing electrophoresis), differential solubilization (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction (see, e.g., Protein Purification, Janson and Ryden, eds., VCH Publishers, New York, 1989), in order to obtain a substantially pure polypeptide.

[0113] In alternative aspects, the polypeptide is not recovered, but rather a host cell of the invention expressing the polypeptide is used as a source of the polypeptide.

[0114] One aspect of the present invention relates to a method for producing a secreted polypeptide of interest, the method comprising the steps of:

[0115] a) cultivating the mutant filamentous fungal host cell of any preceding claim under conditions favorable for production of the secreted polypeptide; and, optionally

[0116] b) recovering the secreted polypeptide of interest.

[0117] In a preferred embodiment, the filamentous fungal host cell belongs to a genus selected from the group consisting of: Acremonium, Aspergillus, Aureobasidium, Nicotiana, Ceroplasts, Chrysosporium, Coprinus, Coriolus, Cryptococcus, Ustilagoraceae, Fusarium, Humicola, Pyrospora, Mucor, Myceliophthora, Neotrichia, Neurospora, Paecilomyces, Penicillium, Flat-Legumins, Radius, Ruminochytrium, Pleurotus, Schizophyllum, Talaromyces, Thermoascus, Thielavia, Toxoplasma, Trametes, and Trichoderma; even more preferably, the filamentous fungal host cell is an Aspergillus cell; preferably, Aspergillus aculeatus, Aspergillus aculetinus, Aspergillus awamori, Aspergillus brasiliensis, Aspergillus foetidus, Aspergillus fumigatus, Aspergillus japonicus, Aspergillus ryukyuus, Aspergillus nidulans, Aspergillus niger, or Aspergillus oryzae.

[0118] Preferably, the secreted polypeptide of interest is an enzyme; preferably, the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase or transferase, such as an aminopeptidase, an amylase, a carbohydrase, a carboxypeptidase, a catalase, a cellobiohydrolase, a cellulase, a chitinase, a cutinase, a cyclodextrin glycosyltransferase, a deoxyribonuclease, an endoglucanase, an esterase, an α-galactosidase, a β-galactosidase, a glucoamylase, an α-glucosidase, a β-glucosidase, an invertase, a laccase, a lipase, a mannosidase, a mutanase, an oxidase, a pectinolytic enzyme, a peroxidase, a phytase, a polyphenol oxidase, a proteolytic enzyme, a ribonuclease, a transglutaminase, a xylanase, or a β-xylosidase.

[0119] Examples

[0120] Filamentous fungal strains

[0121] Trichoderma reesei BTR213 is described in WO 2013 / 086633.

[0122] Trichoderma reesei strain frt4new-1940-1996-2012-12-1 is a Trichoderma reesei BTR213 strain with ku70 destroyed and parasporin synthetase (parS) missing. Cellobiohydrolase I (cbh1), cellobiohydrolase II (cbh2), endoglucanase I (eg1) and xylanase II (xyn2) genes are missing in this strain, and there are FRT sites (FRT-F and FRT-F3), which are inserted into each of these four loci to use Saccharomyces cerevisiae flip enzyme (FLP) and FRT flip enzyme recognition sequences FRT-F and FRT-F3 to perform site-specific targeted integration of expression cassettes, as described in WO 2012 / 160093 and US 2018 / 0037897. Endoglucanase II (eg2) and endoglucanase III genes (eg3) are also missing in this strain. The Aspergillus niger cytosine deaminase (fcyA) gene was inserted between the FRT-F and FRT-F3 sites at each of the four loci to serve as a counter-selection for 5-fluorocytosine (5-FC).

[0123] Media and solutions

[0124] COVE board is composed of: 342.30g sucrose, 25g Difco TM Pure agar, 20 ml COVE salt solution, 10 mM acetamide, 15 mM cesium chloride, and deionized water to make up to 1 liter. Sterilize the solution by autoclaving.

[0125] COVE2 plates consisted of: 30 g sucrose, 20 ml COVE salt solution, 10 ml 1 M acetamide, 25 g Difco TM Pure agar, and make up to 1 liter with deionized water. Sterilize the solution by autoclaving.

[0126] COVE2 glucose plates containing 5-fluorocytosine (5-FC) (Sigma Chemical Co.) were composed of 20 ml COVE saline solution, 10 ml 1 M acetamide, 25 g Difco TM Pure agar, and deionized water to make up to 1 liter. Sterilize the solution by autoclaving. After autoclaving, add 40 ml of 50% (w / v) glucose (sterile). Cool the solution to 50°C, and add 5-FC to a final concentration of 75 μg / ml.

[0127] COVE salt solution is composed of: 26 g KCl, 26 g MgSO 4 7H 2 O, 76g KH 2 PO4 , 50 ml COVE trace metal solution, and deionized water to make up to 1 liter. Sterilize the solution by autoclaving.

[0128] COVE trace metal solution is composed of: 0.04 g Na 2 B 4 O 7 10H 2 O, 0.4 g CuSO 4 ·5H 2 O, 1.2 gFeSO 4 7H 2 O, 0.7 g MnSO 4 ·H 2 O, 0.8 g Na 2 MoO 2 ·2H 2 O, 10g ZnSO 4 7H 2 O, and deionized water to make up to 1 L. Sterilize the solution by autoclaving.

[0129] The fermentation batch medium consisted of 24 g dextrose, 40 g soy flour, 8 g (NH 4 ) 2 SO 4 , 3g K 2 HPO 4 8g K 2 SO 4 , 3g CaCO 3 、8g MgSO 4 7H 2 O, 1 g of citric acid, 8.8 ml of 85% phosphoric acid, 1 ml of defoamer, 14.7 ml of trace metal solution, and deionized water to make up to 1 liter.

[0130] PDA board made of 39g Difco TM Potato dextrose agar was made up with deionized water to 1 liter. The solution was sterilized by autoclaving.

[0131] PDA + 1M sucrose plate is composed of: 39 g Difco TM Potato dextrose agar, 342.30 g sucrose, and deionized water to make up to 1 liter. The solution was sterilized by autoclaving.

[0132] PEG buffer consisted of 50% polyethylene glycol (PEG) 4000, 10 mM Tris-HCl (pH 7.5), and 10 mM CaCl in deionized water. 2The solution was sterilized by filtration.

[0133] The sample buffer (pH 7.5) consisted of 0.1 M Tris-HCl, 0.1 M NaCl, and 0.01% Triton X-100. The solution was sterilized by filtration. The shake flask medium consisted of the following: 20 g glycerol, 10 g soybean powder, 1.5 g (NH 4 ) 2 SO 4 , 2g KH 2 PO 4 , 0.2 g CaCl 2 , 0.4 g MgSO 4 7H 2 O, 0.2 ml of trace metal solution, and deionized water to make up to 1 liter.

[0134] 1.2 M sorbitol was made up from 218.4 g sorbitol and deionized water to 1 liter. The solution was sterilized by autoclaving.

[0135] STC was composed of 1 M sorbitol, 10 mM Tris-HCl (pH 7.5), and 50 mM CaCl in deionized water. 2 The solution was sterilized by filtration.

[0136] TBE buffer was composed of 10.8 g Tris base, 5 g boric acid, 4 ml 0.5 M EDTA (pH 8), and deionized water to make up to 1 liter.

[0137] TE buffer consists of 1 M Tris-HCl (pH 8.0) and 0.5 M EDTA (pH 8.0).

[0138] The trace metal solution consisted of: 26.1 g FeSO 4 7H 2 O, 5.5g ZnSO 4 7H 2 O, 6.6 g MnSO 4 ·H 2 O, 2.6 g CuSO 4 ·5H 2 O, 2 g citric acid, and deionized water to make up to 1 liter. Sterilize the solution by autoclaving.

[0139] Trichoderma minimal medium (TrMM) plates containing 1.5 μM 5-fluoro-2'-deoxyuridine (FdU) were composed of 20 ml COVE salt solution, 0.6 g CaCl 2 .2H 2 O, 6g(NH 4 )2 SO 4 , 25g Difco TM Pure agar, and deionized water to make up to 1 liter. Sterilize the solution by autoclaving. After autoclaving, add 40 ml of 50% (w / v) sterile glucose. Cool the medium to 50°C and add FdU (sterile) to a final concentration of 1.5 μM.

[0140] 2xYT+Amp board consists of: 16g Bacto TM Tryptone, 10g Bacto TM Yeast extract, 5g NaCl, 15g Bacto TM Agar, 1 ml of 100 mg / ml ampicillin (filter sterilized, added after autoclaving), and deionized water made up to 1 liter. The solution was sterilized by autoclaving.

[0141] YP medium consists of 1% Bacto TM Yeast extract and 2% Bacto TM Peptone composition. Sterilize the solution by autoclaving.

[0142] YPD medium contained 1% Bacto TM Yeast extract, 2% Bacto TM Peptone and 2% glucose. The solution was sterilized by autoclaving.

[0143] The fermentation feed medium consisted of 1190 g glucose, 14.2 ml 85% H3PO4 and 486 g H 2 O. Sterilize the solution by autoclaving.

[0144] Example 1: Genomic DNA extracted from Trichoderma reesei

[0145] T. reesei was grown in 50 ml of YPD medium in a 250 ml baffled shake flask at 28°C with agitation at 200 rpm for 2 days. Mycelia from the cultures were collected using a funnel from EMD Chemicals Inc., squeezed dry, and then transferred to a pre-chilled mortar and pestle. Each mycelial preparation was ground into a fine powder and kept frozen with liquid nitrogen. A total of 1-2 g of the powder was transferred to a 50 ml tube and sieved using Genomic DNA was extracted from ground mycelial powder using the Plant Maxi Kit (QIAGEN Inc.). 5 ml of buffer AP1 (QIAGEN) preheated to 65°C was added to a 50 ml tube, followed by 10 μl of RNase A 100 mg / ml stock solution (QIAGEN), and incubated at 65°C for 2-3 hours. A total of 1.8 ml of AP2 buffer (QIAGEN) was added and centrifuged at 3000-5000 x g for 5 minutes. The supernatant was decanted into a QIAshredder large nucleic acid purification column (QIAGEN) placed in a 50 ml collection tube and centrifuged at 3000-5000 x g for 5 minutes in a swing-out rotor at room temperature (15°C-25°C). The flow-through liquid in the collection tube was transferred to a new 50 ml tube without disturbing the precipitate. A 1.5 ml volume of buffer AP3 / E (QIAGEN) was added to the clarified lysate and mixed immediately by vortexing. Pipette the sample (up to 15 ml), including any precipitate that may have formed, into a 50 ml collection tube. 100 mL of Buffer AW (Qiagen) was added to the column and centrifuged at 3000-5000 x g for 5 min at room temperature (15°C-25°C) in a swing-out rotor. The flow-through was discarded. 12 mL of Buffer AW (Qiagen) was added to the column. Place the membrane in a large nucleic acid purification column and centrifuge at 3000-5000 x g for 10 minutes to dry the membrane. Discard the flow-through and collection tube. Transfer the large nucleic acid purification column to a new 50 ml tube. Pipette 0.5 ml of buffer AE (Qiagen) preheated to 65°C directly into the Incubate the cells in a large nucleic acid purification column at room temperature (15°C-25°C) for 5 minutes, then centrifuge at 3000-5000 x g for 5 minutes to elute the genomic DNA. The concentration and purity of the genomic DNA were determined by measuring the absorbance at 260 nm and 280 nm.

[0146] Example 2: Production and transformation of Trichoderma reesei protoplasts

[0147] Protoplast preparation and transformation of Trichoderma reesei were performed using a similar scheme to Penttila et al., 1987, Gene [Gene] 61: 155-164. In brief, Trichoderma reesei was cultured in two shake flasks each containing 25 ml of YPD medium at 27 ° C with gentle stirring at 90 rpm for 17 hours. The mycelium was collected by filtering using a vacuum-driven disposable filtration system (Millipore), and washed twice with deionized water and washed twice with 1.2 M sorbitol. The washed mycelium was suspended in 30 ml of Yatalase containing 5 mg / ml by gently shaking at 75-90 rpm at 34 ° C.TM Protoplasts were generated in 1.2 M sorbitol (Takara Bio USA, Inc.) and 0.5 mg / ml chitinase (Sigma Chemical Co., Ltd.) for 60-75 minutes. Protoplasts were collected by centrifugation at 834 x g for 6 minutes and washed twice with cold 1.2 M sorbitol. Protoplasts were counted using a hemocytometer and resuspended to a final concentration of 1 x 10 8 protoplasts / ml of STC.

[0148] Approximately 1-10 μg of DNA was added to 100 μl of protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. For DNA containing the hygromycin B resistance marker (hph), the contents were plated on PDA+1M sucrose plates and incubated overnight at 30°C. The next day, an overlay consisting of PDA+hygromycin B was added to a final concentration of 10 μg / ml hygromycin B, and the plates were incubated at 30°C for 5-7 days.

[0149] Example 3: Construction of a plasmid (pNJOC577; SEQ ID NO: 13) for modifying the TrA1331W gene (SEQ ID NO: 1) encoding a putative steroid dehydrogenase

[0150] By using HiFi DNA Assembly Cloning Kit (New England Company (New England Inc.)) cloned the 5' targeting region, hph (hygromycin phosphotransferase) and tk (HSV-1 thymidine kinase) boxes, the repetitive sequences to be used to cut out the hph and tk boxes, and the 3' targeting region into pUC19 (linearized with HindIII and Sad) to construct a plasmid that modifies the protein encoded by TrA1331W (SEQ ID NO: 1) by introducing mutations that result in truncation or internal deletion of a large number of consecutive amino acids in the region encoding the putative steroid dehydrogenase domain. The 5' targeting region, hph and tk boxes, the repetitive sequences to be used to cut out the hph and tk boxes, and the 3' targeting region were PCR amplified using the following primer set:

[0151] oNJ587(SEQ ID NO:19)+oNJ605(SEQ ID NO:20)、

[0152] oNJ610(SEQ ID NO:25)+oNJ611(SEQ ID NO:26)、

[0153] oNJ606 (SEQ ID NO: 21) + oNJ607 (SEQ ID NO: 22), and

[0154] oNJ608(SEQ ID NO:23)+oNJ609(SEQ ID NO:24).

[0155] use Hot Start II DNA polymerase (Thermo Fisher Scientific) was used for amplification according to the manufacturer's instructions. PCR consisted of 5 ng pJfyS1579-41-11 (WO 2010 / 039840) (template for hph / tk cassette) or 50 ng BTR213 genomic DNA (WO 2013 / 086633) as template, 1xHF buffer, 200 μM of each dNTP, 500 nM forward primer, 500 nM reverse primer, 1 unit of Hot Start II DNA polymerase, and add sterile H 2 O to a final volume of 50 μl. The reaction was run on a Bio-Rad C1000 Touch TM The PCR products were incubated in a thermocycler (Bio-Rad Laboratories): 1 cycle at 98°C for 3 min; 35 cycles at 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s (repeat) or 2.5 min; and 1 cycle at 72°C for 5 min. After thermocycling, PCR products were separated by 1% agarose gel electrophoresis in TBE buffer, and bands corresponding to different PCR products (2354 bp, 4395 bp, 322 bp, and 1986 bp) were excised from the gel and used according to the manufacturer's instructions. Gel purification was performed using a PCR cleanup kit (Macherey-Nagel). pUC19 was digested with HindIII and Sad in a 50 μl reaction consisting of 5 μg of pUC19, 20 units of each HindIII-HF (New England Biolabs, Inc. Company (New England Inc.)) and SacI-HF (New England Company), 1x Buffer (New England Company), and sterile H 2 The reaction was incubated at 37°C and then subjected to 1% agarose gel electrophoresis in TBE buffer. The 2645 bp pUC19 HindIII / SacI fragment was excised from the gel and used according to the manufacturer's instructions. Gel and PCR clean-up kit (Marshall-Nagel) were used for purification. A total volume of 30 μL The PCR product and the pUC19 HindIII / SacI fragment were fused together using the HiFi DNA Assembly Master Mix Kit (New England Biolabs), which consisted of 1x HiFi assembly master mix and 0.04 pmol of each PCR product. The reaction was incubated at 50 °C for 45 min and then placed on ice. 1 μL of the reaction was used to transform 60 μL of Stellar TM Competent cells (Clontech Laboratories, Inc.). The transformation reaction was plated on two 2xYT+Amp plates and incubated overnight at 37°C. Presumed transformant colonies were isolated from the selection plates and plasmid DNA was prepared from each using the QIAprep plasmid mini kit (Qiagen) and screened for the appropriate insertion of fragments digested with PvuII. After restriction enzyme digestion, plasmid DNA that produced the expected banding pattern (4991 bp, 3362 bp, 2364 bp, 439 bp, and 370 bp) was used to create a paired-end sequencing library and was cloned in NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Illumina Inc.). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the Trim Reads module. Reads were mapped to a model of the pNJOC577 plasmid (SEQ ID NO: 13) using the Map Reads to Reference Values ​​module with a high stringency setting. The Basic Variant Detection module was used to detect the presence of any single nucleotide polymorphisms. The plasmid with the expected nucleotide sequence was named pNJOC577 ( Figure 1 ).

[0156] Example 4: Construction of a Trichoderma reesei strain (NJOC586) modified with the protein encoded by TrA1331W

[0157] Produce Trichoderma reesei frt4new-1940-1996-2012-12-1 protoplasts as described in Example 2. About 2-4 μg linearized TrA1331W modification box (8871bp PmeI fragment) from pNJOC577 is added to 100 μl protoplast solution, and gently mixed. PEG buffer (250 μl) is added, and the reaction is mixed and incubated at 34 ° C for 30 minutes. Then STC (1ml) is added, and the contents are plated on PDA+1M sucrose plates and incubated overnight at 30 ° C. The next day, the covering composed of PDA+hygromycin B is added to a final concentration of 10 μg / ml hygromycin B, and the plate is incubated at 30 ° C for 5-7 days. Next, the hygromycin resistant transformant is transferred to the PDA plate and incubated at 30 ° C for 5-7 days. Transformants are screened by spore PCR to correctly integrate the TrA1331 modification box. For each transformant, spores were collected with a 1 μl sterile inoculation loop and suspended in 20 μl dilution buffer (PHIRE TM Plant Direct PCR Kit, Thermo Scientific). Each spore suspension was used as a template in a PCR reaction to screen for integration of the TrA1331W modification cassette at the TrA1331W locus. Two PCRs were performed on each transformant; one for integration at the 5' site and the other for integration at the 3' site. 5' integration screening was performed using primers that annealed to the upstream region of the integration site and primers that annealed to the regions within the hph and tk cassettes. 3' integration screening was performed using primers that annealed to the downstream region of the integration site and primers that annealed to the regions within the hph and tk cassettes. Each PCR reaction consisted of: 1 μl of spore suspension, 10 pmol of each primer, 10 μl of 2X PHIRE TM Plant PCR Buffer (PHIRE TM Plant Direct PCR Kit, Thermo Scientific), 0.4 μl PHIRE TM Hot Start II DNA Polymerase (PHIRE TM Plant Direct PCR Kit, Thermo Scientific), and H 2O to a final volume of 20 μl. Thermal cycling was performed according to the manufacturer's instructions. PCR products were analyzed by 1% agarose gel electrophoresis using TBE buffer. Transformants producing the desired PCR products were then isolated for single spores on PDA + 1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from a single colony were transferred to a new PDA plate, and the plate was incubated at 30°C for 5-7 days. The above 5' and 3' integration verification PCRs were repeated, and the PCR products were analyzed by 1% agarose gel electrophoresis using TBE buffer. The TrA1331W modification construct pNJOC577 contains hph and HSV-1tk cassettes flanked by direct repeat sequences to promote spontaneous looping of the hph and HSV-1tk cassettes and produce clean TrA1331W modifications by homologous recombination between the two repeat sequences. Spores from transformants with correctly integrated TrA1331W modification cassettes were collected at H 2 O, and the dilutions were plated on TrMM plates containing 1.5 μM 5-fluoro-2'-deoxyuridine (FdU) and incubated at 30°C for 5 days to facilitate the identification of isolates that have lost the hph and HSV-1tk boxes. The FdU-resistant isolates were then transferred to PDA plates and the loss of the hph and HSV-1tk boxes was verified by spore PCR. In this spore PCR, three primers were added; one primer annealed to the upstream region of the hph and tk boxes, one primer annealed to the region outside the 3' integration site, and the other primer annealed to the region within the hph and tk boxes. The primers were designed to produce short or long PCR products, depending on whether the hph and tk boxes were still present. The transformants that had lost the hph and tk boxes were then isolated by single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to new PDA plates and the plates were incubated at 30°C for 5-7 days. To confirm the presence of the desired mutation in the TrA1331W gene, genomic DNA of several isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced in NEXTSEQ TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to a model of the TrA1331W gene (SEQ ID NO: 1) using the map reads to reference value module with a high stringency setting. The presence of the desired mutation was verified using the basic variant detection module. One of the isolates containing the desired mutation was named NJOC586 and saved for further study.

[0158] Example 5: Transformation of Trichoderma reesei strain frt4new-1940-1996-2012-12-1 with pNJOC383

[0159] Trichoderma reesei frt4new-1940-1996-2012-12-1 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pNJOC383 (a plasmid containing an Acremonium alcalophilum CBS114.92 lysozyme expression cassette flanked by FRT-F and FRT-F3 sites for FLP-mediated integration at four loci containing FRT-F and FRT-F3 sites in the host strain; SEQ ID NOs: 14 and Figure 2 ) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC587 and saved for further study.

[0160] Example 6: Transformation of Trichoderma reesei TrA1331W improved strain (NJOC586) with pNJOC383

[0161] Trichoderma reesei NJOC586 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pNJOC383 (SEQ ID NO: 14; Figure 2 ) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced in NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC588 and saved for further study.

[0162] Example 7: Lysozyme activity assay (LSU(F) / ml)

[0163] The whole culture broth from fermentation was mixed at 30°C in a rotisserie mixer for about 2 hours. After the whole culture broth was mixed, all samples were diluted 100 times in pre-dilution buffer and then mixed again for about 2 hours using a rotisserie mixer. Next, the 100-fold pre-dilution sample was diluted 10000 times by 10-fold serial dilutions in 0.1M Tris-HCl, 0.1M NaCl, 0.01% TritonX-100 buffer pH 7.5 (sample buffer), followed by 3-fold serial dilutions until 1 / 9 of the diluted sample. The method was used in conjunction with the Biomek FX of Beckman Coulter and the SpectraMax plate reader from Molecular Devices. In sample buffer, the lysozyme standard was diluted with a concentration of 0.05LSU (F) / ml and ended with a concentration of 0.002LSU (F) / ml. A total of 50 μl of each dilution including the standard was transferred to a 96-well flat-bottom plate. 50 μl of 25ug / ml fluorescein-conjugated cell wall substrate solution was added to each well and then incubated at ambient temperature for 45 minutes. During the incubation period, the reaction rate at 485nm (excitation) / 528nm (emission) of the 96-well plate was monitored at 15-minute intervals. The sample concentration was determined by extrapolation from the generated standard curve.

[0164] Example 8: Laboratory scale fermentation shows that modification of the protein encoded by TrA1331W leads to increased lysozyme productivity / yield

[0165] Strains NJOC587 and NJOC588 expressing four copies of lysozyme were evaluated in 2 liter fermentations. Each strain was grown on two PDA plates at 30°C for 5-7 days. Three 500 ml shake flasks, each containing 100 ml of shake flask medium, were inoculated with two plugs / shake flask from the PDA plate. The shake flasks were incubated at 28°C on an orbital shaker at 200 rpm for 48 hours. These cultures were used as seeds for fermentation.

[0166] A total of 150 ml of various seed cultures were inoculated into 3 liters of glass jacketed fermentors (Applikon Biotechnology) containing 1.5 liters of fermentation batch medium. The fermentor was maintained at a temperature of 28°C, and the pH was controlled at a set point of 3.5 + / - 0.1 using an Applikon 1030 control system. Air was added to the container at a rate of 2.5 L / min, and the culture was stirred by a Rushton impeller rotating at 300-1100 rpm. The fermentation feed medium consisting of autoclaved glucose and phosphoric acid was given a time period of about 7 days at a rate of 0 to 14 g / L / hour. Aliquots of full culture broth were taken at days 5, 6 and 7, and stored at 5°C to 10°C until it was processed for lysozyme activity assay.

[0167] The lysozyme expression level was determined as described in Example 7. Increased lysozyme expression was observed in the NJOC588 strain compared to NJOC587, indicating that modification of the TrA1331W gene encoding a native putative steroid dehydrogenase favored lysozyme expression.

[0168] Example 9: Identification of homologs of the protein encoded by TrA1331W (SEQ ID NO: 3)

[0169] A BLAST search for homologs of proteins encoded by genes in the genomes of A. niger, A. oryzae, and F. venenatum was performed using the amino acid sequence of the protein encoded by TrA1331W (SEQ ID NO: 3) (E value: 1.00e-5, font size: 5). A single BLAST hit was obtained for each organism and is presented in Table 1:

[0170] Table 1. Homologs of the protein encoded by TrA1331W identified in A. niger, A. oryzae and Fusarium venenatum.

[0171] SEQ ID NO: organism 6 Aspergillus niger 9 Aspergillus oryzae 12 Fusarium venenatum

[0172] The percent identity between different proteins was calculated using the Needleman-Wunsch algorithm as described above. The identity between the two proteins is summarized in Table 2.

[0173] Table 2. Amino acid %-identity matrix. Identity is expressed as percent identity calculated using the Needleman-Wunsch algorithm as described elsewhere herein.

[0174]

[0175] According to Table 2, these proteins have significant sequence identity, ranging from approximately 39% to 70% identity (the highest percentage identity is not unexpectedly observed between the more closely related A. niger and A. oryzae proteins).

[0176] To further investigate the correlations between proteins, the MUSCLE algorithm version 3.8.31 and default parameters were used to align the proteins (Edgar, RC (2004). Nucleic Acids Research, 32 (5), 1792-1797). The results of this multiple sequence alignment are shown in Figure 3. As shown in Figure 3, these proteins have significant amino acid sequence identity, with several stretches / blocks of highly conserved amino acid motifs, such as YGAR and / or VPHS[W / Y]F and / or QC[A / V / S]RRL and / or LKKYTLP and / or CPHYT motifs, shown. In summary, the results suggest that the putative enzymes may function similarly in different fungal hosts.

[0177] Example 10: Construction of a plasmid (pNJOC569; SEQ ID NO: 27) for deleting the TrA1331W gene (SEQ ID NO: 1) encoding a putative steroid dehydrogenase

[0178] By using HiFi DNA Assembly Cloning Kit (New England The 5' targeting region, hph (hygromycin phosphotransferase) and tk (HSV-1 thymidine kinase) boxes, the repeating sequences to be used to cut out the hph and tk boxes, and the 3' targeting region were cloned into pUC19 (linearized with HindIII and Sad) to construct a plasmid for deleting the entire protein encoded by TrA1331W (SEQ ID NO: 1). The 5' targeting region, hph and tk boxes, the repeating sequences to be used to cut out the hph and tk boxes, and the 3' targeting region were PCR amplified using the following primer set:

[0179] oNJ587(SEQ ID NO:19)+oNJ588(SEQ ID NO:28)、

[0180] oNJ595(SEQ ID NO:29)+oNJ596(SEQ ID NO:30)、

[0181] oNJ592 (SEQ ID NO: 31) + oNJ593 (SEQ ID NO: 32), and

[0182] oNJ589(SEQ ID NO:33)+oNJ590(SEQ ID NO:34).

[0183] use Amplification reactions were performed using Hot Start II DNA polymerase (Thermo Fisher Scientific) according to the manufacturer's instructions. PCR consisted of 5 ng of pJfyS1579-41-11 (WO2010 / 039840) (template for hph / tk cassette) or 50 ng of BTR213 genomic DNA (WO2013 / 086633) as template, 1×HF buffer, 200 μM of each dNTP, 500 nM forward primer, 500 nM reverse primer, 1 unit of Hot Start II DNA polymerase, and add sterile H 2 O to a final volume of 50 μl. The reaction was run on a Bio-Rad C1000 Touch TM The PCR products were incubated in a thermocycler (Bio-Rad Laboratories, Inc.): 1 cycle at 98°C for 3 min; 35 cycles at 98°C for 10 s, 65°C for 30 s, and 72°C for 30 s (repeat) or 2.5 min; and one cycle at 72°C for 5 min. After thermal cycling, PCR products were separated by 1% agarose gel electrophoresis in TBE buffer, and bands corresponding to different PCR products (1587 bp, 4405 bp, 354 bp, and 1571 bp) were excised from the gel and used according to the manufacturer's instructions. Gel purification was performed using a PCR cleanup kit (Marchery-Nagel). pUC19 was digested with HindIII and Sad in a 50 μl reaction consisting of 5 μg of pUC19, 20 units of each HindIII-HF (New England Biolabs). Company) and SacI-HF (New England Company), 1x Buffer (New England Company), and sterile H 2 The reaction was incubated at 37°C and then subjected to 1% agarose gel electrophoresis in TBE buffer. The 2645 bp pUC19 HindIII / SacI fragment was excised from the gel and used according to the manufacturer's instructions. Gel and PCR clean-up kit (Marshall-Nagel) were used for purification. A total volume of 30 μL The PCR product and the pUC19 HindIII / SacI fragment were fused together using the HiFi DNA Assembly Master Mix Kit (New England Biolabs, Inc.). The kit consisted of 1x HiFi assembly master mix and 0.04 pmol of each PCR product. The reaction was incubated at 50 °C for 45 min and then placed on ice. 1 μL of the reaction was used to transform 60 μL of Stellar TM Competent cells (Clontech Laboratories, Inc.). The transformation reaction was plated on two 2xYT+Amp plates and incubated overnight at 37°C. Presumed transformant colonies were separated from the selection plates and plasmid DNA was prepared from each using QIAprep plasmid mini kit (Qiagen), and screened for the appropriate insertion of the fragment digested with PvuII. After restriction enzyme digestion, plasmid DNA producing the expected banding pattern (4224bp, 3117bp, 2364bp, 370bp, 296bp) was used to create a paired end sequencing library and was cloned in NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the Trim Reads module. Reads were mapped to a model of the pNJOC569 plasmid (SEQ ID NO: 27) using the Map Reads to Reference Values ​​module with a high stringency setting. The Basic Variant Detection module was used to detect the presence of any single nucleotide polymorphism. The plasmid with the expected nucleotide sequence was named pNJOC569 ( Figure 4 ).

[0184] Example 11: Construction of a Trichoderma reesei strain (NJOC584-5D8A) lacking the TrA1331W gene encoding a putative steroid dehydrogenase

[0185] Produce Trichoderma reesei frt4new-1940-1996-2012-12-1 protoplasts as described in Example 2. About 2-4 μg linearized TrA1331W deletion box (7716bp PmeI fragment) from pNJOC569 is added to 100 μl protoplast solution, and mixed gently. PEG buffer (250 μl) is added, and the reaction is mixed and incubated at 34 ° C for 30 minutes. Then STC (1ml) is added, and the contents are plated on PDA+1M sucrose plates and incubated overnight at 30 ° C. The next day, the covering composed of PDA+hygromycin B is added to a final concentration of 10 μg / ml hygromycin B, and the plate is incubated at 30 ° C for 5-7 days. Next, the hygromycin resistant transformant is transferred to the PDA plate and incubated at 30 ° C for 5-7 days. Transformants are screened by spore PCR to correctly integrate the TrA1331 deletion box. For each transformant, spores were collected with a 1 μl sterile inoculation loop and suspended in 20 μl dilution buffer (PHIRETM Plant Direct PCR Kit, Thermo Scientific). Each spore suspension was used as a template in a PCR reaction to screen for integration of the TrA1331W deletion cassette at the TrA1331W locus. Two PCRs were performed on each transformant; one for integration at the 5' site and one for integration at the 3' site. 5' integration screening was performed using primers annealing to the upstream region of the integration site (oNJ632, SEQ ID NO:35) and primers annealing to the region within the hph and tk cassettes (AgJg685, SEQ ID NO:36). 3' integration screening was performed using primers annealing to the downstream region of the integration site (oNJ633, SEQ ID NO:37) and primers annealing to the region within the hph and tk cassettes (AgJg604, SEQ ID NO:38). Each PCR reaction consisted of: 1 μl of spore suspension, 10 pmol of each primer, 10 μl of 2X PHIRE TM Plant PCR Buffer (PHIRE TM Plant Direct PCR Kit, Thermo Scientific), 0.4 μl PHIRE TM Hot Start II DNA Polymerase (PHIRE TM Plant Direct PCR Kit, Thermo Scientific), and H 2 O to a final volume of 20 μl. Thermal cycling was performed according to the manufacturer's instructions. PCR products were analyzed by 1% agarose gel electrophoresis using TBE buffer. Transformants producing the desired PCR products were then single-spore isolated on PDA + 1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to new PDA plates, and the plates were incubated at 30°C for 5-7 days. The above 5' and 3' integration verification PCRs were repeated, and the PCR products were analyzed by 1% agarose gel electrophoresis using TBE buffer. The TrA1331W deletion construct from pNJOC569 contains hph and HSV-1tk cassettes flanked by direct repeat sequences to promote spontaneous looping of the hph and HSV-1tk cassettes and produce a clean TrA1331W deletion by homologous recombination between the two repeat sequences. Spores from transformants with correctly integrated TrA1331W modification cassettes were collected at H 2O, and the dilutions were plated on TrMM plates containing 1.5 μM 5-fluoro-2'-deoxyuridine (FdU) and incubated at 30°C for 5 days to facilitate the identification of isolates that have lost the hph and HSV-1tk boxes. The FdU-resistant isolates were then transferred to PDA plates and the loss of the hph and HSV-1tk boxes was verified by spore PCR. In this spore PCR, three primers were added; one primer annealed to the upstream region of the hph and tk boxes, one primer annealed to the region outside the 3' integration site, and the other primer annealed to the region within the hph and tk boxes. The primers were designed to produce short or long PCR products, depending on whether the hph and tk boxes were still present. The transformants that had lost the hph and tk boxes were then isolated by single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to new PDA plates and the plates were incubated at 30°C for 5-7 days. To confirm the presence of the desired deletion of the TrA1331W gene, genomic DNA of several isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench 11.0.1 (Qiagen). Reads were trimmed using the trimming reads module. The reads were mapped to a model of the TrA1331W gene (SEQ ID NO: 1) using the map reads to reference value module with high stringency settings. The presence of the desired deletion was verified in the InDels and Structural Variants module. One of the isolates containing the desired deletion was named NJOC584-5D8A and stored for further study.

[0186] Example 12: Transformation of Trichoderma reesei strain NJOC584-5D8A with pNJOC383

[0187] Protoplasts of Trichoderma reesei NJOC584-5D8A were generated as described in Example 2. Approximately 1-10 μg of pNJOC383 (SEQ ID NO: 14 and Figure 2) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC618-81D and saved for further study.

[0188] Example 13: Laboratory scale fermentation showed that deletion of the protein encoded by TrA1331W also resulted in an increase in lysozyme productivity / yield

[0189] The strains NJOC587 (control) and NJOC618-81D expressing four copies of lysozyme were evaluated in 2 liters of fermentation. Each strain was grown on two PDA plates at 30°C for 5-7 days. Three 500 ml shake flasks each containing 100 ml of shake flask medium were inoculated with two stoppers / shake flasks from the PDA plates. The shake flasks were incubated at 28°C on an orbital shaker at 200 rpm for 48 hours. These cultures were used as seeds for fermentation.

[0190] Use 150ml of various seed cultures to inoculate 3 liters of glass jacketed fermentors (Ou Pu Biotech) containing 1.5 liters of fermentation batch medium. The fermentor is maintained at a temperature of 28 ℃, and the pH is controlled at a set point of 3.5+ / -0.1 using an Applikon 1030 control system. Air is added to the container at a rate of 2.5L / min, and the culture medium is stirred by the Rushton impeller rotating at 300-1100rpm. The fermentation feed medium consisting of autoclaved glucose and phosphoric acid is given the time period of about 7 days at a rate of 0 to 14g / L / hour. Take equal portions of full culture medium at the 5th, 6th and 7th day, and store at 5 ℃ to 10 ℃ until it is processed for the lysozyme activity assay.

[0191] Lysozyme expression levels were determined as described in Example 7. At all assayed time points, the expression of Figure 5 ), an increase in lysozyme expression was observed in the steroid dehydrogenase-deficient strain NJOC618-81D. The results indicate that inactivation of the TrA1331W gene encoding the native putative steroid dehydrogenase is beneficial for lysozyme expression.

[0192] Example 14: Transformation of Trichoderma reesei strain frt4new-1940-1996-2012-12-1 with pTmmD-Tl_lipase

[0193] Trichoderma reesei frt4new-1940-1996-2012-12-1 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pTmmD-Tl_lipase (Thermomyces lanuginosus HL703 lipase variant expression cassette flanked by FRT-F and FRT-F3 sites, was used for FLP-mediated integration at four loci containing FRT-F and FRT-F3 sites in the host strain; SEQ ID NO: 39 and Figure 6) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC600-2A and saved for further study.

[0194] Example 15: Transformation of Trichoderma reesei strain NJOC586 with pTmmD-T1_lipase

[0195] Trichoderma reesei NJOC586 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pTmmD-Tl_lipase (Thermomyces lanuginosus HL703 lipase variant expression cassette flanked by FRT-F and FRT-F3 sites for FLP-mediated integration at four loci containing FRT-F and FRT-F3 sites in the host strain; SEQ ID NO: 39 and Figure 6) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC609-1A and saved for further study.

[0196] Example 16: Lipase LU (LXP) / ml activity determination

[0197] The method was used in conjunction with the Biomek FX from Beckman Coulter and the SpectraMax plate reader from Molecular Instruments.

[0198] The culture supernatant was appropriately diluted in 0.05M MOPS (3-(N-morpholino) propanesulfonic acid), 10mM CaCl2, 0.01% Triton X-100 buffer pH 7.5 (sample buffer), followed by serial dilution of the diluted sample from 0-fold to 1 / 3-fold to 1 / 9-fold. In sample buffer, the Lipex standard was diluted at a concentration of 4.0LU(LXP) / ml and ended at a concentration of 0.197LU(LXP) / ml. A total of 20 μl of each dilution including the standard was transferred to a 96-well flat bottom plate. 200 μl of pNP-palmitate substrate solution (pNPP stock solution is 7.8 mM pNP-palmitate in 9.99% EtOH - working solution is: per liter - 500 ml 0.1 M MOPS pH 7.5, 20 ml pNPP stock solution, 100 ml 10% Triton X-100, 14.7 ml 680 mM CaCl2, and 1% HCl) were added. 2 The 50% dHO (10% dHO) solution was added to each well and then incubated at ambient temperature for 30 minutes. During the incubation period, the reaction rate of the 96-well plate at an optical density of 405 nm was measured over a 20-minute period. The sample concentration was determined by extrapolation from the generated standard curve.

[0199] Example 17: Laboratory scale fermentation shows that deletion of the protein encoded by TrA1331W also leads to an increase in lipase productivity / yield

[0200] The strains NJOC600-2A (control) and NJOC609-1A expressing four copies of lysozyme were evaluated in 2 liter fermentations. Each strain was grown on two PDA plates at 30°C for 5-7 days. Three 500 ml shake flasks each containing 100 ml of shake flask medium were inoculated with two stoppers / shake flasks from the PDA plates. The shake flasks were incubated at 28°C on an orbital shaker at 200 rpm for 48 hours. These cultures were used as seeds for fermentation.

[0201] Use 150ml of various seed cultures to inoculate 3 liters of glass jacketed fermentors (Ou Pu Biotechnology) containing 1.5 liters of fermentation batch medium. Fermentor is maintained at a temperature of 28 ℃, and the pH is controlled at a set value of 4.5+ / -0.1 using Applikon 1030 control system. Air is added in the container at a rate of 2.5L / min, and by the Rushton impeller stirring culture medium rotating with 300-1100rpm. The fermentation feed medium consisting of autoclaved glucose and phosphoric acid is given the time period of about five days with a rate of 0 to 15g / L / hour. Collect samples (supernatant) at the 2nd, 3rd, 4th and 5th day, and store at 5 ℃ until it is processed for lipase activity assay.

[0202] Lipase expression levels were determined as described in Example 16. At all assayed time points, the expression of lipase was significantly higher than that of NJOC600-2A control ( Figure 7 ), an increase in lipase expression was observed in the steroid dehydrogenase-deficient strain NJOC609-1A (improvement ranged from 45% to 132%). The results indicate that inactivation of the TrA1331W gene encoding the native putative steroid dehydrogenase is beneficial for lipase expression.

[0203] Example 18: Transformation of Trichoderma reesei strain frt4new-1940-1996-2012-12-1 with pSMai326

[0204] Trichoderma reesei frt4new-1940-1996-2012-12-1 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pSMai326 (a plasmid containing a Paenibacillus sp. xanthanase variant expression cassette flanked by FRT-F and FRT-F3 sites for FLP-mediated integration at four loci containing FRT-F and FRT-F3 sites in the host strain; SEQ ID NOs: 40 and Figure 8 ) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TMSequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC608-1B and saved for further study.

[0205] Example 19: Transformation of Trichoderma reesei strain NJOC586 with pSMai326

[0206] Trichoderma reesei NJOC586 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pSMai326 (a plasmid containing a Paenibacillus sp. xanthanase variant expression cassette flanked by FRT-F and FRT-F3 sites for FLP-mediated integration at four loci containing FRT-F and FRT-F3 sites in the host strain; SEQ ID NOs: 40 and Figure 8 ) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TMSequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC617-77C and saved for further study.

[0207] Example 20: Xanthanase XGU (A) activity assay

[0208] The method was run on a Thermo Arena 30 analyzer. 0.1 M ACES (N-(2-acetamido)-2-aminoethanesulfonic acid), 0.056 M NaOH, 4 mM CaCl2 2H 2 O, 0.025% Dilute the sample appropriately with L23 pH7 buffer (dilution buffer). Use dilution buffer to dilute the xanthanase standard to prepare a 7-point curve. Add 20μl of each sample and standard to 125μl 0.1M ACES, 0.056M NaOH (assay buffer) and 50μl substrate (0.1% (w / v) modified xanthan gum, 0.48% (v / v) ethanol, 0.1M ACES, 0.06M NaOH) and incubate at 50°C for 1200 seconds. Add 100μl of terminator (50g / L potassium sodium tartrate, 20g / L PAHBAH (4-hydroxybenzoyl hydrazide), 5.52g / L bismuth (III) acetate, 0.5M NaOH) to each reaction and incubate at 50°C for 1200 seconds. Endpoint measurement is performed at 405nm. Sample activity is determined by extrapolation from the generated standard curve.

[0209] Example 21: Laboratory scale fermentation showed that deletion of the protein encoded by TrA1331W also resulted in an increase in xanthanase productivity / yield

[0210] The strains NJOC608-1B (control) and NJOC617-77C expressing four copies of lysozyme were evaluated in a 2-liter fermentation. Each strain was grown on two PDA plates at 30°C for 5-7 days. Three 500 ml shake flasks each containing 100 ml of shake flask medium were inoculated with two stoppers / shake flask from the PDA plate. The shake flasks were incubated at 28°C on an orbital shaker at 200 rpm for 48 hours. These cultures were used as seeds for fermentation.

[0211] A total of 150 ml of various seed cultures were used to inoculate a 3-liter glass jacketed fermentor (Op Biotech) containing 1.5 liters of fermentation batch medium. The fermentor was maintained at a temperature of 28°C and the pH was controlled at a set value of 4.5+ / -0.1 using an Applikon 1030 control system. Air was added to the container at a rate of 2.5 L / min, and the culture was stirred by a Rushton impeller rotating at 300-1100 rpm. The fermentation feed medium consisting of autoclaved glucose and phosphoric acid was given a period of about seven days at a rate of 0 to 15 g / L / hour. Samples (supernatants) were collected on days 2-7 and stored at 5°C until they were processed for xanthanase activity assay.

[0212] Lipase expression levels were determined as described in Example 20. At all assayed time points, the expression of lipase was significantly higher than that of NJOC608-1B control ( Fig. 9 ), an increase in xanthanase expression was observed in the steroid dehydrogenase-deficient strain NJOC617-77C (improvement of 7%-28%). The results indicate that inactivation of the TrA1331W gene encoding a native putative steroid dehydrogenase is beneficial for xanthanase expression.

[0213] Example 22: Transformation of Trichoderma reesei strain frt4new-1940-1996-2012-12-1 with pTmmD-Mf_lysozyme

[0214] Trichoderma reesei frt4new-1940-1996-2012-12-1 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pTmmD-Mf_lysozyme (a plasmid containing a Myceliophthora fergusii lysozyme expression cassette flanked by FRT-F and FRT-F3 sites for FLP-mediated integration at four loci containing FRT-F and FRT-F3 sites in the host strain; SEQ ID NOs: 41 and Fig.10) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC601-5A and saved for further study.

[0215] Example 23: Transformation of Trichoderma reesei strain NJOC586 with pTmmD-Mf_lysozyme

[0216] Trichoderma reesei NJOC586 protoplasts were generated as described in Example 2. Approximately 1-10 μg of pTmmD-Mf_lysozyme (a plasmid containing a Myceliophthora fergusi lysozyme expression cassette flanked by FRT-F and FRT-F3 sites for FLP-mediated integration at four loci containing FRT-F and FRT-F3 sites in the host strain; SEQ ID NOs: 41 and Fig.10) was added to 100 μl of the protoplast solution and mixed gently. PEG buffer (250 μl) was added, and the reaction was mixed and incubated at 34°C for 30 minutes. STC (1 ml) was then added, and the contents were plated on COVE plates for amdS selection. The plates were incubated at 30°C for 7-9 days. Spores of transformants from each COVE plate were transferred to COVE2 glucose plates containing 75 μg / ml 5-fluorocytosine (5-FC) (Sigma Chemical Co., Ltd.) and incubated at 30°C for 5-7 days. Spores of transformants from COVE2 glucose plates containing 5-FC were transferred to new COVE2 glucose plates containing 5-FC and incubated at 30°C for 5-7 days. Several transformants were then isolated from single spores on PDA+1M sucrose plates. The plates were incubated at 30°C for 3-5 days. Spores from individual colonies were transferred to COVE2 plates, and the plates were incubated at 30°C for 5-7 days. To confirm integration of the lysozyme expression cassette from pNJOC383 at the cbh1, cbh2, eg1, and xyn2 loci, genomic DNA from several single spore isolates was prepared as described in Example 2 and used to create paired-end sequencing libraries and sequenced on NEXTSEQ. TM Sequencing was performed using 2X150bp chemistry on a 500 system (Enomina). Sequence analysis was performed using CLC Genomics Workbench version 11.0.1 (Qiagen). Reads were trimmed using the trim read module. Reads were mapped to models of cbh1, cbh2, eg1, and xyn2 loci (SEQ ID NOs: 15-18) using the map reads to reference value module with high stringency settings. One of the isolates with correct integration at all four sites was named NJOC610-2B and saved for further study.

[0217] Example 24: Lysozyme LSU (A) activity assay

[0218] The method is used in conjunction with Beckman Coulter's Biomek FX and a SpectraMax plate reader from Molecular Instruments. The whole culture broth sample is appropriately diluted in 0.1M acetate, 50mM NaCl, 0.01% Triton X-100 buffer pH 4.5 (sample buffer), and the diluted sample is subsequently serially diluted from 0 times to 1 / 3 times to 1 / 9 times. In sample buffer, the lysozyme standard is diluted at a concentration of 50LSU(A) / ml and ends with a concentration of 2.469LSU(A) / ml. A total of 20μl of each dilution including the standard is transferred to a 96-well flat bottom plate. 200μl of 0.26g / L Micrococcus lysodeikticus substrate solution is added to each well and then incubated at ambient temperature for 75 minutes. After the incubation is complete, the optical density of the 96-well plate at 450nm is obtained. The sample concentration is determined by extrapolating from the generated standard curve.

[0219] Example 25: Laboratory scale fermentation showed that deletion of the protein encoded by TrA1331W also resulted in an increase in the productivity / yield of Mf lysozyme

[0220] The strains NJOC601-5A (control) and NJOC610-2B expressing four copies of lysozyme were evaluated in 2 liters of fermentation. Each strain was grown on two PDA plates at 30°C for 5-7 days. Three 500 ml shake flasks each containing 100 ml of shake flask medium were inoculated with two stoppers / shake flasks from the PDA plates. The shake flasks were incubated at 28°C on an orbital shaker at 200 rpm for 48 hours. These cultures were used as seeds for fermentation.

[0221] Use 150ml of various seed cultures to inoculate 3 liters of glass jacketed fermentors (Ou Pu Biotechnology) containing 1.5 liters of fermentation batch medium. The fermentor is maintained at a temperature of 28 ° C, and the pH is controlled at a set value of 3.5 + / -0.1 using an Applikon 1030 control system. Air is added to the container at a rate of 2.5L / min, and the culture medium is stirred by the Rushton impeller rotating at 300-1100rpm. The fermentation feed medium consisting of autoclaved glucose and phosphoric acid is given the time period of about seven days at a rate of 0 to 15g / L / hour. Take equal parts of full culture solution at the 4th, 5th, 6th and 7th day, and store at 5 ° C to 10 ° C until it is processed for lysozyme activity (LSU (A)) measurement.

[0222] Lipase expression levels were determined as described in Example 24. At all assayed time points, the expression of lipase was significantly higher than that of NJOC601-5A control ( Fig.11), an increase in Mf lysozyme expression was observed in the steroid dehydrogenase-deficient strain NJOC610-2B (improvement of 6%-47%). The results indicate that inactivation of the TrA1331W gene encoding the native putative steroid dehydrogenase is beneficial for Mf lysozyme expression.

[0223] Example (Aspergillus niger)

[0224] Materials and Methods

[0225] Unless otherwise indicated, DNA manipulations and transformations were performed using standard methods of molecular biology as described in Sambrook et al. (1989) Molecular cloning: A laboratory manual, Cold Spring Harbor lab., Cold Spring Harbor, NY; Ausubel, FM et al. (eds.) "Current protocols in Molecular Biology", John Wiley and Sons, 1995; Harwood, CR, and Cutting, SM (eds.) "Molecular Biological Methods for Bacillus". John Wiley and Sons, 1990.

[0226] Purchased materials (E. coli and kit)

[0227] Use Escherichia coli DH5α (Toyobo) for plasmid construction and amplification. Use Qiagen Plasmid test kit (Qiagen) to reclaim the amplified plasmid. Use DNA ligation kit (Takara) or T4 DNA ligase (Boehringer Mannheim) to connect. Use ExpandTMPCR system (Boehringer) to carry out polymerase chain reaction (PCR). QIAquickTM gel extraction kit (Qiagen) is used to purify PCR fragments and extract DNA fragments from agarose gel.

[0228] Enzymes

[0229] Enzymes for DNA manipulation (eg, restriction endonucleases, ligases, etc.) are available from New England Biolabs, Inc.) and were used according to the manufacturer's instructions.

[0230] Plasmids

[0231] pBluescript II SK-(Stratagene #212206).

[0232] A derivative of pHUda801 (WO 2012 / 160093) comprising the Aspergillus nidulans pyrG gene and the herpes simplex virus (HSV) thymidine kinase gene (TK), pHUda963, driven by the Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase promoter (Pgpd) and the Aspergillus nidulans tryptophan synthase terminator (TtrpC), is described in Example 4 of WO 2012 / 160093.

[0233] pJaL1470 comprising the alkalophilic Acremonium lysozyme (Aa lysozyme) gene is described in WO2015144936A1.

[0234] Microbial strains

[0235] In Example 14 of WO 2012 / 160093, expression host strains A. niger C5553 and M1816 (pyrG-phenotype / uridine auxotrophy of C5553) were isolated by Novozymes and are derivatives of A. niger NN049184 isolated from soil. C5553 and M1816 were genetically modified to disrupt the expression of amyloglycosidase activity.

[0236] Culture medium

[0237] The COVE trace metal solution is composed of: 0.04 g NaB4O7·10H2O, 0.4 g CuSO4·5H2O, 1.2 g FeSO4·7H2O, 0.7 g MnSO4·H2O, 0.8 g Na2MoO2·2H20, 10 g ZnSO4·7H2O, and deionized water to make up to 1 liter.

[0238] 50X COVE salt solution was composed of 26 g KCl, 26 g MgSO4.7H2O, 76 g KH2PO4, 50 ml COVE trace metal solution, and deionized water to make up to 1 liter.

[0239] COVE medium is composed of 342.3 g sucrose, 20 ml 50X COVE salt solution, 10 ml 1 M acetamide, 10 ml 1.5 M CsCl2, 25 g pure agar, and deionized water to make up to 1 liter.

[0240] COVE-N-Gly plates were composed of 218 g sorbitol, 10 g glycerol, 2.02 g KNO3, 50 ml COVE salt solution, 25 g neat agar, and deionized water to make up to 1 liter.

[0241] COVE-N(tf) was composed of 342.3 g sucrose, 3 g NaNO3, 20 ml COVE salt solution, 30 g pure agar, and deionized water to make up to 1 liter.

[0242] COVE-N top agarose was composed of 342.3 g sucrose, 3 g NaNO3, 20 ml COVE salt solution, 10 g low melting point agarose, and deionized water to make up to 1 liter.

[0243] COVE-N was composed of 30 g sucrose, 3 g NaNO3, 20 ml COVE salt solution, 30 g pure agar, and deionized water to make up to 1 liter.

[0244] STC buffer consisted of: 0.8 M sorbitol, 25 mM Tris pH 8, and 25 mM CaCl2.

[0245] STPC buffer consisted of: 40% PEG 4000 in STC buffer.

[0246] LB medium was composed of 10 g of tryptone, 5 g of yeast extract, 5 g of sodium chloride, and deionized water to make up to 1 liter.

[0247] LB plus ampicillin plates were composed of 10 g tryptone, 5 g yeast extract, 5 g sodium chloride, 15 g bactoagar, ampicillin at 100 μg / ml, and deionized water to make up to 1 liter.

[0248] YPG medium was composed of 10 g of yeast extract, 20 g of peptone for bacterial culture, 20 g of glucose, and deionized water to make up to 1 liter.

[0249] SOC medium was composed of 20 g tryptone, 5 g yeast extract, 0.5 g NaCl, 10 ml 250 mM KCl, and deionized water to make up to 1 liter.

[0250] TAE buffer was composed of 4.84 g Tris base, 1.14 ml glacial acetic acid, 2 ml 0.5 M EDTA pH 8.0, and deionized water to make up to 1 liter.

[0251] Transformation of Aspergillus

[0252] Transformation of Aspergillus species can be achieved using general methods for yeast transformation.Preferred procedures for use in the present invention are described below.

[0253] The Aspergillus niger host strain was inoculated into 100 ml of YPG medium supplemented with 10 mM uridine and incubated at 32°C at 80 rpm for 16 hours. The pellet was collected and washed with 0.6 M KCl and resuspended in a 5% flask containing a commercial β-glucanase product (GLUCANEX TM , Novozymes AB, Bosvej, Denmark) in 20 ml 0.6 M KCl (final concentration 20 mg / ml). The suspension was incubated at 32°C and 80 rpm until protoplasts were formed and then washed twice with STC buffer.

[0254] The protoplasts were counted using a hemoglobin counter and resuspended in a 8:2:0.1 STC:STPC:DMSO solution to a final concentration of 2.5 x 10 7 Protoplasts / ml. Approximately 4 μg of plasmid DNA was added to 100 μl of protoplast suspension, mixed gently, and incubated on ice for 30 minutes. 1 ml of SPTC was added, and the protoplast suspension was incubated at 37°C for 20 minutes. After adding 10 ml of 50°C Cove or Cove-N top agarose, the reaction was poured onto Cove or Cove-N (tf) agar plates, and the plates were incubated at 30°C for 5 days.

[0255] PCR amplification in Example 1

[0256]

[0257] 3-step cycle:

[0258] 1. Pre-denaturation: 94°C, 2 min.

[0259] 2. Denaturation: 94°C, 15 sec.

[0260] 3. Annealing: Tm-[5-10]℃*, 30sec.

[0261] 4. Extension: 68℃, 1min. / kb

[0262] 5. Repeat steps #2-4 for a total of 35 cycles.

[0263] Laboratory scale tank culture for Aa lysozyme production

[0264] Fermentation was performed as fed-batch fermentation (H. Pedersen 2000, Appl Microbiol Biotechnol, 53: 272-277). The selected strains were pre-cultured in liquid medium and the grown mycelium was then transferred to tanks for further cultivation for enzyme production. Cultivation was carried out at 34° C. at pH 4.75 for 8 days, with glucose and ammonium being fed without overdosing (which prevents enzyme production). The culture broth was used for enzyme assays.

[0265] sequence

[0266] SEQ ID NO: 4: Aspergillus niger steroid dehydrogenase genomic DNA sequence

[0267] SEQ ID NO: 5: Aspergillus niger steroid dehydrogenase coding sequence (or cDNA)

[0268] SEQ ID NO:6: Aspergillus niger steroid dehydrogenase amino acid sequence

[0269] Example 26: Disruption of the steroid dehydrogenase gene in Aspergillus niger

[0270] Construction of steroid dehydrogenase gene disruption plasmid pIhar473

[0271] Plasmid pIhar473 was constructed to contain the 5' and 3' flanking regions of the Aspergillus niger steroid dehydrogenase gene separated by the Aspergillus nidulans orotidine-5'-phosphate decarboxylase gene (pyrG) as a selectable marker together with its terminator repeat sequence, and the human herpes simplex virus 1 (HSV-1) thymidine kinase gene. The HSV-1 thymidine kinase gene is located at the 3' end of the 3' flanking region of the steroid dehydrogenase gene, allowing counter-selection of Aspergillus niger transformants that are not correctly targeted to the steroid dehydrogenase locus. The plasmid was constructed in several steps as described below.

[0272] A PCR product containing the 3' flanking region of the Aspergillus niger steroid dehydrogenase was generated using the following primers:

[0273] SEQ ID NO:42: Primer IH1232-3'steD-F:

[0274] 5'-aactctctcctctagaTTATGTAGCATGAGACCAGCGGGGA-3'

[0275] SEQ ID NO:43: Primer IH1233-3'steD-R:

[0276] 5'-acaggagaattcttaattaaAGTCCGGGGTGGGGAGTTTTCAGGC-3'

[0277] As described in Materials and Methods, the desired fragment was amplified by PCR in a reaction consisting of approximately 100 ng of genomic DNA of Aspergillus niger NN049184. The reaction was programmed as follows C1000 Touch TM The resulting 1,500 bp PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and purified using Gel extraction kit was used for extraction.

[0278] Plasmid pHUda963 was digested with XbaI and PacI (New England Biolabs, Inc.) and purified by 0.8% agarose gel electrophoresis using TAE buffer, from which an 8,153 bp fragment was excised and purified using Gel extraction kit was used for extraction. According to the manufacturer's instructions, the 8,153bp fragment was connected to the 1,500bp PCR fragment by using the In-Fusion kit (Clontech Laboratories, Inc.). 1 μl of the reaction mixture was transformed into DH5α chemically competent E. coli cells. The transformants were plated on LB plus ampicillin plates and incubated overnight at 37°C. Plasmid DNA was purified from several transformants using a QIA mini-prep kit. The appropriately connected plasmid DNA was then screened by using appropriate restriction enzymes and then by 0.8% agarose gel electrophoresis using TAE buffer. A plasmid was named pIhar473-3'steD.

[0279] A PCR product containing the 5' flanking region of the Aspergillus niger steroid dehydrogenase was generated using the following primers:

[0280] SEQ ID NO:44: Primer IH1230-5'steD-F:

[0281] 5'-gtggcggccgcgtttaaacATCCCTATTTTAAATACCGAGTATG-3'

[0282] SEQ ID NO:45: Primer IH1231-5'steD-R:

[0283] 5'-tcagtcacccggatccctaATGGTGGCAGTCGTGTTGGATCCT-3'

[0284] As described in Materials and Methods, the desired fragment was amplified by PCR in a reaction consisting of approximately 100 ng of genomic DNA of Aspergillus niger NN049184. The reaction was programmed as follows C1000 Touch TM The PCR fragment was purified by 0.8% agarose gel electrophoresis using TAE buffer, excised from the gel, and purified using Gel extraction kit was used for extraction.

[0285] Plasmid pIhar473-3'steD was digested with PmeI and BamHI (New England Biolabs) and purified by 0.8% agarose gel electrophoresis using TAE buffer, from which a 9,653 bp fragment was excised and purified using The 9,653 bp fragment was ligated to the 1,500 bp PCR fragment using the In-Fusion kit (Crotech Labs, Inc.) according to the manufacturer's instructions. 5 μl of the ligation mixture was transformed into DH5α chemically competent E. coli cells. The transformants were plated on LB plates with ampicillin and incubated overnight at 37°C. Plasmid DNA was purified from several transformants using a QIA miniprep kit. Appropriately ligated plasmid DNA was screened using appropriate restriction enzymes followed by 0.8% agarose gel electrophoresis using TAE buffer. One plasmid was named pIhar473 (SEQ ID: 46, Fig.12 ).

[0286] Disruption of the steroid dehydrogenase gene in Aspergillus niger strain M1816

[0287] Protoplasts of Aspergillus niger strain M1816 were prepared by culturing the strain in 100 ml of YPG medium supplemented with 10 mM uridine at 32° C. for 16 hours with gentle agitation at 80 rpm. The pellets were collected and washed with 0.6 M KCl and resuspended in 4% paraformaldehyde containing a commercial β-glucanase product (GLUCANEX TM, Novozymes AB, Bosvej, Denmark) in 20 ml 0.6 M KCl (final concentration 20 mg / ml). The suspension was incubated at 32°C and 80 rpm until protoplasts were formed. The pellet was filtered into a 50 ml sterile plastic centrifuge tube using a funnel and washed with 0.6 M KCl to extract the trapped protoplasts. The combined filtrate and supernatant were collected by centrifugation at 2,000 rpm for 15 minutes. The supernatant was discarded and the pellet was washed with 10-25 ml of STC and centrifuged again at 2,000 rpm for 10 minutes, then washed twice with STC buffer. The protoplasts were counted with a hemoglobin meter and resuspended in a 8:2:0.1 STC:STPC:DMSO solution and adjusted to a final concentration of 2.5 x 10 7 protoplasts / ml.

[0288] Approximately 4 μg of pIhar473 was added to 1 ml of protoplast suspension, mixed gently, and incubated on ice for 30 minutes. 3 ml of SPTC was added, and the protoplast suspension was incubated at 37 ° C for 20 minutes. After adding 12 ml of 50 ° C COVE-N top agarose, the mixture was poured onto a COVE-N plate, and the plate was incubated at 30 ° C for 7 days. These growing transformants were transferred to a Cove-N plate supplemented with 1.5 uM 5-fluoro-2-deoxyuridine (FdU) (a reagent that kills cells expressing the herpes simplex virus (HSV) thymidine kinase gene (TK) present on pIhar473) with a sterile toothpick. The single spore isolate was transferred to a COVE-N-gly plate.

[0289] Potential transformants of Aspergillus niger strain M1816 containing pIhar473 disrupting the steroid dehydrogenase gene were screened by Southern blot analysis. Each spore-purified transformant was cultured in 3 ml of YPG medium and incubated at 30°C with shaking at 200 rpm for 2 days. The biomass was collected using a funnel with a 50 mL tube. The ground mycelia were subjected to genomic DNA preparation using the FastDNA SPIN kit for soil (MP Biomedicals) according to the manufacturer's instructions.

[0290] Southern blot analysis was performed to confirm disruption of the steroid dehydrogenase locus. 5 μg of genomic DNA from each transformant was digested with SpeI. The genomic DNA digestion reaction consisted of 5 μg genomic DNA, 1 μl SpeI, 2 μl 10X NEB CutSmart buffer, and water to make up to 20 μl. The genomic DNA digests were incubated at 37°C for approximately 16 hours. The digests were subjected to 0.8% agarose gel electrophoresis using TAE buffer following the manufacturer's recommendations and were purified using Blotting onto hybond N+ (GE Healthcare Life Sciences, Manchester, NH, USA) lasted approximately 1 hour. The membrane was hybridized with a 481 bp digoxigenin-labeled Aspergillus niger steroid dehydrogenase probe synthesized by PCR by incorporation of digoxigenin-11-dUTP using primers IH1252-ste-proF (sense) and IH1253-ste-500R (antisense) as shown below:

[0291] SEQ ID NO:47: Primer IH1252-ste-proF:

[0292] 5'-ATACTCTCCGTCAGCATCCTGCCAG-3'

[0293] SEQ ID NO:48: Primer IH1253-ste-500R:

[0294] 5'-CTGCTCCTTCGATCCATAAGGCAAC-3'

[0295] Amplification reactions (50 μl) consisted of 200 μM PCR DIG labeling mix (Roche Applied Science, Palo Alto, CA, USA), 0.5 μM primers, KOD-Plus (Toyo Corporation), using pIhar473 as template, in a final volume of 50 μl. Amplification reactions were performed in a 50 μl incubator programmed as follows: C1000Touch TM Incubate in a thermocycler: 1 cycle at 94°C for 2 minutes; 30 cycles at 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 30 seconds; and hold at 4°C. PCR products were separated by 0.8% agarose gel electrophoresis using TAE buffer, from which a 0.5 kb fragment was excised and purified using Gel extraction kit is extracted.The probe of denaturation is directly added in DIG Easy Hyb buffer and hybridized overnight at 42 ℃.Wash after hybridization (in 2X SSC, room temperature, 5min washing twice; and in 0.1X SSC, 68 ℃ washing twice, each 15min), follow the scheme of the manufacturer, use DIG detection system and CPD-Star (Roche (Roche)) to carry out chemiluminescent detection.The DNA molecular weight marker II (Roche) of DIG-labeling is used for standard marker.Selection produces the bacterial strain 474P2-1 and 474P2-5 (hybridization band moves to 7612bp from 5118bp) of correct integration at steroid dehydrogenase locus for subsequent experiment.

[0296] Example 27: Expression of Aa lysozyme in 474P2-1 and 474P2-5

[0297] Chromosomal insertion into A. niger 474P2-1 and 474P2-5 of the Aa lysozyme gene (pJaL1470 described in WO 2015144936A1) with the amdS selectable marker was performed as described in WO 2012 / 160093. The Aa lysozyme expression plasmid was targeted to four pre-specified loci by flp recombinase, which are mannosyltransferase (alg2), glucokinase (gukA), acid-stable amylase (asaA) and multi-copper oxidase (mcoH).

[0298] A reference steroid dehydrogenase-wild type Aspergillus niger C5553 with chromosomal insertion into the Aa lysozyme gene was also performed. The strains that grew well were purified and subjected to Southern blot analysis to confirm whether the Aa lysozyme gene was correctly introduced into the mcoH, gukA, asaA and alg2 loci. The following primer sets for preparing non-radioactive probes were used to analyze the selected transformants.

[0299] For the promoter region:

[0300] SEQ ID NO:49:HTJP-324AAGGGATGCAAGACCAAACC

[0301] SEQ ID NO:50:HTJP-325TGAAGAATTTGTGTTGTCTGAG

[0302] The genomic DNA extracted from the selected transformants was digested with SpeI and then probed with the promoter region. Through the correct gene introduction event, hybridization signals of 6.7 kb (alg2), 2.9 kb (mcoH), 6.7 kb (gukA) and 2.7 kb (asaA) sizes were observed by SpeI and MluI digestion as described above.

[0303] Among the strains that gave correct integration events of 4 copies of the genes at the mcoH, gukA, asaA and alg2 loci, one strain was selected that had lysozyme from each host (1470-474P2-1, 1470-474P2-5, 1470-C5553-13).

[0304] Example 28: Effect of steroid dehydrogenase gene disruption on enzyme production.

[0305] One strain from 474P2-1, 474P2-5 and C5553 was fermented in a laboratory scale tank and its enzyme activity (LSU(F) / ml activity) was determined according to the materials and methods described in Example 7; the results are shown in the table below. The steroid dehydrogenase disrupted strain showed about 1.1 times higher lysozyme (LSU(F) / ml) activity than the wild type strain in the reference steroid dehydrogenase-glass fermenter (Table 3).

[0306]

[0307] Table 3. Average LSU(F) activity of three strains selected from each host strain, where the average LSU(F) yield from 1470-C5553-13 was normalized to 1.00.

[0308] Example (Aspergillus oryzae)

[0309] Microbial strains

[0310] Strain AT3091 expresses the Citrobacter braakii phytase described in WO 2006037328 SEQ ID NO.: 4. The strain contains 8 copies of the Citrobacter braakii phytase gene, which have been inserted as tandem inverted repeats into four specific loci on four separate chromosomes using the FLP integration system described in WO 2012160093. The host used to prepare strain AT3091 is derived from JaL1903 described in Example 4 of WO 2018167153.

[0311] Laboratory scale tank culture of Aspergillus oryzae strains

[0312] Fermentation was performed as fed-batch fermentation (H. Pedersen 2000, Appl Microbiol Biotechnol, 53: 272-277), where the selected strain was pre-cultured in liquid medium and the growing mycelium was then transferred to tanks for further culture and enzyme production. Cultivation was carried out at 34°C for 8 days. Ammonia was used to control pH. The pH was maintained at 6 during the batch phase and at 5.4 in the fed bath. Feeding was performed with maltose syrup. The culture broth was used for enzyme assays.

[0313] Phytase activity measurements were performed as described in Example 4 of WO 2006037328.

[0314] Example 29 - Construction and testing of a phytase expressing strain with a truncated steroid dehydrogenase gene

[0315] To prepare a truncated steroid dehydrogenase (SEQ ID NO: 9) of the Aspergillus oryzae steroid dehydrogenase encoded by SEQ ID NO: 7 (genomic) and SEQ ID NO: 8 (cDNA) to mimic the Trichoderma reesei steroid dehydrogenase mutant (NJOC586), a stop codon was introduced at amino acid position Y234 by mutating the codon TAT to TAG.

[0316] To introduce a stop codon, e.g. Oligonucleotide-mediated CRISPR gene editing was performed as described in Fungal Genetics and Biology 115 (2018) 78-89, with a modification in which Cas9 was replaced with Mad7 provided by Incripta.

[0317] The oligo oAT3303 used for mutagenesis was in the antisense orientation and had the following sequence (SEQ ID NO:51):

[0318] TGCTGCGGAACAAGGGGTGGGAGGGAAGGGTGTACTTCTTGAGAGAG TT AAGCTAGTGGTGGGCGTCATGTTGTAGGCCAGAT.

[0319] The two underlined nucleotides introduced mutations at the PAM site to prevent further cleavage by the Mad7 complex, whereas the nucleotide in bold changed the codon corresponding to Y234 to a stop codon.

[0320] The CRISPR-Mad7 plasmid pAT3631 ( Fig.13 , SEQ ID:52): 1) the cas9 gene was exchanged with the mad7 gene, 2) the pyrG marker gene was replaced by the bar gene (conferring resistance to bialaphos) (Thompson et al. 1987, EMBO J [Journal of the European Molecular Biology Association], 6:2519-2523), and 3) the wA protospacer was replaced by the protospacer TCTCTCAAGAAGTACACCCTT (SEQ ID NO:53) targeting the corresponding chromosomal sequence, which has a PAM site TTTC immediately upstream of the target sequence.

[0321] Aspergillus transformation of AT3091 was performed according to Christensen et al., 1988, Biotechnology 6: 1419-1422. Briefly, Aspergillus oryzae mycelia were grown in a nutrient-rich medium. The mycelia were separated from the medium by filtration. The enzyme preparation (Novozymes) added to an osmotically stable buffer (e.g., 1.2 M MgSO buffered to pH 5.0 with sodium phosphate). 4 ) in the mycelium. The suspension was incubated at 37°C with stirring for 60 minutes. (Calbiochem Inc.) Protoplasts were filtered to remove mycelial debris. Protoplasts were harvested and washed twice with STC. Protoplasts were then resuspended in 200-1000 μl STC.

[0322] In order to transform AT3091, 1 μg of plasmid pAT3631 and 100 pmol of repair oligo oAT3303 were added to 100 μl protoplast suspension, and then 200 μl PEG buffer was added. The mixture was incubated at room temperature for 20 minutes. The protoplasts were harvested, washed twice with 1.2 M sorbitol, and resuspended in 200 μl 1.2 M sorbitol. When transformants were selected on a minimal medium agar plate containing 1.0 M sucrose as a carbon source and 10 mM urea as a nitrogen source and 100 mg / l bialaphos, transformants containing the bar gene were selected because they can confer resistance to bialaphos (Cove, 1966, Biochem. Biophys. Acta. [Biochemistry and Biophysics] 113: 51-56). After growing for 5-7 days at 37 ° C, stable transformants appeared to grow vigorously and sporulate the colonies. Transformants were purified once by conidia on non-selective plates (ie, without bialaphos), thereby losing the CRISPR-mad7 plasmid.

[0323] To verify the expected mutation, PCR was performed on selected transformants with the following primers:

[0324] oAT3163:CTAGCAGTCTCAATCGC(SEQ ID NO:54)

[0325] oAT3164:TTGACCGTGACAAAGAC(SEQ ID NO:55)

[0326] The resulting 404 bp PCR product was sequenced using the primers used for PCR. One transformant, AT3944, with an introduced stop codon was selected for laboratory tank fermentation.

[0327] Fermentations of AT3091 and AT3944 and phytase activity were performed as described under Methods. From 117.4 hours until the end of the fermentation, the phytase activity of AT3944 increased by 1.4% to 6.9% (approximately 3% at the end of 182.7 hours, Fig.14 ). The results showed that inactivation of the natural putative steroid dehydrogenase had a positive effect on the expression of phytase in Aspergillus oryzae.

[0328] The invention described and claimed herein is not limited to the scope of the specific aspects disclosed herein, as these aspects are intended to serve as illustrations of several aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. In fact, various modifications of the invention, in addition to those shown and described herein, will become clear to those skilled in the art as a result of the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the event of a conflict, the present disclosure including definitions shall prevail. Sequence Listing <110> Novozymes A / S <120> Modified filamentous fungal host cells <130> NZ 14838-WO-PCT <160> 55 <170> PatentIn Version 3.5 <210> 1 <211> 1040 <212> DNA <213> Trichoderma reesei <220> <221> Exon <222> (1)..(574) <220> <221> Intron <222> (575)..(651) <220> <221> Exon <222> (652)..(1037) <400> 1 atg gat ggc ata tcg aat ctg ctg gcc atg ctc aac gtg agc gac ctg 48 Met Asp Gly Ile Ser Asn Leu Leu Ala Met Leu Asn Val Ser Asp Leu 1 5 10 15 acg ccg gca gaa tgg tgc caa atc ttc ttc gtc gcc aac gct ggc ttc 96 Thr Pro Ala Glu Trp Cys Gln Ile Phe Phe Val Ala Asn Ala Gly Phe 20 25 30 atc ctg atg ctg caa gct ctc ccg gac gac atg cgt cgg gcg ttg atg 144 Ile Leu Met Leu Gln Ala Leu Pro Asp Asp Met Arg Arg Ala Leu Met 35 40 45 gac tac ggc gcc aga aga gcc acg tcc cgc cag gct tcc gca aaa aag 192 Asp Tyr Gly Ala Arg Arg Ala Thr Ser Arg Gln Ala Ser Ala Lys Lys 50 55 60 ggt cag gcc gag gta ccc aag gaa ggc ttc ttc gac gtc ttg acg agc 240 Gly Gln Ala Glu Val Pro Lys Glu Gly Phe Phe Asp Val Leu Thr Ser 65 70 75 80 tat ggc cag gtg ccg cac tcg tgg ttc ata cac ttc tac atc acg tcc 288 Tyr Gly Gln Val Pro His Ser Trp Phe Ile His Phe Tyr Ile Thr Ser 85 90 95 gtg tcg tgg tcc atc ttc tgg ggc tgg cag ttc gtg tcc aag gga tcg 336 Val Ser Trp Ser Ile Phe Trp Gly Trp Gln Phe Val Ser Lys Gly Ser 100 105 110 gtg atg cgg gcc ctg gcc gag agg cag cac aga gct gcg ggg aat gag 384 Val Met Arg Ala Leu Ala Glu Arg Gln His Arg Ala Ala Gly Asn Glu 115 120 125 cca tcg tcg gag gtc gag ctc aca gca acg ctg gtc gcg tgg ctc ttg 432 Pro Ser Ser Glu Val Glu Leu Thr Ala Thr Leu Val Ala Trp Leu Leu 130 135 140 atg agc tcg cag gga gcg aga aga ctg ttt gag tgt ctc ttt gtc acc 480 Met Ser Ser Gln Gly Ala Arg Arg Leu Phe Glu Cys Leu Phe Val Thr 145 150 155 160 aag cct ggg tca tcg ccc atg tgg ttt gtc cat tgg gtt ctc gga ttg 528 Lys Pro Gly Ser Ser Pro Met Trp Phe Val His Trp Val Leu Gly Leu 165 170 175 gcc tat tac aca acc ctg ggg atc tct gtc tgg att caa ggc tca g 574 Ala Tyr Tyr Thr Thr Leu Gly Ile Ser Val Trp Ile Gln Gly Ser 180 185 190 gttcgtctca cacggctatt aacaaaagag tctagtttcg tggctgtctt ggtcgtgacg 634 ctgacgtgag ttcacag ga gca att ctt cgg tcg tgg gag tcc ccg cag 683 Gly Ala Ile Leu Arg Ser Trp Glu Ser Pro Gln 195,200 ccc atc cac ttc acg cca caa atc ​​atc ggg gcg gca gtc ttt gga 731 Pro Ile His Phe Thr Pro Gln Ile Ile Ile Gly Ala Ala Val Phe Gly 205 210 215 ttc gca ggc gcc cag caa aat gaa tgc cac agg tat ctg gca ggg ctc 779 Phe Ala Gly Ala Gln Gln Asn Glu Cys His Arg Tyr Leu Ala Gly Leu 220 225 230 aag aag tac acg ctc ccg agc gag ggc tgg ttc aag tac ttc gtc tgc 827 Lys Lys Tyr Thr Leu Pro Ser Glu Gly Trp Phe Lys Tyr Phe Val Cys 235 240 245 250 ccc cac tac aca ttc gaa tgc ctc ctc tac ttg agc ctt gcc gtt gtt 875 Pro His Tyr Thr Phe Glu Cys Leu Leu Tyr Leu Ser Leu Ala Val Val 255 260 265 gcg gcg ccg aca gga tgc tgg gtg aac gga tcc atc ctg tgc tca ttg 923 Ala Ala Pro Thr Gly Cys Trp Val Asn Gly Ser Ile Leu Cys Ser Leu 270 275 280 acg ttt gtc ctg gcc aat gtc ggc tca acg gca tac ggc acc aag att 971 Thr Phe Val Leu Ala Asn Val Gly Ser Thr Ala Tyr Gly Thr Lys Ile 285 290 295 tgg tat gcc gaa aag ttc ggg gcg gac aag gtg gag ggg aaa tgg atc 1019 Trp Tyr Ala Glu Lys Phe Gly Ala Asp Lys Val Glu Gly Lys Trp Ile 300 305 310 atg att ccc ttt gta ttc taa 1040 Met Ile Pro Phe Val Phe 315 320 <210> 2 <211> 963 <212> DNA <213> Trichoderma reesei <220> <221> CDS <222> (1)..(960) <400> 2 atg gat ggc ata tcg aat ctg ctg gcc atg ctc aac gtg agc gac ctg 48 Met Asp Gly Ile Ser Asn Leu Leu Ala Met Leu Asn Val Ser Asp Leu 1 5 10 15 acg ccg gca gaa tgg tgc caa atc ttc ttc gtc gcc aac gct ggc ttc 96 Thr Pro Ala Glu Trp Cys Gln Ile Phe Phe Val Ala Asn Ala Gly Phe 20 25 30 atc ctg atg ctg caa gct ctc ccg gac gac atg cgt cgg gcg ttg atg 144 Ile Leu Met Leu Gln Ala Leu Pro Asp Asp Met Arg Arg Ala Leu Met 35 40 45 gac tac ggc gcc aga aga gcc acg tcc cgc cag gct tcc gca aaa aag 192 Asp Tyr Gly Ala Arg Arg Ala Thr Ser Arg Gln Ala Ser Ala Lys Lys 50 55 60 ggt cag gcc gag gta ccc aag gaa ggc ttc ttc gac gtc ttg acg agc 240 Gly Gln Ala Glu Val Pro Lys Glu Gly Phe Phe Asp Val Leu Thr Ser 65 70 75 80 tat ggc cag gtg ccg cac tcg tgg ttc ata cac ttc tac atc acg tcc 288 Tyr Gly Gln Val Pro His Ser Trp Phe Ile His Phe Tyr Ile Thr Ser 85 90 95 gtg tcg tgg tcc atc ttc tgg ggc tgg cag ttc gtg tcc aag gga tcg 336 Val Ser Trp Ser Ile Phe Trp Gly Trp Gln Phe Val Ser Lys Gly Ser 100 105 110 gtg atg cgg gcc ctg gcc gag agg cag cac aga gct gcg ggg aat gag 384 Val Met Arg Ala Leu Ala Glu Arg Gln His Arg Ala Ala Gly Asn Glu 115 120 125 cca tcg tcg gag gtc gag ctc aca gca acg ctg gtc gcg tgg ctc ttg 432 Pro Ser Ser Glu Val Glu Leu Thr Ala Thr Leu Val Ala Trp Leu Leu 130 135 140 atg agc tcg cag gga gcg aga aga ctg ttt gag tgt ctc ttt gtc acc 480 Met Ser Ser Gln Gly Ala Arg Arg Leu Phe Glu Cys Leu Phe Val Thr 145 150 155 160 aag cct ggg tca tcg ccc atg tgg ttt gtc cat tgg gtt ctc gga ttg 528 Lys Pro Gly Ser Ser Pro Met Trp Phe Val His Trp Val Leu Gly Leu 165 170 175 gcc tat tac acc acc ctg ggg atc tct gtc tgg att caa ggc tca gga 576 Only Tyr Tyr Thr Leu Gly Ile Ser Val Trp Ile Gln Gly Ser Gly 180 185 190 gca att ctt cgg tcg tgg gag tcc cg cag ccc atc cac ttc acg cca 624 Only Arg Server Trp Glu Ser Pro Gln Pro Is Phe Thr Pro 195 200 205 caa atc ​​att atc ggg gcg gca gtc ttt gga ttc gca gcc gcc cag caa 672 Gln Ile Ile Gly Ala Ala Phe Gly Phe Ala Gly Ala Gln Gln 210 215 220 aat gaa tgc cac agg tat ctg gca ggg ctc aag aag tac acg ctc ccg 720 Asn Glu Cys His Arg Tyr Leu Ala Gly Leu Lys Tyr Thr Leu Pro 225 230 235 240 agc gag ggc tgg ttc aag tac ttc gtc tgc ccc cac tac aca ttc gaa 768 Ser Glu Gly Trp Phe Lys Tyr Phe Val Cys Pro His Tyr Thr Phe Glu 245 250 255 tgc ctc ctc tac ttg agc ctt gcc gtt gtt gcg gcg ccg aca gga tgc 816 Cys Leu Leu Tyr Leu Ser Leu Ala Val Val Ala Ala Pro Thr Gly Cys 260 265 270 tgg gtg aac gga tcc atc ctg tgc tca ttg acg ttt gtc ctg gcc aat 864 Trp Val Asn Gly Ser Ile Leu Cys Ser Leu Thr Phe Val Leu Ala Asn 275 280 285 gtc ggc tca acg gca tac ggc acc aag att tgg tat gcc gaa aag ttc 912 Val Gly Ser Thr Ala Tyr Gly Thr Lys Ile Trp Tyr Ala Glu Lys Phe 290 295 300 ggg gcg gac aag gtg gag ggg aaa tgg atc atg att ccc ttt gta ttc 960 Gly Ala Asp Lys Val Glu Gly Lys Trp Ile Met Ile Pro Phe Val Phe 305 310 315 320 taa 963 <210> 3 <211> 320 <212> PRT <213> Trichoderma reesei <400> 3 Met Asp Gly Ile Ser Asn Leu Leu Ala Met Leu Asn Val Ser Asp Leu 1 5 10 15 Thr Pro Ala Glu Trp Cys Gln Ile Phe Phe Val Ala Asn Ala Gly Phe 20 25 30 Ile Leu Met Leu Gln Ala Leu Pro Asp Asp Met Arg Arg Ala Leu Met 35 40 45 Asp Tyr Gly Ala Arg Arg Ala Thr Ser Arg Gln Ala Ser Ala Lys Lys 50 55 60 Gly Gln Ala Glu Val Pro Lys Glu Gly Phe Phe Asp Val Leu Thr Ser 65 70 75 80 Tyr Gly Gln Val Pro His Ser Trp Phe Ile His Phe Tyr Ile Thr Ser 85 90 95 Val Ser Trp Ser Ile Phe Trp Gly Trp Gln Phe Val Ser Lys Gly Ser 100 105 110 Val Met Arg Ala Leu Ala Glu Arg Gln His Arg Ala Ala Gly Asn Glu 115 120 125 Pro Ser Ser Glu Val Glu Leu Thr Ala Thr Leu Val Ala Trp Leu Leu 130 135 140 Met Ser Ser Gln Gly Ala Arg Arg Leu Phe Glu Cys Leu Phe Val Thr 145 150 155 160 Lys Pro Gly Ser Ser Pro Met Trp Phe Val His Trp Val Leu Gly Leu 165 170 175 Ala Tyr Tyr Thr Thr Leu Gly Ile Ser Val Trp Ile Gln Gly Ser Gly 180 185 190 Ala Ile Leu Arg Ser Trp Glu Ser Pro Gln Pro Ile His Phe Thr Pro 195 200 205 Gln Ile Ile Ile Gly Ala Ala Val Phe Gly Phe Ala Gly Ala Gln Gln 210 215 220 Asn Glu Cys His Arg Tyr Leu Ala Gly Leu Lys Lys Tyr Thr Leu Pro 225 230 235 240 Ser Glu Gly Trp Phe Lys Tyr Phe Val Cys Pro His Tyr Thr Phe Glu 245 250 255 Cys Leu Leu Tyr Leu Ser Leu Ala Val Val Ala Ala Pro Thr Gly Cys 260 265 270 Trp Val Asn Gly Ser Ile Leu Cys Ser Leu Thr Phe Val Leu Ala Asn 275 280 285 Val Gly Ser Thr Ala Tyr Gly Thr Lys Ile Trp Tyr Ala Glu Lys Phe 290 295 300 Gly Ala Asp Lys Val Glu Gly Lys Trp Ile Met Ile Pro Phe Val Phe 305 310 315 320 <210> 4 <211> 1123 <212> DNA <213> Aspergillus niger <220> <221> Exon <222> (1)..(99) <220> <221> Intron <222> (100)..(189) <220> <221> Exon <222> (190)..(670) <220> <221> Intron <222> (671)..(722) <220> <221> Exon <222> (723)..(1120) <400> 4 atg gag ctc ccc ttc agc ctg gtg gat aca gct ctt tcc tcc acg cac 48 Met Glu Leu Pro Phe Ser Leu Val Asp Thr Ala Leu Ser Ser Thr His 1 5 10 15 att gac gcc atc gac gcc ctt cga gcc ttt ttc ctt ttg gca tcc tgc 96 Ile Asp Ala Ile Asp Ala Leu Arg Ala Phe Phe Leu Leu Ala Ser Cys 20 25 30 acg gtatgcaccg atatgttgcc atcccaaatt cgaggcggac gacgttgcaa 149 Thr agtgaccctg catcaactaa acccagaata tcccaactag ata ctc tcc gtc agc 204 Ile Leu Ser Val Ser 35 atc ctg cca gat tcg ctt cat tca cgc ttc att cct tat ggc gct cgt 252 Ile Leu Pro Asp Ser Leu His Ser Arg Phe Ile Pro Tyr Gly Ala Arg 40 45 50 aca act tcg acg gcc gac tcg cag tcc tcg cag tcc tcg ccc ccg gcg 300 Thr Thr Ser Thr Ala Asp Ser Gln Ser Ser Gln Ser Ser Pro Pro Ala 55 60 65 70 tcc tcg gac tcc tcc cca gcc gcc cgc gct ctt gac tac gct gcc gcc 348 Ser Ser Asp Ser Ser Pro Ala Ala Arg Ala Leu Asp Tyr Ala Ala Ala 75 80 85 ttg aca gtc cct cac agc tac ttc acg caa ttc tac att gcc tcc gtt 396 Leu Thr Val Pro His Ser Tyr Phe Thr Gln Phe Tyr Ile Ala Ser Val 90 95 100 ttg gcc tcg gtc ttc tgg gct gcg cag ctt ctg tgt caa gga gcc gtg 444 Leu Ala Ser Val Phe Trp Ala Ala Gln Leu Leu Cys Gln Gly Ala Val 105 110 115 ttc cag gcc ttt gca acg aga atc agt ccg gaa cat atg caa cag tcc 492 Phe Gln Ala Phe Ala Thr Arg Ile Ser Pro Glu His Met Gln Gln Ser 120 125 130 atg tcc ata cac caa gtc ttc ttg tgc tgg gcg ctc atg ctc att cag 540 Met Ser Ile His Gln Val Phe Leu Cys Trp Ala Leu Met Leu Ile Gln 135 140 145 150 ggt gca agg cgg cta tat gag tgc aag gcc ttc gcc aag cct tca gcc 588 Gly Ala Arg Arg Leu Tyr Glu Cys Lys Ala Phe Ala Lys Pro Ser Ala 155 160 165 tca aga atg tgg tt gtt cac tgg ctc gta ggc ctt gca ttt tac cta 636 Ser Arg Met Trp Phe Val His Trp Leu Val Gly Leu Ala Phe Tyr Leu 170 175 180 gca gta tcc gtt gcc tta tgg atc gaa gga gca g gtaccactt 680 Wing Ser Val Val Leu Wing Trp Ile Glu Gly Wing 185 190 gactgacagg ctaaaatacc gaacccact gattgcact ag ga gcc ctg ctg 733 Gly Ala Leu 195 tct cat aaa gtg att ctc gac gac ctc aag gtt aca ata gca ccc tct 781 Ser His Lys Val Ile Asp Asp Leu Lys Val Thr Ile Ala Pro Ser 200 205 210 ctc cgc acc ttt gtc tgc att cct ctt tc tg att gca tca ggc atc 829 Leu Arg Thr Phe Val Cys Ile Pro Leu Phe Leu Ile Ala Ser Gly Ile 215 220 225 caa cac gac tgc cac cat tac ctc ttc tct ttg aag aaa tat acc ctg Gln His Asp Cys His Tyr Leu Phe Ser Leu Lys Lys Tyr Thr Leu 230 235 240 245 ccc act cac ccc atc ttt cgc agg atc gta tgt cca cat tat acg gca 925 Pro Thr His Pro Ile Phe Arg Arg Ile Val Cys Pro His Tyr Thr Ala 250 255 260 gag tgt gtg ata tat ctt tcg ttg gct ctg ctg ggc gcg ccc aag ggc 973 Glu Cys Val Ile Tyr Ser Leu Wing Leu Wing Gly Wing Pro Lys Gly 265 270 275 gag gtc gta aac aag tcg ttg ttg tcc gct ctc gta ttt gtt gtt atc 1021 Glu Val Val Asn Lys Ser Leu Leu Ser Ala Leu Val Phe Val Val Ile 280 285 290 aac ttg ggc gtc acc gct gcg aac act agg cat tgg tat atg cga aaa 1069 Asn Leu Gly Val Thr Ala Ala Asn Thr Arg His Trp Tyr Met Arg Lys 295 300 305 ttc ggc gag gag tct gtg cgg gaa aga tcg aac atg atc cct tgg gtt 1117 Phe Gly Glu Glu Ser Val Arg Glu Arg Ser Asn Met Ile Pro Trp Val 310 315 320 325 tac taa 1123 Tyr <210> 5 <211> 981 <212> DNA <213> Aspergillus niger <220> <221> CDS <222> (1)..(978) <400> 5 atg gag ctc ccc ttc agc ctg gtg gat aca gct ctt tcc tcc acg cac 48 Met Glu Leu Pro Phe Ser Leu Val Asp Thr Ala Leu Ser Ser Thr His 1 5 10 15 att gac gcc atc gac gcc ctt cga gcc ttt ttc ctt ttg gca tcc tgc 96 Ile Asp Ala Ile Asp Ala Leu Arg Ala Phe Phe Leu Leu Ala Ser Cys 20 25 30 acg ata ctc tcc gtc agc atc ctg cca gat tcg ctt cat tca cgc ttc 144 Thr Ile Leu Ser Val Ser Ile Leu Pro Asp Ser Leu His Ser Arg Phe 35 40 45 att cct tat ggc gct cgt aca act tcg acg gcc gac tcg cag tcc tcg 192 Ile Pro Tyr Gly Ala Arg Thr Thr Ser Thr Ala Asp Ser Gln Ser Ser 50 55 60 cag tcc tcg ccc ccg gcg tcc tcg gac tcc tcc cca gcc gcc cgc gct 240 Gln Ser Ser Pro Pro Ala Ser Ser Asp Ser Ser Pro Ala Ala Arg Ala 65 70 75 80 ctt gac tac gct gcc gcc ttg aca gtc cct cac agc tac ttc acg caa 288 Leu Asp Tyr Ala Ala Ala Leu Thr Val Pro His Ser Tyr Phe Thr Gln 85 90 95 ttc tac att gcc tcc gtt ttg gcc tcg gtc ttc tgg gct gcg cag ctt 336 Phe Tyr Ile Ala Ser Val Leu Ala Ser Val Phe Trp Ala Ala Gln Leu 100 105 110 ctg tgt caa gga gcc gtg ttc cag gcc ttt gca acg aga atc agt ccg 384 Leu Cys Gln Gly Ala Val Phe Gln Ala Phe Ala Thr Arg Ile Ser Pro 115 120 125 gaa cat atg caa cag tcc atg tcc ata cac caa gtc ttc ttg tgc tgg 432 Glu His Met Gln Gln Ser Met Ser Ile His Gln Val Phe Leu Cys Trp 130 135 140 gcg ctc atg ctc att cag ggt gca agg cgg cta tat gag tgc aag gcc 480 The Gln Gly Allele Arg Arg and Tyr Glu Cys Lys Allele 145 150 155 160 ttc gcc aag cct tca gcc tca aga atg tgg ttt gtt cac tgg ctc gta 528 Phe Ala Lys Pro Ser Ala Ser Arg Met Trp Phe Val His Trp Leu Val 165 170 175 ggc ctt gca ttt tac cta gca gta tcc gtt gcc tta tgg atc gaa gga 576 Gly Leu Ala Phe Tyr Leu Ala Val Ser Val Ala Leu Trp Ile Glu Gly 180 185 190 gca gga gcc ctg ctg tct cat aaa gtg att ctc gac gac ctc aag gtt 624 Gly Ala Leu Leu Ser His Lys Val Leu Leu Asp Asp Leu Lys Val 195 200 205 aca ata gca ccc tct ctc cgc acc ttt gtc tgc att cct ctt ttc ttg 672 Thr Ile Ala Pro Ser Leu Arg Thr Phe Val Cys Ile Pro Leu Phe Leu 210 215 220 att gca tca ggc atc caa cac gac tgc cac cat tac ctc ttc tct ttg 720 Ile Ala Ser Gly Ile Gln His Asp Cys His His Tyr Leu Phe Ser Leu 225 230 235 240 aag aaa tat acc ctg ccc act cac ccc atc ttt cgc agg atc gta tgt 768 Lys Lys Tyr Thr Leu Pro Thr His Pro Ile Phe Arg Arg Ile Val Cys 245 250 255 cca cat tat acg gca gag tgt gtg ata tat ctt tcg ttg gct ctg ctg 816 Pro His Tyr Thr Ala Glu Cys Val Ile Tyr Leu Ser Leu Ala Leu Leu 260 265 270 ggc gcg ccc aag ggc gag gtc gta aac aag tcg ttg ttg tcc gct ctc 864 Gly Ala Pro Lys Gly Glu Val Val Asn Lys Ser Leu Leu Ser Ala Leu 275 280 285 gta ttt gtt gtt atc aac ttg ggc gtc acc gct gcg aac act agg cat 912 Val Phe Val Val Ile Asn Leu Gly Val Thr Ala Ala Asn Thr Arg His 290 295 300 tgg tat atg cga aaa ttc ggc gag gag tct gtg cgg gaa aga tcg aac 960 Trp Tyr Met Arg Lys Phe Gly Glu Glu Ser Val Arg Glu Arg Ser Asn 305 310 315 320 atg atc cct tgg gtt tac taa 981 Met Ile Pro Trp Val Tyr 325 <210> 6 <211> 326 <212> PRT <213> Black <400> 6 Met Glu Leu Pro Phe Ser Leu Val Asp Thr Ala Leu Ser Ser Thr His 1 5 10 15 Ile Asp Ala Ile Asp Ala Leu Arg Ala Phe Phe Leu Leu Ala Ser Cys 20 25 30 Thr Ile Leu Ser Val Ser Ile Leu Pro Asp Ser Leu His Ser Arg Phe 35 40 45 Ile Pro Tyr Gly Ala Arg Thr Thr Ser Thr Ala Asp Ser Gln Ser Ser 50 55 60 Gln Ser Ser Pro Pro Ala Ser Ser Asp Ser Ser Pro Ala Ala Arg Ala 65 70 75 80 Leu Asp Tyr Ala Ala Ala Leu Thr Val Pro His Ser Tyr Phe Thr Gln 85 90 95 Phe Tyr Ile Ala Ser Val Leu Ala Ser Val Phe Trp Ala Ala Gln Leu 100 105 110 Leu Cys Gln Gly Ala Val Phe Gln Ala Phe Ala Thr Arg Ile Ser Pro 115 120 125 Glu His Met Gln Gln Ser Met Ser Ile His Gln Val Phe Leu Cys Trp 130 135 140 Ala Leu Met Leu Ile Gln Gly Ala Arg Arg Leu Tyr Glu Cys Lys Ala 145 150 155 160 Phe Ala Lys Pro Ser Ala Ser Arg Met Trp Phe Val His Trp Leu Val 165 170 175 Gly Leu Ala Phe Tyr Leu Ala Val Ser Val Ala Leu Trp Ile Glu Gly 180 185 190 Ala Gly Ala Leu Leu Ser His Lys Val Ile Leu Asp Asp Leu Lys Val 195 200 205 Thr Ile Ala Pro Ser Leu Arg Thr Phe Val Cys Ile Pro Leu Phe Leu 210 215 220 Ile Ala Ser Gly Ile Gln His Asp Cys His His Tyr Leu Phe Ser Leu 225 230 235 240 Lys Lys Tyr Thr Leu Pro Thr His Pro Ile Phe Arg Arg Ile Val Cys 245 250 255 Pro His Tyr Thr Ala Glu Cys Val Ile Tyr Leu Ser Leu Ala Leu Leu 260 265 270 Gly Ala Pro Lys Gly Glu Val Val Asn Lys Ser Leu Leu Ser Ala Leu 275 280 285 Val Phe Val Val Ile Asn Leu Gly Val Thr Ala Ala Asn Thr Arg His 290 295 300 Trp Tyr Met Arg Lys Phe Gly Glu Glu Ser Val Arg Glu Arg Ser Asn 305 310 315 320 Met Ile Pro Trp Val Tyr 325 <210> 7 <211> 1152 <212> DNA <213> Aspergillus oryzae <220> <221> Exon <222> (1)..(105) <220> <221> Intron <222> (106)..(216) <220> <221> Exon <222> (217)..(685) <220> <221> Intron <222> (686)..(751) <220> <221> Exon <222> (752)..(1149) <400> 7 atg acc atg gac ttt ctt ccc agt ctc gtc gac tgg gca ctg gcg act 48 Met Thr Met Asp Phe Leu Pro Ser Leu Val Asp Trp Ala Leu Ala Thr 1 5 10 15 gcc cac atg gac gcg gtg gat gtc ctt cga gct ttc ttt ctc ttt gca 96 Ala His Met Asp Ala Val Asp Val Leu Arg Ala Phe Phe Leu Phe Ala 20 25 30 tcg tgt acg gtatgaaaac atgttgacaa tgacgtagtg gcagaacgcc 145 Ser Cys Thr 35 gagcatcata cggcatcagt ctaccaaata tttttttcta tctaaaatgg cttcaaaact 205 aaactcccca g atc ctg tcg gtc agc ctg ttg gat tcc ctt cgt tcg cgc 255 Ile Leu Ser Val Ser Leu Leu Asp Ser Leu Arg Ser Arg 40 45 ttc gtc cct tat ggc gct cgt gca acc gtg acg gcc gag tcg gat act 303 Phe Val Pro Tyr Gly Ala Arg Ala Thr Val Thr Ala Glu Ser Asp Thr 50 55 60 acc ccg tct gag cct tcg agc agc tcc ccc tta act cac att ctc gac 351 Thr Pro Ser Glu Pro Ser Ser Ser Ser Pro Leu Thr His Ile Leu Asp 65 70 75 80 tat ctt gcc tct ttg aaa gtt cca cac agc tat ttc aca cag ttc tac 399 Tyr Leu Ala Ser Leu Lys Val Pro His Ser Tyr Phe Thr Gln Phe Tyr 85 90 95 gtc gtc tcc ctg cta tcc tcg gtt ttc tgg gcc ctt cag ctt atg tgc 447 Val Val Ser Leu Leu Ser Ser Val Phe Trp Ala Leu Gln Leu Met Cys 100 105 110 cat gga caa gcg ttc caa gcc atc gcg acg agg gtt cac tcg gaa cac 495 His Gly Gln Ala Phe Gln Ala Ile Ala Thr Arg Val His Ser Glu His 115 120 125 cta cag agg acg atg tcg atc aac cag att atg ttg tgc tgg gta ctg 543 Leu Gln Arg Thr Met Ser Ile Asn Gln Ile Met Leu Cys Trp Val Leu 130 135 140 atg ctc gcg caa ggt gta aga cgg tta cat gag tgc ttc acc ttt tcc 591 Met Leu Ala Gln Gly Val Arg Arg Leu His Glu Cys Phe Thr Phe Ser 145 150 155 160 aag cct tct tct tcc cag atg tgg ttt gtc cac tgg cta gca ggc att 639 Lys Pro Ser Ser Ser Gln Met Trp Phe Val His Trp Leu Ala Gly Ile 165 170 175 gct ttc tat cta gca gtc tca atc gcc ctg tgg att gag ggg aca g 685 Ala Phe Tyr Leu Ala Val Ser Ile Ala Leu Trp Ile Glu Gly Thr 180 185 190 gtatgcagtt cccgtggcca agcacgattg ctgtcccgct aatttcgatc ggttcgaaat 745 tcacag aa acg ctg ttg tcc cat aaa ttg agc ctc gac gat gta acc 792 Glu Thr Leu Leu Ser His Lys Leu Ser Leu Asp Asp Val Thr 195 200 205 gtg aac aac gcc cca agc ctt cgt aca ttt ctc tgc ttg cca atc ttt 840 Val Asn Asn Ala Pro Ser Leu Arg Thr Phe Leu Cys Leu Pro Ile Phe 210 215 220 ctg ttt gca tct ggc cta caa cat gac gcc cac cac tat ctt ttc tct 888 Leu Phe Ala Ser Gly Leu Gln His Asp Ala His His Tyr Leu Phe Ser 225 230 235 ctc aag aag tac acc ctt ccc tcc cac ccc ttg ttc cgc agc atc gta 936 Leu Lys Lys Tyr Thr Leu Pro Ser His Pro Leu Phe Arg Ser Ile Val 240 245 250 tgt ccg cac tac acg gct gaa tgt gcg atc tac cta tca ttg gcc ctg 984 Cys Pro His Tyr Thr Ala Glu Cys Ala Ile Tyr Leu Ser Leu Ala Leu 255 260 265 ctt gcc gct ccc cgg gga gag atg atc aat aag aca gtt ttg tcc gct 1032 Leu Ala Ala Pro Arg Gly Glu Met Ile Asn Lys Thr Val Leu Ser Ala 270 275 280 285 gcc gtc ttt gtc acg gtc aat tta ggc gtc act gcg tcc gag acc aaa 1080 Ala Val Phe Val Thr Val Asn Leu Gly Val Thr Ala Ser Glu Thr Lys 290 295 300 cgc tgg tac atg cag aaa ttc ggc gag agc tcg gtg cgg gag agg tgg 1128 Arg Trp Tyr Met Gln Lys Phe Gly Glu Ser Ser Val Arg Glu Arg Trp 305 310 315 aat atg atc cct tgg gta tac taa 1152 Asn Met Ile Pro Trp Val Tyr 320 <210> 8 <211> 975 <212> DNA <213> Aspergillus oryzae <220> <221> CDS <222> (1)..(972) <400> 8 atg acc atg gac ttt ctt ccc agt ctc gtc gac tgg gca ctg gcg act 48 Met Thr Met Asp Phe Leu Pro Ser Leu Val Asp Trp Ala Leu Ala Thr 1 5 10 15 gcc cac atg gac gcg gtg gat gtc ctt cga gct ttc ttt ctc ttt gca 96 Ala His Met Asp Ala Val Asp Val Leu Arg Ala Phe Phe Leu Phe Ala 20 25 30 tcg tgt acg atc ctg tcg gtc agc ctg ttg gat tcc ctt cgt tcg cgc 144 Ser Cys Thr Ile Leu Ser Val Ser Leu Leu Asp Ser Leu Arg Ser Arg 35 40 45 ttc gtc cct tat ggc gct cgt gca acc gtg acg gcc gag tcg gat act 192 Phe Val Pro Tyr Gly Ala Arg Ala Thr Val Thr Ala Glu Ser Asp Thr 50 55 60 acc ccg tct gag cct tcg agc agc tcc ccc tta act cac att ctc gac 240 Thr Pro Ser Glu Pro Ser Ser Ser Ser Pro Leu Thr His Ile Leu Asp 65 70 75 80 tat ctt gcc tct ttg aaa gtt cca cac agc tat ttc aca cag ttc tac 288 Tyr Leu Ala Ser Leu Lys Val Pro His Ser Tyr Phe Thr Gln Phe Tyr 85 90 95 gtc gtc tcc ctg cta tcc tcg gtt ttc tgg gcc ctt cag ctt atg tgc 336 Val Val Ser Leu Leu Ser Ser Val Phe Trp Ala Leu Gln Leu Met Cys 100 105 110 cat gga caa gcg ttc caa gcc atc gcg acg agg gtt cac tcg gaa cac 384 His Gly Gln Ala Phe Gln Ala Ile Ala Thr Arg Val His Ser Glu His 115 120 125 cta cag agg acg atg tcg atc aac cag att atg ttg tgc tgg gta ctg 432 Leu Gln Arg Thr Met Ser Ile Asn Gln Ile Met Leu Cys Trp Val Leu 130 135 140 atg ctc gcg caa ggt gta aga cgg tta cat gag tgc ttc acc ttt tcc 480 Met Leu Ala Gln Gly Val Arg Arg Leu His Glu Cys Phe Thr Phe Ser 145 150 155 160 aag cct tct tct tcc cag atg tgg ttt gtc cac tgg cta gca ggc att 528 Lys Pro Ser Ser Ser Gln Met Trp Phe Val His Trp Leu Ala Gly Ile 165 170 175 gct ttc tat cta gca gtc tca atc gcc ctg tgg att gag ggg aca gaa 576 Ala Phe Tyr Leu Ala Val Ser Ile Ala Leu Trp Ile Glu Gly Thr Glu 180 185 190 acg ctg ttg tcc cat aaa ttg agc ctc gac gat gta acc gtg aac aac 624 Thr Leu Leu Ser His Lys Leu Ser Leu Asp Asp Val Thr Val Asn Asn 195 200 205 gcc cca agc ctt cgt aca ttt ctc tgc ttg cca atc ttt ctg ttt gca 672 Ala Pro Ser Leu Arg Thr Phe Leu Cys Leu Pro Ile Phe Leu Phe Ala 210 215 220 tct ggc cta caa cat gac gcc cac cac tat ctt ttc tct ctc aag aag 720 Ser Gly Leu Gln His Asp Ala His His Tyr Leu Phe Ser Leu Lys Lys 225 230 235 240 tac acc ctt ccc tcc cac ccc ttg ttc cgc agc atc gta tgt ccg cac 768 Tyr Thr Leu Pro Ser His Pro Leu Phe Arg Ser Ile Val Cys Pro His 245 250 255 tac acg gct gaa tgt gcg atc tac cta tca ttg gcc ctg ctt gcc gct 816 Tyr Thr Ala Glu Cys Ala Ile Tyr Leu Ser Leu Ala Leu Leu Ala Ala 260 265 270 ccc cgg gga gag atg atc aat aag aca gtt ttg tcc gct gcc gtc ttt 864 Pro Arg Gly Glu Met Ile Asn Lys Thr Val Leu Ser Ala Ala Val Phe 275 280 285 gtc acg gtc aat tta ggc gtc act gcg tcc gag acc aaa cgc tgg tac 912 Val Thr Val Asn Leu Gly Val Thr Ala Ser Glu Thr Lys Arg Trp Tyr 290 295 300 atg cag aaa ttc ggc gag agc tcg gtg cgg gag agg tgg aat atg atc 960 Met Gln Lys Phe Gly Glu Ser Ser Val Arg Glu Arg Trp Asn Met Ile 305 310 315 320 cct tgg gta tac taa 975 Pro Trp Val Tyr <210> 9 <211> 324 <212> PRT <213> Aspergillus oryzae <400> 9 Met Thr Met Asp Phe Leu Pro Ser Leu Val Asp Trp Ala Leu Ala Thr 1 5 10 15 Ala His Met Asp Ala Val Asp Val Leu Arg Ala Phe Phe Leu Phe Ala 20 25 30 Ser Cys Thr Ile Leu Ser Val Ser Leu Leu Asp Ser Leu Arg Ser Arg 35 40 45 Phe Val Pro Tyr Gly Ala Arg Ala Thr Val Thr Ala Glu Ser Asp Thr 50 55 60 Thr Pro Ser Glu Pro Ser Ser Ser Ser Pro Leu Thr His Ile Leu Asp 65 70 75 80 Tyr Leu Ala Ser Leu Lys Val Pro His Ser Tyr Phe Thr Gln Phe Tyr 85 90 95 Val Val Ser Leu Leu Ser Ser Val Phe Trp Ala Leu Gln Leu Met Cys 100 105 110 His Gly Gln Ala Phe Gln Ala Ile Ala Thr Arg Val His Ser Glu His 115 120 125 Leu Gln Arg Thr Met Ser Ile Asn Gln Ile Met Leu Cys Trp Val Leu 130 135 140 Met Leu Ala Gln Gly Val Arg Arg Leu His Glu Cys Phe Thr Phe Ser 145 150 155 160 Lys Pro Ser Ser Ser Gln Met Trp Phe Val His Trp Leu Ala Gly Ile 165 170 175 Ala Phe Tyr Leu Ala Val Ser Ile Ala Leu Trp Ile Glu Gly Thr Glu 180 185 190 Thr Leu Leu Ser His Lys Leu Ser Leu Asp Asp Val Thr Val Asn Asn 195 200 205 Ala Pro Ser Leu Arg Thr Phe Leu Cys Leu Pro Ile Phe Leu Phe Ala 210 215 220 Ser Gly Leu Gln His Asp Ala His His Tyr Leu Phe Ser Leu Lys Lys 225 230 235 240 Tyr Thr Leu Pro Ser His Pro Leu Phe Arg Ser Ile Val Cys Pro His 245 250 255 Tyr Thr Ala Glu Cys Ala Ile Tyr Leu Ser Leu Ala Leu Leu Ala Ala 260 265 270 Pro Arg Gly Glu Met Ile Asn Lys Thr Val Leu Ser Ala Ala Val Phe 275 280 285 Val Thr Val Asn Leu Gly Val Thr Ala Ser Glu Thr Lys Arg Trp Tyr 290 295 300 Met Gln Lys Phe Gly Glu Ser Ser Val Arg Glu Arg Trp Asn Met Ile 305 310 315 320 Pro Trp Val Tyr <210> 10 <211> 1014 <212> DNA <213> Fusarium venenatum <220> <221> Exon <222> (1)..(571) <220> <221> Intron <222> (572)..(622) <220> <221> Exon <222> (623)..(1011) <400> 10 atg gaa gaa ttg ata cac caa tcc atc gat ctg atg tcg att ttg aca 48 Met Glu Glu Leu Ile His Gln Ser Ile Asp Leu Met Ser Ile Leu Thr 1 5 10 15 cca gca caa tgg tgt cag act ttc ttc gcc ctt tct acg gcc atc gtc 96 Pro Ala Gln Trp Cys Gln Thr Phe Phe Ala Leu Ser Thr Ala Ile Val 20 25 30 ctt ggt atc caa gcc ctc cca caa gat gtt cgc agc gct ctc atg gac 144 Leu Gly Ile Gln Ala Leu Pro Gln Asp Val Arg Ser Ala Leu Met Asp 35 40 45 tac ggc gcc cga aga ccc aaa gat gcg aaa cac gga aag gag caa gaa 192 Tyr Gly Ala Arg Arg Pro Lys Asp Ala Lys His Gly Lys Glu Gln Glu 50 55 60 gaa aac gga cag aaa gct ctc gtg cct ctg agg tca ttt atg aag aat 240 Glu Asn Gly Gln Lys Ala Leu Val Pro Leu Arg Ser Phe Met Lys Asn 65 70 75 80 tta aca gag tac ggg caa gtg ccc cat tca tgg ttc ttg cac ttt tac 288 Leu Thr Glu Tyr Gly Gln Val Pro His Ser Trp Phe Leu His Phe Tyr 85 90 95 to gtt tcg gtg gcc ctg tcg ggt ttc tgg gcg tgg cag tat ctc act 336 Ile Val Ser Val Ala Leu Ser Gly Phe Trp Ala Trp Gln Tyr Leu Thr 100 105 110 caa ggt cat gta ctg aaa agc att gtg acg tgg cag aat cga gct gat 384 Gln Gly His Val Leu Lys Ser Ile Val Thr Trp Gln Asn Arg Ala Asp 115 120 125 gga ccg tcc atg agc ctg gag caa att ttc gtg gca tgg ttg ctc atg 432 Gly Pro Ser Met Ser Leu Glu Gln Ile Phe Val Ala Trp Leu Leu Met 130 135 140 gcg ttg cag ggt tcg aga agg ctt tac gag agt ttg ttt gtg ttc aag 480 Only Gln Gly Ser Arg Arg and Tyr Glu Ser Phe Val Phe Lys 145 150 155 160 cca ggg tca tca cct atg tgg ttt att cat tgg gca ctt ggt ctt tcg 528 Pro Gly Ser Ser Pro Met Trp Phe Ile His Trp Ala Leu Gly Leu Ser 165 170 175 tac tac att gca atg agc ctt gct gtc tgg gtc gag ggt tcc a 571 Tyr Tyr Ile Also Leu Ser Al Val Trp Val Glu Gly Ser 180 185 190 gtatgttttc atattcaca cctggctaca acagaagctg acagttgca g gc gcc 627 Ser Ala att tta gca gcc tgg gat tct ccc tat caa cct cct cgg gtt cca cga 675 Ile Leu Wing Wing Trp Asp Ser Pro Tyr Gln Pro Leu Arg Val Pro Arg 195 200 205 cgg cta cct tca gcc cta gcg tta ttc gtg gct tac ttc aag caa 723 Arg Leu Pro Ser Ala Leu Ala Leu Tyr Phe Val Ala Tyr Phe Lys Gln 210 215 220 aac caa tgt cac aga cac ttg gca agc ctc aag aag tat acc ctc cca 771 Asn Gln Cys His Arg Is Leu Ser Leu Lys Tyr Thr Leu Pro 225 230 235 240 agt gag gga tgg ttc aag tat ata atc ​​tgt cca cac tat act tta gaa Ser Glu Gly Trp Phe Lys Tyr Ile Ile Cys Pro His Tyr Thr Leu Glu 245 250 255 tgc ctt gtg tac ctt gcc att gc tg atc gct gca cca cac ggc caa 867 Cys Leu Val Tyr Leu Wing Wing Trp Wing Wing Pro His Gly Gln 260 265 270 atc ttc aac aaa agt atc ttg ggc gct gtc atg ttt gtg gct gtg aat 915 Ile Phe Asn Lys Ser Ile Leu Gly Ala Val Met Phe Val Ala Val Asn 275 280 285 ctc ggt gcc acg gca aag ggc acc aag gta tgg tat gag cag aaa ttc 963 Leu Gly Ala Thr Ala Lys Gly Thr Lys Val Trp Tyr Gln Lys Phe 290,295,300 ggt gca aac aag gtc gct ggg cgg tgg ctc atc atc ccg cct gtc tac 1011 Gly Ala Asn Lys Val Ala Gly Arg Trp Leu Met Ile Pro Pro Val Tyr 305 310 315 320 tag <210> 11 <211> 11526 <212> DNA <213> The snowstorm <220> <223> Description pNJOC577 <400> 11 60. tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcgtt taaacgtgct ggacctgcta aggaggagt tttttttggg acggaaaagc ctggtgaggc atgaagatgg 480 agagagtttt cggtgtgtga ggatttcgag tatcatggaa aaagaaggaa ttcaagttttg 540 taacagaaag atgtttaatg gttgatttgc gaacatgata gacgtccaaa tttcataatc 600 ttttgcaatt gagccttgga gatattacga aaatgagatg tgagatctcg aaatgttgag 660 gaatattcat gcctggttac acctgccgtc gttgtcatgc cactcgggcg ggcaggagca 720 tccatgcttc gcctagcacc aaggattggc aaccgccaga tggatcatga cggcaggatt 780 ccttgaatcg gttctagacc ttttgtgca cgtgccttag ctataagcca acgacttgca 840 aagcggaagg cagcacctgg gcatggctgg gaaagaagct tgaagcatgc gccttgctgt 900 tgccttcgct tggttgatgt tatcggggca acttgcttga gacattggtc gcacttgccg 960 acctgtgaat aggcaagaca tatttcgtca gtagtaccta cccagcgtaa gggatttcac 1020 gaggaagaag gtgagtcatc gggttcaaat gctgtactac ctcttgatgg agttgcagat 1080 actatcacga gcttgtgtgc tactattctg ttggaattcg gtctcttata ccgtccactc 1140 ggttcagcac tgtacgaaca acgtcttcat gctgcaacac tggtccatac atcctttgca 1200 tccgtcggtc aatcctgcat cgcctcatac caagtccctc ctcgtggaac caagccctct 1260 catcctcctt gtctcccagc tcttctcaag ccatcaaatc ccaactgcaa catggaactt 1320 gaagttgctg tgaagcaagc gccaatacga cgaatccacc gcccaatcaa aaccccacag 1380 cagtgcaacg ccacctcagc gtcaattaga ctacggattg gccgtcaagc cgtgtatcgt 1440 attgctggtt gccaagagcc tcagtcacaa gttcaaaaag caagcaaata cgcattctct 1500 ctccttccag tggcaatcca tgatttcatt gaagccatgt tctggtagta ggatctatgc 1560 gagctgcaga gaagtttctc cgcactccat atctgctgca atggccggca atcaagtaaa 1620 tgcaccgaga gtcgttggtt caagggacgg agcaatgtgc cgattttggg accacaagag 1680 cggcggctca gcatgcaggc gaccaaattt cgcacaattg tgcttctcct tggtaggggc 1740 atatcactcc acgcctggct ttggcagtgc aattcggcag ctttcaacca gcgcaacgaa 1800 tgtctgccct ttcatccctt cctgagtcat tttctcccat tcactttatc tggcccctca 1860 atctctaagg tcttgttctt gtggcctggc tgaaccttgc ctcgccgcat cacgccagcc 1920 gcttgaattc acaacatgga tggcatatcg aatctgctgg ccatgctcaa cgtgagcgac 1980 ctgacgccgg cagaatggtg ccaaatcttc ttcgtcgcca acgctggctt catcctgatg 2040 ctgcaagctc tcccggacga catgcgtcgg gcgttgatgg actacggcgc cagaagagcc 2100 acgtcccgcc aggcttccgc aaaaaagggt caggccgagg tacccaagga aggcttcttc 2160 gacgtcttga cgagctatgg ccaggtgccg cactcgtggt tcatacactt ctacatcacg 2220 tccgtgtcgt ggtccatctt ctggggctgg cagttcgtgt ccaagggatc ggtgatgcgg 2280 gccctggccg agaggcagca cagagctgcg gggaatgagc catcgtcgga ggtcgagctc 2340 acagcaacgc tggtcgcgtg gctcttgatg agctcgcagg gagcgagaag actgtttgag 2400 tgtctctttg tcaccaagcc tgggtcatcg cccatgtggt ttgtccattg ggttctcgga 2460 ttggcctatt acacaaccct ggggatctct gtctggattc aaggctcagg ttcgtctcac 2520 acggctatta acaaaagagt ctagtttcgt ggctgtcttg gtcgtgacgc tgacgtgagt 2580 tcacaggagc aattcttcgg tcgtgggagt ccccgcagcc catccacttc acgccacaaa 2640 tcattatcgg ggcggcagtc tttggattcg caggcgccca gcaaaatgaa tgccacaggt 2700 agttcattta aacggcttca cgggcagccc agcggtcgat ttcgcttcca aattttgggg 2760 gaaagggtcc ctgagcagcc tcacaaacgc aaacatgcgc acgcgccaca cggaaaatga 2820 agctgacttt gaatttttaa gaatcccctt tgcccgtggc accttctgat ttttgtcttc 2880 gtgtccaatc catctccttg aacgacaacc cagccctttc tatttcctat cccctaatat 2940 ctaatgtgag tcctcatcgt cacagacggc gacggacgcg acatttcgcc cgtgctcatc 3000 gaccgctctg ctgtcgccaa cagaacacgc ggttatgtcg cgttccgctt tgtcgtacca 3060 ctttcgcccc acaccgctga cctcgcgttc ccagcatgaa aaagcctgaa ctcaccgcga 3120 cgtctgtcga gaagtttctg atcgaaaagt tcgacagcgt ctccgacctg atgcagctct 3180 cggagggcga agaatctcgt gctttcagct tcgatgtagg agggcgtgga tatgtcctgc 3240 gggtaaatag ctgcgccgat ggtttctaca aagatcgtta tgtttatcgg cactttgcat 3300 cggccgcgct cccgattccg gaagtgcttg acattgggga gttcagcgag agcctgacct 3360 attgcatctc ccgccgtgca cagggtgtca cgttgcaaga cctgcctgaa accgaactgc 3420 ccgctggtct gcagccggtc gcggaggcca tggatgcgat cgctgcggcc gatcttagcc 3480 agacgagcgg gttcggcca ttcggaccgc aaaggaatcgg tcaatacact acatggcgtg 3540 atttcatatg cgcgattgct gatccccatg tgtatcactg gcaaactgtg atggacgaca 3600 ccgtcagtgc gtccgtcgcg caggctctcg atgagctgat gctttgggcc gaggactgcc 3660 ccgaagtccg gcacctcgtg cacgcggatt tcggctccaa caatgtcctg acggacaatg 3720 gccgcatac agcggtcatt gactggagcg aggcgatgtt cggggattcc caatacgagg 3780 tcgccaacat cttcttctgg aggccgtggt tggcttgtat ggagcagcag acgcgctact 3840 tcgagcggag gcatccggag cttgcaggat cgccgcggct ccgggcgtat atgctccgca 3900 ttggtcttga ccaactctat cagagcttgg ttgacggcaa tttcgatgat gcagcttggg 3960 cgcagggtcg atgcgacgca atcgtccgat ccggagccgg gactgtcggg cgtacacaaa 4020 tcgcccgcag aagcgcggcc gtctggaccg atggctgtgt agaagctc gccgatagtg 4080 gaaaccgacg ccccagcact cgtccgaggg caaggaatag taaatgattc gttagttctt tcctgaactg atgattcgcg cgattcgtat ttctctttgt tggttgttct gatgatgatg 4200. 4260. aaaatgacgc atctctttat ttgctgcact cgtacaccca tcctttgga tgattatac ccctcctttt tcatcgcgga cggtagtcgt tctctttggg gccgtgtttc ttcccattcg 4320 catgcgacct cgtggtcatt gactgtctgt cctcttcctc tccacctacc tccaccacct 4380 4440. acgttgactg catatcactt tttcaaacat tcatgataat acgctacctt ctggcatgac cttttgatga tcgcttttta ctatcctttc aattacgatg ttgtcacttc tatttgtcat tttgcggaat tagtattttc tttccatctt cgatggagag atgaatattg ggtaccccaa gggcgtagat ccactagtaa cggccgccag tgtgctggaa ttcgcccttg gccgactact 4620 agatcgaccg gtgactcttt ctggcatgcg gagagacgga cggacgcaga gagaagggct 4680 gagtaataag cgccactgcg ccagacagct ctggcggctc tgaggtgcag tggatgatta ttaatccggg accggccgcc cctccgcccc gagtggaa ggctggtgtg cccctcgttg accaagaatc tattgcatca tcggagaata tggagcttca tcgaatcacc ggcagtaagc 4860 gaaggagaat gtgaagccag gggtgtatag ccgtcggcga aatagcatgc cattaaccta 4920 ggtacagaag tccaattgct tccgatctgg taaaagattc acgagatagt accttctccg 4980 aagtaggtag agcgagtacc cggcgcgtaa gctccctaat tggcccatcc ggcatctgta 5040 gggcgtccaa atatcgtgcc tctcctgctt tgcccggtgt atgaaaccgg aaaggccgct 5100 caggagctgg ccagcggcgc agaccgggaa cacaagctgg cagtcgaccc atccggtgct 5160 ctgcactcga cctgctgagg tccctcagtc cctggtaggc agctttgccc cgtctgtccg 5220 cccggtgtgt cggcggggtt gacaaggtcg ttgcgtcagt ccaacatttg ttgccatatt 5280 ttcctgctct ccccaccagc tgtagatcga tcttggtggc gtgaaactcc cgcacctctt 5340 cggccagcgc cttgtagaag cgcgtatggc ttcgtacccc ggccatcaac acgcgtctgc 5400 gttcgaccag gctgcgcgtt ctcgcggcca tagcaaccga cgtacggcgt tgcgccctcg 5460 ccggcagcaa gaagccacgg aagtccgccc ggagcagaaa atgcccacgc tactgcgggt 5520 ttatatagac ggtccccacg ggatggggaa aaccaccacc acgcaactgc tggtggccct 5580 gggttcgcgc gacgatatcg tctacgtacc cgagccgatg acttactggc gggtgctggg 5640 ggcttccgag acaatcgcga acatctacac cacacaacac cgcctcgacc agggtgagat 5700 atcggccggg gacgcggcgg tggtaatgac aagcgcccag ataacaatgg gcatgcctta 5760 tgccgtgacc gacgccgttc tggctcctca tatcgggggg gaggctggga gctcacatgc 5820 cccgcccccg gccctcaccc tcatcttcga ccgccatccc atcgccgccc tcctgtgcta 5880 cccggccgcg cggtacctta tgggcagcat gaccccccag gccgtgctgg cgttcgtggc 5940 cctcatcccg ccgaccttgc ccggcaccaa catcgtgctt ggggcccttc cggaggacag 6000 acacatcgac cgcctggcca aacgccagcg ccccggcgag cggctggacc tggctatgct 6060 ggctgcgatt cgccgcgttt acgggctact tgccaatacg gtgcggtatc tgcagtgcgg 6120 cgggtcgtgg cgggaggact ggggacagct ttcggggacg gccgtgccgc cccagggtgc 6180 cgagccccag agcaacgcgg gcccacgacc ccatatcggg gacacgttat ttaccctgtt 6240 tcggggcccc gagttgctgg cccccaacgg cgacctgtat aacgtgtttg cctgggcctt 6300 ggacgtcttg gccaaacgcc tccgttccat gcacgtcttt atcctggatt acgaccaatc 6360 gccgccggc tgccgggacg ccctgctgca acttacctcc gggatggtc agacccacgt 6420 caccacccccc ggctccatac cgacgatatg cgacctggcg cgcacgtttg cccggggagat 6480 gggggaggct aactgaaaca cggaaggaga caataccgga aggaacccgc gctatccgga 6540 tcgatccact taacgttact gaaatcatca aacagcttga cgaatctgga tataagatcg 6600 ttggtgtcga tgtcagctcc ggagttgaga caaatggtgt tcaggatctc gataagatac 6660 gttcatttgt ccaagcagca aagagtgcct tctagtgatt tatagctcc atgtcaacaa 6720 gaataaaacg cgtttcgggt ttacctcttc cagatacagc tcatctgcaa tgcattaatg 6780 cattggacct cgcaacccta gtacgccctt caggctccgg cgaagcagaa gaatagctta 6840 gcagagtcta ttttcatttt cgggagacga gatcaagcag atcaacggtc gtcaagagac 6900 ctacgagact gaggaatccg ctcttggctc cacgcgacta tatattgtc tctaattgta 6960 ctttgacatg ctcctcttct ttactctgat agcttgacta tgaaaattcc gtcaccagcc 7020 cctgggttcg caaagataat tgcactgttt cttccttgaa ctctcagatc tgtggtttgt 7080 ccattgggtt ctcggattgg cctattacac aaccctgggg atctctgtct ggattcaagg 7140 ctcaggttcg tctcacacgg ctattaacaa aagagtctag tttcgtggct gtcttggtcg 7200 tgacgctgac gtgagttcac aggagcaatt cttcggtcgt gggagtcccc gcagcccatc 7260 cacttcacgc cacaaatcat tatcggggcg gcagtctttg gattcgcagg cgcccagcaa 7320 aatgaatgcc acaggtagct ggcagggctc aagaagtaca cgctcccgag cgagggctgg 7380 ttcaagtact tcgtctgccc ccactacaca ttcgaatgcc tcctctactt gagccttgcc 7440 gttgttgcgg cgccgacagg atgctgggtg aacggatcca tcctgtgctc attgacgttt 7500 gtcctggcca atgtcggctc aacggcatac ggcaccaaga tttggtatgc cgaaaagttc 7560 ggggcggaca aggtggaggg gaaatggatc atgattccct ttgtattcta ataagctact 7620 gagcaattcg ggaaaacggg ttagagcacg ctctcatcgc ttgccgaaga ggcctaattt 7680 ggctccgact ttggacactt ggaggacgtc tcggtatgtg aggctggtgc gggtctgtct 7740 cgggttccga ccgccagcaa acgcctcggg atctcgaagc aagggccagt tcacaatggt 7800 gtcggcagat agatcaagat cctcctcagc gtcggcgatg ccatgcagat agtccgtata 7860 gaggttggct gtggtgatga gaagactacg aggttcttgg agaatgcgcc aggcaggctc 7920 gggatcaagg gcgccgtcct ccttgctgcg gtacaggttc aggcagagac tcgcgccgag 7980 gctgacggtg cacaccacgg gccaatacgc agcgccatcc tagggtggat gagcatttcg 8040 aagctgtcaa ggattcttca actacgtttc cataacactt aacttatgcg gcatgatgcc 8100 gattcccgga ggatactcgt tgataaggac gtgattcggg cgctggtggg ggctttcggc 8160 gaagatgtgc ttgggagagt caccgtcgtc ggagagcgga agggacagta gccgcggcac 8220 aatgggggtc tcaagccaag agggcagcgg tgcgtcgagg agcctgttgt tgacgaggtc 8280 cgacggccag gtctggagcc gtcgatgggt gagctgtttc catcgtggac gaggagccgc 8340 ggcgatctgt gaggaaaaaa aaaagcgtgt gctgtgatca gcagggctgc aggcggagac 8400 gaccggcacc atggacggca ccggccacgg cggcaagacg cactttgtca agaatcaggc gctcctcttc ctcgctgatg aagtttggca agtaggc cgtcgagggc agcgaggcga 8520. ttcgggcggc ttcgagagac gagggcagcc acgcgtcgcc ggtgcctcga gctgccatga 8580 ttgaaggtat gtaggtaggt atctatgcac ggctcgggca ggcaggcagg caggcaggca gacagacaga gagacagaca gctgcagtga gttgcaggag gagagctgcc ttgacagcgc caagagtgag cccaccagtg agcgagaagg cagcctggct cggaatcaga tggggggtcg agggcgga cggattgcga gagaagaagc gatcaaatgg tcgtaagagg gggatgatgg ggtgatgatc cagcgaatgg ccgtatcgag ttaggagggg ggctgcagcg cctgtttgct 8880 ctcgcagcag cacgacttga acagcgaggt gccggttagg gctagccggg cattaatgcc ttttgtccta ccaaggttgc atggcgcatg tgctgcgcga gctgttcggt cggtggcctc 9000 gttatcggcg tgcagcgtct ggtcggtcca gctgcttgtt gctcgaaagg ggggaggcgt 9060 cgtgtctctg ccgtctgcgg gaggcggact gggccaggcc tgaccgggtc atcgatggat 9120 ggattgaatg gactgaatca tggcgaatga tgatttattg attcattgat tgagtgagaa 9180 ggacggcgac cgatgctgca ggtcgcacag acgaggaaaa cagcgcgtgg cagcacggca 9240 cagcgcggtc ggacgcgtgc atgcgtggat atcgagtggt ttaaacaagc ttggcgtaat 9300 catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 9360 gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 9420 ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 9480 gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 9540 tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 9600 cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 9660 gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 9720 gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 9780 gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 9840 ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 9900 atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 9960 tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 10020 ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 10080 gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 10140 ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 10200 ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt ttgtttgca 10260 agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 10320 ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 10380 aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta 10440 tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 10500 cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga 10560 tacgggagg cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac 10620 cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc 10680 ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agatagatga 10740 gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 10800 gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 10860 gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 10920 gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 10980 tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag 11040 aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc 11100 cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 11160 caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 11220 cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 11280 ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 11340 aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 11400 tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg 11460 tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 11520 ttcgtc 11526 <210> 12 <211> 10572 <212> DNA <213> Artificial Sequence <220> <223> Plasmid pNJOC383 <400> 12 cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc 60 ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca 120 actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta 180 gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct 240 ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg 300 gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc 360 acacagccca gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta 420 tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg 480 gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt 540 cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg 600 cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg 660 ccttttgctc acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc 720 gcctttgagt gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg 780 agcgaggaag cggaagagcg cccaatacgc aaaccgcctc tccccgcgcg ttggccgatt 840 cattaatgca gctggcacga caggtttccc gactggaaag cgggcagtga gcgcaacgca 900 attaatgtga gttagctcac tcattaggca ccccaggctt tacactttat gcttccggct 960 cgtatgttgt gtggaattgt gagcggataa caatttcaca caggaaacag ctatgaccat 1020 gattacgaat tgtttaaacg cggccgcgaa ttcatcttga agttcctatt ccgagttcct 1080 attctctaga aagtatagga acttccgaat gtaggattgt tatccgaact ctgctcgtag 1140 aggcatgttg tgaatctgtg tcgggcagga cacgcctcga aggttcacgg caaggggaaac 1200 caccgatagc agtgtctagt agcaacctgt aaagccgcaa tgcagcatca ctggaaaata 1260 caaaccaatg gctaaaagta cataagttaa tgcctaaaga agtcatatac cagcggctaa 1320 taattgtaca atcaagtggc taaacgtacc gtaatttgcc aacggcttgt ggggttgcag 1380 aagcaacggc aaagccccac ttccccacgt ttgtttcttc actcagtcca atctcagctg 1440 gtgatcccc aattgggtcg cttgtttgtt ccggtgaagt gaaagaagac agaggtaaga 1500 atgtctgact cggagcgttt tgcatacaac caagggcagt gatggaagac agtgaaatgt 1560 tgacattcaa ggagtatta gccagggatg cttgagtgta tcgtgtaagg aggtttgtct 1620 gccgatacga cgaatactgt atagtcactt ctgatgaagt ggtccatatt gaaatgtaag 1680 tcggcactga acaggcaaaa gattgagttg aaactgccta agatctcggg ccctcgggcc 1740 ttcggccttt gggtgtacat gtttgtgctc cgggcaaatg caaagtgtgg taggatcgaa 1800 cacactgctg cctttaccaa gcagctgagg gtatgtgata ggcaaatgtt caggggccac 1860 tgcatggttt cgaatagaaa gagaagctta gccaagaaca atagccgata aagatagcct 1920 cattaaacgg aatgagctag taggcaaagt cagcgaatgt gtatatataa aggttcgagg 1980 tccgtgcctc cctcatgctc tccccatcta ccatcaact cagatcctc aggagacttg 2040 tacaccatct tttgaggcac agaaacccaa tagtcaaccg cggactgcgc accatgaagc 2100 ttcttccctc cttgattggc ctggccagtc tggcgtccct cgccgtcgcc cggatccccg 2160 gctttgacat ttcgggctgg caaccgacca ccgactttgc aagggcgtat gctaatggag 2220 atcgtttcgt ctacatcaag gtacgttcaa ccttgccacc aagttgcgaa cccgagacaa 2280 gactgtgacc gcctcctttg ccctggggca gctcacgcac ccagcagcat cccatccccc 2340 ggccccccac gtaccaccgg aaagctaaca tcaaccccct accactgcta ccaggccacc 2400 gagggcacca cattcaagag ctccgcattc agccgccagt acaccggcgc aacgcaaaac 2460 ggcttcatcc gcggcgccta ccacttcgcc cagcccgccg cgtcctcggg cgccgcgcag 2520 gcgagatact tcgccagcaa cggcggcggc tggtccaagg acggcatcac cctgcccggg 2580 gcgctggaca tcgagtacaa ccccaacggc gccacctgct acggcctctc gcaatcggcc 2640 atggtgaact ggatcgagga ctttgtcacc acctaccacg gcatcacctc ccgctggccc 2700 gtcatctaca ccaccaccga ctggtggacc cagtgcaccg gcaactccaa ccgcttcgcg 2760 aaccgctgcc cgctgtggat cgcccgctac gccagctccg tcggcactct gcccaatggc 2820 tggggctttt acaccttctg gcagtacaac gacaagtatc ctcagggcgg tgattcgaac 2880 tggttcaacg gcgatgcgtc gcgtctcagg gctctcgcta acggagacta ataagctccg 2940 tggcgaaagc ctgacgcacc ggtagattct tggtgagccc gtatcatgac ggcggcggga 3000 gctacatggc cccgggtgat ttattttttt tgtatctact tctgaccctt ttcaaatata 3060 cggtcaactc atctttcact ggagatgcgg cctgcttggt attgcgatgt tgtcagcttg 3120 gcaaattgtg gctttcgaaa acacaaaacg attccttagt agccatgcat caagcttggt 3180 accgagctct ggaaacgcaa ccctgaaggg attcttcctt tgagagatgg aagcgtgtca 3240 tatctcttcg gttctacggc aggttttttt ctgctctttc gtagcatggc atggtcactt 3300 cagcgcttat ttacagttgc tggtattgat ttcttgtgca aattgctatc tgacacttat 3360 tagctatgga gtcaccacat ttcccagcaa cttccccact tcctctgcaa tcgccaacgt 3420 cctctcttca ctgagtctcc gtccgataac ctgcactgca accggtgccc catgatacgc 3480 ctccggatca tactcttcct gcacgagggc atcaagctca ctaaccgcct tgaaactctc 3540 attcttctta tcgatgttct tatccgcaaa ggtaaccgga acaaccacgc tcgtgaaatc 3600 cagcaggttg atcacagagg catacccata gtaccggaac tggtcatgcc gtaccgcagc 3660 ggtaggcgta atcggcgcga tgatggcgtc cagttccttc ccggcctttt cttcagcctc 3720 ccgccatttc tcaaggtact ccatctggta attccacttc tggagatgcg tgtcccagag 3780 ctcgttcatg ttaacagctt tgatgttcgg gttcagtagg tctttgatat ttggagtcgc 3840 cggctcgccg gatgcactga tatcgcgcat tacgtcggcg ctgccgtcag ccgcgtagat 3900 atgggagatg agatcgtggc cgaaatcgtg cttgtatggc gtccacgggg tcacggtgtg 3960 accggctttg gcgagtgcgg cgacggtggt ttccacgccg cgcaggatag gagggtgtgg 4020 aaggacattg ccgtcgaagt tgtagtagcc gatattgagc ccgccgttct tgatcttgga 4080 ggcaataatg tccgactcgg actggcgcca gggcatgggg atgaccttgg agtcgtattt 4140 ccaaggctcc tgaccgagga cggatttggt gaagaggcgg aggtctaaca tacttcatca 4200 gtgactgccg gtctcgtata tagtataaaa agcaagaaag gaggacagtg gaggcctggt 4260 atagagcagg aaaagaagga agaggcgaag gactcaccct caacagagtg cgtaatcggc 4320 ccgacaacgc tgtgcaccgt ctcctgaccc tccatgctgt tcgccatctt tgcatacggc 4380 agccgcccat gactcggcct tagaccgtac aggaagttga acgcggccgg cactcgaatc 4440 gagccaccga tatccgttcc tacaccgatg acgccaccac gaatcccaac gatcgcaccc 4500 tcaccaccag aactgccgcc gcacgaccag ttcttgttgc gtgggttgac ggtgcgcccg 4560 atgatgttgt tgactgtctc gcagaccatc agggtctgcg ggacagaggt cttgacgtag 4620 aagacggcac cggctttgcg gagcatggtt gtcagaaccg agtccccttc gtcgtacttg 4680 tttagccatg agatgtagcc cattgatgtt tcgtagccct ggtggcatat gttagctgac 4740 aaaaagggac atctaacgac ttaggggcaa cggtgtacct tgactcgaag ctggtctttg 4800 agagagatgg ggaggccatg aagtggacca acgggtctct tgtgctttgc gtagtattca 4860 tcgagttccc ttgcctgcgc gagagcggcg tcagggaaga actcgtgggc gcagtttgtc 4920 tgcacagaag ccagcgtcag cttgatagtc ccataaggtg gcgttgttac atctccctga 4980 gaggtagagg ggaccctact aactgctggg cgattgctgc ccgtttacag aatgctagcg 5040 taacttccac cgaggtcaac tctccggccg ccagcttgga cacaagatct gcagcggagg 5100 cctctgtgat cttcagttcg gcctctgaaa ggatccccga tttctttggg aaatcaataa 5160 cgctgtcttc cgcaggcagc gtctggactt tccattcatc agggatggtt tttgcgaggc 5220 gggcgcgctt atcagcggcc agttcttccc aggattgagg cattctgtgt tagcttatag 5280 tcaggatgtt ggctcgacga gtgtaaactg ggagttggca tgagggttat gtaggcttct 5340 ttagccccgc atccccctca ttctcctcat tgatcccggg ggagcggatg gtgttgataa 5400 gagactaatt atagggttta gctggtgcct agctggtgat tggctggctt cgccgaattt 5460 tacgggccaa ggaaagctgc agaaccgcgg cactggtaaa cggtaattaa gctatcagcc 5520 ccatgctaac gagtttaaat tacgtgtatt gctgataaac accaacagag ctttactgaa 5580 agatgggagt cacggtgtgg cttccccact gcgattattg cacaagcagc gagggcgaac 5640 ttgactgtcg tcgctgagca gcctgcagtc aaacatacat atatatcaac cgcgaagacg 5700 tctggccttg tagaacacga cgctccctag caacacctgc cgtgtcagcc tctacggttg 5760 ttacttgcat tcaggatgct ctccagcggg cgagctattc aaaatattca aagcaggtat 5820 ctcgtattgc caggattcag ctgaagcaac aggtgccaag gaaatctgcg tcggttctca 5880 tctgggcttg ctcggtcctg gcgtagacaa gggcgaattc tgcattgaag ttcctattcc 5940 gagttcctat tcttcaaata gtataggaac ttcagatatc catcacactg ggagtaccat 6000 ttaattctat ttgtgtttga tcgagaccta atacagcccc tacaacgacc atcaaagtcg 6060 tatagctacc agtgaggaag tggactcaaa tcgacttcag caacatctcc tggataaact 6120 ttaagcctaa actatacaga ataagatggt ggagagctta taccgagctc ccaaatctgt 6180 ccagatcatg gttgaccggt gcctggatct tcctatagaa ccatccttat tcgttgacct 6240 agctgattct ggagtgaccc agagggtcat gacttgagcc taaaatccgc cgcctccacc 6300 atttgtagaa aaatgtgacg aactcgtgag ctctgtacag tgaccggtga ctctttctgg 6360 catgcggaga gacggacgga cgcagagaga agggctgagt aataagcgcc actgcgccag 6420 acagctctgg cggctctgag gtgcagtgga tgattattaa tccgggaccg gccgcccctc 6480 cgccccgaag tggaaaggct ggtgtgcccc tcgttgacca agaatctatt gcatcatcgg 6540 agaatatgga gcttcatcga atcaccggca gtaagcgaag gagaatgtga agccaggggt 6600 gtatagccgt cggcgaaata gcatgccatt aacctaggta cagaagtcca attgcttccg 6660 atctggtaaa agattcacga gatagtacct tctccgaagt aggtagagcg agtacccggc 6720 gcgtaagctc cctaattggc ccatccggca tctgtagggc gtccaaatat cgtgcctctc 6780 ctgctttgcc cggtgtatga aaccggaaag gccgctcagg agctggccag cggcgcagac 6840 cgggaacaca agctggcagt cgacccatcc ggtgctctgc actcgacctg ctgaggtccc 6900 tcagtccctg gtaggcagct ttgccccgtc tgtccgcccg gtgtgtcggc ggggttgaca 6960 aggtcgttgc gtcagtccaa catttgttgc catattttcc tgctctcccc accagctgct 7020 cttttctttt ctctttcttt tcccatcttc agtatattca tcttcccatc caagaacctt 7080 tatttcccct aagtaagtac tttgctacat ccatactcca tccttcccat cccttattcc 7140 tttgaacctt tcagttcgag ctttcccact tcatcgcagc ttgactaaca gctacccgc 7200 ttgagcagac atcaccatgc cccagttcga tatcctctgc aagacccccc ccaaggtcct 7260 cgtccgccag ttcgtcgagc gcttcgagcg cccctccggc gagaagatcg ccctctgcgc 7320 cgccgagctc acctacctct gctggatgat caccataac ggcaccgcca tcaagcgcgc 7380 caccttcatg tcctacaaca ccatcatctc caactccctc tccttcgata tcgtcaacaa 7440 gtccctccag ttcaagtaca agacccagaa ggccaccatc ctggaggcct ccctcaagaa 7500 gctcatcccc gcctgggagt tcaccatcat cccctactac ggccagaagc atcagtccga 7560 tatcaccgat atcgtctcct ccctccagct ccagttcgag tcctccgagg aggccgataa 7620 gggcaactcc cattccaaga agatgctcaa ggccctcctc tccgagggcg agtccatctg 7680 ggagatcacc gagagatcc tcaactcctt cgagtacacc tcccgcttca ccaagaccaa 7740 gaccctctac cagttcctct tcctcgccac cttcatcaac tgcggccgct tctccgatat 7800 caagaacgtc gatcccaagt ccttcaagct cgtccagaac aagtacctcg gcgtcatcat 7860 ccagtgcctc gtcaccgaga ccaagacctc cgtctcccgc catatctact tcttctccgc 7920 ccgcggccgc atcgatcccc tcgtctacct cgatgagttc ctccgcaact ccgagcccgt 7980 cctcaagcgc gtcaaccgca ccggcaactc ctcctccaac aagcaggagt accagctcct 8040 caaggataac ctcgtccgct cctacaacaa ggccctcaag aagaacgccc cctactccat 8100 cttcgccatc aagaacggcc ccaagtccca tatcggccgc catctcatga cctcttcct 8160 ctccatgaag ggcctcaccg agctcaccaa cgtcgtcggc aactggtccg ataagcgcgc 8220 ctccgccgtc gcccgcacca cctacaccca tcagatcacc gccatccccg atcattactt 8280 cgcactagtc tcccgctact acgcctacga tcccatctcc aaggagatga tcgccctcaa 8340 ggatgagacc aaccccatcg aggagtggca gcatatcgag cagctcaagg gctccgccga 8400 gggctccatc cgctaccccg cctggaacgg catcatctcc caggaggtcc tcgattacct 8460 ctcctcctac atcaaccgcc gcatccccaa gaagaagcgc aaggtctgag tcgagattat 8520 8580 8640 tacattagca cggtagaaaa agaataatac aacgagctgg gaatattctt taatataaaa 8700 ctccaagaag agctggtgcg gtggagcttg ttttcgactc tcagtaatat ttcctcatat 8760 ccaagcgcgc taggaggtgg tcgaatacac atgtaggcgc ttctctggat gcaaaagtcg 8820 tgccggacct gccgaaagac tttgaagatg cgttcacgcc atctaagttg cgtagataat 8880 tcacaaaaag ggatgtttgt ttccggaatg tagcaaagag ctgataggca atagcctcac 8940 ttgcatgcat cctagagttt aaacagcttg gcactggccg tcgttttaca acgtcgtgac 9000 tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc 9060 tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaac 9120 ggcgaatggc gcctgatgcg gtattttctc cttacgcatc tgtgcggtat ttcacaccgc 9180 atatggtgca ctctcagtac aatctgctct gatgccgcat agttaagcca gccccgacac 9240 ccgccaacac ccgctgacgc gccctgacgg gcttgtctgc tcccggcatc cgcttacaga 9300 caagctgtga ccgtctccgg gagctgcatg tgtcagaggt tttcaccgtc atcaccgaaa 9360 cgcgcgagac gaaagggcct cgtgatacgc ctatttttat aggttaatgt catgataata 9420 atggtttctt agacgtcagg tggcactttt cggggaaatg tgcgcggaac ccctatttgt 9480 ttatttttct aaatacattc aaatatgtat ccgctcatga gacaataacc ctgataaatg 9540 cttcaataat attgaaaaag gaagagtatg agtattcaac atttccgtgt cgcccttatt 9600 cccttttttg cggcattttg ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta 9660 aaagatgctg aagatcagtt gggtgcacga gtgggttaca tcgaactgga tctcaacagc 9720 ggtaagatcc ttgagagttt tcgccccgaa gaacgttttc caatgatgag cacttttaaa 9780 gttctgctat gtggcgcggt attatcccgt attgacgccg ggcaagagca actcggtcgc 9840 cgcatacact attctcagaa tgacttggtt gagtactcac cagtcacaga aaagcatctt 9900 acggatggca tgacagtaag agaattatgc agtgctgcca taaccatgag tgataacact 9960 gcggccaact tacttctgac aacgatcgga ggaccgaagg agctaaccgc ttttttgcac 10020 aacatggggg atcatgtaac tcgccttgat cgttgggaac cggagctgaa tgaagccata 10080 ccaaacgacg agcgtgacac cacgatgcct gtagcaatgg caacaacgtt gcgcaaacta 10140 ttaactggcg aactacttac tctagcttcc cggcaacaat taatagactg gatggaggcg 10200 gataaagttg caggaccact tctgcgctcg gcccttccgg ctggctggtt tattgctgat 10260 aaatctggag cctccaaggg tgggtctcgc ggtatcattg cagcactggg gccagatggt 10320 aagccctccc gtatcgtagt tatctacacg acggggagtc aggcaactat ggatgaacga 10380 aatagacaga tcgctgagat aggtgcctca ctgattaagc attggtaact gtcagaccaa 10440 gtttactcat atatacttta gattgattta aaacttcatt tttaatttaa aaggatctag 10500 gtgaagatcc tttttgataa tctcatgacc aaaatccctt aacgtgagtt ttcgttccac 10560 tgagcgtcag ac 10572 <210> 13 <211> 8029 <212> DNA <213> Artificial Sequence <220> <223> cbh1 locus, with a lysozyme cassette inserted between the FRT-F and FRT-F3 sites <400> 13 ggtgaaacac cgcccccttc ttgagagagc aacaacaatc attctgctgt cggcagaaga 60 gcagagactt gctgacccta gttaatgact acacagctcg gaggtttgtg acatgtccat 120 gattttgata catggcggag agcaatgtgg tggacgaaat caatcaccat atggcgctat 180 attggctgtt tcaggtcctg tttcaagctg ttcctacagc tctttcttgg tctacttgtg 240 gtcgcctgct acatcagttg atatacccgg aattactgca gccacttgca gtcccgtgga 300 attctcacgg tgaatgtagg ccttttgtag ggtaggaatt gtcactcaag cacccccaac 360 ctccattacg cctcccccat agagttccca atcagtgagt catggcactg ttctcaaata 420 gattggggag aagttgactt ccgcccagag ctgaaggtcg cacaaccgca tgatataggg 480 tcggcaacgg caaaaaagca cgtggctcac cgaaaagcaa gatgtttgcg atctaacatc 540 caggaacctg gatacatcca tcatcacgca cgaccacttt gatctgctgg taaactcgta 600 ttcgccctaa accgaagtgc gtggtaaatc tacacgtggg cccctttcgg tatactgcgt 660 gtgtcttctc taggtgccat tcttttccct tcctctagtg ttgaattgtt tgtgttggag 720 tccgagctgt aactacctct gaatctctgg agaatggtgg actaacgact accgtgcacc 780 tgcatcatgt atataatagt gatcctgaga aggggggttt ggagcaatgt gggactttga 840 tggtcatcaa acaaagaacg aagacgcctc ttttgcaaag ttttgtttcg gctacggtga 900 agaactggat acttgttgtg tcttctgtgt atttttgtgg caacaagagg ccagagacaa 960 tctattcaaa caccaagctt gctcttttga gctacaagaa cctgtggggt atatatctag 1020 agttgtgaag tcggtaatcc cgctgtatag taatacgagt cgcatctaaa tactccgaag 1080 ctgctgcgaa cccggagaat cgagatgtgc tggaaagctt ctagcgagcg gctaaattag 1140 catgaaaggc tatgagaaat tctggagacg gcttgttgaa tcatggcgtt ccattcttcg 1200 acaagcaaag cgtccgtcg cagtagcagg cactcattc cgaaaaaact cggagattcc 1260 taagtagcga tggaaccgga ataatataat aggcaataca ttgagttgcc tcgacggttg 1320 caatgcaggg gtactgagct tggacataac tgttccgtac cccacctctt ctcaaccttt 1380 ggcgtttccc tgattcagcg tacccgtaca agtcgtaatc actattaacc cagactgacc 1440 ggacgtgttt tgcccttcat ttggagaaat aatgtcattg cgatgtgtaa tttgcctgct 1500 tgaccgactg gggctgttcg aacggccgc aattcatctt gaagttccta ttccgagttc 1560 ctattctcta gaaagtatag gaacttccga atgtaggatt gttatccgaa ctctgctcgt 1620 agaggcatgt tgtgaatctg tgtcgggcag gacacgcctc gaaggttcac ggcaagggaa 1680 accaccgata gcagtgtcta gtagcaacct gtaaagccgc aatgcagcat cactggaaaa 1740 tacaaaccaa tggctaaaag tacataagtt aatgcctaaa gaagtcatat accagcggct 1800 aaattgta caatcaagtg gctaaacgta ccgtaatttg caacggctt gtggggttgc 1860 agaagcaacg gcaagcccc actccccac gtttgttct tcactcagtc caatctcagc 1920 tggtgatccc ccaattgggt cgcttgttg ttccggtgaa gtgaaagaag acagaggtaa 1980 gatgtctga ctcggagcgt ttgcataca accaagggca gtgatggaag acagtgaaat 2040 gttgacattc aaggagtatt tagccaggga tgcttgagtg tatcgtgtaa ggaggtttgt 2100 ctgccgatac gacgaatact gtatagtcac ttctgatgaa gtggtccata ttgaaatgta 2160 agtcggcact gaacaggca aagattgagt tgaaactgcc agatctcg ggccctcggg 2220 ccttcggcct ttgggtgtac atgtttgtgc tccgggcaaa tgcaagtgt ggtaggatcg 2280 aacacactgc tgcctttacc aagcagctga gggtagtga taggcaatg ttcaggggcc 2340 actgcatggt ttcgaataga aagagaagct tagccagaa caatagccga taagatagc 2400 ctcattaaac ggaatgagct agtaggcaaa gtcagcgaat gtgtatatat aaaggttcga 2460 ggtccgtgcc tccctcatgc tctcccatc tactcatca ctcagatcct tcccatcct 2520 tgtacaccat cttttgaggc acagaaaccc aatagtcaac cgcggactgc gcaccatgaa 2580 gcttcttccc tccttgattg gcctggccag tctggcgtcc ctcgccgtcg cccggatccc 2640 cggctttgac atttcgggct ggcaaccgac caccgacttt gcaagggcgt atgctaatgg 2700 agatcgtttc gtctacatca aggtacgttc aaccttgcca ccaagttgcg aacccgagac 2760 aagactgtga ccgcctcctt tgccctgggg cagctcacgc acccagcagc atcccatccc 2820 ccggcccccc acgtaccacc ggaaagctaa catcaacccc ctaccactgc taccaggcca 2880 ccgagggcac cacattcaag agctccgcat tcagccgcca gtacaccggc gcaacgcaaa 2940 acggcttcat ccgcggcgcc taccacttcg cccagcccgc cgcgtcctcg ggcgccgcgc 3000 aggcgagata cttcgccagc aacggcggcg gctggtccaa ggacggcatc accctgcccg 3060 gggcgctgga catcgagtac aaccccaacg gcgccacctg ctacggcctc tcgcaatcgg 3120 ccatggtgaa ctggatcgag gactttgtca ccacctacca cggcatcacc tcccgctggc 3180 ccgtcatcta caccaccacc gactggtgga cccagtgcac cggcaactcc aaccgcttcg 3240 cgaaccgctg cccgctgtgg atcgcccgct acgccagctc cgtcggcact ctgcccaatg 3300 gctggggctt ttacaccttc tggcagtaca acgacaagta tcctcagggc ggtgattcga 3360 actggttcaa cggcgatgcg tcgcgtctca gggctctcgc taacggagac taataagctc 3420 cgtggcgaaa gcctgacgca ccggtagatt cttggtgagc ccgtatcatg acggcggcgg 3480 gagctacatg gccccgggtg atttattttt tttgtatcta cttctgaccc ttttcaaata 3540 tacggtcaac tcatctttca ctggagatgc ggcctgcttg gtattgcgat gttgtcagct 3600 tggcaaattg tggctttcga aaacacaaaa cgattcctta gtagccatgc atcaagcttg 3660 gtaccgagct ctggaaacgc aaccctgaag ggattcttcc tttgagagat ggaagcgtgt 3720 catatctctt cggttctacg gcaggttttt ttctgctctt tcgtagcatg gcatggtcac 3780 ttcagcgctt atttacagtt gctggtattg atttcttgtg caaattgcta tctgacactt 3840 attagctatg gagtcaccac atttcccagc aacttcccca cttcctctgc aatcgccaac 3900 gtcctctctt cactgagtct ccgtccgata acctgcactg caaccggtgc cccatgatac 3960 gcctccggat catactcttc ctgcacgagg gcatcaagct cactaaccgc cttgaaactc tcattcttct tatcgatgtt cttatccgca aaggtaaccg gacaaccac gctcgtgaaa tccagcaggt tgatcacaga ggcataccca tagtaccgga actggtcatg ccgtaccgca 4140 gcggtaggcg taatcggcgc gatgatggcg tccagttcct tcccggcctt ttcttcagcc 4200. tcccgccatt tctcaaggta ctccatctgg taattccact tctggagatg cgtgtcccag agctcgttca tgttaacagc tttgatgttc gggttcagta ggtctttgat atttggagtc gccggctcgc cggatgcact gatatcgcgc attacgtcgg cgctgccgtc agccgcgtag 4380 atatgggaga tgagatcgtg gccgaaatcg tgcttgtatg gcgtccacgg ggtcacggtg 4440. tgaccggctt tggcgagtgc ggcgacggtg gtttccacgc cgcgcaggat aggagggtgt 4500. 4560. ggaggacat tgccgtcgaa gttgtagtag ccgatattga gcccgccgtt cttgatcttg gaggcaata tgtccgactc ggactggcgc gaggcatgg ggatgacctt ggagtcgtat ttccaaggct cctgaccgag gacggatttg gtgaagaggc ggaggtctaa catacttcat cagtgactgc cggtctcgta tatagtata aaagcaagaa aggaggacag tggaggcctg gtatagagca ggaaaagaag gaagaggcga aggactcacc ctcaacagag tgcgtaatcg gcccgacaac gctgtgcacc gtctcctgac cctccatgct gttcgccatc tttgcatacg 4860 gcagccgccc atgactcggc cttagaccgt acaggaagtt gaacgcggcc ggcactcgaa tcgagccacc gatatccgtt cctacaccga tgacgccacc acgaatccca acgatcgcac cctcaccacc agaactgccg ccgcacgacc agttcttgtt gcgtgggttg acggtgcgcc 5040 cgatgatgtt gttgactgtc tcgcagacca tcagggtctg cgggacagag gtcttgacgt 5100 agaagacggc accggctttg cggagcatgg ttgtcagaac cgagtcccct tcgtcgtact 5160 tgtttagcca tgagatgtag cccattgatg tttcgtagcc ctggtggcat atgttagctg acaaaaaggg acatctaacg acttaggggc aacggtgtac cttgactcga agctggtctt tgagagat ggggaggcca tgaagtggac caacgggtct cttgtgcttt gcgtagtatt 5340 catcgagttc ccttgcctgc gcgagagcgg cgtcaggga gaactcgtgg gcgcagtttg 5400 tctgcacaga agccagcgtc agcttgatag tcccataagg tggcgttgtt acatctccct 5460 gagaggtaga ggggacccta ctaactgctg ggcgattgct gcccgtttac agaatgctag 5520 cgtaacttcc accgaggtca actctccggc cgccagcttg gacaagat ctgcagcgga 5580 ggcctctgtg atcttcagtt cggcctctga areatcccc gatttctttg ggaaatcaat 5640 aacgctgtct tccgcaggca gcgtctggac tttccattca tcagggatgg tttttgcgag 5700 gcgggcgcgc ttatcagcgg ccagttcttc ccaggattga ggcattctgt gttagcttat 5760 agtcaggatg ttggctcgac gagtgttaac tgggagttgg catgagggtt atgtaggctt 5820 ctttagcccc gcatccccct cattctcctc attgatcccg ggggagcgga tggtgttgat 5880 aagagactaa ttatagggtt taggctggtgc ctagctggtg attggctggc ttcgccgaat 5940 tttacgggcc aaggaaagct gcagaaccgc ggcactggta aacggtaatt aagctatcag 6000 ccccatgcta acgagtttaa attacgtgta ttgctgataa acaccaacag agctttactg 6060 aaagatggga gtcacggtgt ggcttcccca ctgcgattat tgcacaagca gcgagggcga 6120 acttgactgt cgtcgctgag cagcctgcag tcaacatac atatatca accgcgaaga 6180 cgtctggcct tgtagacac gacgctccct agcacacct gccgtgtcag ccttacggt 6240 tgttacttgc attcaggatg ctctccagcg ggcgagctat tcaaatatt caaagcaggt 6300 atctcgtatt gccaggattc agctgaagca acaggtgcca aggaatctg cgtcggttct 6360 catctgggct tgctcggtcc tggcgtagac aagggcgaat tctgcattga agttcctatt 6420 ccgagttcct attctcaaa tagtatagga acttcaacta gctagtgcat gcgataacgg 6480 atagagaa agaggaatt aaaaaaaaaaaaaaaaa catcccgttc ataacccgta 6540 gatcgccgc tcttcgtgta tcccagtacc acggcaagg tattcatga tcgttcaatg 6600 ttgatattgt tcccgccagt atggctccac cccatctcc gcgaatctcc tcttctcgaa 6660 cgcggtagtg gcgcgccaat tggtaatgac ccatagggag acaacacca taatagcaac 6720 agtggaaatt agtggcgcaa taattgagaa cacagtgaga ccatagctgg cggcctggaa 6780 agcactgttg gagaccaact tgtccgttgc gaggccaact tgcattgctg tcagacgat 6840 gacaacgtag ccgaggaccg tcacaaggga cgcaaagttg tcgcggatga ggtctccgta 6900 gatggcatag ccggcaatcc gagagtagcc tctcaacagg tggccttttc gaaaccggta 6960 aaccttgttc agacgtccta gccgcagctc accgtaccag tatcgaggat tgacggcaga 7020 atagcagtgg ctctccagga tttgactgga caaaatcttc cagtattccc aggtcacagt 7080 gtctggcaga agtcccttct cgcgtgcgag tcgaaagtcg ctatagtgcg caatgagagc 7140 acagtaggag aataggaacc cgcgagcaca ttgttcaatc tccacatgaa ttggatgact 7200 gctgggcaga atgtgctgcc tccaaaatcc tgcgtccaac agatactctg gcaggggctt 7260 cagatgaatg cctctgggcc cccagataag atgcagctct ggattctcgg ttacgatgat 7320 atcgcgagag agcacgagtt ggtgatggag gggacgagga ggcataggtc ggccgcaggc 7380 ccataaccag tcttgcacag cattgatctt cctcacgagg agctcctgat gcagaaactc 7440 ctccatgttg ctgattgggt tgagaatttc atcgctcctg gatcgtatgg ttgctggcaa 7500 gaccctgctt aaccgtgccg tgtcatggtc atctctggtg gcttcgtcgc tggcctgtct 7560 ttgcaattcg acagcaaatg gtggagatct ctctatcgtg acagtcatgg tagcgatagc 7620 taggtgtcgt tgcacgcaca taggccgaaa tgcgaagtgg aaagaatttc ccggcgcgga 7680 atgaagtctc gtcattttgt actcgtactc gacacctcca ccgaagtgtt aagaatggat 7740 ccacgatgcc aaaaagcttg ttcatttcgg ctagcccgtg atcctggcgc ttctagggct 7800 gaaactgtgt tgttaatgta ttatggctg tgtaactgac ttgaatgggg aatgaggagc 7860 gcgatggatt cgcttgcatg tcccctggcc aagacgagcc gctttggcgg tttgtgattc 7920 gaaggtgtgt cagcggaggc gccagggcaa cacgcactga gccagccaac atgcattgct 7980 gccgacatga atagacacgc gccgagcaga cataggagac gtgttgact 8029 <210> 14 <211> 7950 <212> DNA <213> Artificial sequence <220> <223> The cbh2 locus with the lysozyme cassette inserted between the FRT-F and FRT-F3 sites <400> 14 acacttactc ttctacacag tcatttcctg gagactaaca gagctttatg tagtatatat 60 ggagacgtga agctactgcc gggtgcatgg cttgcccatc accgcacgag ttcgagcacg 120 ttaatattcc atttacgact caatcaata ccttgtca tgggagctcg tcttgacatt 180 aacgcatcct ttcaagtaat gcaatgcagc aatggaggaa cttgtagaga ccgagggagg 240 aatggcgaag ggcggccgga gcttggagtc ctggtggagg ctgaagctt cgagtttcag 300 cgtctcccag aagttaccca acccaagtgg ctacaacgac ataagtatt ctatacctag 360 taatattgtt cgatgcttgt atggagtaga tgtggagtc tggtgtaata ttaatggctt 420 agttcatact acatttgaca ttccagccc gagagcgcac cgaagccaca tgccgcatat 480 tgacaagtg ctagattgtg taaggaggc attctctata gaggaatcag cgtttgcata 540 tacctactac gtcattgccc taatggacag taagctagcc agctgcatta tgataagagt 600 aacgtgagat aggtaataag tcttacaaca ctttccctta tagccacta actacaacat 660 cgtcctgcag ttcctatatg atacgtataa cccattgata catccaagta tccagaggtg 720 tatggaaata tcagatcaag acctctctct tctaagaaac ctagaaccag acgctggtag 780 tataatagc acactgtgac tcgcttaggc ccttaagctt agccggct gcttactatt 840 aacctctcat aaacgctact gcaatgattg gaaacttctt atagtagaat gaggcaataa 900 gacgcatctc aggtcacata tagtcttatg tttgaaaccc ctcactactg ccatttatct 960 tgtggaaata tctattattt cagtctatac gtaatgaagg cacttttcag gatctcttcc 1020 ctaagcttgt ataagcaggt ttgttgccgt aaccattctg tctcctcgcc taatacctgt 1080 gaagcacaga atacgtttat tctataagag acgtcttacc ttccatcgag attgaaagct 1140 taaaccgtct acaacggatg ccctcatcat gacccgtcta actcgaacat ctgccacatt 1200 agtctcgggt aacaggagga gtaacacgac cagtgtaaca cgttaagcat acaattgaac 1260 gagaatggtg aggactgaga taaaagaatt ctgttaagga tctaaaatta tagtgcatac 1320 aaggtagatg ttagtaggtg gtttcagttt tcctttcctt tacgttggta tagagcagcg 1380 ttcaccaaat gttagcagag ttctatctat gtcgtatcca ttctgcctta tatctctcaa 1440 gggcgccgag ctcatcctac gaagctctca ggccatcgta ggaaatacag gatagacact 1500 cggccgcgaa ttcatcttga agttcctatt ccgagttcct attctctaga aagtatagga 1560 acttccgaat gtaggattgt tatccgaact ctgctcgtag aggcatgttg tgaatctgtg 1620 tcgggcagga cacgcctcga aggttcacgg caagggaaac caccgatagc agtgtctagt 1680 agcaacctgt aaagccgcaa tgcagcatca ctggaaaata caaaccaatg gctaaaagta 1740 cataagttaa tgcctaaaga agtcatatac cagcggctaa taattgtaca atcaagtggc 1800 taaacgtacc gtaatttgcc aacggcttgt ggggttgcag aagcaacggc aaagccccac 1860 ttccccacgt ttgtttcttc actcagtcca atctcagctg gtgatcccccc aattgggtcg 1920 cttgtttgtt ccggtgaagt gaaagaagac agaggtaaga atgtctgact cggagcgttt 1980 tgcatacaac caagggcagt gatggaagac agtgaaatgt tgacattcaa ggagtatta 2040 gccagggatg cttgagtgta tcgtgtaagg aggtttgtct gccgatacga cgaatactgt 2100 atagtcactt ctgatgaagt ggtccatatt gaaatgtaag tcggcactga acaggcaaaa 2160 gattgagttg aaactgccta agatctcggg ccctcgggcc ttcggccttt gggtgtacat 2220 gtttgtgctc cgggcaaatg caaagtgtgg taggatcgaa cacactgctg cctttaccaa 2280 gcagctgagg gtatgtgata ggcaatgtt caggggccac tgcatggttt cgaatagaaa 2340 gagaagctta gccagaaca atagccgata aagatagcct cattaaacgg atgagctag 2400 taggcaagt cagcgaatgt gtatatata aggttcgagg tccgtgccctc cctcatgctc 2460 tcccatcta ctcatcact cagatcctcc aggagacttg tacaccatct tttgaggcac 2520 agaaacccaa tagtcaccg cggactgcgc accatgaagc ttctccctc cttgattggc 2580 ctggccagtc tgcgtccct cgccgtcgcc cggatccccg gcttgacat tcgggctgg 2640 caaccgacca ccgactttgc aagggcgtat gctaatggag atcgttcgt ctacatcaag 2700 gtacgttcaa ccttgccacc aagttgcgaa cccgagacaca gactgtgacc gcctcctttg 2760 ccctggggca gctcacgcac ccagcac cccacccc ggccccc gtaccaccgg 2820 aaagctaaca tcaccccct accactgcta catchcacc gagggcacca cattcagag 2880 ctccgcattc agccgccagt acaccggcgc acgcaaac ggctcatcc gcggcgccta 2940 ccactcgcc cagcccgccg cgtcctcggg cgccgcgcag gcgagatact tcgccagca 3000 cggcggcggc tggtccaagg acggcatcac cctgcccggg gcgctggaca tcgagtacaa 3060 ccccaacggc gccacctgct acggcctctc gcaatcggcc atggtgaact ggatcgagga 3120 ctttgtcacc acctaccacg gcatcacctc ccgctggccc gtcatctaca ccaccaccga 3180 ctggtggacc cagtgcaccg gcaactccaa ccgcttcgcg aaccgctgcc cgctgtggat 3240 cgcccgctac gccagctccg tcggcactct gcccaatggc tggggctttt acaccttctg 3300 gcagtacaac gacaagtatc ctcagggcgg tgattcgaac tggttcaacg gcgatgcgtc 3360 gcgtctcagg gctctcgcta acggagacta ataagctccg tggcgaaagc ctgacgcacc 3420 ggtagattct tggtgagccc gtatcatgac ggcggcggga gctacatggc cccgggtgat 3480 ttattttttt tgtatctact tctgaccctt ttcaaatata cggtcaactc atctttcact 3540 ggagatgcgg cctgcttggt attgcgatgt tgtcagcttg gcaaattgtg gctttcgaaa 3600 acacaaaacg attccttagt agccatgcat caagcttggt accgagctct ggaaacgcaa 3660 ccctgaaggg attcttcctt tgagagatgg aagcgtgtca tatctcttcg gttctacggc 3720 aggttttttt ctgctctttc gtagcatggc atggtcactt cagcgcttat ttacagttgc 3780 tggtattgat ttcttgtgca aattgctatc tgacacttat tagctatgga gtcaccacat 3840 ttcccagcaa cttccccact tcctctgcaa tcgccaacgt cctctcttca ctgagtctcc 3900 gtccgataac ctgcactgca accggtgccc catgatacgc ctccggatca tactcttcct 3960 gcacgagggc atcaagctca ctaaccgcct tgaaactctc attcttctta tcgatgttct 4020 tatccgcaaa ggtaaccgga acaaccacgc tcgtgaaatc cagcaggttg atcacagagg 4080 catacccata gtaccggaac tggtcatgcc gtaccgcagc ggtaggcgta atcggcgcga 4140 tgatggcgtc cagttccttc ccggcctttt cttcagcctc ccgccatttc tcaaggtact 4200 ccatctggta attccacttc tggagatgcg tgtcccagag ctcgttcatg ttaacagctt 4260 tgatgttcgg gttcagtagg tctttgatat ttggagtcgc cggctcgccg gatgcactga 4320 tatcgcgcat tacgtcggcg ctgccgtcag ccgcgtagat atgggagatg agatcgtggc 4380 cgaaatcgtg cttgtatggc gtccacgggg tcacggtgtg accggctttg gcgagtgcgg 4440 cgacggtggt ttccacgccg cgcaggatag gagggtgtgg aaggacattg ccgtcgaagt 4500 tgtagtagcc gatattgagc ccgccgttct tgatcttgga ggcaataatg tccgactcgg 4560 actggcgcca gggcatgggg atgaccttgg agtcgtattt ccaaggctcc tgaccgagga 4620 cggatttggt gaagaggcgg aggtctaaca tacttcatca gtgactgccg gtctcgtata 4680 tagtataaaa agcaagaaag gaggacagtg gaggcctggt atagagcagg aaaagaagga 4740 agaggcgaag gactcaccct caacagagtg cgtaatcggc ccgacaacgc tgtgcaccgt 4800 ctcctgaccc tccatgctgt tcgccatctt tgcatacggc agccgcccat gactcggcct 4860 tagaccgtac aggaagttga acgcggccgg cactcgaatc gagccaccga tatccgttcc 4920 tacaccgatg acgccaccac gaatcccaac gatcgcaccc tcaccaccag aactgccgcc 4980 gcacgaccag ttcttgttgc gtgggttgac ggtgcgcccg atgatgttgt tgactgtctc 5040 gcagaccatc agggtctgcg ggacagaggt cttgacgtag aagacggcac cggctttgcg 5100 gagcatggtt gtcagaaccg agtccccttc gtcgtacttg tttagccatg agatgtagcc 5160 cattgatgtt tcgtagccct ggtggcatat gttagctgac aaaaagggac atctaacgac 5220 ttaggggcaa cggtgtacct tgactcgaag ctggtctttg agagagatgg ggaggccatg 5280 aagtggacca acgggtctct tgtgctttgc gtagtattca tcgagttccc ttgcctgcgc 5340 gagagcggcg tcagggaaga actcgtgggc gcagtttgtc tgcacagaag ccagcgtcag 5400 cttgatagtc ccataaggtg gcgttgttac atctccctga gaggtagagg ggaccctact 5460 aactgctggg cgattgctgc ccgtttacag aatgctagcg taacttccac cgaggtcaac 5520 tctccggccg ccagcttgga cacaagatct gcagcggagg cctctgtgat cttcagttcg 5580 gcctctgaaa ggatccccga tttctttggg aaatcaataa cgctgtcttc cgcaggcagc 5640 gtctggactt tccattcatc agggatggtt tttgcgaggc gggcgcgctt atcagcggcc 5700 agttcttccc aggattgagg cattctgtgt tagcttatag tcaggatgtt ggctcgacga 5760 gtgtaaactg ggagttggca tgagggttat gtaggcttct ttagccccgc atccccctca 5820 ttctcctcat tgatcccggg ggagcggatg gtgttgataa gagactaatt atagggttta 5880 gctggtgcct agctggtgat tggctggctt cgccgaattt tacgggccaa ggaaagctgc 5940 agaaccgcgg cactggtaaa cggtaattaa gctatcagcc ccatgctaac gagtttaaat 6000 tacgtgtatt gctgataaac accaacagag ctttactgaa agatgggagt cacggtgtgg 6060 cttccccact gcgattattg cacaagcagc gagggcgaac ttgactgtcg tcgctgagca 6120 gcctgcagtc aaacatacat atatatcaac cgcgaagacg tctggccttg tagaacacga 6180 cgctccctag caacacctgc cgtgtcagcc tctacggttg ttacttgcat tcaggatgct 6240 ctccagcggg cgagctattc aaaatattca aagcaggtat ctcgtattgc caggattcag 6300 ctgaagcaac aggtgccaag gaaatctgcg tcggttctca tctgggcttg ctcggtcctg 6360 gcgtagacaa gggcgaattc tgcattgaag ttcctattcc gagttcctat tcttcaaata 6420 gtataggaac ttcaactagc tagtgcatgc cacaatgtcg agtgtctatt agacatactc 6480 cgagaataaa gtcaactgtg tctgtgatct aaagatcgat tcggcagtcg agtagcgtat 6540 aacaactccg agtaccagca aaagcacgtc gtgacaggag cagggctttg ccaactgcgc 6600 aaccttgctt gaatgaggat acacggggtg caacatggct gtactgatcc atcgcaacca 6660 aaatttctgt ttatagatca agctggtaga ttccaattac tccacctctt gcgcttctcc 6720 atgacatgta agtgcacgtg gaaaccatac ccaaattgcc tacagctgcg gagcatgagc 6780 ctatggcgat cagtctggtc atgttaacca gcctgtgctc tgacgttaat gcagaataga 6840 aagccgcggt tgcaatgcaa atgatgatgc ctttgcagaa atggcttgct cgctgactga 6900 taccagtaac aactttgctt ggccgtctag cgctgttgat tgtattcatc acaacctcgt 6960 ctccctcctt tgggttgagc tctttggatg gctttccaaa cgttaatagc gcgtttttct 7020 ccacaaagta ttcgtatgga cgcgcttttg cgtgtattgc gtgagctacc agcagcccaa 7080 ttggcgaagt cttgagccgc atcgcataga ataattgatt gcgcatttga tgcgattttt 7140 gagcggctgt ttcaggcgac atttcgcccg cccttatttg ctccattata tcatcgacgg 7200 catgtccaat agcccggtga tagtcttgtc gaatatggct gtcgtggata acccatcggc 7260 agcagatgat aatgattccg cagcacaagc tcgtatgtgg gtagcagaag aactgagcga 7320 gatcttcgag ggcgtaactc tgcatatccg attggcctgc tgccacatgt catttgcttc 7380 ggtttctttt ctgttgagtt cttgtatttg ggtgaaagta acatggtgta tgacgagaga 7440 cattggtggt aagaaaaaat ttcacctcct cttagtgcag gactgactct caaaatctat 7500 atgcaaatgt gtcgtgtaac acccttcgca tgagcgctga ccgtacccta ccatttcgcc 7560 ccactcatga tagcagaaga gacatattaa ttcggcaatg ctacgaaagt ctgcaggtat 7620 gcttaaataa acgcttgcca cagaagccga cagtttattg ttactactta ctatactgta 7680 ttattgttgc tcacataagg cggtgaacca ttggttcacc acgacgcctg acgaggtaaa 7740 ttactctctc gtagggctgc caaggtaggt cccaaccccg tatcctcggt cgagggtgcg 7800 aggttctttg gtccttccct ctttggtaaa gcccagtagc gtgtttgaat cagttcacaa 7860 tctctcctaa acacagtccg acactaggta ggtacgttgt aatagcaact caaacatgta 7920 attcgttcaa ggcaggaaca ttttataaac 7950 <210> 15 <211> 7936 <212> DNA <213> Artificial Sequence <220> <223> Locus eg1 with a lysozyme cassette inserted between the FRT-F and FRT-F3 sites <400> 15 ggagcagatg gcgacaccat aggcggtgcg aatcgtccag aaacttgttg tgcgagacac 60 cacggtctca tttcgcagaa tcccagaccc tttatggtct taccgatgac cggttcaggc 120 caaacagagg caatggggtt ctttgagtat atttcgatca agcatctcaa tgaataccgc 180 cctagtgatt catggcggag aagcctcatg ttcttctccc agacggtacc atccgtgcgg 240 tacgctgcta tcgcattggc attggccaac caaaactacc tgcatcgcgg gtttagcgac 300 caattgcacc aaccgccatc ctcgaaagac tggctgtcag acagcgttgc cttgttttac 360 tataaccgag ccatccagct tcttctcaag caggagaacg gagacagcga ggatacaaca 420 gccatcacgc tcttggtctg ttatctcttc atctgctttg atcatctggc gggcaactac 480 gcacaggcaa tgaagcacct acgcggaggt gttgagctct cacgaaacgc ccaaaaggcg 540 atactagacg gcaacaatgc atacgacgag accaagacct caggaactca cgcactcatc 600 tgccagatca cgagacagat ccgtcgtctt gacatgcaag ccgtaacgtt tctggttgac 660 tggactcccg ccgatatcaa agacacagcc gtatcccagc ttgcgcatcc caatagtgca 720 tttcaatctc ttgaccaagc cgctgaccac ctacagagtc tcatcgctcg agtcatgagt 780 ctacgcaata acccgggaca gcaaatgctt cctttgtcag tcaagaatgc agttctcgaa 840 cagttggaaa cgtggtcgac tctcttcgaa aacatgctgc aacaacatgg cagttcctct 900 gattcagagg agacggcata cccgctcatc acactgctac gcctacagta taccatcgta 960 tggacttatc tcagtagctc agggcctggg agggaaatgg aatacgacaa cttcctgacc 1020 cagtttcagc aatgcgtggc gttggcaggc gacttcgcgg cagtgcatga gcgatattcg 1080 gggtcgttga agccgacgtt cacgccggag attggcatga tcccagtgct ttacatcatc 1140 ggggccaaat gccggcatcc tgttgtgcgg cgggaggcct tgggtctttt gaggcggcaa 1200 ccgatccggg aggcggtttg ggatagcgtt gttgttgcca gggtagtgga gaggataatg 1260 gagattgagg aggttgggtt tgagaagtgg gaaatgatac agagtatgga acaggttccg 1320 gtgtggcaga gggttgagac gctgtcttgg gcacatgtcg tcgtcgatgg acagtctgcg 1380 ggcagagtgg acattaacta tacgttctgc gcgcgagagg gatcgcatat tgagtctttc 1440 atgatgtaat aagcttgggc ttgacagcgt tctattgcca gtgtatcaac gaagtggtat 1500 ggcggccgct tgaagttcct attccgagtt cctattctct agaagtata ggaacttccg 1560 aatgtaggat tgttatccga actctgctcg tegggcatg tgtgaatct gtgtcgggca 1620 ggacacgcct cgaggttca cggcaaggga aaccaccgat agcagtgtct agtagcaacc 1680 tgtaaagccg caatgcagca tcactggaaa atacaacca atggctaaaa gtacataagt 1740 taatgcctaa agaagtcata taccagcggc taatattgt acatcaagt ggctaaacgt 1800 accgtaattt gccaacggct tgtggggttg cagaagcaac ggcaagccc cactcccca 1860 cgtttgtttc ttcactcagt ccaatctcag ctggtgatcc cccattggg tcgcttgttt 1920 gttccggtga agtgaaagaa gagaggta agaatgtctg actcggagcg tttgcatac 1980 aaccaagggc agtgatggaa gaagtgaaa tgttgacatt caggagat tagccagggg 2040 atgcttgagt gtatcgtgta aggaggttg tctgccgata cgacgaatac tgtatagtca 2100 cttctgatga agtggtccat attgaatgt aagtcggcac tgaacaggca aaagattgag ttgaaactgc ctaagatctc gggccctcgg gccttcggcc tttgggtgta catgtttgtg ctccgggcaa atgcaaagtg tggtaggatc gaacacactg ctgcctttac caagcagctg agggtatgtg ataggcaaat gttcaggggc cactgcatgg tttcgaatag aaagagaagc ttagccaaga acaatagccg ataaagatag cctcattaa cggaatgagc tagtagca agtcagcgaa tgtgtatatata taaaggttcg aggtccgtgc ctccctcatg ctctccccat ctactcatca actcagatcc tccaggagac ttgtacacca tcttttgagg cacagaaacc caatagtcaa ccgcggactg cgcaccatga agcttcttcc ctccttgatt ggcctggcca gtctggcgtc cctcgccgtc gcccggatcc ccggctttga catttcgggc tggcaaccga ccaccgactt tgcaagggcg tatgctaatg gagatcgttt cgtctacatc aaggtacgtt caaccttgcc accaagttgc gaacccgaga caagactgtg accgcctcct ttgccctggg gcagctcacg cacccagcag catcccatcc cccggccccc cacgtaccac cggaagcta acatcaaccc cctaccactg ctaccaggcc accgagggca ccacattcaa gagctccgca 2880 ttcagccgcc agtacaccgg cgcaacgcaa aacggcttca tccgcggcgc ctaccacttc 2940 gcccagcccg ccgcgtcctc gggcgccgcg caggcgagat acttcgccag caacggcggc 3000 ggctggtcca aggacggcat caccctgccc ggggcgctgg acatcgagta caaccccaac 3060 ggcgccacct gctacggcct ctcgcaatcg gccatggtga actggatcga ggactttgtc 3120 accacctacc acggcatcac ctcccgctgg cccgtcatct acaccaccac cgactggtgg 3180 acccagtgca ccggcaactc caaccgcttc gcgaaccgct gcccgctgtg gatcgcccgc 3240 tacgccagct ccgtcggcac tctgcccaat ggctggggct tttacacctt ctggcagtac 3300 aacgacaagt atcctcaggg cggtgattcg aactggttca acggcgatgc gtcgcgtctc 3360 agggctctcg ctaacggaga ctaataagct ccgtggcgaa agcctgacgc accggtagat 3420 tcttggtgag cccgtatcat gacggcggcg ggagctacat ggccccgggt gatttatttt 3480 ttttgtatct acttctgacc cttttcaaat atacggtcaa ctcatctttc actggagatg 3540 cggcctgctt ggtattgcga tgttgtcagc ttggcaaatt gtggctttcg aaaacacaaa 3600 acgattcctt agtagccatg catcaagctt ggtaccgagc tctggaaacg caaccctgaa 3660 gggattcttc ctttgagaga tggaagcgtg tcatatctct tcggttctac ggcaggtttt 3720 tttctgctct ttcgtagcat ggcatggtca cttcagcgct tatttacagt tgctggtatt 3780 gatttcttgt gcaaattgct atctgacact tattagctat ggagtcacca catttcccag 3840 caacttcccc acttctctctg caatcgccaa cgtcctctct tcactgagtc tccgtccgat 3900 aacctgcact gcaaccggtg ccccatgata cgcctccgga tcatactctt cctgcacgag 3960 ggcatcaagc tcactaaccg ccttgaaact ctcattcttc ttatcgatgt tcttatccgc 4020 aaaggtaacc ggaacaacca cgctcgtgaa atccagcagg ttgatcacag aggcataccc 4080 atagtaccgg aactggtcat gccgtaccgc agcggtaggc gtaatcggcg cgatgatggc 4140 gtccagttcc ttcccggcct tttcttcagc ctcccgccat ttctcaaggt actccatctg 4200 gtaattccac ttctggagat gcgtgtccca gagctcgttc atgttaacag ctttgatgtt 4260 cgggttcagt aggtctttga tatttggagt cgccggctcg ccggatgcac tgatatcgcg 4320 cattacgtcg gcgctgccgt cagccgcgta gatatgggag atgagatcgt ggccgaaatc 4380 gtgcttgtat ggcgtccacg gggtcacggt gtgaccggct ttggcgagtg cggcgacggt 4440 4500 gccgatattg agcccgccgt tcttgatctt ggaggcaata atgtccgact cggactggcg 4560 ccagggcatg gggatgacct tggagtcgta tttccaaggc tcctgaccga ggacggattt 4620 ggtgaagagg cggaggtcta acatacttca tcagtgactg ccggtctcgt atatagtata 4680 aaaagcaaga aaggagca gtggaggcct ggtatagagc aggaaaagaa ggagaggcg 4740 4800 ccctccatgc tgttcgccat ctttgcatac ggcagccgcc catgactcgg ccttagaccg 4860 tacaggaagt tgaacgcggc cggcactcga atcgagccac cgatatccgt tcctacaccg 4920 atgacgccac cacgaatccc aacgatcgca ccctcaccac cagaactgcc gccgcaccac 4980 cagttcttgt tgcgtgggtt gacggtgcgc ccgatgatgt tgttgactgt ctcgcagacc 5040 atcagggtct gcgggacaga ggtcttgacg tagagaacgg caccggcttt gcggagcatg 5100 gttgtcagaa ccgagtcccc ttcgtcgtac ttgtttagcc atgagatgta gcccattgat 5160 gtttcgtagc cctggtggca tatgttagct gacaaaaagg gacatctaac gacttagggg 5220 caacggtgta ccttgactcg aagctggtct ttgagagaga tgggggaggcc atgaagtgga 5280 ccaacgggtc tcttgtgctt tgcgtagtat tcatcgagtt cccttgcctg cgcgagagcg 5340 gcgtcaggga agaactcgtg ggcgcagttt gtctgcacag aagccagcgt cagcttgata 5400 gtcccataag gtggcgttgt tacatctccc tgagaggtag aggggaccct actaactgct 5460 gggcgattgc tgcccgttta cagaatgcta gcgtaacttc caccgaggtc aactctccgg 5520 ccgccagctt ggacacaaga tctgcagcgg aggcctctgt gatcttcagt tcggcctctg 5580 aaaggatccc cgatttcttt gggaaatcaa taacgctgtc ttccgcaggc agcgtctgga 5640 ctttccattc atcagggatg gtttttgcga ggcgggcgcg cttatcagcg gccagttctt 5700 cccaggattg aggcattctg tgttagctta tagtcaggat gttggctcga cgagtgtaaa 5760 ctgggagttg gcatgagggt tatgtaggct tctttagccc cgcatcccccc tcattctcct 5820 cattgatccc gggggagcgg atggtgttga taagagacta attatagggt ttagctggtg 5880 cctagctggt gattggctgg cttcgccgaa ttttacgggc caaggaaagc tgcagaaccg 5940 cggcactggt aaacggtaat taagctatca gccccatgct aacgagttta aattacgtgt 6000 attgctgata aacaccaaca gagctttact gaagatggg agtcacggtg tggcttcccc 6060 actgcgatta ttgcacaagc agcgagggcg aacttgactg tcgtcgctga gcagcctgca 6120 gtcaaacata catatatatc aaccgcgaag acgtctggcc ttgtagaaca cgacgctccc 6180 tagcaacacc tgccgtgtca gcctctacgg ttgttacttg cattcaggat gctctccagc 6240 gggcgagcta ttcaaaatat tcaaagcagg tatctcgtat tgccaggatt cagctgaagc 6300 aacaggtgcc aaagaaatct gcgtcggttc tcatctgggc ttgctcggtc ctggcgtaga 6360 6420 aacttcatta attaagataa tggccacttt catctgaatc areagagga gccgttgatg 6480 atttccagat atcctatctt catcgctagt actaataaca agtaagcaaa cagccagcta 6540 cactcgtaca caccgctcat gaaaacataa gacaaagctc aagccatgtc aagcaccacc 6600 ccatcgtaca cgtacatctt ctaccaatct gtccagatgc cggctacgtc agcctccaac 6660 ccattgcgat acaatgacgg atgtcgtata gaccatggca acggctccca ccaccattgt 6720 cactgcgtcc aaagtcttct cccacctgct ctcagcaacg cccttgaaat gcaggaatgc 6780 cggatacatg tagaccaatg gaatgcaggc aaaagatccc gtcagcgcca caaacttatc 6840 caaatcactt gctcccacca ccgccacgcc gatgcatgcc acaatggtca aggcccggag 6900 gccgttcttc ttccacttga ttgccgcgct cttcttacca gtggcgcgct ctccgaaaat 6960 cgacgtttcc aatatgcgga tcgcgggggaa cagctgcaca ggctcgccag ccagtacggc 7020 7080 gatttgaatc ttggtgtgtt ctccaaacgt cgcatagcag agtgcgccga ctgatgtgaa 7140 gatggccgtg atgaggagca tgacaaggagaggcccc ttgaactgat gaggcttctt 7200 catactcgac tgaattggca ggatcaggcc aatgccctca aacgtga tcgccgagcc 7260 cagagtcagg ggaaaatcgg aggggttgaa gagcttgacg cttggctcca taccgtgcct 7320 7380 cgccaccaga gcaaccggac ccagcttgga gatgttgcgg atccaggcta aggaatgag 7440 agggagaac tgaagcgcaa ttaggcccga caccccgaaa tgaccaaggc cgttggtgac 7500 agcgtcgagg your area gattttcagc agtgaagata atgcctgagc agacgaagcc 7560 cagctgagaa atggcaatgg aggcgagaat caagcttcga aaccggggtc caacgacggc 7620 ctcgccaatg tctccatagc caccgccgta cttgtggcgg cagtccagaa gtaagcggaa 7680 agaagcaa ttgaccagtg acacggagat gagcgccagt gacgaaaaga ggatacctcc 7740 gttgcggaat gccttgggca ggaacaggat gcctgtgccg atgaaagcct tgagcagcgt 7800 gaagaggtc ttgactgtgc tcgcgtcacc ctggcgggca agacggcggg agcttctccg 7860 gcgaccagca ctcggtcgcg caagcagcgg acgccgctcg tcggcggctt cttccgcctc 7920 atcagtgacg gcagac 7936 <210> 16 <211> 8996 <212> DNA <213> Artificial Sequence <220> <223> The xyn2 locus with a lysozyme cassette inserted between the FRT-F and FRT-F3 sites <400> 16 cttgaacgcg aaaatgttat cagggccgag gagatgtacc ctgagcctta ccagtggcca 60 gccatccttc aagggtccag gaagcattgg caaatctggc gagattgagg catctgctgg 120 tataccttgt agttaaggga actcttgtgc cttctttgtc aggaacctgc cttgcaaggc 180 taagcatcta ccttgcttgt tcgccttgcc ttacttagat tctgggagct tgtagttaca 240 tagctcatat gctatttgct tttgcgagga gggcacttgc aagactggct ctatgaaggg 300 cgttggatac tgtcgctact acggtcgtac gggatggtcc ttgcaaagaa gtgcaatcta 360 tttcagagga ttgttgttgc cttttgagtc ttaggttgtt gataggacac cttctttaca 420 ataaggtagt gaaaaccagc ctcttgtcgc tgagacttcc agttatctgg cctacctagg 480 taggtaccca gagaatatct acctaggcag tatggtgctt taaccgtggc ccttctgaac ctgatctttc ttgtcgctct gctcataggc tggccttaca cttggatctt 600 660. tatggtcaaa tgttcatgaa acaacgctct gggtccttga gctatgtatc atgatatcag ccttgaacag tctgggttat ggctgtaatg caagcatacc atggcttcaa ggggcaggag 720 780. 780. cccttcaaaa aacgctgctgt acatgatccc cagtgtcgac atcctgatct attctaggta aggtagattc aactcagtat 840 atcgttattc gagataaat ggatagcatt gagtatctga agaaagtagg taccaatatt aaacttctct ttatagctag atcacagtac tgaaaagaaa agaagtagcg attattatct tgaataaaag atatagcagt ctatatctct actagagga agtaggagtagctac ctagaattac aagtctcctc tttctacccc ctcctctccc ccctctcctc tgcttatttc 1080 ataaccatct cctgtttcgc catttaaacg tacattcaaa gctctctcgg cgccgtctgc ccacacatca acaagcatca cgcctgcagc cgcctcta ggactgctcg cgcctgaaaa gcagatcaac aagagcagtt cagactggca ttctatccgg ccctattctc attccgacgg 1260 ttactctgcc accgaccgtg cccagaagga ataccagaac acctgaacct gctggaaggc 1320 accttttagt ccaccaactt tggaacgacg cagcctcttc tctcaaagct cagatcatag 1380 acgcagccag cgacatgcag tgcaatgtca tggatgtttt gtgggttacg ttcgtcccta 1440 cagagtcact ggcaggctac atgcatgtca tggtcccata tcgcccattc gaccaccgtc 1500 agcccagtac ttgctcgtgt caatctccgt cagtcgcgtg tgatcagaca ttccaactgg 1560 atctgggcca gccgggcact ctttgccttg tcctgtttga caggttcaat ttgctctgta 1620 tgccacttct gtccagtctg tttagtgagc cagactgctg agacactctg aaccgaggag 1680 caagcgcctc cacagccaag aagttgaaga agacggcaga cacccacaca gtgaccacga 1740 agctttgtca cgcagtattg atcccatcaa ccactagcaa atccctagac accccgaaag 1800 gacttcaaca gtgacctagc agcaaagccg tgagtctcgg acggcctctt gttcaactca 1860 accgaccttc caagctacaa aaacgacaag gttggatgtc tgccgtttgc tgcctcgcca 1920 ccagctgact ttaggcaaaa caggtcattg aatccagatc ggagtcgaca ctcgcatccg 1980 tgcggccgcg aattcatctt gaagttccta ttccgagttc ctattctcta gaaagtatag 2040 gaacttccga atgtaggatt gttatccgaa ctctgctcgt agaggcatgt tgtgaatctg 2100 tgtcgggcag gacacgcctc gaaggttcac ggcaagggaa accaccgata gcagtgcta 2160 gtagcaacct gtaaagccgc aatgcagcat cactggaaaa tacaaaccaa tggctaaaag 2220 tacataagtt aatgcctaaa gaagtcatat accagcggct aataattgta caatcaagtg 2280 gctaaacgta ccgtaatttg ccaacggctt gtggggttgc agaagcaacg gcaaagcccc 2340 acttccccac gtttgtttct tcactcagtc caatctcagc tggtgatccc ccaattgggt 2400 cgcttgtttg ttccggtgaa gtgaaagaag acagaggtaa gaatgtctga ctcggagcgt 2460 tttgcataca accaagggca gtgatggaag acagtgaaat gttgacattc aaggagtatt 2520 tagccaggga tgcttgagtg tatcgtgtaa ggaggtttgt ctgccgatac gacgaatact 2580 gtatagtcac ttctgatgaa gtggtccata ttgaaatgta agtcggcact gaacaggcaa 2640 aagattgagt tgaaactgcc taagatctcg ggccctcggg ccttcggcct ttgggtgtac 2700 atgtttgtgc tccgggcaaa tgcaaagtgt ggtaggatcg aacacactgc tgcctttacc 2760 aagcagctga gggtatgtga taggcaaatg ttcaggggcc actgcatggt ttcgaataga 2820 aagagaagct tagccaagaa caatagccga taaagatagc ctcattaaac ggaatgagct 2880 agtaggcaaa gtcagcgaat gtgtatatat aaaggttcga ggtccgtgcc tccctcatgc 2940 tctccccatc tactcatcaa ctcagatcct ccaggagact tgtacaccat cttttgaggc 3000 acagaaaccc aatagtcaac cgcggactgc gcaccatgaa gcttcttccc tccttgattg 3060 gcctggccag tctggcgtcc ctcgccgtcg cccggatccc cggctttgac atttcgggct 3120 ggcaaccgac caccgacttt gcaagggcgt atgctaatgg agatcgtttc gtctacatca 3180 aggtacgttc aaccttgcca ccaagttgcg aacccgagac aagactgtga ccgcctcctt 3240 tgccctgggg cagctcacgc acccagcagc atcccatccc ccggcccccc acgtaccacc 3300 ggaaagctaa catcaacccc ctaccactgc taccaggcca ccgagggcac cacattcaag 3360 agctccgcat tcagccgcca gtacaccggc gcaacgcaaa acggcttcat ccgcggcgcc 3420 taccacttcg cccagcccgc cgcgtcctcg ggcgccgcgc aggcgagata cttcgccagc 3480 aacggcggcg gctggtccaa ggacggcatc accctgcccg gggcgctgga catcgagtac 3540 aaccccaacg gcgccacctg ctacggcctc tcgcaatcgg ccatggtgaa ctggatcgag 3600 gactttgtca ccacctacca cggcatcacc tcccgctggc ccgtcatcta caccaccacc 3660 gactggtgga cccagtgcac cggcaactcc aaccgcttcg cgaaccgctg cccgctgtgg 3720 atcgcccgct acgccagctc cgtcggcact ctgcccaatg gctggggctt ttacaccttc 3780 tggcagtaca acgacaagta tcctcagggc ggtgattcga actggttcaa cggcgatgcg 3840 tcgcgtctca gggctctcgc taacggagac taataagctc cgtggcgaaa gcctgacgca 3900 ccggtagatt cttggtgagc ccgtatcatg acggcggcgg gagctacatg gccccgggtg 3960 atttattttt tttgtatcta cttctgaccc ttttcaaata tacggtcaac tcatctttca 4020 ctggagatgc ggcctgcttg gtattgcgat gttgtcagct tggcaaattg tggctttcga 4080 aaacacaaaaa cgattcctta gtagccatgc atcaagcttg gtaccgagct ctggaaacgc aaccctgag ggattcttcc tttgagagat ggagcgtgt catatctctt cggttctacg gcaggttttt ttctgctctt tcgtagcatg gcatggtcac ttcagcgctt atttacagtt 4260 gctggtattg atttcttgtg caaattgcta tctgacactt attagctatg gagtcaccac atttcccagc aacttcccca cttcctctgc aatcgccaac gtcctctctt cactgagtct 4380 ccgtccgata acctgcactg caaccggtgc cccatgatac gcctccggat catactcttc ctgcacgagg gcatcaagct cactaaccgc cttgaaactc tcattcttct tatcgatgtt cttatccgca aaggtaaccg gaacaaccac gctcgtgaaa tccagcaggt tgatcacaga ggcataccca tagtaccgga actggtcatg ccgtaccgca gcggtaggcg taatcggcgc 4620 gatgatggcg tccagttcct tcccggcctt ttcttcagcc tcccgccatt tctcaaggta 4680. ctccatctgg taattccact tctggagatg cgtgtcccag agctcgttca tgttaacagc 4740 tttgatgttc gggttcagta ggtctttgat atttggagtc gccggctcgc cggatgcact 4800 gatatcgcgc attacgtcgg cgctgccgtc agccgcgtag atatgggaga tgagatcgtg 4860 gccgaaatcg tgcttgtatg gcgtccacgg ggtcacggtg tgaccggctt tggcgagtgc 4920 ggcgacggtg gtttccacgc cgcgcaggat aggagggtgt ggaaggacat tgccgtcgaa 4980. gttgtagtag ccgatattga gcccgccgtt cttgatcttg end tgtccgactc ggactggcgc cagggcatgg ggatgacctt ggagtcgtat ttccaaggct cctgaccgag 5100 gacggatttg gtgaagaggc ggaggtctaa catacttcat cagtgactgc cggtctcgta tatagtata aaagcaagaa aggaggacag tggaggcctg gtatagagca ggaaaagaag gaagaggcga aggactcacc ctcaacagag tgcgtaatcg gcccgacaac gctgtgcacc 5280. gtctcctgac cctccatgct gttcgccatc tttgcatacg gcagccgccc atgactcggc 5340 cttagaccgt acaggaagtt gaacgcggcc ggcactcga tcgagccacc gatatccgtt cctacaccga tgacgccacc acgaatccca acgatcgcac cctcaccacc agaactgccg ccgcacgacc agttcttgtt gcgtgggttg acggtgcgcc cgatgatgtt gttgactgtc 5520 tcgcagacca tcagggtctg cgggacagag gtcttgacgt agaagacggc accggctttg 5580 cggagcatgg ttgtcagaac cgagtcccct tcgtcgtact tgtttagcca tgagatgtag 5640 cccattgatg tttcgtagcc ctggtggcat atgttagctg acaaaaaggg acatctaacg 5700 acttaggggc aacggtgtac cttgactcga agctggtctt tgagagagat ggggaggcca 5760 tgaagtggac caacgggtct cttgtgcttt gcgtagtatt catcgagttc ccttgcctgc 5820 gcgagagcgg cgtcagggaa gaactcgtgg gcgcagtttg tctgcacaga agccagcgtc 5880 agcttgatag tcccataagg tggcgttgtt acatctccct gagaggtaga ggggacccta 5940 ctaactgctg ggcgattgct gccgtttac agaatgctag cgtaacttcc accgaggtca 6000 actctccggc cgccagcttg gacacaagat ctgcagcgga ggcctctgtg atcttcagtt 6060 cggcctctga aaggatcccc gatttctttg ggaaatcaat aacgctgtct tccgcaggca 6120 gcgtctggac tttccattca tcagggatgg ttttgcgag gcgggcgcgc ttatcagcgg 6180 ccagttcttc ccaggattga ggcattctgt gttagcttat agtcaggatg ttggctcgac 6240 gagtgttaac tgggagttgg catgagggtt atgtaggctt ctttagcccc gcatccccct 6300 cattctcctc attgatcccg ggggagcgga tggtgttgat aagagactaa ttatagggtt 6360 tagctggtgc ctagctggtg attggctggc ttcgccgaat tttacgggcc aaggaaagct 6420 6480 attacgtgta ttgctgataa acaccaacag agctttactg aaagatggga gtcacggtgt 6540 ggcttcccca ctgcgattat tgcacaagca gcgagggcga acttgactgt cgtcgctgag 6600 6660 gacgctccct agcaacacct gccgtgtcag cctctacggt tgttacttgc attcaggatg 6720 ctctccagcg ggcgagctat tcaaaatatt caaagcaggt atctcgtatt gccaggattc 6780 agctgaagca acaggtgcca aggaaatctg cgtcggttct catctgggct tgctcggtcc 6840 tggcgtagac aagggcgaat tctgcattga agttcctatt ccgagttcct attcttcaaa 6900 tagtagga acttcaacta gctagtgcat gcggttgaag ggcttgtgtt ctttggctct 6960 gtagaggctc tagggggttg gattgggctg actatggtct cccctttgta tgctacacac 7020 tgatcagacg atcgtagtca gttgagagat gagcttcatt ggtcgatatg agtgctttga 7080 gactggacac ttgcgtgact gcatgttccg tttcttgtga taattgccgt gaagatgtgt 7140 ctgctggtat gacgacaaag tagcatcagc agcaaagtat ggcgaggact actaggccca 7200 agatattgtc ggcttcgtca aagtgagaaa ttttagggtc tccattgatt acattcatcc 7260 gtttcagaag cacgatatag aggagtagca ccatcaggtc ggaaaggtcg tcaacagctt 7320 gaacaagtca tactaaggta tgttagtgtg gtcgtggttg tcggtatcag taggtatcat 7380 tggagtatgt gttatataca gattaatggg accaatgcat cacgcatcag gacatgccct 7440 ggcaatcctc cctcttacaa atcgcgatga ggcttgggtt tgggggtaat agtagcggtc 7500 gtaaaggtgg tggtgccagt agcgcacacg cagccctggc cggaaatgct ggtaatggga 7560 ggagatttgc aggtgggctc ggtggtaaag gaggcgtagg tgctggtggg ctcaaccgtg 7620 ggctcaacca gctcagcctt gaccaggacg gggatgatct ggcctgtgga caggctgaag 7680 gagcggtggt tgagcacggt gagaatggcg ccaatctcgc ccgagtggct ggtgatgcta 7740 atccaggtgt tgtcgtcgtg cgaaaagacg tcgtcaatcg cctccttgga acgggcgacc 7800 tggtgagcag gcgtctcgcc ctcgtcctct ttgccgcgcc acagcaggtc ctcctcggtg 7860 aagccagcct cgaactcaaa gttgggagcg taggcgtgaa tctgagactt ggtggagcgg 7920 cggtcgcagg tgtggatgct gatgctctcg cgaaacagct ccttgatgac gggtttgaag 7980 gggtgtgagc gaggtagctt ctggttggca aaggtgaatt gggccgtctg gaggcagcgc 8040 ttgagaggcg agctgtagta cgactcaaaa aaggggaggc cttcctgctc gaagcgcgac 8100 ttgaagtagg cgttggcctt ggtagtctgc tgaatgccgt tggggtcag ttcagggtca 8160 gcccaggtgg aagtgccgtt gccatcttgc tcggcccagt agcactatgg aagcgtaagt 8220 cagcagctgt ttgagcaacg aagaggagat ttgtcgaggc tcacattcca ggcgggagtg 8280 ccgtaaaagc tttcggcagt gttgtgccat ccctcgccgt ggcggcccat gaagagcacc 8340 ttgtaggtgc tcttgtcctc cttgcggcac tcgctgttga gcgactcgac gtagtgggcg 8400 aagcgctgcc actgggtctt cctgtggtga ggatcgaacc tggcatctgt ggggtaggtc 8460 ctgttgatga gaccaaagtt gaaggcggcc tgtgtcaagc aaagcgtgag tcggagtctc taaccagagc ggcacagatg ctggcaacac ctacatagtc gaagctgccg gggtcagtgc tcgggtcgtc ctggaggag aagcccgga ccgacgagta cttgatgtcg tcgcagtcgg agacgtgctt ccaggccacg gcgccgcgag cgagcgccag ggcgacggac agcagagg 8700 ccttcatctt ggcgataatg aggtgtag tgaagacgaa gaggaggcag aggctcagac 8760 tcgttggctg cgacggaga caggcgtcct agagagcaac gtcatgtcga tcccggggcg 8820. acgcagcgac ttatatgtct gaacctgtcc agctgctctc tcctgcatgc gacgttgaga cactcgcaac aggctggtga acaccaggat gtaaccagtc gacagggctg ggaggctgca cccgctgcgc cagatggagc ctgtcagtgc tgctctgggg cctctgtcag cacttg 8996 <210> 17 <211> 61 <212> DNA <213> The snowstorm <220> <223> Building oNJ587 <400> 17 gtaaaacgac ggccagtgaa ttcgagctcg tttaaacgtg ctggacctgc taaggaggaa 60 g 61 <210> 18 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ605 <400> 18 ctgggctgcc cgtgaagccg tttaaatgaa ctacctgtgg cattcatttt gctgg 55 <210> 19 <211> 53 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ606 <400> 19 gcactgtttc ttccttgaac tctcagatct gtggtttgtc cattgggttc tcg 53 <210> 20 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ607 <400> 20 gcgtgtactt cttgagccct gccagctacc tgtggcattc attttgctgg 50 <210> twenty one <211> 29 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ608 <400> twenty one ggtagctggc agggctcaag aagtacacg 29 <210> twenty two <211> 63 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ609 <400> twenty two ggaaacagct atgaccatga ttacgccaag cttgtttaaa ccactcgata tccacgcatg 60 cac 63 <210> twenty three <211> 31 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ610 <400> twenty three aggtagttca tttaaacggc ttcacgggca g 31 <210> twenty four <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ611 <400> twenty four gaacccaatg gacaaaccac agatctgaga gttcaaggaa gaaacagtgc 50 <210> 25 <211> 963 <212> DNA <213> Fusarium venenatum <220> <221> CDS <222> (1)..(960) <400> 25 atg gaa gaa ttg ata cac caa tcc atc gat ctg atg tcg att ttg aca 48 Met Glu Glu Leu Ile His Gln Ser Ile Asp Leu Met Ser Ile Leu Thr 1 5 10 15 cca gca caa tgg tgt cag act ttc ttc gcc ctt tct acg gcc atc gtc 96 Pro Ala Gln Trp Cys Gln Thr Phe Phe Ala Leu Ser Thr Ala Ile Val 20 25 30 ctt ggt atc caa gcc ctc cca caa gat gtt cgc agc gct ctc atg gac 144 Leu Gly Ile Gln Ala Leu Pro Gln Asp Val Arg Ser Ala Leu Met Asp 35 40 45 tac ggc gcc cga aga ccc aaa gat gcg aaa cac gga aag gag caa gaa 192 Tyr Gly Ala Arg Arg Pro Lys Asp Ala Lys His Gly Lys Glu Gln Glu 50 55 60 gaa aac gga cag aaa gct ctc gtg cct ctg agg tca ttt atg aag aat 240 Glu Asn Gly Gln Lys Ala Leu Val Pro Leu Arg Ser Phe Met Lys Asn 65 70 75 80 tta aca gag tac ggg caa gtg ccc cat tca tgg ttc ttg cac ttt tac 288 Leu Thr Glu Tyr Gly Gln Val Pro His Ser Trp Phe Leu His Phe Tyr 85 90 95 att gtt tcg gtg gcc ctg tcg ggt ttc tgg gcg tgg cag tat ctc act 336 Ile Val Ser Val Ala Leu Ser Gly Phe Trp Ala Trp Gln Tyr Leu Thr 100 105 110 caa ggt cat gta ctg aaa agc att gtg acg tgg cag aat cga gct gat 384 Gln Gly His Val Leu Lys Ser Ile Val Thr Trp Gln Asn Arg Ala Asp 115 120 125 gga ccg tcc atg agc ctg gag caa att ttc gtg gca tgg ttg ctc atg 432 Gly Pro Ser Met Ser Leu Glu Gln Ile Phe Val Ala Trp Leu Leu Met 130 135 140 gcg ttg cag ggt tcg aga agg ctt tac gag agt ttg ttt gtg ttc aag 480 Ala Leu Gln Gly Ser Arg Arg Leu Tyr Glu Ser Leu Phe Val Phe Lys 145 150 155 160 cca ggg tca tca cct atg tgg ttt att cat tgg gca ctt ggt ctt tcg 528 Pro Gly Ser Ser Pro Met Trp Phe Ile His Trp Ala Leu Gly Leu Ser 165 170 175 tac tac to gca atg agc ctt gct gtc tgg gtc gag ggt tcc agc gcc 576 Tyr Tyr Ile Ala Met Ser Leu Ala Val Trp Val Glu Gly Ser Ser Ala 180 185 190 att tta gca gcc tgg gat tct ccc tat caa cct ctc cgg gtt cca cga 624 Ile Leu Wing Wing Trp Asp Ser Pro Tyr Gln Pro Leu Arg Val Pro Arg 195 200 205 cgg cta cct tca gcc cta gcg tta tat ttc gtg gct tac ttc aag caa 672 Arg Leu Pro Ser Ala Leu Ala Leu Tyr Phe Val Ala Tyr Phe Lys Gln 210 215 220 aac caa tgt cac aga cac ttg gca agc ctc aag aag tat acc ctc cca 720 Asn Gln Cys His Arg Is Leu Ser Leu Lys Tyr Thr Leu Pro 225 230 235 240 agt gag gga tgg ttc aag tat ata atc ​​tgt cca cac tat act tta gaa Ser Glu Gly Trp Phe Lys Tyr Ile Ile Cys Pro His Tyr Thr Leu Glu 245 250 255 tgc ctt gtg tac ctt gcc att gc tg atc gct gca cca cac ggc caa 816 Cys Leu Val Tyr Leu Wing Wing Trp Wing Wing Pro His Gly Gln 260 265 270 atc ttc aac aaa agt atc ttg ggc gct gtc atg ttt gtg gct gtg aat 864 Ile Phe Asn Lys Ser Ile Leu Gly Ala Val Met Phe Val Ala Val Asn 275 280 285 ctc ggt gcc acg gca aag ggc acc aag gta tgg tat gag cag aaa ttc 912 Leu Gly Ala Thr Ala Lys Gly Thr Lys Val Trp Tyr Glu Gln Lys Phe 290 295 300 ggt gca aac aag gtc gct ggg cgg tgg ctc atg atc ccg cct gtc tac 960 Gly Ala Asn Lys Val Ala Gly Arg Trp Leu Met Ile Pro Pro Val Tyr 305 310 315 320 tag 963 <210> 26 <211> 320 <212> PRT <213> Fusarium venenatum <400> 26 Met Glu Glu Leu Ile His Gln Ser Ile Asp Leu Met Ser Ile Leu Thr 1 5 10 15 Pro Ala Gln Trp Cys Gln Thr Phe Phe Ala Leu Ser Thr Ala Ile Val 20 25 30 Leu Gly Ile Gln Ala Leu Pro Gln Asp Val Arg Ser Ala Leu Met Asp 35 40 45 Tyr Gly Ala Arg Arg Pro Lys Asp Ala Lys His Gly Lys Glu Gln Glu 50 55 60 Glu Asn Gly Gln Lys Ala Leu Val Pro Leu Arg Ser Phe Met Lys Asn 65 70 75 80 Leu Thr Glu Tyr Gly Gln Val Pro His Ser Trp Phe Leu His Phe Tyr 85 90 95 Ile Val Ser Val Ala Leu Ser Gly Phe Trp Ala Trp Gln Tyr Leu Thr 100 105 110 Gln Gly His Val Leu Lys Ser Ile Val Thr Trp Gln Asn Arg Ala Asp 115 120 125 Gly Pro Ser Met Ser Leu Glu Gln Ile Phe Val Ala Trp Leu Leu Met 130 135 140 Ala Leu Gln Gly Ser Arg Arg Leu Tyr Glu Ser Leu Phe Val Phe Lys 145 150 155 160 Pro Gly Ser Ser Pro Met Trp Phe Ile His Trp Ala Leu Gly Leu Ser 165 170 175 Tyr Tyr Ile Ala Met Ser Leu Ala Val Trp Val Glu Gly Ser Ser Ala 180 185 190 Ile Leu Ala Ala Trp Asp Ser Pro Tyr Gln Pro Leu Arg Val Pro Arg 195 200 205 Arg Leu Pro Ser Ala Leu Ala Leu Tyr Phe Val Ala Tyr Phe Lys Gln 210 215 220 Asn Gln Cys His Arg His Leu Ala Ser Leu Lys Lys Tyr Thr Leu Pro 225 230 235 240 Ser Glu Gly Trp Phe Lys Tyr Ile Ile Cys Pro His Tyr Thr Leu Glu 245 250 255 Cys Leu Val Tyr Leu Ala Ile Ala Trp Ile Ala Ala Pro His Gly Gln 260 265 270 Ile Phe Asn Lys Ser Ile Leu Gly Ala Val Met Phe Val Ala Val Asn 275 280 285 Leu Gly Ala Thr Ala Lys Gly Thr Lys Val Trp Tyr Glu Gln Lys Phe 290 295 300 Gly Ala Asn Lys Val Ala Gly Arg Trp Leu Met Ile Pro Pro Val Tyr 305 310 315 320 <210> 27 <211> 10371 <212> DNA <213> Artificial Sequence <220> <223> Plasmid pNJOC569 <400> 27 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcgtt taaacgtgct ggacctgcta aggaggagt tttttttggg acggaaaagc ctggtgaggc atgaagatgg 480 agagagtttt cggtgtgtga ggatttcgag tatcatgga aaagaagga ttcaagtttg 600. 600. 600. 600. 600. 600. 600. 600. 600 ttttgcaatt gagccttgga gatattacga aaatgagatg tgagatctcg aaatgttgag gaatattcat gcctggttac acctgccgtc gttgtcatgc cactcgggcg ggcaggagca 720 tccatgcttc gcctagcacc aaggattggc aaccgccaga tggatcatga cggcaggatt 780 ccttgaatcg gttctagacc tttttgtgca cgtgccttag ctataagcca acgacttgca aagcggaagg cagcacctgg gcatggctgg gaaagaagct tgaagcatgc gccttgctgt tgccttcgct tggttgatgt tatcggggca acttgcttga gacattggtc gcacttgccg 960 acctgtgaat aggcaagaca tatttcgtca gtagtaccta cccagcgtaa gggatttcac 1020 gaggaagaag gtgagtcatc gggttcaaat gctgtactac ctcttgatgg agttgcagat 1080 actatcacga gcttgtgtgc tactattctg ttggaattcg gtctcttata ccgtccactc 1140 ggttcagcac tgtacgaaca acgtcttcat gctgcaacac tggtccatac atcctttgca 1200 tccgtcggtc aatcctgcat cgcctcatac caagtccctc ctcgtggaac caagccctct 1260 catcctcctt gtctcccagc tcttctcaag ccatcaaatc ccaactgcaa catggaactt 1320 gaagttgctg tgaagcaagc gccaatacga cgaatccacc gcccaatcaa aaccccacag 1380 cagtgcaacg ccacctcagc gtcaattaga ctacggattg gccgtcaagc cgtgtatcgt 1440 attgctggtt gccaagagcc tcagtcacaa gttcaaaaag caagcaaata cgcattctct 1500 ctccttccag tggcaatcca tgatttcatt gaagccatgt tctggtagta ggatctatgc 1560 gagctgcaga gaagtttctc cgcactccat atctgctgca atggccggca atcaagtaaa 1620 1680 cggcggctca gcatgcaggc gaccaaattt cgcacaattg tgcttctcct tggtaggggc 1740 atatcactcc acgcctggct ttggcagtgc aattcggcag ctttcaacca gcgcaacgaa 1800 tgtctgccct ttcatccctt cctgagtcat tttctcccat tcactttatc tggcccctca 1860 atctctaagg tcttgttctt gtggcctggc tgaaccttgc ctcgccgcat cacgccagcc 1920 gcttgaattc aaacttcat ttaaacggct tcacgggcag cccagcggtc gatttcgctt 1980 ccaaattttg gggaaaggg tccctgagca gcctcacaaa cgcaaacatg cgcacgcgcc 2040 acacggaaaa tgaagctgac tttgaattt taagaatccc ctttgcccgt ggcaccttct 2100 gatttttgtc ttcgtgtcca atccatctcc ttgaacgaca acccagccct ttctatttcc 2160 tatcccctaa tatctaatgt gagtcctcat cgtcacagac ggcgacggac gcgacatttc 2220 gcccgtgctc atcgaccgct ctgctgtcgc aacaagaaca cgcggttatg tcgcgttccg 2280 ctttgtcgta ccactttcgc cccacaccgc tgacctcgcg ttcccagcat gaaaaagcct 2340 gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag cgtctccgac 2400 ctgatgcagc tctcggaggg cgaagaatct cgtgctttca gcttcgatgt aggagggcgt 2460 ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct acaaagatcg ttatgtttat 2520 cggcactttg catcggccgc gctcccgatt ccggaagtgc ttgacattgg ggagttcagc 2580 gagagcctga cctattgcat ctcccgccgt gcacagggtg tcacgttgca agacctgcct 2640 gaaaccgaac tgcccgctgt tctgcagccg gtcgcggagg ccatggatgc gatcgctgcg 2700 gccgatctta gccagacgag cgggttcggc ccattcggac cgcaaggaat cggtcaatac 2760 actacatggc gtgatttcat atgcgcgatt gctgatcccc atgtgtatca ctggcaaact 2820 gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct gatgctttgg 2880 gccgaggact gccccgaagt ccggcacctc gtgcacgcgg atttcggctc caacaatgtc 2940 ctgacggaca atggccgcat aacagcggtc attgactgga gcgaggcgat gttcggggat 3000 tcccaatacg aggtcgccaa catcttcttc tggaggccgt ggttggcttg tatggagcag 3060 cagacgcgct acttcgagcg gaggcatccg gagcttgcag gatcgccgcg gctccgggcg 3120 tatatgctcc gcattggtct tgaccaactc tatcagagct tggttgacgg caatttcgat 3180 gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc cgggactgtc 3240 gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg tgtagagaga 3300 ctcgccgata gtggaaccg acgccccagc actcgtccga gggcaaggaa tagtaaatga 3360 ttcgttagtt ctttcctgaa ctgatgattc gcgcgattcg tattctctt tgttggttgt 3420 tctgatgatg atgaaatga cgcatctctt tatttgctgc actcgtacac ccatcctttg 3480 gaatgattaa tacccctcct ttttcatcgc ggacggtagt cgttctcttt ggggccgtgt 3540 ttcttcccat tcgcatgcga cctcgtggtc attgactgtc tgtcctcttc ctctccacct 3600 acctccacca cctacgttga ctgcatatca ctttttcaaa cattcatgat aatacgctac 3660 cttctggcat gaccttttga tgatcgcttt ttactatcct ttcaattacg atgttgtcac 3720 ttctatttgt cattttgcgg aattagtatt ttctttccat cttcgatgga gagatgaata 3780 ttgggtaccc caagggcgta gatccactag taacggccgc cagtgtgctg gaattcgccc 3840 ttggccgact actagatcga ccggtgactc tttctggcat gcggagagac ggacggacgc 3900 agagagaagg gctgagtaat aagcgccact gcgccagaca gctctggcgg ctctgaggtg 3960 cagtggatga ttattaatcc gggaccggcc gcccctccgc cccgaagtgg aaaggctggt 4020 gtgcccctcg ttgaccaaga atctattgca tcatcggaga atatggagct tcatcgaatc 4080 accggcagta agcgaaggag aatgtgaagc caggggtgta tagccgtcgg cgaaatagca 4140 tgccattaac ctaggtacag aagtccaatt gcttccgatc tggtaaaaga ttcacgagat 4200 agtaccttct ccgaagtagg tagagcgagt acccggcgcg taagctccct aattggccca 4260 tccggcatct gtagggcgtc caaatatcgt gcctctcctg ctttgcccgg tgtatgaaac 4320 cggaaaggcc gctcaggagc tggccagcgg cgcagaccgg gaacacaagc tggcagtcga 4380 cccatccggt gctctgcact cgacctgctg aggtccctca gtccctggta ggcagctttg 4440 ccccgtctgt ccgcccggtg tgtcggcggg gttgacaagg tcgttgcgtc agtccaacat 4500 ttgttgccat attttcctgc tctccccacc agctgtagat cgatcttggt ggcgtgaaac 4560 tcccgcacct cttcggccag cgccttgtag aagcgcgtat ggcttcgtac cccggccatc 4620 aacacgcgtc tgcgttcgac caggctgcgc gttctcgcgg ccatagcaac cgacgtacgg 4680 cgttgcgccc tcgccggcag caagaagcca cggaagtccg cccggagcag aaaatgccca 4740 cgctactgcg ggtttatata gacggtcccc acgggatggg gaaaaccacc accacgcaac 4800 tgctggtggc cctgggttcg cgcgacgata tcgtctacgt acccgagccg atgacttact 4860 ggcgggtgct gggggcttcc gagacaatcg cgaacatcta caccacacaa caccgcctcg 4920 accagggtga gatatcggcc ggggacgcgg cggtggtaat gacaagcgcc cagataacaa 4980 tgggcatgcc ttatgccgtg accgacgccg ttctggctcc tcatatcggg ggggaggctg 5040 ggagctcaca tgccccgccc ccggccctca ccctcatctt cgaccgccat cccatcgccg 5100 ccctcctgtg ctacccggcc gcgcggtacc ttatgggcag catgaccccc caggccgtgc 5160 tggcgttcgt ggccctcatc ccgccgacct tgcccggcac caacatcgtg cttggggccc 5220 ttccggagga cagacacatc gaccgcctgg ccaaacgcca gcgccccggc gagcggctgg 5280 acctggctat gctggctgcg attcgccgcg tttacgggct acttgccaat acggtgcggt 5340 atctgcagtg cggcgggtcg tggcgggagg actggggaca gctttcgggg acggccgtgc 5400 cgccccaggg tgccgagccc cagagcaacg cgggcccacg accccatatc ggggacacgt 5460 tatttaccct gtttcggggc cccgagttgc tggcccccaa cggcgacctg tataacgtgt 5520 ttgcctgggc cttggacgtc ttggccaaac gcctccgttc catgcacgtc tttatcctgg 5580 attacgacca atcgcccgcc ggctgccggg acgccctgct gcaacttacc tccgggatgg 5640 tccagaccca cgtcaccacc cccggctcca taccgacgat atgcgacctg gcgcgcacgt 5700 ttgcccggga gatgggggag gctaactgaa acacggaagg agacaatacc ggaaggaacc 5760 cgcgctatcc ggatcgatcc acttaacgtt actgaaatca tcaaacagct tgacgaatct 5820 ggatataaga tcgttggtgt cgatgtcagc tccggagttg agacaaatgg tgttcaggat 5880 ctcgataaga tacgttcatt tgtccaagca gcaaagagtg ccttctagtg atttaatagc 5940 tccatgtcaa acgcgtttcg ggtttacctc ttccagatac agctcatctg 6000 caatgcatta atgcattgga cctcgcaacc ctagtacgcc cttcaggctc cggcgaagca 6060 gaagatagc ttagcagagt ctattttcat tttcgggaga cgagatcaag cagatcaacg 6120 gtcgtcaaga gacctacgag actgaggaat ccgctcttgg ctccacgcga ctatatattt 6180 gtctctaatt gtactttgac atgctcctct tctttactct gatagcttga ctatgaaaat 6240 tccgtcacca gcccctgggt tcgcaaagat aattgcactg tttcttcctt gaactctcag 6300 atctcaaggg acggagcaat gtgccgattt tgggaccaca agagcggcgg ctcagcatgc 6360 aggcgaccaa atttcgcaca attgtgcttc tccttggtag gggcatatca ctccacgcct 6420 ggctttggca gtgcaattcg gcagctttca accagcgcaa cgaatgtctg ccctttcatc 6480 ccttcctgag tcattttctc ccattcactt tatctggccc ctcaatctct aaggtcttgt 6540 tcttgtggcc tggctgaacc ttgcctcgcc gcatcacgcc agccgcttga attcacaact 6600 aagctactga gcaattcggg aaaacgggtt agagcacgct ctcatcgctt gccgaagagg 6660 cctaatttgg ctccgacttt ggacacttgg aggacgtctc ggtatgtgag gctggtgcgg 6720 gtctgtctcg ggttccgacc gccagcaaac gcctcgggat ctcgaagcaa gggccagttc 6780 acaatggtgt cggcagatag atcaagatcc tcctcagcgt cggcgatgcc atgcagatag 6840 tccgtataga ggttggctgt ggtgatgaga agactacgag gttcttggag aatgcgccag 6900 gcaggctcgg gatcaagggc gccgtcctcc ttgctgcggt acaggttcag gcagagactc 6960 gcgccgaggc tgacggtgca caccacgggc caatacgcag cgccatccta gggtggatga 7020 gcatttcgaa gctgtcaagg attcttcaac tacgtttcca taacacttaa cttatgcggc 7080 atgatgccga ttcccggagg atactcgttg ataaggacgt gattcgggcg ctggtggggg 7140 ctttcggcga agatgtgctt gggagagtca ccgtcgtcgg agagcggaag ggacagtagc 7200 cgcggcacaa tgggggtctc aagccaagag ggcagcggtg cgtcgaggag cctgttgttg 7260 acgaggtccg acggccaggt ctggagccgt cgatgggtga gctgtttcca tcgtggacga 7320 ggagccgcgg cgatctgtga ggaaaaaaaa aagcgtgtgc tgtgatcagc agggctgcag 7380 gcggagacga ccggcaccat ggacggcacc ggccacggcg gcaagacgca ctttgtcaag 7440 aatcaggcgc tcctcttcct cgctgatgaa gtttggcaag tagtagccg tcgagggcag 7500. cgaggcgatt cgggcggctt cgagacga gggcagccac gcgtcgccgg tgcctcgagc 7560 tgccatgatt gaaggtatgt aggtaggtat ctatgcacgg ctcgggcagg caggcaggca ggcaggcaga cagacagaca gacagacagc tgcagtgagt tgcaggagga gagctgcctt gacagcgcca agagtgagcc caccagtgag cgagaaggca gcctggctcg gaatcagatg gggggtcgag agggcggacg gattgcgaga gaagaagcga tcaaatggtc gtaagagggg 7800. gatgatgggg tgatgatcca gcgaatggcc gtatcgagtt aggagggggg ctgcagcgcc 7860 tgtttgctct cgcagcagca cgacttgaac agcgaggtgc cggttagggc tagccgggca 7920. ttaatgcctt ttgtcctacc aaggttgcat ggcgcatgtg ctgcgcgagc tgttcggtcg 7980 gtggcctcgt tatcggcgtg cagcgtctgg tcggtccagc tgcttgttgc tcgaaagggg 8040 ggaggcgtcg tgtctctgcc gtctgcggga ggcggactgg gccaggcctg accgggtcat 8100 cgatggatgg attgaatgga ctggtttaaa caagcttggc gtaatcatgg tcatagctgt 8160 ttcctgtgtg aaattgttat ccgctcacaa ttccacacaa catacgagcc ggaagcataa 8220 agtgtaaagc ctggggtgcc taatgagtga gctaactcac attaattgcg ttgcgctcac 8280 tgcccgcttt ccagtcggga aacctgtcgt gccagctgca ttaatgaatc ggccaacgcg 8340 cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 8400 gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 8460 ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 8520 ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 8580 atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 8640 aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 8700 gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 8760 ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 8820 ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 8880 acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 8940 gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga aggacagtat 9000 ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 9060 ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 9120 gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 9180 ggaacgaaaa ctcacgttaa gggattttgg tcatgagatt atcaaaaagg atcttcacct 9240 agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 9300 ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 9360 gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 9420 catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 9480 cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 9540 cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 9600 gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 9660 tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 9720 gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 9780 tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 9840 gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 9900 gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 9960 taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 10020 tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 10080 ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 10140 taagggcgac acggaaatgt tgaatactca tactcttcct ttttcaatat tattgaagca 10200 tttatcaggg ttattgtctc atgagcggat acatatttga atgtatttag aaaaataaac 10260 aaataggggt tccgcgcaca tttccccgaa aagtgccacc tgacgtctaa gaaaccatta 10320 ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt c 10371 <210> 28 <211> 52 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ588 <400> 28 ctgggctgcc cgtgaagccg tttaaatgaa gttgtgaatt caagcggctg gc 52 <210> 29 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ595 <400> 29 cacaacttca tttaaacggc ttcacgggca g 31 <210> 30 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ596 <400> 30 cccaaaatcg gcacattgct ccgtcccttg agatctgaga gttcaaggaa gaaacagtgc 60 <210> 31 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ592 <400> 31 gcactgtttc ttccttgaac tctcagatct caagggacgg agcaatgtgc 50 <210> 32 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ593 <400> 32 cccgttttcc cgaattgctc agtagcttag ttgtgaattc aagcggctgg 50 <210> 33 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ589 <400> 33 cacaactaag ctactgagca attcgggaaa acgg 34 <210> 34 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ590 <400> 34 ggaaacagct atgaccatga ttacgccaag cttgtttaaa ccagtccatt caatccatcc 60 atcgatg 67 <210> 35 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Primer oNJ632 <400> 35 cagccaagaa gtgctcggct c 21 <210> 36 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Primer AgJg685 <400> 36 ctacatcgaa gctgaaagca cgaga 25 <210> 37 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Primer oNJ633 <400> 37 gatgtggtgc tgcagccagc 20 <210> 38 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Primer AgJg604 <400> 38 gggacgccct gctgcaactt acc 23 <210> 39 <211> 10679 <212> DNA <213> Artificial sequence <220> <223> pTmmD-Tl_lipase: Thermomyces lanuginosus HL703 lipase variant expression cassette flanked by FRT-F and FRT-F3 sites <400> 39 gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg 60 acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca 120 ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg tgtggaattg 180 tgagcggata acaatttcac acaggaaaca gctatgacca tgattacgaa ttgtttaaac 240 gcggccgcga attcatcttg aagttcctat tccgagttcc tattctctag aaagtatagg 300 aacttcgcta gccgagagca gccgaatgta ggattgttat ccgaactctg ctcgtagagg 360 catgttgtga atctgtgtcg ggcaggacac gcctcgaagg ttcacggcaa gggaaaccac 420 cgatagcagt gtctagtagc aacctgtaaa gccgcaatgc agcatcactg gaaaatacaa 480 accaatggct aaaagtacat aagttaatgc ctaaagaagt catataccag cggctaataa 540 ttgtacaatc aagtggctaa acgtaccgta atttgccaac ggcttgtggg gttgcagaag 600 caacggcaaa gccccacttc cccacgtttg tttcttcact cagtccaatc tcagctggtg 660 atcccccaat tggtcgctt gtttgttccg gtgaagtgaa agaagacaga ggtaagaatg 720 tctgactcgg agcgttttgc atacaaccaa gggcagtgat ggaagacagt gaaatgttga 780 cattcaagga gtatttagcc agggatgctt gagtgtatcg tgtaaggagg tttgtctgcc 840 gatacgacga atactgtata gtcacttctg atgaagtggt ccatattgaa atgtaagtcg 900 gcactgaaca ggcaaaagat tgagttgaaa ctgcctaaga tctcgggccc tcgggccttc 960 ggcctttggg tgtacatgtt tgtgctccgg gcaaatgcaa agtgtggtag gatcgaacac 1020 actgctgcct ttaccaagca gctgagggta tgtgataggc aaatgttcag gggccactgc 1080 atggtttcga atagaaagag aagcttagcc aagaacaata gccgataaag atagcctcat 1140 ttcgaggtcc 1200 gtgcctccct catgctctcc ccatctactc atcaactcag atcctccagg agacttgtac 1260 accatctttt gaggcacaga aacccaatag tcaaccgcgg actgcgcaca tgaagttctt 1320 caccaccatc ctcagcaccg ccagccttgt tgctgctctc cccgccgctg ttgactcgaa 1380 ccataccccg gccgctcctg aacttgttgc ccggagtcct attcgtcgag aggtctcgca 1440 ggatctgttt aaccagttca atctctttgc acagtattct gcagccgcat actgcggaaa 1500 aaacaatgat gccccagctg gtacaaacat tacgtgcacg ggaaatgcct gccccgaggt 1560 agaaggcg gatgcaacgt ttctctactc gtttgaagac tctggagtgg gcgatgtcac 1620 cggcttcctt gctctcgaca acacgaacaa attgatcgtc ctctctttcc gtggctctcg 1680 ttccatagag aactggatcg ggaatcttaa cttcgacttg aaagaaataa atgacatttg 1740 ctccggctgc aggggcatg acggcttcac ttcgtcctgg aggtctgtag ccgatacgtt 1800 aaggcagaag gtggaggatg ctgtgaggga gcatcccgac tatcgcgtgg tgtttaccgg 1860 acatagcttg ggtggtgcat tggcaactgt tgccggagca gacctgcgtg gaaatgggta 1920 tgatatcgac gtgttttcat atggcgcccc ccgagtcgga aacagggctt ttgcagaatt 1980 cctgaccgta cagaccggcg gaacactcta ccgcattacc cacaccaatg atattgtccc 2040 tagactcccg ccgcgcgaat tcggttacag ccattctagc ccagaatact ggatcaaatc 2100 tggaaccctt gtccccgtcc ggcgacgaga catcgtgaag atagaaggca tcgatgccac 2160 cggcggcaat aaccagccta acattccgga tatccctgcg cacctatggt acttcgggtt 2220 aattgggaca tgtctttagt aagctccgtg gcgaaagcct gacgcaccgg tagattcttg 2280 gtgagcccgt atcatgacgg cggcgggagc tacatggccc cgggtgattt attttttttg 2340 tatctacttc tgaccctttt caaatatacg gtcaactcat ctttcactgg agatgcggcc 2400 tgcttggtat tgcgatgttg tcagcttggc aaattgtggc tttcgaaaac acaaaacgat 2460 tccttagtag ccatgcatca agcttggtac cgagctctgg aaacgcaacc ctgaagggat 2520 tcttcctttg agagatggaa gcgtgtcata tctcttcggt tctacggcag gtttttttct 2580 gctctttcgt agcatggcat ggtcacttca gcgcttattt acagttgctg gtattgattt 2640 cttgtgcaaa ttgctatctg acacttatta gctatggagt caccacattt cccagcaact 2700 tccccacttc ctctgcaatc gccaacgtcc tctcttcact gagtctccgt ccgataacct 2760 gcactgcaac cggtgcccca tgatacgcct ccggatcata ctcttcctgc acgagggcat 2820 caagctcact aaccgccttg aaactctcat tcttcttatc gatgttctta tccgcaaagg 2880 taaccggaac aaccacgctc gtgaaatcca gcaggttgat cacagaggca tacccatagt 2940 accggaactg gtcatgccgt accgcagcgg taggcgtaat cggcgcgatg atggcgtcca 3000 gttccttccc ggccttttct tcagcctccc gccatttctc aaggtactcc atctggtaat 3060 tccacttctg gagatgcgtg tcccagagct cgttcatgtt aacagctttg atgttcgggt 3120 tcagtaggtc tttgatattt ggagtcgccg gctcgccgga tgcactgata tcgcgcatta 3180 3240. cgtcggcgct gccgtcagcc gcgtagatat gggagatgag atcgtggccg aaatcgtgct tgtatggcgt ccacggggtc acggtgtgac cggctttggc gagtgcggcg acggtggttt 3300 ccacgccgcg gggtgtgga ggacattgcc gtcgaagttg tagtagccga 3420. tattgagccc gccgttcttg atcttggagg caataatgtc cgactcggac tggcgccagg gcatggggat gaccttggag tcgtatttcc aaggctcctg accgaggacg gatttggtga 3480 agaggcggag gtctaacata cttcatcagt gactgccggt ctcgtatata gtataaaag caagaagga ggacagtgga ggcctggtat aagaagcaag aggcgaagga 3600. ctcaccctca acagagtgcg taatcggccc gacaacgctg tgcaccgtct cctgaccctc catgctgttc gccatctttg catacggcag ccgcccatga ctcggcctta gaccgtacag 3720 gaagttgaac gcggccggca ctcgaatcga gccaccgata tccgttccta caccgatgac gccaccacga atcccaacga tcgcaccctc accaccagaa ctgccgccgc acgaccagtt 3840 cttgttgcgt gggttgacgg tgcgcccgat gatgttgttg actgtctcgc agaccatcag 3900 ggtctgcggg acagaggtct tgacgtagaa gacggcaccg gctttgcgga gcatggttgt 3960 cagaaccgag tccccttcgt cgtacttgtt tagccatgag atgtagccca ttgatgtttc 4020 gtagccctgg tggcatatgt tagctgacaa aaagggacat ctaacgactt aggggcaacg 4080 gtgtaccttg actcgaagct ggtctttgag agagatgggg aggccatgaa gtggaccaac 4140 gggtctcttg tgctttgcgt agtattcatc gagttccctt gcctgcgcga gagcggcgtc 4200 agggaagaac tcgtgggcgc agtttgtctg cacagaagcc agcgtcagct tgatagtccc 4260 ataaggtggc gttgttacat ctccctgaga ggtagagggg accctactaa ctgctgggcg 4320 attgctgccc gtttacagaa tgctagcgta acttccaccg aggtcaactc tccggccgcc 4380 agcttggaca caagatctgc agcggaggcc tctgtgatct tcagttcggc ctctgaaagg 4440 atccccgatt tctttgggaa atcaataacg ctgtcttccg caggcagcgt ctggactttc 4500 cattcatcag ggatggtttt tgcgaggcgg gcgcgcttat cagcggccag ttcttcccag 4560 gattgaggca ttctgtgtta gcttatagtc aggatgttgg ctcgacgagt gtaaactggg 4620 agttggcatg agggttatgt aggcttcttt agccccgcat ccccctcatt ctcctcattg 4680 atcccggggg agcggatggt gttgataaga gactaattat agggtttagc tggtgcctag 4740 ctggtgattg gctggcttcg ccgaatttta cgggccaagg aaagctgcag aaccgcggca 4800 ctggtaaacg gtaattaagc tatcagcccc atgctaacga gtttaaatta cgtgtattgc 4860 tgataaacac caacagagct ttactgaaag atgggagtca cggtgtggct tccccactgc 4920 gattattgca caagcagcga gggcgaactt gactgtcgtc gctgagcagc ctgcagtcaa 4980 acatacatat atatcaaccg cgaagacgtc tggccttgta gaacacgacg ctccctagca 5040 acacctgccg tgtcagcctc tacggttgtt acttgcattc aggatgctct ccagcgggcg 5100 agctattcaa aatattcaaa gcaggtatct cgtattgcca ggattcagct gaagcaacag 5160 gtgccaagga aatctgcgtc ggttctcatc tgggcttgct cggtcctggc gtagacaagg 5220 gcgaattctg cattgaagtt cctattccga gttcctattc ttcaaatagt ataggaactt 5280 cagatatcca tcacactggg agtaccattt aattctattt gtgtttgatc gagacctaat 5340 acagccccta caacgaccat caaagtcgta tagctaccag tgaggaagtg gactcaaatc 5400 gacttcagca acatctcctg gataaacttt aagcctaaac tatacagaat aagatggtgg 5460 agagcttata ccgagctccc aaatctgtcc agatcatggt tgaccggtgc ctggatcttc 5520 ctatagaacc atccttattc gttgacctag ctgattctgg agtgacccag agggtcatga 5580 cttgagccta aaatccgccg cctccaccat ttgtagaaaa atgtgacgaa ctcgtgagct 5640 ctgtacagtg accggtgact ctttctggca tgcggagaga cggacggacg cagagagaag 5700 ggctgagtaa taagcgccac tgcgccagac agctctggcg gctctgaggt gcagtggatg 5760 attattaatc cgggaccggc cgcccctccg ccccgaagtg gaaaggctgg tgtgcccctc 5820 gttgaccaag aatctattgc atcatcggag aatatggagc ttcatcgaat caccggcagt 5880 aagcgaagga gaatgtgaag ccaggggtgt atagccgtcg gcgaaatagc atgccattaa 5940 cctaggtaca gaagtccaat tgcttccgat ctggtaaaag attcacgaga tagtaccttc 6000 tccgaagtag gtagagcgag tacccggcgc gtaagctccc taattggccc atccggcatc 6060 tgtagggcgt ccaaatatcg tgcctctcct gctttgcccg gtgtatgaaa ccggaaaggc 6120 cgctcaggag ctggccagcg gcgcagaccg ggaacacaag ctggcagtcg acccatccgg 6180 tgctctgcac tcgacctgct gaggtccctc agtccctggt aggcagcttt gccccgtctg 6240 tccgcccggt gtgtcggcgg ggttgacaag gtcgttgcgt cagtccaaca tttgttgcca 6300 tattttcctg ctctccccac cagctgctct tttcttttct ctttcttttc ccatcttcag 6360 tatattcatc ttcccatcca agaaccttta tttcccctaa gtaagtactt tgctacatcc 6420 atactccatc cttcccatcc cttatcctt tgaacctttc agttcgagct ttcccattc 6480 atcgcagctt gactaacagc taccccgctt gagcagacat caccatgccc cagttcgata 6540 tcctctgcaa gacccccccc aaggtcctcg tccgccagtt cgtcgagcgc ttcgagcgcc 6600 cctccggcga gaagatcgcc ctctgcgccg ccgagctcac ctacctctgc tggatgatca 6660 cccataacgg caccgccatc aagcgcgcca ccttcatgtc ctacaacacc atcatctcca 6720 actccctctc cttcgatatc gtcaacaagt ccctccagtt caagtacaag acccagaagg 6780 ccaccatcct ggaggcctcc ctcaagaagc tcatccccgc ctgggagttc accatcatcc 6840 cctactacgg ccagaagcat cagtccgata tcaccgatat cgtctcctcc ctccagctcc 6900 agttcgagtc ctccgaggag gccgataagg gcaactccca ttccaagaag atgctcaagg 6960 ccctcctctc cgagggcgag tccatctggg agatcaccga gaagatcctc aactccttcg 7020 agtacacctc ccgcttcacc aagaccaaga ccctctacca gttcctcttc ctcgccacct 7080 tcatcaactg cggccgcttc tccgatatca agaacgtcga tcccaagtcc ttcaagctcg 7140 tccagaacaa gtacctcggc gtcatcatcc agtgcctcgt caccgagacc aagacctccg 7200 tctcccgcca tatctacttc ttctccgccc gcggccgcat cgatcccctc gtctacctcg 7260 atgagttcct ccgcaactcc gagcccgtcc tcaagcgcgt caaccgcacc ggcaactcct 7320 cctccaacaa gcaggagtac cagctcctca aggataacct cgtccgctcc tacaacaagg 7380 ccctcaagaa gaacgccccc tactccatct tcgccatcaa gaacggcccc aagtcccata 7440 tcggccgcca tctcatgacc tccttcctct ccatgaaggg cctcaccgag ctcaccaacg 7500 tcgtcggcaa ctggtccgat aagcgcgcct ccgccgtcgc ccgcaccacc tacacccatc 7560 agatcaccgc catccccgat cattacttcg cactagtctc ccgctactac gcctacgatc 7620 ccatctccaa ggagatgatc gccctcaagg atgagaccaa ccccatcgag gagtggcagc 7680 atacgagca gctcaagggc tccgccgagg gctccatccg ctaccccgcc tggaacggca 7740 tcatctccca ggaggtcctc gattacctct cctcctacat caaccgccgc atccccaaga 7800 agaagcgcaa ggtctgagtc gagattatcc aagggaatga cttaatgagt atgtaagaca 7860 tgggtcataa cggcgttcga aacatataca gggttatgtt tgggaatagc acacgaataa 7920 taacgttaat aggtaccaaa gtccttgata cattagcacg gtagaaaaag aataatacaa 7980 cgagctggga atattcttta atataaaact ccaagaagag ctggtgcggt ggagcttgtt 8040 ttcgactctc agtaatatttt cctcatatcc aagcgcgcta ggaggtggtc gaatacacat 8100 gtaggcgctt ctctggatgc aaaagtcgtg ccggacctgc cgaaagactt tgaagatgcg 8160 ttcacgccat ctaagttgcg tagataattc acaaaaaggg atgtttgttt ccggaatgta 8220 gcaaagagct gataggcaat agcctcactt gcatgcatcc tagagtttaa acagcttggc 8280 actggccgtc gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg 8340 ccttgcagca catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg 8400 cccttcccaa cagttgcgca gcctgaacgg cgaatggcgc ctgatgcggt atttctcct 8460 tacgcatctg tgcggtattt cacaccgcat atggtgcact ctcagtacaa tctgctctga 8520 tgccgcatag ttaagccagc cccgacaccc gccaacaccc gctgacgcgc cctgacgggc 8580 ttgtctgctc ccggcatccg cttacagaca agctgtgacc gtctccggga gctgcatgtg 8640 tcagaggttt tcaccgtcat caccgaaacg cgcgagacga aagggcctcg tgatacgcct 8700 atttttatag gttaatgtca tgataataat ggtttcttag acgtcaggtg gcacttttcg 8760 gggaaatgtg cgcggaaccc ctatttgttt atttttctaa atacattcaa atatgtatcc 8820 gctcatgaga caataaccct gataaatgct tcaataatat tgaaaaagga agagtatgag 8880 tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc ttcctgtttt 8940 tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg gtgcacgagt 9000 gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc gccccgaaga 9060 acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat tatcccgtat 9120 tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg acttggttga 9180 gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag aattatgcag 9240 tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa cgatcggagg 9300 accgaaggag ctaaccgcttt tttgcacaa catgggggat catgtaactc gccttgatcg 9360 ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca cgatgcctgt 9420 agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc tagcttcccg 9480 gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc tgcgctcggc 9540 ccttccggct ggctggttta ttgctgataa atctggagcc tccaagggtg ggtctcgcgg 9600 tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta tctacacgac 9660 ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag gtgcctcact 9720 gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga ttgatttaaa 9780 acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc tcatgaccaa 9840 aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa agatcaaagg 9900 atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa aaaaaccacc 9960 gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc cgaaggtaac 10020 tggcttcagc agagcgcaga taccaaatac tgttcttcta gtgtagccgt agttaggcca 10080 ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc tgttaccagt 10140 ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac gatagttacc 10200 ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca gcttggagcg 10260 aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg ccacgcttcc 10320 cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag gagagcgcac 10380 gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt ttcgccacct 10440 ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat ggaaaaacgc 10500 cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc acatgttctt 10560 tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt gagctgatac 10620 cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag cggaagagc 10679 <210> 40 <211> 12973 <212> DNA <213> Artificial sequence <220> <223> Plasmid pSMai326, containing the Paenibacillus sp. xanthanase variant expression cassette flanked by FRT-F and FRT-F3 sites <400> 40 gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg 60 acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca 120 ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg tgtggaattg 180 tgagcggata acaatttcac acaggaaaca gctatgacca tgattacgaa ttgtttaaac 240 gcggccgcga attcatcttg aagttcctat tccgagttcc tattctctag aaagtatagg 300 aacttcgcta gccgagagca gccgaatgta ggattgttat ccgaactctg ctcgtagagg 360 catgttgtga atctgtgtcg ggcaggacac gcctcgaagg ttcacggcaa gggaaaccac 420 cgatagcagt gtctagtagc aacctgtaaa gccgcaatgc agcatcactg gaaaatacaa 480 accaatggct aaaagtacat aagttaatgc ctaaagaagt catataccag cggctaataa 540 ttgtacaatc aagtggctaa acgtaccgta atttgccaac ggcttgtggg gttgcagaag 600 caacggcaaa gccccacttc cccacgtttg tttcttcact cagtccaatc tcagctggtg 660 atcccccaat tggtcgctt gtttgttccg gtgaagtgaa agaagacaga ggtaagaatg 720 tctgactcgg agcgttttgc atacaaccaa gggcagtgat ggaagacagt gaaatgttga 780 cattcaagga gtatttagcc agggatgctt gagtgtatcg tgtaaggagg tttgtctgcc 840 gatacgacga atactgtata gtcacttctg atgaagtggt ccatattgaa atgtaagtcg 900 gcactgaaca ggcaaaagat tgagttgaaa ctgcctaaga tctcgggccc tcgggccttc 960 ggcctttgg tgtacatgtt tgtgctccgg gcaaatgcaa agtgtggtag gatcgaacac 1020 actgctgcct ttaccaagca gctgaggta tgtgataggc aaatgttcag gggccactgc 1080 atggtttcga atagaaagag aagcttagcc aagaacaata gccgataaag atagcctcat 1140 taaacggaat gagctagtag gcaaagtcag cgaatgtgta tatataaagg ttcgaggtcc 1200 gtgcctccct catgctctcc ccatctactc atcaactcag atcctccagg agacttgtac 1260 accatctttt gaggcacaga aacccaatag tcaaccgcgg actgcgcacc atgaagcttc 1320 ttccctcctt gattggcctg gccagtctgg cgtccctcgc cgtcgccatc gccggcgtcg 1380 tccagagcgt caacgtcagc caggccggct acagcagcaa cgacttcaag accgccaccg 1440 tcaccgccag cgacaagctc agcgacacca gctaccagat cctccagggc accaccgtca 1500 ttgccaccgg caccatgaag gacgagggct acgtctgggg caagtacgtc tacagcatcg 1560 acttctccag cgtcacggcc acgggcacca acttcaccat ccgcagcaac ggcgtcagca 1620 gctacacgtt ccccatccag accaacatgt ggaacgagta caaggacgag atgaccgcct 1680 tctaccgcct cctccgcacc accgacacct tcgccgccta tcctgccggc tactccaaca 1740 ttgcccctag caacaagatt ctgcaccccg actcgttcct cgacgacgcc ttctcgcccg 1800 accgcaccac gcactacgac ctcaccggcg gctggttcga tgccggcgac tacggcaagt 1860 atggcggcaa ccagtgggtc cagggcaaca ttgctatcag ctacctccgc cacgccagct 1920 ctgccgccgt caacttcgac areacacca acggcatccc cgacctggtc gacgaggcca 1980 tcttcggcag ccagtacctc gtcaagttcg cccagcagct tggcggcgct atccacaaca 2040 tcctccgcaa gggcggcttc gtcctgcctc acaaggtcac cgacaacgtc cccggcaaca 2100 ccgacgatcg cgccctcgag gctgtcgagg ccgtcggcgg caggggcaag agcagcggca 2160 gcctcgccgc caccgctcgc gccatccgca ccgctattgc tggcggcaag gtcgccgcca 2220 acaaggtggc ccagctgcag accctcgcca acgagttcca ggccgctgcc atcatcttct 2280 acaactacac cctcacgcac caggacggca accacggcag ctacggcacg atgaacaacg 2340 gcggcattgc taacccgctc ctctgggccg aggtccagct ctacctcctg accggcgacg 2400 ccgcctacaa gacgcaggcc cagacgcgca tcaacgccat caacgaggcc tacgtgagca 2460 gcaccaacta ctgggacatg caccccattg ctctcgccga gttctacccc gtcgccgaca 2520 gcgccatcaa gaccaagatc cagagcatcc tgaagcacca ggcctactac ttcatcaccc 2580 tcatggacga cacgccctac ggcgtcctca accagttcgg caacttcggc gtcaacgagc 2640 cccacgcctc ctacatggcc gacctgctcc gctactacga gctgttcaac gaccctgtcg 2700 ctctccgagc cgccaagaag gccctctact ggatcgtcgg caacaacccc tggaacatca 2760 gctgggtcag cggcgtcggc agcaacttta cccgcttcct gcacacccgc ctcgacgagg 2820 aggcctacag ccagacgaac acgggcgtcg tgctccctgg cgccatggtg agcggcccca 2880 acatcaagga ccccaacaac aagctgagca gcagcccctg gtacgaggac aagcccattt 2940 gggccgacga cacgaaccag tggcgctaca acgagtactc cgtcagcatc cagacgggcc 3000 tcttctacac catcatgggc ctcagcgccc tcggcggcaa cgcctccact ggcggcgctg 3060 agcccgtcaa gctccccatc acgtggccca tcatcggcga ctgggtcacg ggcgacgtca 3120 ccgtctttgc ccagcctgag ggcagcctct cgaacgtcag cgccaacggc accgtgctca 3180 gccccagcga cggcgtctac accaccacgg tcagcaccag cgccgacgct ccctacaccg 3240 agcgcaaggt ccagatcaag ggcaccgacg actcgggcaa caccacctac agcaacaccc 3300 acttcacggt cgcccctccg ctgcctgatc cttcgcaccc tctcctcttc gacgacttta 3360 accagaaggg catctggggc agccagaagc tcgattgggt caactggtac aaccagaacg 3420 gcggcaccgc cagctacacc cgcaccacgg tcgacggccg caccgtcggc aagttcgctc 3480 acacccctgc cgccaccacc agcaaggcca agtttcagcc ccgcaagtac aacgccaacc 3540 tcaacggcta ccgctacctc aacttcacga tgaagaaccc tggctacccc aacacgaaga 3600 tccgcattgc cgccaacgac ggcaccaagt ccgtcaacct cacctccggc gaggtcgcca 3660 tcagcagcac ctggaccacc taccagtacg acctgaacct ccatcctacg ctcaacaaga 3720 gcaacgtcct catcgaggtc tggctcagca accccacggc tggcgcctac ggcgagatcc 3780 tgatcgacga gatctctgcc gtcaacacca acagcggcac ggcccctacg ctctccgcca 3840 ccggcgtgaa cgccagcatt ggcaaccaga gcaccgtgtt cacctacacc gccacgtaca 3900 ccgacgccaa caaccaggct cctttcgacg tccaggtcgt cattgacggc gtcatccgct 3960 ccatgaccgc tgctgacccc acggacacga cctactccga cggcaaggtt tacacctacg 4020 ccacgaagct ccccgtcggc acccacaagt tctacttccg cacgacggac accacgacca 4080 acttcgtcag cacctccgtc cagactggcc ccacggtcat ccgcaaccga ctcgaggccg 4140 aggtgctcag catcaacctg acgaacggca cccatgccgt caaggacaac gccgacgcca 4200 gcggcggcaa gtaccgcctc ttcaacggcc gccaggccaa cgactacatt gagtacgccg 4260 tgaacgtccc caaggccggc acgtaccagg tcagcgcccg agccatgcgc ctctccgata 4320 acggcatcta tcagctccag attaacggct ccaaccaggg cacgcccttc gacacttacc 4380 agtcctcggg caagtatctc gactacgcccc tgggcaacgt caccatcacg agccccggca 4440 cgcagctgtt ccgcttcaag gtgaccggca agaacgcctc gagcctcggc tacaagctgc 4500 ccctggactt tatccagctc gtccccgtgc cttaaagctc cgtggcgaaa gcctgacgca 4560 ccggtagatt cttggtgagc ccgtatcatg acggcggcgg gagctacatg gccccgggtg 4620 atttattttt tttgtatcta cttctgaccc ttttcaaata tacggtcaac tcatctttca 4680 ctggagatgc ggcctgcttg gtattgcgat gttgtcagct tggcaaattg tggctttcga 4740 aaacacaaaa cgattcctta gtagccatgc atcaagcttg gtaccgagct ctggaaacgc 4800 aaccctgaag ggattcttcc tttgagagat ggaagcgtgt catatctctt cggttctacg 4860 gcaggttttt ttctgctctt tcgtagcatg gcatggtcac ttcagcgctt atttacagtt 4920 gctggtattg atttcttgtg caaattgcta tctgacactt attagctatg gagtcaccac 4980 atttcccagc aacttcccca cttcctctgc aatcgccaac gtcctctctt cactgagtct 5040 ccgtccgata acctgcactg caaccggtgc cccatgatac gcctccggat catactcttc 5100 ctgcacgagg gcatcaagct cactaaccgc cttgaaactc tcattcttct tatcgatgtt 5160 cttatccgca aaggtaaccg gaacaaccac gctcgtgaaa tccagcaggt tgatcacaga ggcataccca tagtaccgga actggtcatg ccgtaccgca gcggtaggcg taatcggcgc 5280 gatgatggcg tccagttcct tcccggcctt ttcttcagcc tcccgccatt tctcaaggta 5340 ctccatctgg taattccact tctggagatg cgtgtcccag agctcgttca tgttaacagc tttgatgttc gggttcagta ggtctttgat atttggagtc gccggctcgc cggatgcact 5460 gatatcgcgc attacgtcgg cgctgccgtc agccgcgtag atatgggaga tgagatcgtg 5520 gccgaaatcg tgcttgtatg gcgtccacgg ggtcacggtg tgaccggctt tggcgagtgc 5580 ggcgacggtg gtttccacgc cgcgcaggat aggagggtgt ggaaggacat tgccgtcgaa 5640. gttgtagtag ccgatattga gcccgccgtt cttgatcttg end tgtccgactc ggactggcgc cagggcatgg ggatgacctt ggagtcgtat ttccaaggct cctgaccgag 5760 gacggatttg gtgaagaggc ggaggtctaa catacttcat cagtgactgc cggtctcgta tatagtata aaagcaagaa aggaggacag tggaggcctg gtatagagca ggaaaagaag gaagaggcga aggactcacc ctcaacagag tgcgtaatcg gcccgacaac gctgtgcacc 5940 gtctcctgac cctccatgct gttcgccatc tttgcatacg gcagccgccc atgactcggc 6000 cttagaccgt acaggaagtt gaacgcggcc ggcactcgaa tcgagccacc gatatccgtt 6060 cctacaccga tgacgccacc acgaatccca acgatcgcac cctcaccacc agaactgccg 6120 ccgcacgacc agttcttgtt gcgtgggttg acggtgcgcc cgatgatgtt gttgactgtc 6180 tcgcagacca tcagggtctg cgggacagag gtcttgacgt agaagacggc accggctttg 6240 cggagcatgg ttgtcagaac cgagtcccct tcgtcgtact tgtttagcca tgagatgtag 6300 cccattgatg tttcgtagcc ctggtggcat atgttagctg acaaaaaggg acatctaacg 6360 acttaggggc aacggtgtac cttgactcga agctggtctt tgagagagat ggggaggcca 6420 tgaagtggac caacgggtct cttgtgcttt gcgtagtatt catcgagttc ccttgcctgc 6480 gcgagagcgg cgtcagggaa gaactcgtgg gcgcagtttg tctgcacaga agccagcgtc 6540 agcttgatag tcccataagg tggcgttgtt acatctccct gagaggtaga ggggacccta 6600 ctaactgctg ggcgattgct gcccgtttac agaatgctag cgtaacttcc accgaggtca 6660 actctccggc cgccagcttg gacaagat ctgcagcgga ggcctctgtg atcttcagtt 6720 cggcctctga areatcccc gatttctttg ggaaatcaat aacgctgtct tccgcaggca 6780 gcgtctggac tttccattca tcagggatgg tttttgcgag gcgggcgcgc ttatcagcgg 6840 ccagttcttc ccaggattga ggcattctgt gttagcttat agtcaggatg ttggctcgac 6900 gagtgttaac tgggagttgg catgagggtt atgtaggctt ctttagcccc gcatccccct 6960 cattctcctc attgatcccg ggggagcgga tggtgttgat aagagactaa ttatagggtt 7020 tagctggtgc ctagctggtg attggctggc ttcgccgaat tttacgggcc aaggaaagct 7080 gcagaaccgc ggcactggta aacggtaatt aagctatcag ccccatgcta acgagtttaa 7140 attacgtgta ttgctgataa acaccaacag agctttactg aaagatggga gtcacggtgt 7200 ggcttcccca ctgcgattat tgcacaagca gcgagggcga acttgactgt cgtcgctgag 7260 7320 gacgctccct agcaacacct gccgtgtcag cctctacggt tgttacttgc attcaggatg 7380 ctctccagcg ggcgagctat tcaaaatatt caaagcaggt atctcgtatt gccaggattc 7440 agctgaagca acaggtgcca aggaaatctg cgtcggttct catctgggct tgctcggtcc 7500 tggcgtagac aagggcgaat tctgcattga agttcctatt ccgagttcct attcttcaaa 7560 tagtatagga acttcagata tccatcacac tgggagtacc atttaattct atttgtgttt 7620 gatcgagacc taatacagcc cctacaacga ccatcaaagt cgtatagcta ccagtgagga 7680 agtggactca aatcgacttc agcaacatct cctggataaa ctttaagcct aaactataca 7740 gaataagatg gtggagagct tataccgagc tcccaaatct gtccagatca tggttgaccg 7800 gtgcctggat cttcctatag aaccatcctt attcgttgac ctagctgatt ctggagtgac 7860 ccagagggtc atgacttgag cctaaaatcc gccgcctcca ccatttgtag aaaaatgtga 7920 cgaactcgtg agctctgtac agtgaccggt gactctttct ggcatgcgga gagacggacg 7980 gacgcagaga gaagggctga gtaataagcg ccactgcgcc agacagctct ggcggctctg 8040 aggtgcagtg gatgattatt aatccggggac cggccgcccc tccgccccga agtggaaagg ctggtgtgcc cctcgttgac cagaatcta ttgcatcatc ggagaattg gagcttcatc 8220. gaatcaccgg cagtaagcga aggagaatgt gaagccaggg gtgtatagcc gtcggcgaaa tagcatgcca ttaacctagg tagcagaagtc caattgcttc cgatctggta aaagattcac gagatagtac cttctccgaa gtaggtagag cgagtacccg gcgcgtaagc tccctaattg gcccatccgg catctgtagg gcgtccaaat atcgtgcctc tcctgctttg cccggtgtat 8400 gaaccgga aggccgctca ggagctggcc agcggcgcag accggggaca caagctggca gtcgacccat ccggtgctct gcactcgacc tgctgaggtc cctcagtccc tggtaggcag 8520 ctttgccccg tctgtccgcc cggtgtgtcg gcggggttga caaggtcgtt gcgtcagtcc 8580 aacatttgtt gccatatttt cctgctctcc ccaccagctg ctcttttctt ttctctttct 8640 tttcccatct tcagtatatt catcttccca tccaagaacc tttatttccc ctaagtaagt 8760. actttgctac atccatactc catccttccc atcccttatt cctttgaacc tttcagttcg agctttccca cttcatcgca gcttgactaa cagctacccc gcttgagcag acatcaccat 8820 gccccagttc gatatcctct gcaagacccc ccccaaggtc ctcgtccgcc agttcgtcga 8880 gcgcttcgag cgcccctccg gcgagaagat cgccctctgc gccgccgagc tcacctacct 8940 ctgctggatg atcacccata acggcaccgc catcaagcgc gccaccttca tgtcctacaa 9000 caccatcatc tccaactccc tctccttcga tatcgtcaac aagtccctcc agttcaagta 9060 caagacccag aaggccacca tcctggaggc ctccctcaag aagctcatcc ccgcctggga 9120 gttcaccatc atcccctact acggccagaa gcatcagtcc gatatcaccg atatcgtctc 9180 ctccctccag ctccagttcg agtcctccga ggaggccgat aagggcaact cccattccaa 9240 gaagatgctc aaggccctcc tctccgaggg cgagtccatc tgggagatca ccgagaagat 9300 cctcaactcc ttcgagtaca cctcccgctt caccaagacc aagaccctct accagttcct 9360 cttcctcgcc accttcatca actgcggccg cttctccgat atcaagaacg tcgatcccaa 9420 gtccttcaag ctcgtccaga acaagtacct cggcgtcatc atccagtgcc tcgtcaccga 9480 gaccaagacc tccgtctccc gccatatcta cttcttctcc gcccgcggcc gcatcgatcc 9540 cctcgtctac ctcgatgagt tcctccgcaa ctccgagccc gtcctcaagc gcgtcaaccg 9600 caccggcaac tcctcctcca acaagcagga gtaccagctc ctcaaggata acctcgtccg 9660 ctcctacaac aaggccctca agaagaacgc cccctactcc atcttcgcca tcaagaacgg 9720 ccccaagtcc catatcggcc gccatctcat gacctccttc ctctccatga agggcctcac 9780 cgagctcacc aacgtcgtcg gcaactggtc cgataagcgc gcctccgccg tcgcccgcac 9840 cacctacacc catcagatca ccgccatccc cgatcattac ttcgcactag tctcccgcta 9900 ctacgcctac gatcccatct ccaaggagat gatcgccctc aaggatgaga ccaaccccat 9960 cgaggagtgg cagcatatcg agcagctcaa gggctccgcc gagggctcca tccgctaccc 10020 cgcctggaac ggcatcatct cccaggaggt cctcgattac ctctcctcct acatcaaccg 10080 ccgcatcccc aagaagaagc gcaaggtctg agtcgagatt atccaaggga atgacttaat 10140 gagtatgtaa gacatgggtc ataacggcgt tcgaaacata tacagggtta tgtttgggaa 10200 tagcacacga fathercgt fathercgt caaagtcctt fathercattag father aaagaat acaacgagct gggaatattc tttaatata aactccaaga agagctggtg 10380. cggtggagct tgttttcgac tctcagtaat atttcctcat atccaagcgc gctaggaggt ggtcgaatac acatgtaggc gcttctctgg atgcaaaagt cgtgccggac ctgccgaaag actttgaaga tgcgttcacg ccatctaagt tgcgtagata attcacaaaa agggatgttt gtttccggaa tgtagcaaag agctgatagg caatagcctc acttgcatgc atcctaggt ttaaacagct tggcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga acggcgaatg gcgcctgatg 10740 cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatggtg cactctcagt 10800 acaatctgct ctgatgccgc atagttaagc cagccccgac acccgccaac acccgctgac gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag acgaaagggc 10980 ctcgtgatac gcctattttt ataggttaat gtcatgataa taatggtttc ttagacgtca 11040 ggtggcactt ttcgggggaaa tgtgcgcgga acccctattt gtttatttt ctaaatacat 11100 tcaaatatgt atccgctcat gagaataa ccctgataaa tgcttcaata atattgaaaa 11160 around tgagtattca acatttccgt gtcgccctta ttcccttttt tgcggcattt 11220 tgccttcctg tttttgctca cccagaaacg ctggtgaaag taaaagatgc tgaagatcag 11280 ttgggtgcac gagtgggtta catcgaactg gatctcaaca gcggtaagat ccttgagagt 11340 tttcgccccg aagaacgttt tccaatgatg agcactttta aagttctgct atgtggcgcg 11400 gtattatccc gtattgacgc cgggcaagag caactcggtc gccgcataca ctattctcag 11460 aatgacttgg ttgagtactc accagtcaca gaaaagcatc ttacggatgg catgacagta 11520 agagaattat gcagtgctgc cataaccatg agtgataaca ctgcggccaa cttactcttctg 11580 acaacgatcg gaggaccgaa ggagctaacc gcttttttgc acaacatggg ggatcatgta 11640 actcgccttg atcgttggga accggagctg aatgaagcca taccaaacga cgagcgtgac 11700 accacgatgc ctgtagcaat ggcaacaacg ttgcgcaaac tattaactgg cgaactactt 11760 actctagctt cccggcaaca attaatagac tggatggagg cggataaagt tgcaggacca 11820 cttctgcgct cggcccttcc ggctggctgg tttattgctg ataaatctgg agcctccaag 11880 ggtgggtctc gcggtatcat tgcagcactg gggccagatg gtaagccctc ccgtatcgta 11940 gttatctaca cgacggggag tcaggcaact atggatgaac gaaatagaca gatcgctgag 12000 ataggtgcct cactgattaa gcattggtaa ctgtcagacc aagtttactc atatatactt 12060 tagattgatt taaaacttca ttttaattt aaaaggatct aggtgaagat cctttttgat 12120 aatctcatga ccaaaatccc ttaacgtgag ttttcgttcc actgagcgtc agaccccgta 12180 gaaaagatca aggatcttc ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa 12240 acaaaaaaac caccgctacc agcggtggtt tgtttgccgg atcaagagct accaactctt 12300 tttccgaagg taactggctt cagcagagcg cagataccaa atactgttct tctagtgtag 12360 ccgtagttag gccaccactt caagaactct gtagcaccgc ctacatacct cgctctgcta 12420 atcctgttac cagtggctgc tgccagtggc gataagtcgt gtcttaccgg gttggactca 12480 agacgatagt taccggataa ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag 12540 cccagcttgg agcgaacgac ctacaccgaa ctgagatacc tacagcgtga gctatgagaa 12600 agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga 12660 acaggagagc gcacgaggga gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc 12720 gggttcgcc acctctgact tgagcgtcga ttttgtgat gctcgtcagg ggggcggagc 12780 ctatggaaaa acgccagcaa cgcggccttt ttacggttcc tggccttttg ctggcctttt 12840 gctcacatgt tctttcctgc gttatcccct gattctgtgg ataaccgtat taccgccttt 12900 gagtgagctg ataccgctcg ccgcagccga acgaccgagc gcagcgagtc agtgagcgag 12960 gaagcggaag agc 12973 <210> 41 <211> 10427 <212> DNA <213> Artificial sequence <220> <223> Plasmid pTmmD-Mf_lysozyme, containing the Myceliophthora fergusi lysozyme expression cassette flanked by FRT-F and FRT-F3 sites <400> 41 gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg 60 acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca 120 ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg tgtggaattg 180 tgagcggata acaatttcac acaggaaaca gctatgacca tgattacgaa ttgtttaaac 240 gcggccgcga attcatcttg aagttcctat tccgagttcc tattctctag aaagtatagg 300 aacttcgcta gccgagagca gccgaatgta ggattgttat ccgaactctg ctcgtagagg 360 catgttgtga atctgtgtcg ggcaggacac gcctcgaagg ttcacggcaa gggaaaccac 420 cgatagcagt gtctagtagc aacctgtaaa gccgcaatgc agcatcactg gaaaatacaa 480 accaatggct aaaagtacat aagttaatgc ctaaagaagt catataccag cggctaataa 540 ttgtacaatc aagtggctaa acgtaccgta atttgccaac ggcttgtggg gttgcagaag 600 caacggcaaa gccccacttc cccacgtttg tttcttcact cagtccaatc tcagctggtg 660 atcccccaat tggtcgctt gtttgttccg gtgaagtgaa agaagacaga ggtaagaatg 720 tctgactcgg agcgttttgc atacaaccaa gggcagtgat ggaagacagt gaaatgttga 780 cattcaagga gtatttagcc agggatgctt gagtgtatcg tgtaaggagg tttgtctgcc 840 gatacgacga atactgtata gtcacttctg atgaagtggt ccatattgaa atgtaagtcg 900 gcactgaaca ggcaaaagat tgagttgaaa ctgcctaaga tctcgggccc tcgggccttc 960 ggcctttggg tgtacatgtt tgtgctccgg gcaaatgcaa agtgtggtag gatcgaacac 1020 actgctgcct ttaccaagca gctgagggta tgtgataggc aaatgttcag gggccactgc 1080 atggttcga atagaaagag aagcttagcc aagaacaata gccgataaag atagcctcat 1140 taaacggaat gagctagtag gcaaagtcag cgaatgtgta tatataaagg ttcgaggtcc 1200 gtgcctccct catgctctcc ccatctactc atcaactcag atcctccagg agacttgtac 1260 accatctttt gaggcacaga aacccaatag tcaaccgcgg actgcgcaca tgaaggctgc 1320 cctcctcgct acggtgtcgg ctcttgctgc tggcgttcaa gccgctgtcc agggtttcga 1380 catcagccac tggcagtctt ctgtcgactt caaggctgcg tacaactctg gcgctcgctt 1440 cgtgatcatc aaggctaccg aaagaacctc gttcatcgat cccaagttct cgagccatta 1500 cactggtgct accaatgctg gcttcattcg tggtgcctat catttcgccc atcccggtca 1560 aagctctgga gaagcgcaag ccgactactt cctcgcgcat ggcggtggct ggactccgga 1620 cggcatcacc cttcctggca tgttggacct ggaggcctac aatgcgggtg aatgctgggg 1680 tctcagccag agcgcgatgg tggcctggat caaggccttc tccgatcgct atcatgcgcg 1740 tacgggagtc tacccgatgc tgtacaccaa cctctcgtgg tggagaacgt gcacgggcaa 1800 ctctaaggcc ttcgtgaaca ccaatccctt ggtcctggct cgatgggctt ccagccctgg 1860 cgagattcct ggcggatggc catggcagac catttggcag aactccgaca gctatcgcta 1920 tggcggtgac tcggacatct tcaacggcga catgaaccag cttcgccgac tcgctacggc 1980 tgcttaataa gctccgtggc gaaagcctga cgcaccggta gattcttggt gagcccgtat 2040 catgacggcg gcgggagcta catggccccg ggtgatttat tttttttgta tctacttctg 2100 acccttttca aatatacggt caactcatct ttcactggag atgcggcctg cttggtattg 2160 cgatgttgtc agcttggcaa attgtggctt tcgaaaacac aaaacgattc cttagtagcc 2220 atgcatcaag cttggtaccg agctctggaa acgcaaccct gaagggattc ttcctttgag 2280 agatggaagc gtgtcatatc tcttcggttc tacggcaggt ttttttctgc tctttcgtag 2340 catggcatgg tcacttcagc gcttatttac agttgctggt attgatttct tgtgcaaatt 2400 gctatctgac acttattagc tatggagtca ccacatttcc cagcaacttc cccacttcct 2460 ctgcaatcgc caacgtcctc tcttcactga gtctccgtcc gataacctgc actgcaaccg 2520 gtgccccatg atacgcctcc ggatcatact cttcctgcac gagggcatca agctcactaa 2580 ccgccttgaa actctcattc ttcttatcga tgttcttatc cgcaaaggta accggaacaa 2640 ccacgctcgt gaaatccagc aggttgatca cagaggcata cccatagtac cggaactggt 2700 catgccgtac cgcagcggta ggcgtaatcg gcgcgatgat ggcgtccagt tccttcccgg 2760 ccttttcttc agcctcccgc catttctcaa ggtactccat ctggtaattc cacttctgga 2820 gatgcgtgtc ccagagctcg ttcatgttaa cagctttgat gttcgggttc agtaggtctt 2880 tgatatttgg agtcgccggc tcgccggatg cactgatatc gcgcattacg tcggcgctgc 2940 cgtcagccgc gtagatatgg gagatgagat cgtggccgaa atcgtgcttg tatggcgtcc 3000 acggggtcac ggtgtgaccg gctttggcga gtgcggcgac ggtggtttcc acgccgcgca 3060 ggataggagg gtgtggaagg acattgccgt cgaagttgta gtagccgata ttgagcccgc 3120 cgttcttgat cttggaggca ataatgtccg actcggactg gcgccagggc atggggatga 3180 ccttggagtc gtatttccaa ggctcctgac cgaggacgga tttggtgaag aggcggaggt 3240 ctaacatact tcatcagtga ctgccggtct cgtatatagt ataaaaagca agaaaggagg 3300 acagtggagg cctggtatag agcaggaaaa gaaggaagag gcgaaggact caccctcaac 3360 agagtgcgta atcggcccga caacgctgtg caccgtctcc tgaccctcca tgctgttcgc 3420 catctttgca tacggcagcc gcccatgact cggccttaga ccgtacagga agttgaacgc 3480 ggccggcact cgaatcgagc caccgatatc cgttcctaca ccgatgacgc caccacgaat 3540 cccaacgatc gcaccctcac caccagaact gccgccgcac gaccagttct tgttgcgtgg 3600 gttgacggtg cgcccgatga tgttgttgac tgtctcgcag accatcaggg tctgcgggac 3660 agaggtcttg acgtagaaga cggcaccggc tttgcggagc atggttgtca gaaccgagtc 3720 cccttcgtcg tacttgttta gccatgagat gtagcccatt gatgtttcgt agccctggtg 3780 gcatatgtta gctgacaaaa agggacatct aacgacttag gggcaacggt gtaccttgac 3840 tcgaagctgg tctttgagag agatggggag gccatgaagt ggaccaacgg gtctcttgtg 3900 ctttgcgtag tattcatcga gttcccttgc ctgcgcgaga gcggcgtcag ggaagaactc 3960 gtgggcgcag tttgtctgca cagaagccag cgtcagcttg atagtcccat aaggtggcgt 4020 tgttacatct ccctgagagg tagaggggac cctactaact gctgggcgat tgctgcccgt 4080 ttacagaatg ctagcgtaac ttccaccgag gtcaactctc cggccgccag cttggacaca 4140 agatctgcag cggaggcctc tgtgatcttc agttcggcct ctgaaaggat ccccgatttc 4200 tttgggaaat caataacgct gtcttccgca ggcagcgtct ggactttcca ttcatcaggg 4260 atggttttg cgaggcgggc gcgcttatca gcggccagtt cttcccagga ttgaggcatt 4320 ctgtgttagc ttatagtcag gatgttggct cgacgagtgt aaactgggag ttggcatgag 4380 ggtatgtag gcttctttag ccccgcatcc ccctcattct cctcattgat cccgggggag 4440 cggatggtgt tgataagaga ctaattatag ggtttagctg gtgcctagct ggtgattggc 4500 tggcttcgcc gaattttacg ggccaaggaa agctgcagaa ccgcggcact ggtaaacggt 4560 aattaagcta tcagccccat gctaacgagt ttaaattacg tgtattgctg ataaacacca 4620 acagagcttt actgaaagat gggagtcacg gtgtggcttc cccactgcga ttattgcaca 4680 agcagcgagg gcgaacttga ctgtcgtcgc tgagcagcct gcagtcaaac atacatatat 4740 atcaaccgcg aagacgtctg gccttgtaga acacgacgct ccctagcaac acctgccgtg 4800 tcagcctcta cggttgttac ttgcattcag gatgctctcc agcgggcgag ctattcaaaa 4860 tattcaaagc aggtatctcg tattgccagg attcagctga agcaacaggt gccaaggaaa 4920 <h2 style=";text-align:left;direction:ltr">tctgcgtcgg ttctcatctg ggcttgctcg gtcctggcgt agacaagggc gaattctgca 4980<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ttgaagttcc tattccgagt tcctattctt caaatagtat aggaacttca gatatccatc 5040<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acactgggag taccatttaa ttctatttgt gtttgatcga gacctaatac agcccctaca 5100<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> acgaccatca aagtcgtata gctaccagtg aggaagtgga ctcaaatcga cttcagcaac 5160<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atctcctgga taaactttaa gcctaaacta tacagaataa gatggtggag agcttatacc 5220<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> gagctcccaa atctgtccag atcatggttg accggtgcct ggatcttcct atagaaccat 5280<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ccttattcgt tgacctagct gattctggag tgacccagag ggtcatgact tgagcctaaa 5340<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> atccgccgcc tccaccattt gtagaaaaat gtgacgaact cgtgagctct gtacagtgac 5400<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> cggtgactct ttctggcatg cggagagacg gacggacgca gagagaaggg ctgagtaata 5460<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> agcgccactg cgccagacag ctctggcggc tctgaggtgc agtggatgat tattaatccg 5520<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> ggaccggccg cccctccgcc ccgaagtgga aaggctggtg tgcccctcgt tgaccaagaa 5580<h2 style=";text-align:left;direction:ltr"> <h2 style=";text-align:left;direction:ltr"> tctattgcat catcggagaa tatggagctt catcgaatca ccggcagtaa gcgaaggaga 5640<h2 style=";text-align:left;direction:ltr"> atgtgaagcc aggggtgtat agccgtcggc gaaatagcat gccattaacc taggtacaga 5700 agtccaattg cttccgatct ggtaaaagat tcacgagata gtaccttctc cgaagtaggt 5760 agagcgagta cccggcgcgt aagctcccta attggcccat ccggcatctg tagggcgtcc 5820 aaatatcgtg cctctcctgc tttgcccggt gtatgaaacc ggaaaggccg ctcaggagct 5880 ggccagcggc gcagaccggg aacacaagct ggcagtcgac ccatccggtg ctctgcactc 5940 gacctgctga ggtccctcag tccctggtag gcagctttgc cccgtctgtc cgcccggtgt 6000 gtcggcgggg ttgacaaggt cgttgcgtca gtccaacatt tgttgccata ttttcctgct 6060 ctccccacca gctgctcttt tcttttctct ttcttttccc atcttcagta tattcatctt 6120 cccatccaag aacctttatt tcccctaagt aagtactttg ctacatccat actccatcct 6180 tcccatccct tattcctttg aacctttcag ttcgagcttt cccacttcat cgcagcttga 6240 ctaacagcta ccccgcttga gcagacatca ccatgcccca gttcgatatc ctctgcaaga 6300 ccccccccaa ggtcctcgtc cgccagttcg tcgagcgctt cgagcgcccc tccggcgaga 6360 agatcgccct ctgcgccgcc gagctcacct acctctgctg gatgatcacc cataacggca 6420 ccgccatcaa gcgcgccacc ttcatgtcct acaacaccat catctccaac tccctctcct 6480 tcgatatcgt caacaagtcc ctccagttca agtacaagac ccagaaggcc accatcctgg 6540 aggcctccct caagaagctc atccccgcct gggagttcac catcatcccc tactacggcc 6600 agaagcatca gtccgatatc accgatatcg tctcctccct ccagctccag ttcgagtcct 6660 ccgaggaggc cgataagggc aactcccatt ccaagaagat gctcaaggcc ctcctctccg 6720 agggcgagtc catctgggag atcaccgaga agatcctcaa ctccttcgag tacacctccc 6780 gcttcaccaa gaccaagacc ctctaccagt tcctcttcct cgccaccttc atcaactgcg 6840 gccgcttctc cgatatcaag aacgtcgatc ccaagtcctt caagctcgtc cagaacaagt 6900 acctcggcgt catcatccag tgcctcgtca ccgagaccaa gacctccgtc tcccgccata 6960 tctacttctt ctccgcccgc ggccgcatcg atcccctcgt ctacctcgat gagttcctcc 7020 gcaactccga gcccgtcctc aagcgcgtca accgcaccgg caactcctcc tccaacaagc 7080 aggagtacca gctcctcaag gataacctcg tccgctccta caacaaggcc ctcaagaaga 7140 acgcccccta ctccatcttc gccatcaaga acggccccaa gtcccatatc ggccgccatc 7200 tcatgacctc cttcctctcc atgaagggcc tcaccgagct caccaacgtc gtcggcaact 7260 ggtccgataa gcgcgcctcc gccgtcgccc gcaccaccta cacccatcag atcaccgcca 7320 tccccgatca ttacttcgca ctagtctccc gctactacgc ctacgatccc atctccaagg 7380 agatgatcgc cctcaaggat gagaccaacc ccatcgagga gtggcagcat atcgagcagc 7440 tcaagggctc cgccgagggc tccatccgct accccgcctg gaacggcatc atctcccagg 7500 aggtcctcga ttacctctcc tcctacatca accgccgcat ccccaagaag aagcgcaagg 7560 tctgagtcga gattatccaa gggaatgact taatgagtat gtaagacatg ggtcataacg 7620 gcgttcgaaa catatacagg gttatgtttg ggaatagcac acgaataata acgttaatag 7680 gtaccaaagt ccttgataca ttagcacggt agaaaaagaa tatacaacg agctgggaat 7740 attctttaat ataaaactcc aagaagagct ggtgcggtgg agcttgtttt cgactctcag 7800 tatattcc tcatatccaa gcgcgctagg aggtggtcga atacacatgt aggcgcttct 7860 ctggatgcaa aagtcgtgcc ggacctgccg aaagactttg aagatgcgtt cacgccatct 7920 aagttgcgta gataattcac aaaaagggat gtttgtttcc ggaatgtagc aaagagctga 7980 taggcaatag cctcacttgc atgcatccta gagttaaac agcttggcac tggccgtcgt 8040 tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca 8100 tccccttc gccagctggc gtaatagcga agaggcccgc accgatcgcc cttcccaaca 8160 gttgcgcagc ctgaacggcg aatggcgcct gatgcggtat tttctcctta cgcatctgtg 8220 cggtatttca caccgcatat ggtgcactct cagtacaatc tgctctgatg ccgcatagtt 8280 aagccagcc cgacacccgc caaccccgc tgacgcgccc tgacgggct gtctgctccc 8340 ggcatccgct tacagacaag ctgtgaccgt ctccgggagc tgcatgtgtc agaggttttc 8400 accgtcatca ccgaaacgcg cgagacgaaa gggcctcgtg atacgcctat ttttataggt 8460 taatgtcatg ataataatgg tttcttagac gtcaggtggc acttttcggg gaaatgtgcg 8520 cggaacccct atttgtttat ttttctaaat acattcaaat atgtatccgc tcatgagaca 8580 8640 ccgtgtcgcc cttattccct tttttgcggc attttgcctt cctgtttttg ctcacccaga 8700 aacgctggtg aaagtaaaag atgctgaaga tcagttgggt gcacgagtgg gttacatcga 8760 actggatctc aacagcggta agatccttga gagttttcgc cccgaagaac gttttccaat 8820 gatgagcact tttaaagttc tgctatgtgg cgcggtatta tcccgtattg acgccgggca 8880 agagcaactc ggtcgccgca tacactattc tcagaatgac ttggttgagt actcaccagt 8940 cacagaaaag catcttacgg atggcatgac agtaagagaa ttatgcagtg ctgccataac 9000 catgagtgat aacactgcgg ccaacttact tctgacaacg atcggaggac cgaaggagct 9060 aaccgctttt ttgcacaaca tgggggatca tgtaactcgc cttgatcgtt gggaaccgga 9120 gctgaatgaa gccataccaa acgacgagcg tgacaccacg atgcctgtag caatggcaac 9180 aacgttgcgc aaactattaa ctggcgaact acttactcta gcttccccggc aacaattaat 9240 agactggatg gaggcggata aagttgcagg accacttctg cgctcggccc ttccggctgg 9300 ctggtttatt gctgataaat ctggagcctc caagggtggg tctcgcggta tcattgcagc 9360 actggggcca gatggtaagc cctcccgtat cgtagttatc tacacgacgg ggagtcaggc 9420 aactatggat gaacgaaata gacagatcgc tgagataggt gcctcactga ttaagcattg 9480 gtaactgtca gaccaagttt actcatatat actttagatt gatttaaaac ttcattttta 9540 atttaaaagg atctaggtga agatcctttt tgataatctc atgaccaaaa tcccttaacg 9600 tgagttttcg ttccactgag cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga 9660 tccttttttt ctgcgcgtaa tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt 9720 ggtttgtttg ccggatcaag agctaccaac tctttttccg aaggtaactg gcttcagcag 9780 agcgcagata ccaaatactg ttcttctagt gtagccgtag ttaggccacc acttcaagaa 9840 ctctgtagca ccgcctacat acctcgctct gctaatcctg ttaccagtgg ctgctgccag 9900 tggcgataag tcgtgtctta ccgggttgga ctcaagacga tagttaccgg ataaggcgca 9960 gcggtcgggc tgaacggggg gttcgtgcac acagcccagc ttggagcgaa cgacctacac 10020 cgaactgaga tacctacagc gtgagctatg agaaagcgcc acgcttcccg aagggagaaa 10080 ggcggacagg tatccggtaa gcggcagggt cggaacagga gagcgcacga gggagcttcc 10140 agggggaaac gcctggtatc tttatagtcc tgtcgggttt...

Claims

1. A mutant filamentous fungal host cell that produces a secreted heterologous polypeptide of interest, wherein the host cell comprises a polynucleotide construct encoding the secreted heterologous polypeptide of interest, and wherein a native putative steroid dehydrogenase is modified, truncated, partially or completely inactivated, present at a reduced level compared to a non-mutated parent cell, or eliminated; wherein the native putative steroid dehydrogenase comprises or consists of an amino acid sequence identical to the mature amino acid sequence shown in SEQ ID NO: 3, SEQ ID NO: 6, and / or SEQ ID NO: 9; and The mutant filamentous fungal host cell is an Aspergillus niger cell, an Aspergillus oryzae cell or a Trichoderma reesei cell.

2. The host cell of claim 1, wherein the secreted polypeptide of interest is an enzyme.

3. The host cell of claim 2, wherein the secreted polypeptide of interest is a hydrolase, an isomerase, a ligase, a lyase, an oxidoreductase or a transferase.

4. The host cell of claim 3, wherein the secreted polypeptide of interest is a carbohydrase, chitinase, cutinase, deoxyribonuclease, esterase, invertase, laccase, mannosidase, mutanase, oxidase, pectinase, phytase, proteolytic enzyme, ribonuclease, xylanase, or β-xylosidase.

5. A host cell as claimed in any preceding claim, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 95% identity to the genomic DNA sequence shown in SEQ ID NO: 1, SEQ ID NO: 4, and / or SEQ ID NO:

7.

6. The host cell of claim 5, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 96% identity to the genomic DNA sequence shown in SEQ ID NO: 1, SEQ ID NO: 4, and / or SEQ ID NO:

7.

7. A host cell as claimed in any preceding claim, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 95% identity to the cDNA sequence shown in SEQ ID NO:2, SEQ ID NO:5, and / or SEQ ID NO:

8.

8. The host cell of claim 7, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 96% identity to the cDNA sequence shown in SEQ ID NO: 2, SEQ ID NO: 5, and / or SEQ ID NO:

8.

9. A host cell as claimed in any preceding claim, wherein the native putative steroid dehydrogenase is modified, truncated, partially or completely inactivated, present at reduced levels compared to the non-mutated parent cell or eliminated by nonsense or frameshift mutation of the encoding gene, by partial or complete deletion of the encoding gene, or by silencing of the encoding gene.

10. A method for producing a mutant filamentous fungal host cell having an improved yield of a secreted polypeptide of interest compared to a non-mutated parental host cell, the method comprising the following steps in no particular order: a) transforming a filamentous fungal host cell with a polynucleotide construct encoding the secreted polypeptide of interest; and b) mutating the host cell to modify, truncate, partially or completely inactivate, reduce the level of, or eliminate a native putative steroid dehydrogenase, wherein the native putative steroid dehydrogenase comprises or consists of an amino acid sequence identical to the mature amino acid sequence set forth in SEQ ID NO:3, SEQ ID NO:6, and / or SEQ ID NO:9; and The mutant filamentous fungal host cell is an Aspergillus niger cell, an Aspergillus oryzae cell or a Trichoderma reesei cell. The method of claim 10 , wherein the secreted polypeptide of interest is an enzyme.

12. The method of claim 11, wherein the enzyme is a hydrolase, isomerase, ligase, lyase, oxidoreductase or transferase.

13. The method of claim 12, wherein the enzyme is a carbohydrase, chitinase, cutinase, deoxyribonuclease, esterase, invertase, laccase, mannosidase, mutanase, oxidase, pectinolytic enzyme, phytase, proteolytic enzyme, ribonuclease, xylanase, or β-xylosidase.

14. The method of any one of claims 10-13, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 95% identity to the genomic DNA sequence shown in SEQ ID NO: 1, SEQ ID NO: 4, and / or SEQ ID NO:

7.

15. The method of claim 14, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 96% identity to the genomic DNA sequence shown in SEQ ID NO: 1, SEQ ID NO: 4, and / or SEQ ID NO:

7.

16. The method of any one of claims 10-15, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 95% identity to the cDNA sequence shown in SEQ ID NO:2, SEQ ID NO:5, and / or SEQ ID NO:

8.

17. The method of claim 16, wherein the native putative steroid dehydrogenase is encoded by a gene comprising or consisting of a nucleotide sequence having at least 96% identity to the cDNA sequence shown in SEQ ID NO:2, SEQ ID NO:5, and / or SEQ ID NO:

8.

18. The method of any one of claims 10-17, wherein the native putative steroid dehydrogenase is modified, truncated, partially or completely inactivated, present at reduced levels compared to a non-mutated parent cell, or eliminated by nonsense or frameshift mutations in the encoding gene, by partial or complete deletion of the encoding gene, or by silencing of the encoding gene.

19. A method for producing a secreted polypeptide of interest, the method comprising the following steps: a) culturing the mutant filamentous fungal host cell according to any one of claims 1 to 9 under conditions favorable for production of the secreted polypeptide; and, optionally b) recovering the secreted polypeptide of interest.

Images