Antibody

Abstract

The present invention relates to an antibody. The present invention provides an active ingredient of a pharmaceutical composition for treating multiple myeloma. The antibody of the present invention has an epitope in the region of human integrin β<subgt;7< / subgt> containing amino acid residues 20 to 109.

Description

[0001] This application is a divisional application of a patent application for invention titled "Antibody" with an application date of August 2, 2016, an application number of 201680046842.8 (international application number PCT / JP2016 / 072688). Technical Field

[0002] The present invention discloses a novel antibody and its applications, etc. Background Art

[0003] Multiple myeloma, which is a representative example of a disease of neoplastic proliferation of plasma cells, accounts for approximately 1% of all cancers and more than 10% of all hematological malignancies. Multiple myeloma is a disease in which plasma cells existing in the bone marrow become cancerous (resulting in abnormal plasma cells) and proliferate monoclonally.

[0004] In multiple myeloma, abnormal plasma cells (myeloma cells) spread in the bone marrow in the body, proliferating throughout the whole body bone marrow. If the abnormal plasma cells proliferate, various symptoms including bone fractures will appear. M protein, which is an abnormal immunoglobulin produced by myeloma cells, increases the concentration of M protein in the blood, causing the blood to become viscous.

[0005] M protein does not function as an original antibody that recognizes foreign substances such as pathogens invading the body, and thus also causes a decrease in immunity. These can affect multiple organs and cause various syndromes. Representative syndromes are bone pain and damage, hypercalcemia, kidney damage or renal failure, anemia, etc.

[0006] Currently, for the treatment of multiple myeloma, mainly protease inhibitors, immunomodulatory drugs (iMIDs) such as thalidomide and lenalidomide which is its derivative, and chemotherapy such as the combination of melphalan and prednisone, as well as hematopoietic stem cell transplantation are carried out.

[0007] However, myeloma cells almost always acquire resistance to these therapeutic drugs in most cases. Therefore, with the current treatment methods, the actual situation is that the average survival time after onset is about 3 to 5 years, and the prognosis of myeloma patients is poor. In addition, these therapeutic drugs do not act specifically only on target tumor cells, but also show toxicity to normal cells, and as a result, there is a problem of accompanying serious side effects.

[0008] The industry has attempted to develop treatment methods for multiple myeloma using monoclonal antibodies. For example, anti-CS1 antibodies and anti-CD38 antibodies are considered promising (Non-Patent Documents 1 and 2). In addition, Patent Document 1 discloses a therapeutic agent for multiple myeloma and the like, which contains an anti-human CD48 monoclonal antibody as an active ingredient.

[0009] Integrins mainly form heterodimers of α-chains and β-chains in vivo and function as receptors on the cell surface. There are multiple combinations of such α-chains and β-chains of integrins.

[0010] In addition, Non-Patent Documents 4 to 6 disclose chimeric antigen receptor T cells (CAR-T cells) that contain antigen recognition sites having affinity for specific antigens.

[0011] Prior Art Documents

[0012] Patent Documents

[0013] Patent Document 1: International Publication Gazette 2010 / 117059

[0014] Non-Patent Documents

[0015] Non-Patent Document 1: Journal of Clinical Oncology, 2012 Jun 1; 30(16): 1953-9.

[0016] Non-Patent Document 2: Journal of immunology, 2011 Feb 1; 186(3): 1840-8.

[0017] Non-Patent Document 3: J Biol Chem. 2012 May 4; 287(19): 15749-59.

[0018] Non-Patent Document 4: J Immunol. 2009 Nov 1; 183(9): 5563-74.

[0019] Non-Patent Document 5: N Engl J Med. 2014 Oct 16; 371(16): 1507-17.

[0020] Non-Patent Document 6: Nat Biotechnol. 2002 Jan; 20(1): 70-5. Summary of the Invention

[0021] [Problems to be Solved by the Invention]

[0022] Anti-CS1 antibodies are relatively highly specific for myeloma cells, but the anti-myeloma effect is not good when the antibodies are used alone, and a single dose has not shown effectiveness in clinical trials. It has been found that the anti-tumor effect of anti-CS1 antibodies increases when used in combination with lenalidomide, and it is considered that the current goal is to obtain approval for the combined use of the two. On the other hand, CD38 is also expressed in most normal blood cells including CD34-positive hematopoietic progenitor cells, and thus is an antigen with low specificity as a therapeutic target for multiple myeloma. One of the subjects of the present invention is to provide a more effective treatment method for diseases such as multiple myeloma accompanied by neoplastic proliferation of plasma cells based on this current situation.

[0023] [Technical means for solving the problem]

[0024] The inventors of the present invention made intensive studies to solve this problem, and as a result, screened using specific binding to myeloma cells and their progenitor cells as an index, and obtained the MMG49 antibody. Then, it was confirmed that this antibody binds to a specific region of human integrin β7, and it was found that CAR-T cells prepared using the antigen recognition site of this antibody are very useful for the treatment of myeloma. In addition, it was also confirmed that the epitope of the MMG49 antibody is present in the region of human integrin β7 containing amino acid residues 20 to 109.

[0025] The present invention has been completed based on this insight, and includes inventions in the following multiple aspects.

[0026] (I) Antibody

[0027] Antibody (I) includes the antibodies shown in the following (I-1) to (I-25).

[0028] (I-1)

[0029] An antibody which is an anti-human integrin β7 antibody and has an epitope in the region of human integrin β7 containing amino acid residues 20 to 109.

[0030] (1-1A)

[0031] The antibody according to (I-1), which has an epitope in the region of human integrin β7 containing amino acid residues 33 to 109.

[0032] (1-1B)

[0033] The antibody according to (I-1), which has an epitope in the region of human integrin β7 containing amino acid residues 20 to 90.

[0034] (1-1C)

[0035] The antibody according to (I-1) has an epitope in the region of human integrin β7 comprising amino acid residues 33 to 90.

[0036] (I-2)

[0037] The antibody according to (I-1) has an increased affinity for the epitope in the presence of at least a part of the region of human integrin β7 comprising amino acid residues 379 to 721.

[0038] (I-3)

[0039] The antibody according to (I-2) has an increased affinity for the epitope in the presence of at least a part of the region of human integrin β7 comprising amino acid residues 417 to 721.

[0040] (I-4)

[0041] The antibody according to (I-2) has an increased affinity for the epitope in the presence of at least a part of the region of human integrin β7 comprising amino acid residues 564 to 721.

[0042] (I-5)

[0043] The antibody according to (I-2) has an increased affinity for the epitope in the presence of at least a part of the region of human integrin β7 comprising amino acid residues 379 to 563.

[0044] (I-6)

[0045] The antibody according to (I-2) has an increased affinity for the epitope in the presence of at least a part of the region of human integrin β7 comprising amino acid residues 417 to 563.

[0046] (I-7)

[0047] The antibody according to (I-2) has an increased affinity for the epitope in the presence of at least a part of the region of human integrin β7 comprising amino acid residues 379 to 416.

[0048] (I-8)

[0049] The antibody according to any one of (I-1) to (I-7) has an increased affinity for the epitope by activating human integrin β7.

[0050] (I-9)

[0051] An antibody, which is an anti-human integrin β7 antibody and has a higher affinity for human integrin β7 expressed in myeloma cells than for human integrin β7 expressed in normal cells.

[0052] (I-10)

[0053] The antibody according to any one of (I-1) to (I-9) has the same epitope as the MMG49 antibody.

[0054] (I-11)

[0055] The antibody according to any one of (I-1) to (I-10) comprises a heavy chain variable region and / or a light chain variable region, and the heavy chain variable region comprises:

[0056] Heavy chain CDR1 having the amino acid sequence shown in SEQ ID NO: 1,

[0057] Heavy chain CDR2 having the amino acid sequence shown in SEQ ID NO: 2 and / or

[0058] Heavy chain CDR3 having the amino acid sequence shown in SEQ ID NO: 3,

[0059] The light chain variable region comprises:

[0060] Light chain CDR1 having the amino acid sequence shown in SEQ ID NO: 6,

[0061] Light chain CDR2 having the amino acid sequence shown in SEQ ID NO: 7 and / or

[0062] Light chain CDR3 having the amino acid sequence shown in SEQ ID NO: 8.

[0063] (I-12)

[0064] The antibody according to any one of (I-1) to (I-10) comprises

[0065] A heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 4 and / or

[0066] A light chain variable region having the amino acid sequence shown in SEQ ID NO: 9.

[0067] (I-13)

[0068] The antibody according to any one of (I-1) to (I-12) is an Fv, scFv, diabody, triabody, tetrabody or a combination thereof.

[0069] (I-14)

[0070] The antibody according to any one of (I-1) to (I-11) comprises a constant region.

[0071] (I-15)

[0072] The antibody according to any one of (I-1) to (I-12) and (I-14) is a chimeric antibody.

[0073] (I-16)

[0074] The antibody according to any one of (I-1) to (I-12) and (I-14) is a humanized antibody.

[0075] (I-17)

[0076] The antibody according to any one of (I-1) to (I-12) and (I-14) is a human antibody.

[0077] (I-18)

[0078] The antibody according to any one of (I-1) to (I-12) and (I-14) to (I-17) is an immunoglobulin, Fab, F(ab')2, minibody, scFv-Fc or a combination thereof.

[0079] (I-19)

[0080] The antibody according to any one of (I-1) to (I-12) and (I-14) to (I-18) is IgA, IgD, IgE, IgG or IgM.

[0081] (I-20)

[0082] The antibody according to any one of (I-1) to (I-12) and (I-14) to (I-19) comprises a heavy chain having the amino acid sequence shown in SEQ ID NO: 5 and / or a light chain having the amino acid sequence shown in SEQ ID NO: 10.

[0083] (I-21)

[0084] The antibody according to any one of (I-1) to (I-20) has cytotoxicity.

[0085] (I-22)

[0086] The cytotoxicity of the antibody according to (I-21) is ADCC activity and / or CDC activity.

[0087] (I-23)

[0088] The antibody according to any one of (I-1) to (I-22) is a multispecific antibody.

[0089] (I-24)

[0090] The antibody according to any one of (I-1) to (I-23) is formed by binding a cytotoxin.

[0091] (I-25)

[0092] The antibody according to any one of (I-1) to (I-24) is a monoclonal antibody.

[0093] (II) Polynucleotide

[0094] The polynucleotide (II) includes the polynucleotide shown in the following (II-1).

[0095] (II-1)

[0096] A polynucleotide having a base sequence encoding the amino acid sequence of the antibody (I).

[0097] (III) Host cell

[0098] The host cell (III) includes the host cell shown in the following (III-1) or (III-2).

[0099] (III-1)

[0100] A host cell carrying the polynucleotide (II).

[0101] (III-2)

[0102] The host cell according to (III-1) is a eukaryotic cell.

[0103] (IV) Chimeric antigen receptor

[0104] The chimeric antigen receptor (IV) includes the chimeric antigen receptors shown in the following (IV-1) to (IV-5).

[0105] (IV-1)

[0106] A chimeric antigen receptor having the same epitope as the antibody (I).

[0107] (IV-2)

[0108] The chimeric antigen receptor according to (IV-1) comprises the antigen recognition site of the antibody (I).

[0109] (IV-3)

[0110] The chimeric antigen receptor according to (IV-1) or (IV-2), wherein the antigen recognition site comprises a heavy chain variable region and / or a light chain variable region, and the heavy chain variable region comprises:

[0111] a heavy chain CDR1 having the amino acid sequence shown in SEQ ID NO: 1,

[0112] a heavy chain CDR2 having the amino acid sequence shown in SEQ ID NO: 2 and / or

[0113] a heavy chain CDR3 having the amino acid sequence shown in SEQ ID NO: 3,

[0114] The light chain variable region comprises:

[0115] a light chain CDR1 having the amino acid sequence shown in SEQ ID NO: 6,

[0116] a light chain CDR2 having the amino acid sequence shown in SEQ ID NO: 7 and / or

[0117] a light chain CDR3 having the amino acid sequence shown in SEQ ID NO: 8.

[0118] (IV-4)

[0119] The chimeric antigen receptor according to any one of (IV-1) to (IV-3), wherein the antigen recognition site comprises

[0120] a heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 4 and / or

[0121] a light chain variable region having the amino acid sequence shown in SEQ ID NO: 9.

[0122] (IV-5)

[0123] The chimeric antigen receptor according to any one of (IV-1) to (IV-4), which has the amino acid sequence shown in SEQ ID NO: 21.

[0124] (V) Polynucleotide

[0125] The polynucleotide (V) is different from the polynucleotide (II) and comprises the polynucleotide shown in the following (V-1) or (V-2).

[0126] (V-1)

[0127] A polynucleotide encoding the amino acid sequence of the chimeric antigen receptor (IV).

[0128] (V-2)

[0129] The polynucleotide according to (V-1), which has the base sequence shown in SEQ ID NO: 22.

[0130] (VI) Cell

[0131] The cell (VI) is different from the host cell (III) and includes any one of the cells shown in the following (VI-1) to (VI-4).

[0132] (VI-1)

[0133] A cell that carries the polynucleotide (V).

[0134] (VI-2)

[0135] The cell according to (VI-1), which is a eukaryotic cell.

[0136] (VI-3)

[0137] The cell according to (VI-1) or (VI-2), which is a T cell or an NK cell.

[0138] (VI-4)

[0139] The cell according to any one of (VI-1) to (VI-3), which is a chimeric antigen receptor T cell or a chimeric antigen receptor NK cell.

[0140] (VII) Pharmaceutical composition

[0141] The pharmaceutical composition (VII) includes the pharmaceutical compositions shown in the following (VII-1) to (VII-5).

[0142] (VII-1)

[0143] A pharmaceutical composition that contains the antibody (I) or the cell (VI).

[0144] (VII-2)

[0145] The pharmaceutical composition according to (VII-1), wherein the cell is a chimeric antigen receptor T cell (VI-4).

[0146] (VII-3)

[0147] The pharmaceutical composition according to (VII-1) or (VII-2), which is used for the treatment of cancer.

[0148] (VII-4)

[0149] The pharmaceutical composition according to (VII-3), wherein the cancer is a hematological cancer.

[0150] (VII-5)

[0151] The pharmaceutical composition according to (VII-4), wherein the blood cancer is a disease of neoplastic proliferation that produces plasma cells.

[0152] (VIII) Method for treating or preventing a disease

[0153] The method for treating or preventing a disease (VIII) includes the methods for treating or preventing the diseases shown in (VIII-1) to (VIII-6) below.

[0154] (VIII-1)

[0155] A method for treating or preventing a disease, which includes the step of administering a therapeutically effective amount of the antibody (I) or the cell (VI) to a subject.

[0156] (VIII-2)

[0157] The method for treating or preventing according to (VIII-1), wherein the cell is a chimeric antigen receptor T cell (VI-4).

[0158] (VIII-3)

[0159] The method for treating or preventing according to (VIII-1) or (VIII-2), wherein the disease is cancer, and the subject is a patient suffering from cancer or an animal likely to suffer from cancer.

[0160] (VIII-4)

[0161] The method for treating or preventing according to (VIII-3), wherein the cancer is blood cancer.

[0162] (VIII-5)

[0163] The method for treating or preventing according to (VIII-4), wherein the blood cancer is a disease of neoplastic proliferation that produces plasma cells.

[0164] (VIII-6)

[0165] A method for treating or preventing multiple myeloma, which targets active human integrin β7.

[0166] (IX) Use

[0167] The use (IX) includes the uses shown in (IX-1) to (IX-5) below.

[0168] (IX-1)

[0169] A use of the antibody (I) or the cell (VI) for manufacturing a pharmaceutical composition.

[0170] (IX-2)

[0171] A treatment or prevention method as described in (IX-1), wherein the cell is a chimeric antigen receptor T cell (VI-4).

[0172] (IX-3)

[0173] Use according to (IX-1) or (IX-2), which is used for the treatment of cancer.

[0174] (IX-4)

[0175] Use according to (IX-3), wherein the cancer is a hematological cancer.

[0176] (IX-5)

[0177] Use according to (IX-4), wherein the hematological cancer is a disease of neoplastic proliferation that produces plasma cells.

[0178] (X) Screening method

[0179] The screening method (X) includes the screening methods shown in (X-1) to (X-5) below.

[0180] (X-1)

[0181] A screening method for an active ingredient of a pharmaceutical composition for the treatment or prevention of cancer, which includes the following steps: screening candidate substances from a compound library that specifically bind to human integrin β7 and bind to the region of human integrin β7 containing amino acid residues 20 to 109.

[0182] (X-2)

[0183] The screening method according to (X-1) further includes the following step: screening substances with cytotoxicity.

[0184] (X-3)

[0185] The screening method according to (X-1) or (X-2), wherein the screened substance is a monoclonal antibody.

[0186] (X-4)

[0187] The screening method according to any one of (X-1) to (X-3), wherein the cancer is a hematological cancer.

[0188] (X-5)

[0189] The screening method according to (X-4), wherein the hematological cancer is a disease of neoplastic proliferation that produces plasma cells.

[0190] (XI) Diagnostic method

[0191] The diagnostic method (XI) includes the diagnostic methods shown in (XI-1) to (XI-5) below.

[0192] (XI-1)

[0193] A diagnostic method for cancer, comprising the steps of: bringing a sample collected from a subject into contact with the antibody (I).

[0194] (XI-2)

[0195] The diagnostic method according to (XI-1), wherein the sample collected from the subject is blood or bone marrow fluid.

[0196] (XI-3)

[0197] The diagnostic method according to (XI-1) or (XI-2), wherein the case where cells bound to the antibody (I) are detected is judged as having cancer or the possibility of having cancer.

[0198] (XI-4)

[0199] The diagnostic method according to (XI-3), wherein the cancer is a blood cancer.

[0200] (XI-5)

[0201] The diagnostic method according to (XI-4), wherein the cell is a plasma cell, and the cancer is a disease of neoplastic proliferation that produces plasma cells.

[0202] (XII) Kit

[0203] The kit (XII) includes the kits shown in (XII-1) to (XII-3) below.

[0204] (XII-1)

[0205] A kit for diagnosing cancer, comprising the antibody (I).

[0206] (XII-2)

[0207] The diagnostic method according to (XII-1), wherein the cancer is a blood cancer.

[0208] (XII-3)

[0209] The kit according to (XII-2), wherein the cancer is a disease of neoplastic proliferation that produces plasma cells.

[0210] [Advantages of the Invention]

[0211] The antibody of the present invention is useful as an active ingredient of a pharmaceutical composition because it does not recognize normal cells. In particular, it is useful as an active ingredient of a therapeutic agent for cancer (e.g., blood cancer).

[0212] Regarding the antibody of the present invention, by applying its antigen recognition site to a chimeric antigen receptor to produce chimeric antigen receptor T cells, since the produced chimeric antigen receptor T cells can be used as an active ingredient of the pharmaceutical composition as described above, the antibody of the present invention is useful. BRIEF DESCRIPTION OF THE DRAWINGS

[0213] Figure 1 It is a figure showing the following result, which is obtained by analyzing the binding of the MMG49 antibody to bone marrow cells derived from a myeloma patient using FACS (Fluorescence-activated cell sorter) in Example 2. The left figure shows the identification method of myeloma progenitor cells, myeloma plasma cells, and CD45 + white blood cells (CD45 + leukocytes). The right figure shows the binding of the MMG49 antibody to each component.

[0214] Figure 2 It is a figure showing the following result, which is obtained by analyzing the binding of the MMG49 antibody to myeloma progenitor cells, myeloma plasma cells, and CD45 + white blood cells of multiple bone marrow cells (UPN1 - 5) derived from myeloma patients using FACS in Example 2.

[0215] Figure 3 It is a figure showing the process of identifying the antigen protein recognized by the MMG49 antibody by the expression cloning method in Example 3. It shows the process of concentrating BaF3 cells that initially bind to the MMG49 antibody at 0.1% or less by FACS sorting.

[0216] Figure 4 It is a figure showing the following result, which is obtained by staining ITGB7-deficient U266 cells prepared using the Crisp-cas9 system with the MMG49 antibody or the FIB27 antibody (commercially available anti-integrin β7 antibody) and performing FACS analysis in Example 4.

[0217] Figure 5This is a figure showing the results obtained by immunoprecipitating from a cell lysate derived from MM1s myeloma cells using the MMG49 antibody or an isotype control antibody in Example 4, subjecting the resulting material to SDS-PAGE (Sodium dodecyl sulfate Polyacrylamide gel electrophoresis), and then performing Western blotting using a commercially available anti-integrin β7 antibody (Abcam).

[0218] Figure 6 This is a figure showing the results obtained by analyzing the binding of the MMG49 antibody, FIB27 antibody, and FIB504 antibody to each cell component of healthy human peripheral blood cells (in the figure, B cells, T cells, monocytes, neutrophils, red blood cells, and platelets are shown in order from the left) using FACS in Example 5.

[0219] Figure 7 This is a figure showing the results obtained by performing FACS analysis on the binding of the MMG49 antibody to each cell component of bone marrow cells derived from myeloma patients in Example 5. The left figure shows the method for identifying each cell component, and the right figure shows the binding of MMG49 to each component. A shows the comparison between hematopoietic stem cell and progenitor cell components and myeloma cells, and B shows the comparison between B / T lymphocyte components and myeloma progenitor cell and myeloma plasma cell components.

[0220] Figure 8 This is a figure showing the results obtained by analyzing the binding of the MMG49 antibody and FIB27 antibody to various myeloma cell lines, T cells, and B cells derived from peripheral blood using FACS in Example 6. Also shown are the results obtained by performing FACS analysis on the confirmation of the expression of ITGA4 (binding of anti-integrin α4 antibody) and ITGAE (binding of anti-integrin α E antibody) in the said cells.

[0221] Figure 9 This is a figure showing the results obtained by performing FACS analysis on the binding of the MMG49 antibody and FIB27 antibody to U266 cells and ITGA4 (integrin α4)-deficient U266 cells in Example 6. Also shown are the results obtained by performing FACS analysis on the expression of ITGA4 (binding of anti-integrin α4 antibody) in the said cells.

[0222] Figure 10is a figure showing the following result, which was obtained in Example 7 by reacting integrin α4β7-overexpressing K562 cells and T cells derived from human normal peripheral blood that were treated at 37°C for 20 minutes with MMG49 antibody or an isotype antibody in the presence of Ca 2+ / Mg 2+ or Mn 2+ , followed by staining with anti-mouse IgG antibody as a secondary antibody and performing FACS analysis on these.

[0223] Figure 11 is a figure showing the construction of a human / mouse chimeric integrin β7 protein in Example 8 and the binding of MMG49 antibody to 293T cells transiently expressing this human / mouse chimeric integrin β7 protein.

[0224] Figure 12 [[ID=No.14]]is a figure showing the following result, which was obtained by performing FACS analysis on the binding of MMG49 antibody to 293T cells transiently expressing a human / mouse chimeric integrin β7 protein in Example 8.

[0225] Figure 13 is a summary Figure 12 of the results shown. In the graph in the figure, the vertical axis represents the percentage of cells bound with the antibody, and the horizontal axis represents various human / mouse chimeric integrin β7 proteins.

[0226] Figure 14 is a figure showing the following result, which was obtained by staining MM1s cells and KMS12BM cells with a chimerized MMG49 antibody prepared by linking the variable region of MMG49 antibody and the constant region of human IgG4 antibody.

[0227] Figure 15 is a diagram showing the method for preparing a CAR construct using the variable region of MMG49 antibody.

[0228] Figure 16 is a figure showing the following result, which was obtained by staining T cells expressing a CAR construct using the variable region of MMG49 antibody with a PE - anti-human F(ab')2 antibody.

[0229] Figure 17It is a figure showing the following results, which were obtained by quantifying the amounts of IFN-γ and IL2 produced by co-culturing CAR-T cells derived from MMG49 antibody or T cells transfected with GFP (control) with K562 cells not expressing integrin β7 or K562 cells forcibly expressing integrin α4β7 by ELISA (Enzyme Linked Immunosorbent Assay) in Example 11. *: p < 0.05.

[0230] Figure 18 It is a figure showing the following results, which were obtained by quantifying the amount of IFN-γ produced by co-culturing CAR-T cells derived from MMG49 antibody or T cells transfected with GFP (control) with MMG49 antigen-expressing cells or non-expressing cells by ELISA in Example 11.

[0231] Figure 19 It is a figure showing the following results, which were obtained by quantifying the amount of IL2 produced by co-culturing CAR-T cells derived from MMG49 antibody or T cells transfected with GFP (control) with MMG49 antigen-expressing cells or non-expressing cells by ELISA in Example 11.

[0232] Figure 20 It is a figure showing the following results, which were obtained in Example 11 by 51 Cr killing assay, the cell killing degree of CAR-T cells derived from MMG49 antibody or T cells transfected with GFP (control) against K562 cells not expressing integrin β7 or K562 cells forcibly expressing integrin α4β7 was measured. In addition, the y-axis of the graph in the figure refers to the cell killing rate (%).

[0233] Figure 21 It is a figure showing the following results, which were obtained in Example 11 by 51 Cr killing assay, the cell killing degree of CAR-T cells derived from MMG49 antibody or T cells transfected with GFP (control) against MMG49 antigen-expressing cells or non-expressing cells was measured.

[0234] Figure 22This is a graph showing the design and results of the treatment experiment for the myeloma cell line MM1s transplanted into the bone marrow of NOG mice in Example 12. Bone marrow cells were collected 1 week after implantation of CAR-T cells derived from the MMG49 antibody or T cells transfected with GFP (control), and analyzed by FACS. MM1s cells can be identified as human CD138 + cells. In the group administered with CAR-T cells derived from the MMG49 antibody, MM1s cells in the bone marrow almost completely disappeared.

[0235] Figure 23 This is a graph showing the design and results of the treatment experiment for the myeloma cell line MM1s transplanted throughout the body of NOG mice in Example 12. The amount of myeloma cells before and after implantation of CAR-T cells derived from the MMG49 antibody or T cells transfected with GFP (control) was evaluated by measuring the fluorescence intensity using IVIS imaging. In the group administered with CAR-T cells derived from the MMG49 antibody, MM1s cells in the bone marrow almost completely disappeared.

[0236] Figure 24 This is a graph showing the comparison of the amino acid sequence of human integrin β7 and the amino acid sequence of mouse integrin β7.

[0237] Figure 25 This is a graph showing the construction of human / mouse chimeric integrin β7 protein in Example 13 and the binding of the MMG49 antibody to 293T cells transiently expressing the human / mouse chimeric integrin β7 protein.

[0238] Figure 26 This is a graph showing the experimental results of the epitope study of the MMG49 antibody in Example 14. The MFI on the horizontal axis represents the binding strength to the MMG49 antibody, and the higher the value, the higher the binding affinity. Detailed implementation mode

[0239] In this specification, "comprising" and "having" are so-called open languages, but these concepts include closed languages such as "consisting only of", and in one embodiment, they can be replaced by "consisting only of".

[0240] "Myeloma progenitor cells" are progenitor cells at the stage before differentiating into myeloma plasma cells, and are characterized in that although they strongly express CD38, they do not express the marker specific for mature plasma cells, namely CD138. Therefore, myeloma progenitor cells are sometimes also referred to as "CD38 ++ CD138 - cells" or "CD19 - CD38 ++CD138 - cells.

[0241] “Myeloma plasma cells” are generally also referred to as myeloma cells and are cells that produce M protein, which is an abnormal immunoglobulin. Among myeloma plasma cells, in addition to strongly expressing CD38, they also express CD138. Therefore, myeloma plasma cells are sometimes also described as “CD38 ++ CD138 + cells” or “CD19 - CD38 ++ CD138 + cells”.

[0242] Myeloma progenitor cells and myeloma plasma cells also refer to tumor progenitor cells and neoplastic plasma cells in diseases with neoplastic proliferation of plasma cells other than each multiple myeloma.

[0243] “Hematopoietic progenitor cells” are cells that can differentiate into various blood cells. Hematopoietic progenitor cells are characterized by expressing CD34. Therefore, in this specification, hematopoietic progenitor cells are sometimes also described as “CD34 + cells”.

[0244] (I) Antibody

[0245] Antibody (I) is preferably an antibody that is an anti-human integrin β7 antibody and has an epitope in the region encompassing amino acid residues 20 to 109 of human integrin β7.

[0246] More preferably, examples include: an antibody having an epitope in the region encompassing amino acid residues 33 to 109 of human integrin β7 or an antibody having an epitope in the region encompassing amino acid residues 20 to 90 of human integrin β7. Most preferably, examples include: an antibody having an epitope in the region encompassing amino acid residues 33 to 90 of human integrin β7.

[0247] Human integrin β7 is not particularly limited and is a transmembrane protein having the amino acid sequence shown in SEQ ID NO: 31 and can be a protein that forms a heterodimer with integrin α. As a specific integrin α, examples include integrin α4 or integrin α E .

[0248] In addition to the amino acid sequence shown in SEQ ID NO: 31, the specific amino acid sequence of human integrin β7 may also include, for example, ACCESSION: EAW96675; VERSION: EAW96675.1, GI: 119617081, ACCESSION: NM000889; VERSION: NM000889.2, GI: 540344585, ACCESSION: XM005268851, VERSION: XM005268851.2, GI: 767974096, ACCESSION: XM006719376, VERSION: XM006719376.2, GI: 767974098, ACCESSION: XM005268852, VERSION: XM005268852.3, GI: 767974097 and the like recorded in the database of NCBI.

[0249] The following description of human integrin β7 is based on the amino acid sequence shown in SEQ ID NO: 31. However, for the amino acid sequences of other human integrin β7, those skilled in the art can easily determine which region or site of the amino acid sequence of other human integrin β7 corresponds to the region and / or site of human integrin β7 described below by confirming the homology with the amino acid sequence shown in SEQ ID NO: 31 through in silico analysis.

[0250] The region of human integrin β7 containing amino acid residues 1 to 19 is a signal peptide and is a peptide fragment that does not exist when functioning as a membrane protein in vivo. Therefore, the N-terminus of human integrin β7 when functioning as a membrane protein is the 20th amino acid residue of the amino acid sequence.

[0251] The region of human integrin β7 containing amino acid residues 20 to 109 contains a PSI domain. It is known that the PSI domain of human integrin β7 has a relatively high homology with the PSI domain of mouse integrin β7, about 80% or more. However, if the amino acid residues of the region containing amino acid residues 20 to 109 of human integrin β7 and mouse integrin β7 containing the PSI domain are compared, as Figure 24 shown, a total of 15 amino acid residues at positions 23, 26, 28, 30, 32, 35, 36, 38, 41, 42, 48, 93, 94, 102, and 109 of human integrin β7 are different.

[0252] Therefore, the epitope of antibody (I) is preferably related to any one or more of these 15 amino acid residues, preferably two or more, and more preferably three or more. Specifically, the epitope of antibody (I) preferably exists in the region of human integrin β7 containing amino acid residues 23 to 109, and more preferably exists in the region containing amino acid residues 23 to 48 or the region containing amino acid residues 93 to 109.

[0253] The epitope of antibody (I) in other more preferred forms may also be the region containing amino acid residues 23 to 48, the region containing amino acid residues 93 to 109, or a three-dimensional region formed by combining the region containing amino acid residues 23 to 48 and the region containing amino acid residues 93 to 109.

[0254] In addition, the epitope of antibody (I) may be a linear epitope or a conformational epitope (also called a non-linear epitope). Those skilled in the art know that a linear epitope refers to a case where continuous amino acid residues form an epitope, and a conformational epitope is an epitope composed of non-continuous amino acid residues.

[0255] For example, as an example of a conformational epitope, a case where the three-dimensional region formed by combining the region containing amino acid residues 23 to 48 and the region containing amino acid residues 93 to 109 is used as an epitope can be cited, but the conformational epitope also includes a case where a region containing non-continuous amino acid residues in the region containing amino acid residues 20 to 109 is used as an epitope.

[0256] Among the above-mentioned epitopes, the 48th amino acid residue is preferably closely related to the epitope of antibody (I) or is included in the epitope of antibody (I).

[0257] Regarding specific linear epitopes and conformational epitopes, those skilled in the art can understand, for example, by referring to Japanese Patent No. 2011-527572, Japanese Patent No. 2009-534401, "Dissecting antibodies with regards to linear and conformational epitopes." Forsstrom B, Axnas BB, Rockberg J, Danielsson H, Bohlin A, Uhlen M. PLoS One. 2015 Mar 27;10(3):e0121673.doi:10.1371 / journal.pone.0121673.eCollection 2015., etc.

[0258] In other words, antibody (I) is an antibody that specifically binds to the region of human integrin β7 containing amino acid residues 20 to 109, preferably specifically binds to the region containing amino acids 23 to 109, and more preferably specifically binds to the region containing amino acids 23 to 48 and / or 93 to 109.

[0259] In addition, the property of antibody (I) to bind to the epitope, i.e., the region of integrin β7 containing amino acid residues 20 to 109, is sometimes referred to as the affinity for the epitope. Therefore, the terms "increased affinity for the epitope" and "increased ability to specifically bind to the epitope" have the same meaning.

[0260] The term "specifically" can be distinguished from "selectively".

[0261] As another form of antibody (I), it is preferred that the affinity of antibody (I) for the epitope is increased in the presence of at least a part of the region of human integrin β7 containing amino acid residues 379 to 721.

[0262] "At least a part of the region containing amino acid residues 379 to 721" means that it can be the region containing amino acid residues 379 to 721 or a part of this region. Regarding the specific "part of the region", for example, it can include at least a part of the region of human integrin β7 containing amino acid residues 417 to 721, at least a part of the region of human integrin β7 containing amino acid residues 564 to 721, at least a part of the region of human integrin β7 containing amino acid residues 379 to 563, at least a part of the region of human integrin β7 containing amino acid residues 417 to 563, or at least a part of the region of human integrin β7 containing amino acid residues 379 to 416. That is, in the presence of these regions, the affinity of antibody (I) for the epitope can be increased.

[0263] The so-called term "in the presence of" can be set such that the region of human integrin β7 containing amino acid residues 20 to 109 and at least a part of the region of human integrin β7 containing amino acid residues 379 to 721 exist within the same molecule, or it can be set such that the two regions exist in separate single molecules. It is preferred that the two regions exist within the same molecule. In addition, the term "in the presence of" can also be changed to "by".

[0264] Regarding the increase in the affinity of the antibody (I) for the epitope, those skilled in the art can easily confirm it by conventional immunological assays such as those described in the following examples.

[0265] For example, cells expressing the chimeric integrin β7 protein of human / mouse (#4960) are prepared, and the chimeric integrin β7 protein of human / mouse (#4961) is prepared. The chimeric integrin β7 protein of human / mouse (#4960) is various chimeric integrin β7 proteins of human / mouse shown in Example 8, which contains the region comprising amino acid residues 1 to 109 derived from human integrin β7 and the region comprising amino acid residues 722 to 798 derived from human integrin β7. The chimeric integrin β7 protein of human / mouse (#4961) is obtained by replacing the region comprising amino acid residues 379 to 721 derived from human integrin β7 in #4960 with the region comprising amino acid residues 379 to 721 derived from mouse integrin β7. Herein, the cells expressing the latter (#4961) and the cells expressing the former (#4960) are compared with respect to the degree of binding of antibody (I), whereby the increased affinity of antibody (I) for the epitope can be confirmed.

[0266] As another form of antibody (I), it is preferred that the affinity of antibody (I) for the epitope is increased by activating human integrin β7. Activated human integrin β7 has structural characteristics in the region containing the epitope, and thus it is considered that the affinity of antibody (I) for the epitope is increased.

[0267] Methods for activating human integrin β7 are well known. For example, by allowing phorbol esters such as PMA (phorbol myristate acetate) or manganese salts to act on cells expressing human integrin β7, such as any one of blood cells or immune cells including plasma cells, NK cells, T cells, B cells, lymphoblasts, cells derived from Burkitt lymphoma, dendritic cells, etc., the human integrin β7 expressed in the cells can be activated. In addition, not limited to the specific cells described above, cells expressing human integrin β7 can also be used and treated with phorbol esters, manganese salts, etc. to activate human integrin β7.

[0268] Regarding the case where the affinity of antibody (I) for the epitope is increased by activating human integrin β7, those skilled in the art can easily confirm it by conventional immunological assay methods such as those described in the following examples.

[0269] For example, prepare cells expressing #4960 or #4961, where #4960 or #4961 are various human / mouse chimeric integrin β7 proteins shown in Example 8 and contain a region encompassing amino acid residues 1 to 109. After supplying the cells expressing #4960 or #4961 to the integrin β7 activation method shown in Example 7, perform measurement using an immunological assay method. Thus, it is possible to compare before and after the activation treatment and confirm that the affinity of antibody (I) for the epitope of the activated cells increases.

[0270] As another form of antibody (I), it can be set as the following anti-human integrin β7 antibody, which is characterized in that: compared with human integrin β7 expressed in normal cells, it has a higher affinity for human integrin β7 expressed in myeloma-derived cells.

[0271] The so-called normal cells, if they are cells derived from a healthy person, are not particularly limited. For example, they can be set as normal cells derived from blood, and among such normal cells, normal plasma cells are preferably set.

[0272] Regarding the method for confirming such a situation where the affinity for human integrin β7 expressed in myeloma cells is higher compared with that for human integrin β7 expressed in normal cells, those skilled in the art can easily implement it through conventional immunological assay methods such as those described in the following examples.

[0273] The so-called "conventional immunological assay method" is not particularly limited as long as it is a method for performing measurement using various antibodies regardless of the antigen. For example, flow cytometry (FACS), cell sorting attached thereto, Western blotting, ELISA (Enzyme linked immunosorbent assay), immunoprecipitation, SPR (Surface Plasmon Resonance) method, QCM (Quartz Crystal Microbalance) method, etc. can be cited.

[0274] As another form of antibody (I), it is preferably set as an antibody having the same epitope as the MMG49 antibody disclosed in the following examples. Most preferably, it is the same antibody as the MMG49 antibody. The production method of the MMG49 antibody can be referred to the following examples.

[0275] As another form of antibody (I), it is preferably set as an antibody in a form containing a heavy chain variable region and / or a light chain variable region. That is, antibody (I) can be set as containing only the heavy chain variable region alone, or can be set as containing only the light chain variable region alone. An antibody containing both a heavy chain variable region and a light chain variable region is preferred.

[0276] The variable region is also known as the antigen recognition site, and those skilled in the art understand that this variable region is an important site for the antibody to recognize antigens. Those skilled in the art also know that there are 3 regions called hypervariable regions (also known as complementarity-determining regions [CDR]) in this variable region, and these CDRs are very important regions most relevant to the antigen recognition function of the antibody.

[0277] The heavy chain variable region contained in other forms of antibody (I) contains any one or more of heavy chain CDR1, heavy chain CDR2, or heavy chain CDR3. That is, the heavy chain variable region may contain heavy chain CDR1, heavy chain CDR2, or heavy chain CDR3 alone, preferably contains at least heavy chain CDR3. More preferably, it is in a form that sequentially includes heavy chain CDR1, heavy chain CDR2, and heavy chain CDR3 from the amino terminus (N-terminus).

[0278] The light chain variable region can also be set to be the same as the heavy chain variable region. For example, it contains any one of light chain CDR1, light chain CDR2, or light chain CDR3, preferably contains at least light chain CDR3, and preferably sequentially includes light chain CDR1, light chain CDR2, and light chain CDR3 from the N-terminus of the light chain variable region.

[0279] Sometimes, the regions other than CDR1-3 in the respective heavy chain variable region and light chain variable region are called FR. More specifically, the region between the N-terminus and CDR1 is called FR1, the region between CDR1 and CDR2 is called FR2, the region between CDR2 and CDR3 is called FR3, and the region between CDR3 and the carboxyl terminus (C-terminus) is called FR4, and names are set for the heavy chain variable region and the light chain variable region respectively.

[0280] The amino acid sequences of the heavy chain CDR1-3 and the light chain CDR1-3 are not particularly limited. For example, the heavy chain CDR1-3 or the light chain CDR1-3 of the MMG49 antibody can be listed, that is

[0281] The heavy chain CDR1 having the amino acid sequence shown in SEQ ID NO: 1,

[0282] The heavy chain CDR2 having the amino acid sequence shown in SEQ ID NO: 2,

[0283] The heavy chain CDR3 having the amino acid sequence shown in SEQ ID NO: 3,

[0284] The light chain CDR1 having the amino acid sequence shown in SEQ ID NO: 6,

[0285] The light chain CDR2 having the amino acid sequence shown in SEQ ID NO: 7,

[0286] The light chain CDR3 having the amino acid sequence shown in SEQ ID NO: 8, etc.

[0287] As a preferred form of the heavy chain variable region containing the heavy chain CDR1 to CDR3, for example, there may be mentioned: the heavy chain variable region having the amino acid sequence shown in SEQ ID NO: 4 as the heavy chain variable region of the MMG49 antibody. In addition, as a preferred form of the light chain variable region containing the light chain CDR1 to CDR3, for example, there may be mentioned: the light chain variable region having the amino acid sequence shown in SEQ ID NO: 9 as the light chain variable region of the MMG49 antibody.

[0288] The amino acid sequences of the MMG49 antibody shown in SEQ ID NOs: 1 to 4 and 6 to 9 are shown in Table 1 below. The underlined portions in the amino acid sequences of each heavy chain and variable region shown in SEQ ID NOs: 4 and 9 in the table indicate the portions located in CDR1, CDR2, and CDR3 in sequence from the N-terminus.

[0289] [Table 1]

[0290]

[0291] The structure of antibody (I) is not limited. As specific structures, there may be mentioned: Fv, scFv, diabody, triabody, tetrabody, etc., and it may also be a structure formed by appropriately combining these. In addition, sometimes the structure formed by combining these is also included and called a fragment antibody. Furthermore, such a fragment antibody may be an artificially designed recombinant protein containing Fv, or may be an antibody fused with a biomolecule such as a protein.

[0292] Fv is also called the minimum structural unit of an antibody, and is a structure in which the heavy chain variable region and the light chain variable region are associated through non-covalent intermolecular interactions. In addition, it may also be a structure in which the thiol groups of cysteine residues present in the heavy chain variable region and the light chain variable region are disulfide-bonded to each other.

[0293] scFv is a structure in which the C-terminus of the heavy chain variable region and the N-terminus of the light chain variable region are connected by a linker, and is also called a single-chain antibody. In addition, the C-terminus and N-terminus connected by the linker may be reversed. Furthermore, scFv can also associate to form its structure through non-covalent intermolecular interactions and the like in the same way as Fv.

[0294] The so-called diabody, triabody, and tetrabody are structures in which the scFv forms a dimer, trimer, and tetramer, respectively, and is associated in the most stable state through non-covalent intermolecular interactions between variable regions in the same way as Fv and the like.

[0295] Regarding such antibodies (I) with various structures, those skilled in the art can easily manufacture them by using conventional genetic engineering methods to construct expression vectors and applying such expression vectors to expression systems using host cells such as prokaryotic cells (Escherichia coli, actinomycetes, etc.), eukaryotic cells (yeast cells, insect cells, mammalian cells, etc.), and conventional cell-free expression systems. The antibodies thus manufactured can also be obtained in a highly purified state by appropriately subjecting them to conventional purification steps.

[0296] As another form of antibody (I), it may also contain a constant region. By the constant region, those skilled in the art understand that if it is a heavy-chain constant region, it includes CH1, CH2, and CH3, and if it is a light-chain constant region, it includes CL. Additionally, the region containing CH2 and CH3 is sometimes referred to as the Fc domain.

[0297] The source of the specific constant region is not particularly limited. For example, it may include constant regions derived from humans, mice, rats, rabbits, monkeys, chimpanzees, etc., from animal species capable of large-scale production, animal species closely related to humans, and animal species that are difficult to generate immunogenicity even when administered to humans.

[0298] Among antibodies (I), when the heavy-chain variable region and / or the light-chain variable region has an amino acid sequence derived from a mouse, for example, by combining a constant region derived from a human, the antibody (I) can be made into a chimeric antibody.

[0299] In addition, by replacing the heavy-chain FR1-4 and / or the light-chain FR1-4 in the above chimeric antibody with an amino acid sequence derived from a human, the antibody (I) can be made into a humanized antibody.

[0300] Furthermore, within the range that does not weaken the function of the CDR, by replacing the heavy-chain CDR1-3 and / or the light-chain CDR1-3 in the humanized antibody with an amino acid sequence derived from a human, the antibody (I) can be made into a human antibody. In addition, the term "human antibody" is sometimes also referred to as "fully humanized antibody".

[0301] Regarding the structure of antibody (I) in the form containing a constant region, there are not only immunoglobulins with a structure consisting of one pair each of a heavy chain having a heavy-chain variable region and a heavy-chain constant region and a light chain having a light-chain variable region and a light-chain constant region to form a four-chain structure, but also structures such as Fab, F(ab')2, minibody, scFv-Fc, etc. can be cited. In addition, it can also be a structure appropriately combining these. Additionally, the structure formed by combining these is sometimes included and referred to as a fragment antibody. Furthermore, such a fragment antibody can also be an artificially designed recombinant protein containing Fv, and can also be an antibody fused with a biomolecule such as a protein.

[0302] The Fab has the following structure, which is a fragment of a heavy chain containing a variable region of the heavy chain and CH1 in the constant region of the heavy chain and a light chain containing a variable region of the light chain and a constant region of the light chain, and the variable region of the heavy chain and the variable region of the light chain are associated by the non-covalent intermolecular interaction or bonded by a disulfide bond. In addition, it can also be a structure in which CH1 and CL are disulfide-bonded to each other by the thiol groups of cysteine residues present in these respectively.

[0303] The F(ab')2 has the following structure, which has a pair of the above-mentioned Fabs, and CH1s are disulfide-bonded to each other by the thiol groups of cysteine residues contained in these.

[0304] The minibody has the following structure, which has a pair of antibody fragments containing the above-mentioned scFv and CH3, and such antibody fragments are associated with each other by non-covalent intermolecular interaction between CH3s.

[0305] The scFv-Fc has the following structure, which has a pair of antibody fragments containing the above-mentioned scFv, CH2 and CH3, and is associated with each other by non-covalent intermolecular interaction between CH3s in the same way as the above-mentioned minibody, and is disulfide-bonded to each other by the thiol groups of cysteine residues contained in each CH3.

[0306] For such an antibody (I) containing a constant region having various structures, those skilled in the art can also easily manufacture it in the same way as an antibody (I) not containing a constant region by using an expression system of a host cell that constructs an expression vector by using conventional genetic engineering methods and applies such an expression vector to antibody production. The manufactured antibody can also be obtained in a high-purity state by appropriately subjecting it to conventional purification steps.

[0307] In addition, if it is Fab, for example, it can also be obtained by decomposing IgG, which is an immunoglobulin, using a protease such as papain. Further, if it is F(ab')2, it can also be obtained by decomposing IgG using a protease such as pepsin.

[0308] In the antibody (I) containing the above-mentioned constant region, the preferred structure is an immunoglobulin. The subtype of such an immunoglobulin is not particularly limited, and examples thereof include: IgA, IgD, IgE, IgG, IgM, etc. Among these, IgG is preferred. For example, if it is mouse-derived IgG, IgG2 is preferred among the four subclasses.

[0309] Among the antibodies (I) containing the constant region, the antibodies in a further preferred form are antibodies containing a heavy chain having the amino acid sequence shown in SEQ ID NO: 5 and / or a light chain having the amino acid sequence shown in SEQ ID NO: 10. The most preferred antibody is an antibody containing a heavy chain having the amino acid sequence shown in SEQ ID NO: 5 and a light chain having the amino acid sequence shown in SEQ ID NO: 10.

[0310] The amino acid sequence may be an amino acid sequence obtained by introducing mutations according to the circumstances. Such mutations are preferably not introduced into the heavy chain CDR and the light chain CDR. That is, an amino acid sequence obtained by introducing mutations into the heavy chain FR and the light chain FR is preferred. When the antibody (I) contains a constant region, it may be an amino acid sequence obtained by further introducing mutations in addition to the mutations for adjusting the ADCC activity or the CDC activity shown below.

[0311] The number of amino acid residues into which specific mutations are introduced is not particularly limited. For example, the homology between the amino acid sequence before mutation introduction and the amino acid sequence after mutation introduction is about 70%, preferably about 75%, more preferably about 80%, more preferably about 85%, more preferably about 90%, more preferably about 95%, more preferably about 96%, more preferably about 97%, more preferably about 98%, and most preferably about 99%. In addition, such values are obtained by rounding.

[0312] The term "homology" refers to the degree of identity between two or more comparable amino acid sequences. Therefore, the higher the homology of two amino acid sequences, the higher not only the homology of these sequences but also the similarity can be said.

[0313] The homology of amino acids can be calculated using commercially available analysis tools or analysis tools available via the Internet (such as software such as FASTA, BLAST, PSI-BLAST, SSEARCH, etc.). For example, the main initial conditions generally used in BLAST searches are as follows. That is, in Advanced BLAST 2.1, the program uses blastp, sets the Expect value to 10, sets all Filters to OFF, uses the BLOSUM62 scoring matrix, sets the Gap existence cost, the Per residue gap cost, and the Lambda ratio to 11, 1, and 0.85 (default values), respectively, and sets other various parameters to default values for the search, whereby the homology value (%) of the amino acid sequence can be calculated.

[0314] The introduction of mutations into the amino acid sequence is substitution, deletion, insertion, etc. The specific introduction of mutations is not particularly limited as long as it can be achieved by using conventional methods. For example, in the case of substitution, conservative substitution techniques can be used.

[0315] The term "conservative substitution technique" refers to a technique in which an amino acid residue is substituted with an amino acid residue having a side chain similar to it.

[0316] For example, the substitution of amino acid residues having basic side chains such as lysine, arginine, and histidine with each other belongs to the conservative substitution technique. In addition, the substitution of amino acid residues having acidic side chains such as aspartic acid and glutamic acid with each other; the substitution of amino acid residues having uncharged polar side chains such as glycine, asparagine, glutamine, serine, threonine, tyrosine, and cysteine with each other; the substitution of amino acid residues having nonpolar side chains such as alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, and tryptophan with each other; the substitution of amino acid residues having β-branched side chains such as threonine, valine, and isoleucine with each other; the substitution of amino acid residues having aromatic side chains such as tyrosine, phenylalanine, tryptophan, and histidine with each other also belongs to the conservative substitution technique.

[0317] As another form of the antibody (I), the antibody (I) can be set as an antibody having cytotoxicity. The so-called cytotoxicity refers to the activity in which the antibody binds to a cell and as a result brings some toxicity to the bound cell.

[0318] As such cytotoxicity, for example, ADCC activity, CDC activity, etc. can be cited. The term "ADCC activity" is an abbreviation for Antibody-Dependent Cellular Cytotoxicity, and it is an activity in which cytotoxic cells such as NK cells that express receptors specific for the constant region of the antibody are found near the antibody, and toxicity to the cell bound by the antibody is induced by the action of such cells.

[0319] The term "CDC activity" is an abbreviation for Complement-Dependent Cytotoxicity, and it refers to the activity in which complement is found near the antibody, and the action of inducing toxicity to the cell bound by the antibody is induced by the action of the complement.

[0320] Here, whether it is ADCC activity or CDC activity, the cytotoxicity can be regulated by appropriately referring to documents such as Lazar GA et al., Proc Natl Acad Sci USA, 103:4005-10 (2006), Shields RL et al., J Biol Chem, 276:6591-604 (2001), Moore GL et al., J Immunol, 159:3613-21 (1997), An Z et al., MAbs, 1:572-9 (2009) and implementing mutations on the constant region.

[0321] For example, if the constant region is human IgG1, the ADCC activity can be increased by implementing mutations such as S239D, I332E, S239D / I332E, S239D / I332E / A330L, S298A, K334A, S298A / K334A, S298A / E333A / K334A.

[0322] In addition, similarly, when the constant region is human IgG1, the ADCC activity can be decreased by implementing mutations such as V234A / G237A, H268Q / V309L / A330S / P331S.

[0323] Regarding the CDC activity, when the constant region is human IgG1, if mutations such as S267E, H268F, S324T, S267E / H268F, S267E / S324T, H268F / S324T, S267E / H268F / S324T are implemented, the activity can be increased.

[0324] The ADCC activity can be measured according to the method of Brunner K.T. et al. (Brunner, K.T., et al., Immunology, 1968.14:181-96). For example, myeloma cells are cultured in RPMI1640 medium supplemented with 10% FCS (Fetal Calf Serum), and the cell number is prepared to be 0.5×10 4 ~1.0×10 4 cells. An appropriate amount of Na2 51 CrO4 is added thereto, and the reaction is carried out at 37 °C for 1 hour, and then using 51Cr-label the cells and wash them. Designate the obtained cells as target cells. As effector cells, use cells obtained by culturing bone marrow cells of SCID (Severe combined immune deficency) mice in RPMI 1640 supplemented with 10% FBS (Fetal Bovine serum), 10 ng / ml of mouse GM-CSF (Mouse Granulocyte-Macrophage Colony Stimulating Factor), and 40 IU / ml of human IL2 for 6 days, etc. Add the test antibody or its isotype antibody as a control to a 96-well culture plate at a final concentration of 0.05 - 10 μg / mL. Then add the target cells (1.0×10 4 cells) and effector cells (5×10 5 cells). React at 37°C for 4 hours, centrifuge, and measure the 51 Cr released into the supernatant using a γ-counter. The ADCC activity can be calculated based on the following formula.

[0325] ADCC activity = {( 51 Cr released from target cells] - 51 Cr spontaneously released in the absence of antibody]) / ( 51 Maximum 51 Cr release caused by adding 1% Triton X-100] - 51 Cr spontaneously released in the absence of antibody])} × 100

[0326] Regarding the CDC activity, it can also be measured according to the method of Brunner K.T. et al. (Brunner, K.T., et al., Immunology, 1968.14:181 - 96). For example, culture myeloma cells as target cells in RPMI 1640 medium supplemented with 10% FCS, and prepare the cell number to be 0.5×10 4 - 1.0×10 4 cells. Add an appropriate amount of Na2 51 CrO4, react at 37°C for 1 hour, label the cells with 51 Cr and wash them. Designate the obtained cells as target cells. Add the test antibody or its isotype antibody as a control suspended in RPMI 1640 medium supplemented with fetal bovine serum to a 96-well culture plate at a final concentration of 0.5 - 50 μg / mL. Then add the above target cells and complement, and let them react for 1.5 hours. Centrifuge the reaction solution, and measure the51 The Cr is assayed. The CDC activity can be determined based on the following formula.

[0327] CDC activity = {([51Cr released from the target cells] - 51 [51Cr spontaneously released in the absence of antibody]) / 51 [maximum 51Cr release caused by addition of 1% Triton X-100] - 51 [51Cr spontaneously released in the absence of antibody])} × 100 51

[0328] A cytotoxic antibody can be obtained, for example, by evaluating the presence or absence of cytotoxicity using the above method and selecting an antibody having such activity.

[0329] As another form of the antibody (I), a multispecific antibody can also be used. That is, it can be an antibody that is specific for an antigen other than the region containing amino acid residues 20 to 109 of human integrin β7 (hereinafter referred to as other antigen) and has a binding ability.

[0330] The other antigen is preferably an antigen that is not structurally similar to the region containing amino acid residues 20 to 109 of human integrin β7.

[0331] The specific other antigen is not particularly limited. For example, CD3, CD16, C1q, adenovirus knob domain, etc. can be mentioned, and at least one can be appropriately selected and used as the other antigen by appropriately combining them. It is preferred to select one of the antigens exemplified above as the other antigen. That is, it is preferred that the multispecific antibody is a bispecific antibody.

[0332] Regarding such a multispecific antibody, those skilled in the art can easily manufacture it by appropriately using conventional techniques. For example, prepare the following hybridomas, which are produced using antibody-producing cells such as B cells. The B cells are obtained from an animal immunized with a peptide fragment expressing the region containing amino acid residues 20 to 109 of human integrin β7, or a chimeric integrin β7 in which only the region containing amino acid residues 20 to 109 of human integrin β7 is of human origin and the rest is of non-human origin such as mouse. Another hybridoma is produced using antibody-producing cells such as B cells obtained from an animal immunized with the above other antigen, and the obtained hybridomas are fused with each other to obtain a new hybridoma (in the case of producing a bispecific antibody, it is also called a quadroma). The multispecific antibody can be obtained by screening the obtained new hybridomas by a conventional method.

[0333] In addition, for example, if it is a bispecific antibody, the bispecific antibody can also be produced in the order shown in (1) to (4) below:

[0334] (1) Produce an antibody with an F(ab')2 structure that has as its epitope the region containing amino acid residues 20 to 109 of human integrin β7;

[0335] (2) On the other hand, also produce an antibody with an F(ab')2 structure that specifically binds to another antigen in the same manner;

[0336] (3) After treating the antibodies with an F(ab')2 structure obtained in (1) and (2) with a reducing agent such as DTT, further treat any one of the treated products with Ellman's reagent;

[0337] (4) Mix and react the treated antibodies with an F(ab')2 structure obtained in (3).

[0338] A bispecific antibody can also be produced in the order shown in (A) to (D) below:

[0339] (A) Produce an antibody that has as its epitope the region containing amino acid residues 20 to 109 of human integrin β7.

[0340] (B) On the other hand, also produce an antibody that specifically binds to another antigen in the same manner.

[0341] (C) Identify the amino acid sequences of the respective variable regions and the base sequences of the polynucleotides encoding them obtained in (A) and (B).

[0342] (D) After producing an expression vector that incorporates the polynucleotides having the respective base sequences identified in (C), the base sequence of the constant region as needed, and the polynucleotide having a linker sequence, introduce it into a host cell suitable for antibody production such as a CHO cell.

[0343] As another form of antibody (I), it can be set as an antibody conjugated with a cytotoxin (a substance having cytotoxicity). A cytotoxin is not particularly limited as long as it is a substance that causes cell death, inhibits cell proliferation, or the like and brings some toxicity to cells.

[0344] Examples of such cytotoxins include alkylating agents such as cyclophosphamide hydrate, ifosfamide, thiotepa, busulfan, melphalan, nimustine hydrochloride, ranimustine, dacarbazine, temozolomide, etc.; metabolic antagonists such as methotrexate, pemetrexed disodium hydrate, fluorouracil, doxifluridine, capecitabine, tegafur, cytarabine, gemcitabine hydrochloride, fludarabine phosphate, nelarabine, cladribine, leucovorin calcium, etc.; antibiotics such as doxorubicin hydrochloride, daunorubicin hydrochloride, pirarubicin, epirubicin hydrochloride, idarubicin hydrochloride, aclacinomycin hydrochloride, amrubicin hydrochloride, mitoxantrone hydrochloride, mitomycin C, actinomycin D, bleomycin hydrochloride, peplomycin sulfate, zinostatin stimalamer, calicheamicin, etc.; microtubule inhibitors such as vincristine sulfate, vinblastine sulfate, vindesine sulfate, paclitaxel, etc.; aromatase inhibitors such as anastrozole, exemestane, letrozole, fadrozole hydrochloride hydrate, etc.; platinum preparations such as cisplatin, carboplatin, nedaplatin, oxaliplatin, etc.; topoisomerase inhibitors such as irinotecan hydrochloride hydrate, topotecan hydrochloride, etoposide, sobuzoxane, etc.; adrenocortical steroids such as prednisolone, dexamethasone, etc.; thalidomide and lenalidomide as its derivative; bortezomib as a protease inhibitor; radioactive isotopes such as 90-Ittrium.

[0345] Among these, calicheamicin, melphalan, vincristine sulfate, doxorubicin hydrochloride, prednisolone, dexamethasone, thalidomide, lenalidomide, and bortezomib are preferred, and calicheamicin, which has good actual results in binding to antibodies, is more preferred.

[0346] These cytotoxins are all commercially available, and one kind can be appropriately selected from them or two or more kinds can be selected in combination.

[0347] The binding mode of the cytotoxin and the above-mentioned antibody is not particularly limited. If conventional genetic engineering techniques or protein engineering techniques are appropriately used, those skilled in the art can easily bind the cytotoxin and the above-mentioned antibody. More specifically, examples include a method of binding to a functional group such as an amino group, a thiol group, a guanidyl group, a hydroxyl group, or a carboxyl group on the side chain of an amino acid residue of the antibody (I) via a linker.

[0348] The antibody (I) can be a polyclonal antibody or a monoclonal antibody. A monoclonal antibody is preferred.

[0349] The term "monoclonal" means obtained from a substantially homogeneous population, and a "monoclonal antibody" means an antibody obtained from such a population. That is, for each antibody contained in such a population, if naturally occurring mutations that may be present in trace amounts are excluded, they are understood to be the same.

[0350] In addition, regarding the specific binding target (epitope) of the antibody, for example, in the case of antibody (I), the specific binding target of the antibody is present in the region containing amino acid residues 20 to 109 of human integrin β7. In the case of a polyclonal antibody, the specific binding targets of the antibody are multiple sites in the region containing amino acid residues 20 to 109 of human integrin β7. In contrast, in the case of a monoclonal antibody, it exhibits high specificity at a single site, which is therefore more advantageous.

[0351] In addition, regarding the modifier "monoclonal" used as described above, it should be understood as being obtained from a substantially homogeneous population, rather than as a modifier that limits its manufacturing method.

[0352] Antibody (I) can be easily manufactured by those skilled in the art in addition to being manufactured by the above-described method, such as by using the hybridoma method, the recombinant DNA method using a host cell (III) carrying a polynucleotide (II) as shown below, or by individual isolation from a phage library.

[0353] For example, the following method can be cited: A peptide corresponding to the region containing amino acid residues 20 to 109 of human integrin β7 is immunized to animals suitable for antibody production, such as mice, rats, and rabbits. Subsequently, B cells are recovered and subjected to the hybridoma method, and screening is performed using the function exhibited by the above-described antibody (I) as an index, thereby manufacturing antibody (I).

[0354] In addition, the following method can be cited: A cell expressing a chimeric integrin β7 in which only the region containing amino acid residues 20 to 109 of integrin β7 is derived from human and the rest is derived from non-human sources such as mice is prepared, and it is used to immunize animals suitable for antibody production, such as mice, rats, and rabbits (preferably mice). Subsequently, B cells are recovered and subjected to the hybridoma method, and screening is performed using the function exhibited by the above-described antibody (I) as an index, thereby manufacturing antibody (I).

[0355] As the function exhibited by antibody (I), for example, the following can be cited: The affinity for the region containing amino acid residues 20 to 109 of human integrin β7 increases in the presence of at least a part of the region containing amino acid residues 380 to 721 of human integrin β7; it increases by activating human integrin β7, etc. Therefore, antibody (I) can also be obtained by the method shown in the following screening method (X) that utilizes such a function.

[0356] Antibody (I) has an epitope in the region encompassing amino acid residues 20 to 109 of human integrin β7. Therefore, it is expected that antibody (I) not only exerts the aforementioned ADCC activity and CDC activity on cells expressing this integrin β7, but also exerts cytotoxicity and the like on such cells by combining one or more of the activities such as apoptosis-inducing activity and survival signal-blocking activity. Therefore, the composition containing antibody (I) is useful as a pharmaceutical composition (VII) as described in detail below.

[0357] In particular, antibody (I) is an antibody having an epitope in the region encompassing amino acid residues 20 to 109 of human integrin β7, but the affinity of antibody (I) for the epitope increases upon activation of integrin β7. Activated integrin β7 is expressed in blood cells such as plasma cells. Therefore, antibody (I) can be used as an active ingredient of a pharmaceutical composition against these cancers (e.g., blood cancers). In particular, it can be effectively used as an active ingredient of a pharmaceutical composition against diseases (e.g., myeloma, multiple myeloma, etc.) in which the cells have mutations.

[0358] (II) Polynucleotide

[0359] Polynucleotide (II) is a polynucleotide having a base sequence encoding the amino acid sequence of the aforementioned antibody (I). The term "polynucleotide" includes, for example, single-stranded or double-stranded forms obtained by appropriately modifying ribonucleotides, deoxyribonucleotides, or any of these nucleotides by known methods.

[0360] Regarding the base sequence of polynucleotide (II), those skilled in the art can appropriately determine it based on the amino acid sequence of the aforementioned antibody (I) by computer simulation, for example. There is no limitation on the types of codons used to determine such a base sequence. It is preferable to determine the base sequence in consideration of the codon frequency of the host of the polynucleotide.

[0361] The specific base sequence of polynucleotide (II) is not particularly limited. The corresponding sequence numbers representing the amino acid sequences and the sequence numbers representing the base sequences encoding such amino acid sequences, which are specific as one of the forms of the aforementioned antibody (I), are shown in Table 2 below. That is, the preferred base sequences of polynucleotide (II) are the base sequences shown in SEQ ID NOs: 11 to 20.

[0362] [Table 2]

[0363] Amino acid sequence Base sequence Sequence number 1 Sequence number 11 Sequence number 2 Sequence number 12 Sequence number 3 Sequence number 13 Sequence number 4 Sequence number 14 Sequence number 5 Sequence number 15 Sequence number 6 Sequence number 16 Sequence number 7 Sequence number 17 Sequence number 8 Sequence number 18 Sequence number 9 Sequence number 19 Sequence number 10 Sequence number 20

[0364] Polynucleotide (II) can also be in a form incorporated into a vector. The vector is not particularly limited. For example, it can be a cloning vector or an expression vector, and its use is not restricted.

[0365] Alternatively, if it is a vector for expression, it can be a vector for prokaryotic cells such as Escherichia coli and Actinomycetes, or a vector for eukaryotic cells such as yeast cells, insect cells, and mammalian cells.

[0366] In addition, a base sequence encoding a signal peptide may be appropriately added to the 5'-terminal side of the polynucleotide (II) (the N-terminal side in the antibody (I)).

[0367] There is no particular limitation on the specific method of using the polynucleotide (II). For example, it can be introduced into the following host cell (III) to express the antibody (I).

[0368] (III) Host cell

[0369] The host cell (III) is a cell carrying the polynucleotide (II). The term "carrying" means maintaining the state in which the polynucleotide (II) exists within the cell, and means the state in which the cell does not spontaneously release the polynucleotide actively or passively to the outside of the cell.

[0370] There is no particular limitation on the form in which the host cell (III) carries the polynucleotide (II). For example, the polynucleotide can be carried in the form of a vector within the cell, or the polynucleotide (II) can be carried in an integrated form in the genome within the cell.

[0371] Regarding the specific cell type of the host cell (III), it can be a eukaryotic cell such as a yeast cell, an insect cell, or a mammalian cell, or a prokaryotic cell such as Escherichia coli or Actinomycetes, without particular limitation.

[0372] (IV) Chimeric antigen receptor

[0373] A chimeric antigen receptor is an artificial T cell receptor (TCR)-like protein, and is constructed in such a way that the antigen recognition site expressed on the cell membrane of a T cell (corresponding to the extracellular region) is replaced with a desired antigen recognition site, and can more effectively exert functions such as the cytotoxicity inherent to T cells.

[0374] The chimeric antigen receptor (IV) has the same epitope as the antibody (I). More specifically, it is a protein containing the antigen recognition site of the antibody (I). That is, the epitope present in the antigen recognition site contained in the chimeric antigen receptor can be set to be the same as the epitope detailed in the antibody (I).

[0375] More specifically, it is a protein in which the antigen recognition site of the antibody (I), a spacer sequence, a transmembrane domain, a co-stimulatory factor, and the cytoplasmic domain of a TCR are arranged in sequence from the N-terminus of the chimeric antigen receptor (IV).

[0376] The antigen recognition site of the antibody (I) configured in the chimeric antigen receptor (IV) can be set to the same as the antigen recognition site detailed in the antibody (I). Specifically, the heavy chain variable region and / or the light chain variable region can be cited. Among them, a structure that preferably has a heavy chain variable region and a light chain variable region and is scFv.

[0377] In such scFv, for example, a spacer sequence containing about 10 to 25 amino acid residues can be appropriately set between the heavy chain variable region and the light chain variable region. More preferably about 15 to 18. Such a spacer sequence can be set to the same as the spacer sequence configured in the chimeric antigen receptor (IV), or can be set to different from the spacer sequence configured in the chimeric antigen receptor (IV).

[0378] The spacer sequence configured in the chimeric antigen receptor (IV) is not particularly limited. For example, it can be set to a spacer sequence containing about 10 to 25 amino acid residues. More preferably about 15 to 18.

[0379] The transmembrane domain of the chimeric antigen receptor (IV) is not particularly limited. Specifically, it is possible to appropriately introduce mutations into the cell transmembrane domains derived from proteins such as CD28 and 4-1BB expressed in T cells, etc. and adopt them.

[0380] The co-stimulatory factor configured in the chimeric antigen receptor (IV) can be a co-stimulatory factor possessed by T cells, etc., and is not particularly limited. For example, it is possible to appropriately introduce mutations into 4-1BB, OX40, CD28, etc. and adopt them.

[0381] The cytoplasmic domain of the TCR of the chimeric antigen receptor (IV) is not particularly limited. For example, it is possible to appropriately introduce mutations into the cytoplasmic domains derived from CD3, etc. also known as the TCRζ chain and adopt them. In addition, regarding the introduction of mutations into CD3, it is preferably carried out in a manner that includes ITAM (Immunoreceptor Tyrosine-based Activation Motif).

[0382] The chimeric antigen receptor (IV) is preferably set to a chimeric antigen receptor having the amino acid sequence shown in SEQ ID NO: 21.

[0383] The amino acid sequence of the specific chimeric antigen receptor can be set to an amino acid sequence obtained by appropriately introducing mutations. In addition, the introduction of mutations into the transmembrane domain, co-stimulatory factor, and cytoplasmic domain of the TCR can also be set to the same. The specific number of mutations introduced is not particularly limited.

[0384] For example, the homology between the amino acid sequence before mutagenesis introduction and the amino acid sequence after mutagenesis introduction is about 70%, preferably about 75%, more preferably about 80%, more preferably about 85%, more preferably about 90%, more preferably about 95%, more preferably about 96%, more preferably about 97%, more preferably about 98%, and most preferably about 99%. In addition, such numerical values are obtained by rounding off.

[0385] The introduction of mutations into the amino acid sequence is substitution, deletion, insertion, etc. The specific introduction of mutations may be any mutation introduction achieved by conventional methods, and there is no particular limitation. For example, if it is substitution, conservative substitution techniques may be used.

[0386] In addition, when manufacturing such chimeric antigen receptors, those skilled in the art can easily manufacture them by referring to the methods described in Non-Patent Documents 4 to 6, etc.

[0387] (V) Polynucleotide

[0388] The polynucleotide (V) is different from the polynucleotide (II) and is a polynucleotide encoding the amino acid sequence of the chimeric antigen receptor (IV).

[0389] The base sequence of the polynucleotide (V) can be appropriately determined based on the amino acid sequence of the chimeric antigen receptor (IV), for example, by computer simulation, in the same manner as the polynucleotide (II). There is no limitation on the types of codons used to determine the base sequence. It is preferable to determine the base sequence considering the codon frequency of the cells to which the polynucleotide will be applied.

[0390] The specific base sequence is not particularly limited. For example, a polynucleotide having the base sequence shown in SEQ ID NO: 22 can be mentioned. The base sequence shown in SEQ ID NO: 22 is determined based on the amino acid sequence of the chimeric antigen receptor (IV) having the amino acid sequence shown in SEQ ID NO: 21. Of course, regarding the base sequence determined based on such an amino acid sequence, if the types of codons used are not limited, it is of course not limited to the base sequence shown in SEQ ID NO: 22.

[0391] In addition, a base sequence encoding a signal peptide can be appropriately added to the 5'-end side of the polynucleotide (V) (the N-terminal side of the chimeric antigen receptor (IV)).

[0392] The specific method of using the polynucleotide (V) is not particularly limited. For example, it can be mentioned that it is introduced into the following cell (VI) to express the chimeric antigen receptor (IV).

[0393] (VI) Cell

[0394] The cell (VI) is different from the host cell (III) and is a cell carrying the polynucleotide (V). The term "carrying" can be set to be the same as that of the host cell (III). The specific type of cell can also be set to be the same as that of the host cell (III), but preferably it has cytotoxicity. For example, T cells, NK cells, K cells, etc. can be listed, and among them, killer T cells (also called cytotoxic T cells [CTL]), which are a type of T cell, are most preferred.

[0395] Preferably, by expressing the polynucleotide (V) encoding the chimeric antigen receptor contained in the cell (VI), the antigen recognition site of the antibody (I) constituting the chimeric antigen receptor (IV) is exposed outside the cell, so that the transmembrane domain of the chimeric antigen receptor (IV), the costimulatory factor or the cytoplasmic domain of the TCR is locally present in the cell membrane or inside the cell.

[0396] Regarding these costimulatory factors or the regions locally present in the cell membrane or inside the cell, if the antigen recognition site of the antibody (I) binds to the region containing amino acid residues 20 to 109 of human integrin β7, a signal that causes cytotoxicity inside the cell will be activated. In addition, the affinity of the antibody (I) for the region containing amino acid residues 20 to 109 of human integrin β7 increases by activating human integrin β7. Therefore, the antibody (I) attacks or exerts cytotoxicity on cells or tissues expressing active integrin β7.

[0397] When the cell that exerts this function is a T cell, it is called a chimeric antigen receptor T cell (VI-4). In addition, regarding cells such as NK cells that may exert cytotoxicity, similar to the chimeric antigen receptor T cell, by linking the binding of the antigen recognition site to the region containing amino acid residues 20 to 109 of active human integrin β7 and the activation of a signal that causes cytotoxicity in the cell membrane or cytoplasmic domain, the same effect as that of the chimeric antigen receptor T cell can be exerted (it is called a chimeric antigen receptor NK cell).

[0398] As described above, the cell (VI) exerts cytotoxicity on cells or tissues expressing active integrin β7. Therefore, it can be considered that, similar to the antibody (I), the composition containing the cell (VI) is useful as a pharmaceutical composition (IV) as described in detail below. Active integrin β7 is expressed in blood cells such as plasma cells, so it can be used as an active ingredient of a pharmaceutical composition for cancer (for example, blood cancer). In particular, it can be effectively used as an active ingredient of a pharmaceutical composition for diseases that cause mutations in the cells (for example, myeloma, multiple myeloma, etc.).

[0399] (VII) Pharmaceutical composition

[0400] The pharmaceutical composition (VII) comprises the antibody (I) or the cell (VI). As the cell (VI), a chimeric antigen receptor T cell (VI-4) is preferred.

[0401] The content of the antibody (I) or the cell (VI) in the pharmaceutical composition (VII) is not particularly limited. For example, if it is the antibody (I), it can be set to about 0.001 parts by weight to 10 parts by weight relative to 100 parts by weight of the pharmaceutical composition. Additionally, if it is the cell (VI), it can be set to about 1 cell / mL to 10 4 cells / mL.

[0402] The administration method of the pharmaceutical composition (VII) is not particularly limited. Since the active ingredient is an antibody or a cell, parenteral administration or enteral administration is preferably used. Examples include intravenous administration, intramuscular administration, subcutaneous administration, etc., and intravenous administration is preferred.

[0403] Regarding the dosage form of the pharmaceutical composition (VII), it can be prepared together with a pharmaceutically acceptable conventional carrier according to the administration method. Considering the preferred administration method, an injection is preferably used.

[0404] The target disease of the pharmaceutical composition (VII) is not particularly limited. As specific target diseases, for example, cancer can be mentioned, preferably blood cancer, and further preferably a disease with neoplastic proliferation of plasma cell-producing. The term "disease with neoplastic proliferation of plasma cell-producing" is a disease characterized by neoplastic proliferation of abnormal plasma cells and an increase in abnormal proteins secreted by these. As such diseases, for example, myeloma, multiple myeloma, plasmacytic leukemia, plasmacytoma, heavy chain disease, systemic AL-type amyloidosis, etc. can be mentioned. In addition, in other embodiments, the target disease of the pharmaceutical composition (VII) can also be other hematological malignancies such as malignant lymphoma, leukemia, etc.

[0405] The administration subject (subject) of the pharmaceutical composition (VII) can be a patient suffering from the disease or an animal with the possibility of suffering from the disease. "Having the possibility of suffering" can be determined by the following diagnostic method (XI). The animal can be, for example, a mammalian animal, preferably a human.

[0406] Regarding the dosage of the pharmaceutical composition (VII), it varies depending on various conditions such as the degree of the disease of the administration subject, the degree of the expected effect by administration, body weight, gender, age, animal species, etc., and cannot be generalized. For example, when the active ingredient is the antibody (I), it is usually set to about 1 μg / kg (body weight) to 10 g / kg (body weight) per day. Additionally, if the active ingredient is the cell (VI), it can usually be set to 10 4cells / kg (body weight) to 10 9 cells / kg (body weight) or so.

[0407] Regarding the administration schedule of the pharmaceutical composition (VII), similar to the dosage of the pharmaceutical composition (VII), it varies depending on various conditions such as the degree of the disease of the administration subject and cannot be generalized. For example, it is preferably administered in such a way that the daily dosage is once a day to once a month.

[0408] (VIII) Method for treating or preventing a disease

[0409] The method for treating or preventing a disease (VIII) is a method for treating or preventing a disease that includes the step of administering a therapeutically effective amount of the antibody (I) or the cell (VI) to a subject. As the cell (VI), a chimeric antigen receptor T cell (VI-4) is preferred.

[0410] The subject can be set to be the same as the pharmaceutical composition (VII). In the case where the subject is a patient suffering from a disease, by administering a therapeutically effective amount of the antibody (I) or the cell (VI), its therapeutic effect is expected. In the case where the subject is an animal with a possibility of suffering from a disease, its preventive effect is expected. Prevention means a situation where the value measured by a conventional immunological method as shown in the following diagnostic method (XI) does not reach the value judged to have the disease.

[0411] The disease can be set to be the same as the pharmaceutical composition (VII). For example, cancer can be exemplified. As a preferred cancer, diseases with neoplastic proliferation of plasma cells (such as multiple myeloma, etc.) can be listed.

[0412] The therapeutically effective amount can be set to be the same as the dosage of the pharmaceutical composition (VII), and the preparation of the antibody (I) or the cell (VI) can be set to be the same as the dosage form of the pharmaceutical composition (VII). In addition, the administration method, administration schedule, etc. of the antibody (I) or the cell (VI) can also be set as detailed in the pharmaceutical composition (VII).

[0413] The method for treating or preventing a disease (VIII) can include a method for treating or preventing multiple myeloma targeting active human integrin β7. In addition, as the target, the applications of the antibody (I) or the cell (VI) described above can be listed.

[0414] (IX) Use

[0415] The use (IX) is the use of the antibody (I) or the cell (IV) for manufacturing a pharmaceutical composition.

[0416] The pharmaceutical composition can be set to be the same as the pharmaceutical composition (VII). In addition, the cell (IV) is preferably a chimeric antigen receptor T cell (VI-4).

[0417] In addition, the target diseases of the pharmaceutical compositions are also the same. For example, it can be mentioned: for the treatment of cancer, preferably blood cancer, and more preferably diseases with neoplastic proliferation of plasma cell-producing (such as myeloma, multiple myeloma, etc.).

[0418] In addition, the content of the antibody (I) or the cell (VI) as the active ingredient in the pharmaceutical composition, the dosage form thereof, the administration method, the administration schedule, etc. can also be set to be the same as those detailed in the pharmaceutical composition (VII).

[0419] (X) Screening method

[0420] The screening method (X) is a screening method for the active ingredient of a pharmaceutical composition for the treatment or prevention of diseases with neoplastic proliferation of plasma cell-producing. This method includes the following steps: screening a candidate substance that specifically binds to human integrin β7 and binds to the region containing amino acid residues 20 to 109 of human integrin β7 from a compound library.

[0421] The pharmaceutical composition can be set to be the same as the pharmaceutical composition (VII). The active ingredient of a pharmaceutical composition for the treatment or prevention of cancer, preferably blood cancer, and more preferably diseases with neoplastic proliferation of plasma cell-producing (such as myeloma, multiple myeloma, etc.), for example, can be the antibody (I).

[0422] The compound library is not particularly limited, and existing libraries can be used. An antibody library is preferred. Preferably, a hybridoma as described below is used as the library, and this hybridoma is produced using antibody-producing cells such as B cells obtained from an animal immunized with the required antigen.

[0423] Here, the required antigen is not particularly limited. For example, the region containing amino acid residues 20 to 109 of human integrin β7 is preferred. Active human integrin β7 is more preferred.

[0424] The method for screening candidate substances is not particularly limited. For example, the following method can be adopted: screening candidate substances that specifically bind to human integrin β7, and using conventional immunological assay methods to confirm binding to a peptide fragment corresponding to the region containing amino acid residues 20 to 109 of human integrin β7, thereby screening candidate substances.

[0425] Alternatively, the following method can also be adopted: screening candidate substances that specifically bind to human integrin β7, and then using conventional immunological assay methods to confirm candidate substances that bind to cells of chimeric integrin β7 in which only the region containing amino acid residues 20 to 109 of integrin β7 is derived from human and the rest is derived from non-human sources such as mice as described in detail in the antibody (I), thereby screening candidate substances.

[0426] Alternatively, the following method can also be adopted: screening candidate substances that specifically bind to human integrin β7, and then treating cells of chimeric integrin β7 in which only the region containing amino acid residues 20 to 109 of integrin β7 is derived from human and the rest is derived from non-human sources such as mice as described in detail in the antibody (I) with phorbol esters, manganese salts, etc., and confirming candidate substances with increased binding levels before and after treatment, thereby screening candidate substances.

[0427] Alternatively, the following method can also be adopted: screening candidate substances that specifically bind to human integrin β7, and then preparing cells in which the region containing amino acid residues 111 to 378 of human integrin β7 is replaced with that derived from mice and chimeras in which the region containing amino acid residues 110 to 721 of human integrin β7 is replaced with that derived from mice as described in detail in the antibody (I), and confirming candidate substances with high binding levels to the former, thereby screening candidate substances.

[0428] In addition, the screening method (X) may also include the following steps: screening candidate substances using cytotoxicity as an index. The cells specifically targeted for confirming cytotoxicity are not particularly limited. For example, hemocytes expressing active human integrin β7 with characteristics in the PSI domain of the human integrin β7 can be cited.

[0429] Here, when the screened candidate substance is an antibody, the step of screening candidate substances using cytotoxicity as an index can also be used as a step for screening antibodies with ADCC activity or CDC activity.

[0430] The candidate substances screened by the screening method (X) as described above are preferably antibodies, more preferably monoclonal antibodies. Most preferably, it is the antibody (I).

[0431] (XI) Diagnostic method

[0432] The diagnostic method (XI) is a diagnostic method for cancer, including the step of contacting a sample collected from a subject with the antibody (I).

[0433] The subject can be set to be the same as the subject described in detail in the disease treatment or prevention method (VIII).

[0434] Samples collected from a subject may be set as blood or bone marrow fluid.

[0435] There is no particular limitation on the specific diagnostic method. For example, it may be exemplified that when cells bound to the antibody (I) are detected, it is determined that the subject has cancer or is likely to have cancer.

[0436] Regarding the degree of binding, those skilled in the art can easily determine it by using conventional immunological assay methods. Whether the subject has cancer or is likely to have cancer can be determined based on the degree measured herein.

[0437] There is no particular limitation on the diagnosis of specific cancer. For example, in the case of blood cancer, and more preferably when the cells bound to the antibody (I) are plasma cells, it can be determined that the subject has a disease of neoplastic proliferation that produces plasma cells (such as myeloma, multiple myeloma, etc.) or is likely to have it.

[0438] (XII) Kit

[0439] The kit (XII) is a diagnostic kit for cancer containing the antibody (I).

[0440] There is no particular limitation on the cancer, which may be set as the same cancer as that detailed in the pharmaceutical composition (VII), preferably blood cancer, and more preferably a disease of neoplastic proliferation that produces plasma cells (such as myeloma, multiple myeloma, etc.).

[0441] In addition, a guide may be appropriately attached to the kit (XII). In such a guide, the method detailed in the diagnostic method (XI) may be recorded as the diagnostic criterion for cancer.

[0442] [Embodiment]

[0443] The following are examples for more specifically explaining the present invention. In addition, the present invention is of course not limited to the examples shown below.

[0444] Test method: Flow cytometry and sorting

[0445] In the following examples, the flow cytometry (FACS) analysis used for sorting cells was performed according to the following key points.

[0446] Bone marrow single cells were collected from the iliac bone of myeloma patients who had given informed consent, and the bone marrow single cells were suspended in ACK solution (150 mM NH4Cl and 10 mM KHCO3), and red blood cells were removed by allowing them to stand at 4°C for 3 minutes. After washing the bone marrow single cells after removal with PBS supplemented with 2% fetal bovine serum, they were blocked in PBS containing 10% human AB serum at 4°C for 20 minutes to prevent non-specific antibody binding.

[0447] Thereafter, each antibody labeled with a fluorescent dye (see below) was added thereto, and the cells were stained at 4°C for 30 minutes. Subsequently, after washing with PBS, the cells were suspended in PBS containing 1 μg / ml propidium iodide (PI), and then subjected to FACS analysis. Analysis and cell sorting of the cells were performed using a FACS Aria cell sorter (manufactured by Becton Dickinson Immunocytometry Systems).

[0448] For cell staining, the following monoclonal antibodies were appropriately selected and used.

[0449] · APC (Antigen presenting cell) conjugated anti - human CD34 antibody (manufactured by BD Pharmingen) · PE - Cy7 conjugated anti - human CD34 antibody (manufactured by BD Pharmingen) · APC / Cy7 conjugated anti - human CD19 antibody (manufactured by Biolegend) · FITC (Fluorescein Isothiocyanate) conjugated anti - human CD38 antibody (manufactured by eBioscoience) · APC conjugated anti - human CD138 antibody (manufactured by Biolegend) · PE - Cy7 conjugated anti - human CD3 antibody (manufactured by Biolegend) · FITC conjugated anti - human CD14 antibody (manufactured by BD Pharmingen) · PE / Cy7 conjugated anti - human CD45 antibody (manufactured by Biolegend).

[0450] [Example 1]

[0451] Preparation of a monoclonal antibody library that binds to myeloma cell lines but not to healthy human peripheral blood

[0452] In antibody therapy for multiple myeloma, it is important to use antibodies that bind to myeloma cells but not to normal blood cells. For this, such antibodies are identified in the following way. First, more than 10,000 clones of monoclonal antibodies that bind to various myeloma cell lines are produced using the following method.

[0453] Six human myeloma cell lines (MM.1s cells, RPMI8226 cells, INA6 cells, U266 cells, OPM2 cells, and KMS12BM cells) were used as antigens, and the footpads of Balb / c mice were immunized twice a week for 2 - 3 weeks. Thereafter, the popliteal lymph nodes were removed to prepare a cell suspension, which was fused with SP2 / 0 mouse myeloma cell line cells to prepare hybridomas. Cell fusion was carried out using the polyethylene glycol method (PEG method). Thereafter, hybridomas (>10,000 clones) were selected by culturing the cells in hypoxanthine - aminopterin - thymidine medium (HAT medium).

[0454] Finally, using the culture supernatant of the hybridomas, FACS was used to select the supernatant containing antibodies that bind to the myeloma cell lines used for immunization and do not bind to single cells derived from healthy human peripheral blood. As a result, approximately 200 clones were candidates for antibodies specific to myeloma cells. After proliferating the hybridomas expressing these, they were cryopreserved.

[0455] [Example 2]

[0456] Identification of antibodies that specifically bind to myeloma cells in the bone marrow of human multiple myeloma patients

[0457] Using the approximately 200 - clone candidate antibodies obtained in Example 1 above, bone marrow cells derived from myeloma patients were stained and analyzed using FACS.

[0458] Each candidate antibody was added to bone marrow cells derived from multiple myeloma patients, cultured at 4°C for 30 minutes, then washed, and a PE - conjugated anti - mouse IgG antibody was added as a secondary antibody, and further cultured at 4°C for 30 minutes. After washing, finally, staining was carried out using an APC - conjugated anti - human CD138 antibody, a FITC - conjugated anti - human CD38, or a PE / Cy7 - conjugated anti - human CD45 antibody. As a negative control, a sample obtained by adding an isotype control instead of the candidate antibody was prepared simultaneously.

[0459] These were analyzed using FACS, and thereby selected those that, although they bind to CD45 - CD38 ++ CD138 + myeloma plasma cells and CD45 -CD38 ++ CD138 - antibodies that bind to myeloma progenitor cells but not to CD45 + and blood cells.

[0460] As a result, the MMG49 antibody was identified as an antibody that satisfies the above conditions ( Figure 1 and Figure 2 ). For each bar graph in the figure, the Y-axis represents the number of cells and the X-axis represents the binding intensity of the MMG49 antibody.

[0461] [Example 3]

[0462] Identification of the antigen protein that binds to the MMG49 antibody

[0463] Identification of the antigen protein that binds to the MMG49 antibody by expression cloning method.

[0464] First, using the superscript choice system for cDNA synthesis (Invitrogen), a cDNA library was prepared from MM.1s cells known to bind to the MMG49 antibody, and inserted into the pMXs retroviral vector using a BstXI linker (Invitrogen) (provided by Mr. Toshio Kitamura of the Institute of Medical Science, the University of Tokyo). The cDNA library prepared in this way was introduced into plat-E cells (distributed by Mr. Toshio Kitamura), and the resulting retrovirus was used to infect BaF3 cells, thereby obtaining BaF3 cells expressing the cDNA library derived from MM.1s.

[0465] Next, these cells were stained with the MMG49 antibody, and positive cells were sorted by FACS to repeatedly concentrate the cells ( Figure 3 ). After the third sorting, most of the cells became cells that bind to the MMG49 antibody. Then, the insert of the retrovirus possessed by these cells was amplified by PCR and sequenced, and as a result, the base sequence was identified, and it was clarified that the insert retained by the cells was ITGB7.

[0466] [Example 4]

[0467] Confirmation that the binding antigen of the MMG49 antibody is the ITGB7-expressing protein by generating ITGB7-deficient myeloma cells

[0468] Production of ITGB7-deficient U266 myeloma cell line using the Crisp-Cas9 system.

[0469] First, a vector was prepared by inserting a double-stranded DNA sequence of an ITGB7-specific target sequence into the PX330 (Addgene) vector. It and a vector for a selection agent, i.e., a linear hygromycin-resistant gene expression vector (Clontech), were co-introduced into U266 cells using Nucleofector (registered trademark) II (Lonza). Thereafter, for the resulting clones in a medium supplemented with hygromycin, the expression of ITGB7 was stained using the FIB27 antibody (anti-integrin β7 antibody; Biolegend), and analyzed by FACS, whereby ITGB7-deficient cells were identified.

[0470] Second, the obtained ITGB7-deficient cells were stained with the MMG49 antibody and analyzed by FACS. As a result, the MMG49 antibody bound to wild-type U266 cells, whereas in the ITGB7-deficient strain, the binding of the MMG49 antibody completely disappeared ( Figure 4 ). This indicates that MMG49 binds only to the ITGB7-expressing protein (integrin β7).

[0471] Third, after immunoprecipitation from a lysate of MM1s myeloma cells using the MMG49 antibody, SDS-PAGE was performed, and then WB was performed using an anti-integrin β7 antibody (Miltenyi). As a result, integrin β7 was detected in the immunoprecipitate of the MMG49 antibody ( Figure 5 ). This indicates that the MMG49 antibody binds to integrin β7.

[0472] [Example 5]

[0473] Determination of the binding pattern of the MMG49 antibody in each cell fraction of healthy human peripheral blood and the bone marrow of myeloma patients

[0474] Using a commercially available anti-integrin β7 antibody (FIB27 antibody; Biolegend) and the MMG49 antibody, the binding to various cell components in healthy human peripheral blood and bone marrow cells was measured.

[0475] Using HES40, after removing red blood cells from peripheral blood cells derived from healthy humans, an Fc receptor blocking reagent (Miltenyi) was added to block the binding of non-specific antibodies. Thereafter, the MMG49 antibody or the FIB27 antibody, or mouse IgG2a as an isotype control, was added, and after culturing at 4°C for 30 minutes, washing was performed. An anti-mouse IgG antibody conjugated with PE as a secondary antibody was added, and further cultured at 4°C for 30 minutes.

[0476] After washing these, they were finally stained with APC / Cy7-conjugated anti-human CD19 antibody, FITC-conjugated anti-human CD14 antibody, and PE / Cy7-conjugated anti-human CD3 antibody. The stained cells were analyzed using FACS, and thereby the binding of MMG49 antibody and FIB27 antibody in each fraction was measured ( Figure 6 ).

[0477] In addition, similarly, those obtained by adding 1 μl of peripheral blood of a healthy person to 100 μl of PBS (containing EDTA) were stained with MMG49 antibody or FIB27 antibody, and finally stained with Pacific blue-conjugated anti-human CD235 antibody (manufactured by BD Pharmingen) or FITC-conjugated anti-human CD41 antibody (manufactured by BD Pharmingen). Thus, whether each antibody binds to CD235 + red blood cells and platelets was also studied by FACS analysis ( Figure 6 ). These results showed that FIB27 antibody binds strongly to most lymphoid cells, whereas MMG49 antibody binds very weakly to the normal blood cells described above.

[0478] Furthermore, in order to clarify whether there is binding of MMG49 antibody to each normal cell fraction other than myeloma cells in the bone marrow, myeloma patient bone marrow cells were similarly stained with MMG49 antibody, and finally stained with APC-conjugated anti-human CD34 antibody (manufactured by BD Pharmingen), Alexa647-conjugated human CD3 (manufactured by BD Pharmingen), Cy7APC-conjugated anti-human CD19 antibody (manufactured by BD Pharmingen), PE-Cy7-conjugated anti-human CD38 antibody (manufactured by BD Pharmingen), or FITC-conjugated anti-CD14 human antibody (manufactured by BD Pharmingen). The stained bone marrow cells derived from myeloma patients were analyzed using FACS, and thereby the binding of MMG49 antibody in each fraction was measured ( Figure 7 ). These results showed that MMG49 antibody binds firmly to myeloma cells, whereas it hardly binds to all normal blood cells including hematopoietic stem cell and progenitor cell fractions.

[0479] [Example 6]

[0480] Analysis of the binding of MMG49 to various cell lines

[0481] The binding of MMG49 antibody and FIB27 antibody in various cell lines (MM1s cells, U266 cells, RPMI8226 cells, and JJN3 cells) was analyzed using FACS. The staining method was the same as that for peripheral blood and the like shown in Example 5 above.

[0482] It is known that integrin β7 forms a heterodimer with integrin α4 or integrin α E and is expressed on the cell surface. Therefore, Alexa647-conjugated anti-human CD49d antibody (Biolegend) and APC-conjugated anti-human CD103 antibody (Biolegend) were used, and FACS was also used to analyze the expression of these. In addition, CD103 represents integrin α E , and CD49d represents integrin α4. In addition, in the same manner as in Example 5 above, the expression levels of integrin α E and integrin α4 in peripheral blood from healthy individuals were also studied ( Figure 8 ).

[0483] As a result, ITGA4 was expressed in most myeloma cell lines, while ITGAE was not expressed in all cell lines. The FIB27 antibody bound to all myeloma cell lines, but the binding of the MMG49 antibody was inconsistent with the expression level of the FIB27 antibody. In addition, using FACS, the binding of the MMG49 antibody and FIB27 antibody to ITGA4-deficient U266 cells prepared using the Crisp-Cas9 system was studied, and as a result, the binding to U266 cells disappeared due to ITGA4 deficiency. That is, it was found that both the MMG49 antibody and the FIB27 antibody recognize β7 integrin expressed as α4β7 integrin.

[0484] [Example 7]

[0485] Analysis of the association between integrin activation and the binding of the MMG49 antibody

[0486] Considering the specific binding mode of the MMG49 antibody, it is speculated that the MMG49 antibody recognizes integrin β7 whose structure has changed due to activation.

[0487] For this, K562 cells that forcibly express α4β7 and human normal peripheral blood CD4 T cells concentrated using a CD4 T cell enrichment kit (BD pharmingen) were washed with 5 mM EDTA (Ethylenediamine tetraacetic acid) / HBS, and then in 1 mM Ca 2+ / 1 mM Mg 2+ / HBS (low-activity buffer) or 2 mM Mn 2+In / HBS (activation buffer), after culturing together with MMG49 antibody or FIB27 antibody at room temperature for 30 minutes, wash, add PE-conjugated anti-mouse IgG antibody as the secondary antibody, and then culture at room temperature for 30 minutes. Analyze these by FACS, and thereby measure the binding of MMG49 antibody and FIB27 antibody in the cells in which integrin α4β7 is activated.

[0488] As a result, it was observed that the binding of MMG49 antibody was enhanced in the presence of Mn 2+ ( Figure 10 ). On the other hand, for FIB27 antibody, no such change was found. This suggests that MMG49 antibody may be an antibody specific to activated integrin β7.

[0489] [Example 8]

[0490] Identification of the epitope required to recognize the MMG49 antibody

[0491] To identify the epitope recognized by MMG49 antibody, 8 kinds of human / mouse chimeric integrin β7 protein expression vectors as shown in Figure 11 were prepared using the overlapping PCR method.

[0492] Each expression vector was introduced into 293T cells by lipofection, and after 48 hours, it was analyzed whether MMG49 antibody bound. Suspend the cells in PBS supplemented with 1% fetal bovine serum, add MMG49 antibody, and let stand at room temperature for 30 minutes. After washing, add Alexa488-anti-mouse IgG antibody, let stand at room temperature for 30 minutes, and then analyze by FACS.

[0493] As a result, it was clarified that MMG49 antibody binds firmly to chimeric integrin β7 protein (#4960) almost in the same manner as in the case of chimeric integrin β7 protein (#4927) whose full length is derived from human. This chimeric integrin β7 protein is a sequence in which the region containing amino acid residues 110 - 721 is derived from mouse and the remaining regions (the region containing amino acid residues 20 - 109 and the region containing amino acid residues 722 - 798) are derived from human Figures 11 - 13 .

[0494] Since the region containing amino acid residues 722 - 798 contains a transmembrane domain (TM) and a cytoplasmic domain, and further the region containing amino acid residues 1 - 19 is a signal peptide, it indicates that the epitope necessary for the binding of MMG49 antibody exists in the region containing amino acid residues 20 - 109 which contains a PSI domain.

[0495] It is further specified that, compared with the chimeric integrin β7 protein (#4961) and the chimeric integrin β7 protein (#4960), the binding ability of the MMG49 antibody increases slightly and becomes the same binding level as that of the chimeric integrin β7 protein (#4927) which is entirely derived from humans. In this chimeric integrin β7 protein, the region containing amino acid residues 110 to 378 is derived from mouse, and the regions containing amino acid residues 20 to 109 and 379 to 798 are derived from humans.

[0496] Furthermore, it is specified that, compared with the chimeric integrin β7 protein (#4944), the chimeric integrin β7 protein (#4945), the chimeric integrin β7 protein (#4946), and the chimeric integrin β7 protein (#4947), the binding ability of the MMG49 antibody increases slightly. For the chimeric integrin β7 protein (#4944), the region containing amino acid residues 1 to 378, which includes the region containing amino acid residues 20 to 109 including the epitope of the MMG49 antibody and the region containing amino acid residues 1 to 19 corresponding to the signal peptide, is derived from mouse, and the region containing amino acid residues 379 to 798 is derived from humans; for the chimeric integrin β7 protein (#4945), the region containing amino acid residues 1 to 416 is derived from humans, and the region containing amino acid residues 417 to 798 is derived from humans; for the chimeric integrin β7 protein (#4946), the region containing amino acid residues 1 to 563 is derived from mouse, and the region containing amino acid residues 564 to 798 is derived from humans; for the chimeric integrin β7 protein (#4947), the region containing amino acid residues 1 to 721 is derived from mouse, and the region containing amino acid residues 722 to 798 is derived from humans.

[0497] In view of the above experimental results, it is specified that the specific binding ability, i.e., the affinity, of the MMG49 antibody for the region containing amino acid residues 20 to 109 of integrin β7 increases due to the presence of the region containing amino acid residues 379 to 721 of human integrin β7, i.e., in the region containing amino acid residues 379 to 721 of human integrin β7.

[0498] [Example 9]

[0499] Determination of the base sequence of the antibody molecule variable region of the MMG49 antibody

[0500] The confirmation of the subclass of the MMG49 antibody was carried out using an isotyping kit (Roche), and the result was confirmed to be the IgG2a subclass. Furthermore, the base sequence and amino acid sequence of the variable region of the MMG49 antibody were determined.

[0501] The method for sequence determination was carried out using the Smarter RACE cDNA Amplification Kit (Clontech). That is, using the cDNA prepared from the mRNA derived from the hybridoma MMG49 that produces the MMG49 antibody as a template, the cDNA fragments of the variable regions of the H chain and κ chain were amplified by PCR reaction, and their base sequences were decoded. The amino acid sequences, base sequences, and hypervariable regions (CDR1-3) of the decoded H chain variable region are shown in Tables 3 and 4 below.

[0502] The amino acid sequences, base sequences, and hypervariable regions (CDR1-3) of the decoded L chain (κ chain) variable region are also shown in Tables 3 and 4 below.

[0503] To confirm the specificity of the variable region sequence of the separately isolated MMG49 antibody, a chimeric antibody was prepared by binding the variable region sequence cDNA to the constant region of human IgG4 and the constant region sequence of the κ chain of human IgL. Specifically, using the In-Fusion cloning kit (Takara), after inserting each variable region sequence into pFuse-CH-Ig-hG4 and pFuse-CL-Ig-hk (invivogen), these were introduced into FreeStyle CHO-S cells (Invitrogen), and the chimeric antibody secreted into the culture supernatant was recovered. Subsequently, MM1s cells that bind to the MMG49 antibody and KMS12BM cells that do not bind to the MMG49 antibody were cultured in a buffer containing MMG49-hIgG4, washed, biotinylated anti-human IgG (Rockland) was added as a secondary antibody, washed again, and streptavidin-PE (Biolegend) was added, followed by staining and FACS analysis. As a result, MMG49-hIgG4 showed the same staining pattern as the original MMG49 antibody, indicating that the obtained variable region sequence is correct ( Figure 14 ).

[0504] [Table 3]

[0505]

[0506] [Table 4]

[0507]

[0508] [Example 10]

[0509] Production of chimeric antigen receptor T cells using the antibody molecule variable region of the MMG49 antibody

[0510] The production of chimeric antigen receptor T cells (hereinafter referred to as MMG49 antibody-derived chimeric antigen receptor T cells) using the variable region sequence of the MMG49 antibody molecule is carried out in the following order with reference to Non-Patent Documents 2 to 4 and the like.

[0511] (1) Cloning of CD28 and CD3z:

[0512] RNA was collected from Jurkat cells using Trizol (Invitrogen), and then cDNA was prepared using the Superscript III cDNA synthesis kit (Invitrogen). Then, using this as a template, the cDNAs of CD28 and CD3z were amplified by PCR, cloned and sequenced using the TA cloning kit (Invitrogen) respectively, and the base sequences of these were confirmed.

[0513] (2) Binding of the four fragments of VL / VH derived from the MMG49 antibody and CD28 / CD3z:

[0514] Using the overlap PCR method, the VL region, VH region derived from the MMG49 antibody and the respective gene fragments of the cloned CD28 and CD3z were combined to prepare chimeric cDNA. The order and the primers used are shown in Figure 15 . The base sequences of the primers used are shown in Table 5 below.

[0515] [Table 5]

[0516] Number Primer name Base sequence 23 49_car_vk-s5 gaattccaccatggattttcaagtgcagatt 24 49_car_vk-as6 gccggaaccgctagtggagccccgtttgatttccagcttggt 25 593_car_vk_as4 gctgccttctccgctgccaggtttgccggaaccgctagtggagcc 26 49_car_vh-s5 aaacctggcagcggagaaggcagccaggttcagctgcagcagtc 27 49_car_vh-as6 tgaggagacggtgaccgtgg 28 49_VKVH28as8 atacataacttcaattgcggccgctgaggagacggtgaccgtgg 29 49carinfus1 ctaggcgccggaattccaccatggattttc 30 tcrzcarinfuas4 aatgtcgacctcgagtggctgttagcgag

[0517] The combined chimeric cDNA was cloned using the Zeroblunt PCR cloning kit (Invitrogen) and then sequenced to confirm the base sequence. In addition, the amino acid sequence (SEQ ID NO: 21) and its base sequence (SEQ ID NO: 22) confirmed based on the confirmed base sequence are shown in the sequence listing. In addition, the amino acid sequence shown in SEQ ID NO: 21 does not contain the Kozak sequence (gaattccacc) shown in SEQ ID NO: 23, and is converted to an amino acid sequence starting from the start codon (atg) immediately following it.

[0518] (3) Insertion into the expression vector:

[0519] Subsequently, the chimeric cDNA combined in (2) was cut out with two restriction enzymes, EcoRI / SalI, and inserted into the MSCV-ires-GFP vector.

[0520] Using Lipofectamine 2000 (Invitrogen), the chimeric antigen receptor cDNA retroviral vector derived from the MMG49 antibody prepared by the above method, together with the gag / pol and VSV-G envelope expression vectors, were co-introduced into 293T cells to produce retroviruses. 48 hours after gene introduction, the supernatant was collected and used as the virus solution.

[0521] (4) Introduction into T cells:

[0522] Subsequently, the introduction of the cDNA of the chimeric antigen receptor derived from the MMG49 antibody into human T cells was carried out by the following method.

[0523] First, human peripheral blood mononuclear cells were added to a 48-well culture plate coated with anti-CD3 antibody (eBioscience) and cultured for 72 hours. The culture medium used was the one obtained by adding 10% human AB serum and IL-2 (175 IU / L) to X-VIVO15 (Lonza) to stimulate the peripheral blood mononuclear cells. Thereafter, the virus solution prepared above was added to a 48-well culture plate coated with fibronectin (Retronectin) (Takara), and centrifuged at 1700×g for 120 minutes. After the fibronectin adsorbed the virus, the stimulated peripheral blood mononuclear cells (including T cells) were added, and gene introduction was performed on them. Thereafter, the cells were continuously cultured in the above medium to expand the chimeric antigen receptor T cells derived from the MMG49 antibody and used for the following studies. T cells expressing the CAR construct using the variable region of the MMG49 antibody were stained with PE-anti-human F(ab')2 antibody (Jackson Laboratory), and as a result, it was detected that the expression of human F(ab')2 was proportional to the expression of GFP indicating the introduction of the construct ( Figure 16 ). That is, it was confirmed that the expression occurred on the surface of the introduced CAR cells.

[0524] [Example 11]

[0525] Recognition of ITGB7-expressing tumor cells by chimeric antigen receptor T cells derived from the MMG49 antibody and Analysis of cytotoxicity

[0526] The chimeric antigen receptor T cells derived from the MMG49 antibody prepared by the above method or control T cells transfected only with GFP were co-cultured with K562 cells that did not express integrin β7 or K562 cells that forcibly expressed integrin α4β7, and the amount of cytokines produced was quantified. Specifically, 1×10 5Cells were added to a 96-well culture plate. After 24 hours, the supernatant was recovered, and the production of IFN-γ was measured by ELISA. The measurement was performed using a Quantikine kit (R&D). As a result, higher production of IFN-γ and IL-2 was found only in the co-culture of K562 cells that forcibly expressed integrin α4β7 and chimeric antigen receptor T cells derived from the MMG49 antibody, compared to the control group (T cells obtained by culturing stimulated peripheral blood single cells transfected with a GFP expression vector in the same manner)( Figure 17 ).

[0527] Next, chimeric antigen receptor T cells derived from the MMG49 antibody or control T cells transfected only with GFP were co-cultured with myeloma cell lines (MM.1s cells, RPMI8226 cells, and JJN3 cells) that bind to the MMG49 antibody or cells that do not bind to the MMG49 antibody (KMS12BM, Molt4, and Raji cells), and the amount of cytokines produced was similarly quantified. As a result, higher production of IFN-γ and IL-2 was found only in the co-culture of cells that bind to the MMG49 antibody, namely MM.1s, RPMI8226 cells, and JJN3 cells, and chimeric antigen receptor T cells derived from the MMG49 antibody, compared to the control group (T cells obtained by culturing stimulated peripheral blood single cells transfected with a GFP expression vector in the same manner)( Figure 18 and 19 ). These results indicate that chimeric antigen receptor T cells derived from the MMG49 antibody are activated by recognizing the antigen recognized by the MMG49 antibody (sometimes referred to as the MMG49 antigen).

[0528] In addition, in 51 a 51Cr cell killing assay, it was investigated whether chimeric antigen receptor T cells derived from the MMG49 antibody kill myeloma cell lines. First, K562 cells that did not express integrin β7 or K562 cells that forcibly expressed integrin α4β7, which were to be target cells, were cultured in RPMI1640 medium supplemented with 10% FCS to prepare a cell count of 0.5 - 1.0×10 4 cells.

[0529] An appropriate amount of Na2 51 CrO4 was added thereto, and the reaction was carried out at 37°C for 2 hours. The cells were labeled with 51 51Cr and washed, and the obtained cells were used as target cells. These were mixed with chimeric antigen receptor T cells derived from the MMG49 antibody suspended in RPMI1640 medium supplemented with fetal bovine serum and co-cultured for 4 hours.

[0530] Thereafter, the released into the supernatant was measured using a γ-counter.51 The measurement of Cr was carried out. The cell killing rate (%) was calculated based on the following formula (1).

[0531] (A-B) / (C-D)×100 (1)

[0532] A: The amount of 51 Cr released from the cells used in the experiment

[0533] B: The amount of 51 Cr spontaneously released in the absence of antibody

[0534] C: The maximum 51 Cr release amount caused by adding 1% Triton X-100

[0535] D: The amount of 51 Cr spontaneously released in the absence of antibody.

[0536] As a result, in the case of K562 cells that forcibly express integrin α4β7 and are bound by the MMG49 antibody, it was found that the cell killing by chimeric antigen receptor T cells derived from the MMG49 antibody was higher than that of T cells expressing only GFP as a control ( Figure 20 ).

[0537] Next, chimeric antigen receptor T cells derived from the MMG49 antibody or control T cells transfected only with GFP were co-cultured with myeloma cell lines (MM1s cells, RPMI8226 cells, and JJN3 cells) bound by the MMG49 antibody or cells not bound by the MMG49 antibody (KMS12BM, Molt4, and Raji cells), and the same study was conducted. As a result, it was found that only in K562 cells that forcibly express integrin α4β7 and are bound by the MMG49 antibody, the cell killing by chimeric antigen receptor T cells derived from the MMG49 antibody was higher than that of T cells expressing only GFP as a control ( Figure 21 ).

[0538] The above results indicate that chimeric antigen receptor T cells derived from the MMG49 antibody can specifically kill cells expressing the antigen recognized by the MMG49 antibody.

[0539] [Example 12]

[0540] Analysis of the ability of chimeric antigen receptor T cells derived from the MMG49 antibody to eliminate myeloma cells in vivo Analysis

[0541] Using chimeric antigen receptor T cells derived from the MMG49 antibody, the therapeutic effect on multiple myeloma in vivo was investigated.

[0542] The myeloma cell line MM1s cells (4 × 10 5 cells) were transplanted into the bone marrow of NOG mice irradiated with 2.4 Gy of radiation. Five days later, the mice were divided into a group administered chimeric antigen receptor T cells derived from the MMG49 antibody and a group administered control T cells, and 5 × 10 6 cells of each were administered intravenously. Seven days later, bone marrow analysis was performed, and as a result, in the group administered control T cells, significant proliferation of myeloma cells was clearly found in all mice. In contrast, in the group administered chimeric antigen receptor T cells derived from the MMG49 antibody, the tumor almost completely disappeared. These results indicate that administration of chimeric antigen receptor T cells derived from the MMG49 antibody has the ability to eliminate tumors expressing the MMG49 antigen even in vivo ( Figure 22 ).

[0543] Furthermore, a myeloma systemic inoculation model was used to investigate the therapeutic effect on multiple myeloma in vivo.

[0544] The myeloma cell line MM1s cells (5 × 10 6 cells) into which the luciferase gene had been introduced were transplanted into the vein of NOG mice irradiated with 2.4 Gy of radiation. Five days after transplantation, an IVIS imaging system (PerkinElmer) was used to measure the degree of tumor cell transplantation. Thereafter, the mice were divided into a group administered chimeric antigen receptor T cells derived from the MMG49 antibody and a group administered control T cells, and 3 × 10 6 cells of each were administered intravenously on days 5 and 7 after transplantation. Seven days after the second administration of T cells, the IVIS imaging system was used to measure the tumor volume again. As a result, in the group administered control T cells, significant proliferation of myeloma cells was clearly found in all mice. In contrast, in the group administered chimeric antigen receptor T cells derived from the MMG49 antibody, the tumor almost completely disappeared ( Figure 23 ). These results indicate that administration of chimeric antigen receptor T cells derived from the MMG49 antibody has the ability to eliminate tumors expressing the MMG49 antigen even in vivo.

[0545] [Example 13]

[0546] Regarding the epitope of the MMG49 antibody, the following experiment was conducted to further detail the results obtained in Example 8. Three human / mouse chimeric integrin β7 protein expression vectors as shown in Figure 25 were prepared, and each expression vector was introduced into 293T cells by lipofection. After 48 hours, FACS was used to analyze whether the MMG49 antibody was bound.

[0547] As a result, it was confirmed that the MMG49 antibody binds firmly to the chimeric integrin β7 protein (ch5.1 in Figure 25 ) in the same manner as to the integrin β7 protein (#4927 in Figure 11 ) that is almost entirely derived from humans. The region of the integrin β7 protein of the chimeric integrin β7 protein containing amino acid residues 1 to 32 and 91 to 798 is derived from mice, and the remaining region (the region containing amino acid residues 33 to 90) is derived from humans ( Figure 25 ). Figure 11 Figure 25 Therefore, it is strongly suggested that the epitope of the MMG49 antibody is included in amino acid residues 33 to 90 of the human integrin β7 protein. Figure 25 )

[0548]

[0549] [Example 14]

[0550] Vectors expressing human integrin β7, mouse integrin β7, and various mutants (R35E / N36D, H38D, M41L / L42Q, and A48V) in which only 1 or 2 amino acids of human integrin β7 are mutated to amino acid sequences derived from mice were introduced into 293T cells by the lipofection method, and then experiments were conducted in the same manner as in Example 8. As a result, as shown in Figure 26 , the binding ability of only the A48V mutant to the MMG49 antibody was significantly reduced compared to human integrin β7 and became close to the value of mouse integrin β7. From this result, it was confirmed that amino acid residue 48 of human integrin β7 is closely related to the epitope of the MMG49 antibody or is included in the epitope of the MMG49 antibody. Figure 26

[0551] Hereinafter, the base sequences and amino acid sequences shown in this specification are disclosed. Sequence Listing <110> The National University Corporation Osaka University <120> Antibody <130> P16-107WO <150> JP 2015-159240 <151> 2015-08-11 <160> 31 <170> PatentIn version 3.5 <210> 1 <211> 8 <212> PRT <213> Artificial Sequence <220> <223> VH CDR1 of MMG49 antibody ​​​<400> 1 Gly Tyr Thr Phe Ser Ser Tyr Trp 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial sequence <220> <223> VH CDR2 of MMG49 antibody <400> 2 Met Leu Pro Gly Ser Gly Ser Ser 1 5 <210> 3 <211> 12 <212> PRT <213> Artificial sequence <220> <223> VH CDR3 of MMG49 antibody <400> 3 Ala Arg Gly Asp Gly Asn Tyr Trp Tyr Phe Asp Val 1 5 10 <210> 4 <211> 131 <212> PRT <213> Artificial sequence <220> <223> VH of MMG49 antibody <400> 4 Met Glu Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Met Lys 20 25 30 Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Ser Ser Tyr Trp Ile Glu Trp Val Lys Gln Arg Pro Gly His Gly Leu 50 55 60 Glu Trp Ile Gly Glu Met Leu Pro Gly Ser Gly Ser Ser Asn Tyr Asn 65 70 75 80 Glu Lys Phe Lys Gly Lys Ala Thr Phe Thr Ala Asp Thr Ser Ser Asn 85 90 95 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Gly Asp Gly Asn Tyr Trp Tyr Phe Asp Val Trp 115 120 125 Gly Ala Gly 130 <210> 5 <211> 461 <212> PRT <213> Artificial Sequence <220> <223> Heavy chain of MMG49 antibody <400> 5 Met Glu Trp Thr Trp Val Phe Leu Phe Leu Leu Ser Val Thr Ala Gly 1 5 10 15 Val His Ser Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Met Lys 20 25 30 Pro Gly Ala Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe 35 40 45 Ser Ser Tyr Trp Ile Glu Trp Val Lys Gln Arg Pro Gly His Gly Leu 50 55 60 Glu Trp Ile Gly Glu Met Leu Pro Gly Ser Gly Ser Ser Asn Tyr Asn 65 70 75 80 Glu Lys Phe Lys Gly Lys Ala Thr Phe Thr Ala Asp Thr Ser Ser Asn 85 90 95 Thr Ala Tyr Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val 100 105 110 Tyr Tyr Cys Ala Arg Gly Asp Gly Asn Tyr Trp Tyr Phe Asp Val Trp 115 120 125 Gly Ala Gly Ala Lys Thr Thr Ala Pro Ser Val Tyr Pro Leu Ala Pro 130 135 140 Val Cys Gly Asp Thr Thr Gly Ser Ser Val Thr Leu Gly Cys Leu Val 145 150 155 160 Lys Gly Tyr Phe Pro Glu Pro Val Thr Leu Thr Trp Asn Ser Gly Ser 165 170 175 Leu Ser Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Asp Leu 180 185 190 Tyr Thr Leu Ser Ser Ser Val Thr Val Thr Ser Ser Thr Trp Pro Ser 195 200 205 Gln Ser Ile Thr Cys Asn Val Ala His Pro Ala Ser Ser Thr Lys Val 210 215 220 Asp Lys Lys Ile Glu Pro Arg Gly Pro Thr Ile Lys Pro Cys Pro Pro 225 230 235 240 Cys Lys Cys Pro Ala Pro Asn Leu Leu Gly Gly Pro Ser Val Phe Ile 245 250 255 Phe Pro Pro Lys Ile Lys Asp Val Leu Met Ile Ser Leu Ser Pro Ile 260 265 270 Val Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro Asp Val Gln 275 280 285 Ile Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala Gln Thr Gln 290 295 300 Thr His Arg Glu Asp Tyr Asn Ser Thr Leu Arg Val Val Ser Ala Leu 305 310 315 320 Pro Ile Gln His Gln Asp Trp Met Ser Gly Lys Glu Phe Lys Cys Lys 325 330 335 Val Asn Asn Lys Asp Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys 340 345 350 Pro Lys Gly Ser Val Arg Ala Pro Gln Val Tyr Val Leu Pro Pro Pro 355 360 365 Glu Glu Glu Met Thr Lys Lys Gln Val Thr Leu Thr Cys Met Val Thr 370 375 380 Asp Phe Met Pro Glu Asp Ile Tyr Val Glu Trp Thr Asn Asn Gly Lys 385 390 395 400 Thr Glu Leu Asn Tyr Lys Asn Thr Glu Pro Val Leu Asp Ser Asp Gly 405 410 415 Ser Tyr Phe Met Tyr Ser Lys Leu Arg Val Glu Lys Lys Asn Trp Val 420 425 430 Glu Arg Asn Ser Tyr Ser Cys Ser Val Val His Glu Gly Leu His Asn 435 440 445 His His Thr Thr Lys Ser Phe Ser Arg Thr Pro Gly Lys 450 455 460 <210> 6 <211> 5 <212> PRT <213> Artificial Sequence <220> <223> VL CDR1 of MMG49 Antibody <400> 6 Ser Ser Val Gly Tyr 1 5 <210> 7 <211> 3 <212> PRT <213> Artificial Sequence <220> <223> VL CDR2 of MMG49 Antibody <400> 7 Ala Thr Ser 1 <210> 8 <211> 9 <212> PRT <213> Artificial sequence <220> <223> VL CDR3 of MMG49 <400> 8 Gln Gln Trp Ser Ser Asp Pro Pro Thr 1 5 <210> 9 <211> 128 <212> PRT <213> Artificial sequence <220> <223> VL of MMG49 antibody <400> 9 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Gln Ile Val Leu Ser Gln Ser Pro Ala Ile 20 25 30 Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser 35 40 45 Ser Ser Val Gly Tyr Met His Trp Phe Gln Gln Lys Pro Gly Ser Ser 50 55 60 Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Glu Ser Gly Thr Ser Tyr Ser Leu Thr Ile 85 90 95 Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp 100 105 110 Ser Ser Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 115 120 125 <210> 10 <211> 234 <212> PRT <213> Artificial Sequence <220> <223> Light chain of MMG49 antibody <400> 10 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Gln Ile Val Leu Ser Gln Ser Pro Ala Ile 20 25 30 Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser 35 40 45 Ser Ser Val Gly Tyr Met His Trp Phe Gln Gln Lys Pro Gly Ser Ser 50 55 60 Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Glu Ser Gly Thr Ser Tyr Ser Leu Thr Ile 85 90 95 Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp 100 105 110 Ser Ser Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 115 120 125 Ala Asp Ala Ala Pro Thr Val Ser Ile Phe Pro Pro Ser Ser Glu Gln 130 135 140 Leu Thr Ser Gly Gly Ala Ser Val Val Cys Phe Leu Asn Asn Phe Tyr 145 150 155 160 Pro Lys Asp Ile Asn Val Lys Trp Lys Ile Asp Gly Ser Glu Arg Gln 165 170 175 Asn Gly Val Leu Asn Ser Trp Thr Asp Gln Asp Ser Lys Asp Ser Thr 180 185 190 Tyr Ser Met Ser Ser Thr Leu Thr Leu Thr Lys Asp Glu Tyr Glu Arg 195 200 205 His Asn Ser Tyr Thr Cys Glu Ala Thr His Lys Thr Ser Thr Ser Pro 210 215 220 Ile Val Lys Ser Phe Asn Arg Asn Glu Cys 225 230 <210> 11 <211> 24 <212> DNA <213> Artificial sequence <220> <223> VH CDR1 of MMG49 antibody <400> 11 ggctacacat tcagtagcta ctgg 24 <210> 12 <211> 24 <212> DNA <213> Artificial sequence <220> <223> VH CDR2 of MMG49 antibody <400> 12 atgttacctg gaagtggtag ttct 24 <210> 13 <211> 36 <212> DNA <213> Artificial sequence <220> <223> VH CDR3 of MMG49 antibody <400> 13 gcaagggggg atggtaacta ctggtacttc gatgtc 36 <210> 14 <211> 393 <212> DNA <213> Artificial sequence <220> <223> VH of MMG49 antibody <400> 14 atggaatgga cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag 60 gttcagctgc agcagtctgg agctgagctg atgaagcctg gggcctcagt gaagatatcc 120 tgcaaggctt ctggctacac attcagtagc tactggatag agtgggtaaa gcagaggcct 180 ggacatggcc ttgagtggat tggagagatg ttacctggaa gtggtagttc taactacaat 240 gagaagttca agggcaaggc cacattcact gcagatacat cctccaacac agcctacatg 300 caactcagca gcctgacatc tgaggactct gccgtctatt actgtgcaag gggggatggt 360 aactactggt acttcgatgt ctggggcgca ggg 393 <210> 15 <211> 1383 <212> DNA <213> Artificial sequence <220> <223> Heavy chain of MMG49 antibody <400> 15 atggaatgga cctgggtctt tctcttcctc ctgtcagtaa ctgcaggtgt ccactcccag 60 gttcagctgc agcagtctgg agctgagctg atgaagcctg gggcctcagt gaagatatcc 120 tgcaaggctt ctggctacac attcagtagc tactggatag agtgggtaaa gcagaggcct 180 ggacatggcc ttgagtggat tggagagatg ttacctggaa gtggtagttc taactacaat 240 gagaagttca agggcaaggc cacattcact gcagatacat cctccaacac agcctacatg 300 caactcagca gcctgacatc tgaggactct gccgtctatt actgtgcaag gggggatggt 360 aactactggt acttcgatgt ctggggcgca ggggctaaaa caacagcccc atcggtctat 420 ccactggccc ctgtgtgtgg agatacaact ggctcctcgg tgactctagg atgcctggtc 480 aagggttatt tccctgagcc agtgaccttg acctggaact ctggatccct gtccagtggt 540 gtgcacacct tcccagctgt cctgcagtct gacctctaca ccctcagcag ctcagtgact 600 gtaacctcga gcacctggcc cagccagtcc atcacctgca atgtggccca cccggcaagc 660 agcaccaagg tggacaagaa aattgagccc agagggccca caatcaagcc ctgtcctcca 720 tgcaaatgcc cagcacctaa cctcttgggt ggaccatccg tcttcatctt ccctccaaag 780 atcaaggatg tactcatgat ctccctgagc cccatagtca catgtgtggt ggtggatgtg 840 agcgaggatg acccagatgt ccagatcagc tggtttgtga acaacgtgga agtacacaca 900 gctcagacac aaacccatag agaggattac aacagtactc tccgggtggt cagtgccctc 960 cccatccagc accaggactg gatgagtggc aaggagttca aatgcaaggt caacaacaaa 1020 gacctcccag cgcccatcga gagaaccatc tcaaaaccca aagggtcagt aagagctcca 1080 caggtatatg tcttgcctcc accagaagaa gagatgacta agaaacaggt cactctgacc 1140 tgcatggtca cagacttcat gcctgaagac atttacgtgg agtggaccaa caacgggaaa 1200 acagagctaa actacaagaa cactgaacca gtcctggact ctgatggttc ttacttcatg 1260 tacagcaagc tgagagtgga aaagaagaac tgggtggaaa gaaatagcta ctcctgttca 1320 gtggtccacg agggtctgca caatcaccac acgactaaga gcttctcccg gactccgggt 1380 aaa 1383 <210> 16 <211> 15 <212> DNA <213> Artificial sequence <220> <223> VL CDR1 of MMG49 antibody <400> 16 tcaagtgtag gttac 15 <210> 17 <211> 9 <212> DNA <213> Artificial sequence <220> <223> VL CDR2 of MMG49 antibody <400> 17 gccacatcc 9 <210> 18 <211> 27 <212> DNA <213> Artificial sequence <220> <223> VL CDR3 of MMG49 antibody <400> 18 cagcagtgga gtagtgaccc accgacg 27 <210> 19 <211> 384 <212> DNA <213> Artificial sequence <220> <223> VL of MMG49 antibody <400> 19 atggattttc aagtgcagat tttcagcttc ctgctaatca gtgcttcagt cataatgtcc 60 agaggacaaa ttgttctctc ccagtctcca gcaatcctgt ctgcatctcc aggggagaag 120 gtcacaatga cttgcagggc cagctcaagt gtaggttaca tgcactggtt ccagcagaag 180 ccaggatcct cccccaaacc ctggatttat gccacatcca acctggcttc tggagtccct 240 gctcgcttca gtggcagtga gtctgggacc tcttactctc tcacaatcag cagagtggag 300 gctgaagatg ctgccactta ttactgccag cagtggagta gtgacccacc gacgttcggt 360 ggaggcacca agctggaaat caaa 384 <210> 20 <211> 702 <212> DNA <213> Artificial sequence <220> <223> Light chain of MMG49 antibody <400> 20 atggattttc aagtgcagat tttcagcttc ctgctaatca gtgcttcagt cataatgtcc 60 agaggacaaa ttgttctctc ccagtctcca gcaatcctgt ctgcatctcc aggggagaag 120 gtcacaatga cttgcagggc cagctcaagt gtaggttaca tgcactggtt ccagcagaag 180 ccaggatcct cccccaaacc ctggatttat gccacatcca acctggcttc tggagtccct 240 gctcgcttca gtggcagtga gtctgggacc tcttactctc tcacaatcag cagagtggag 300 gctgaagatg ctgccactta ttactgccag cagtggagta gtgacccacc gacgttcggt 360 ggaggcacca agctggaaat caaagcagat gctgcaccaa ctgtatccat cttcccacca 420 tccagtgagc agttaacatc tggaggtgcc tcagtcgtgt gcttcttgaa caacttctac 480 cccaaagaca tcaatgtcaa gtggaagatt gatggcagtg aacgacaaaa tggcgtcctg 540 aacagttgga ctgatcagga cagcaaagac agcacctaca gcatgagcag caccctcacg 600 ttgaccaagg acgagtatga acgacataac agctatacct gtgaggccac tcacaagaca 660 tcaacttcac ccattgtcaa gagcttcaac aggaatgagt gt 702 <210> 21 <211> 485 <212> PRT <213> Artificial Sequence <220> <223> CAR as described in the example <400> 21 Met Asp Phe Gln Val Gln Ile Phe Ser Phe Leu Leu Ile Ser Ala Ser 1 5 10 15 Val Ile Met Ser Arg Gly Gln Ile Val Leu Ser Gln Ser Pro Ala Ile 20 25 30 Leu Ser Ala Ser Pro Gly Glu Lys Val Thr Met Thr Cys Arg Ala Ser 35 40 45 Ser Ser Val Gly Tyr Met His Trp Phe Gln Gln Lys Pro Gly Ser Ser 50 55 60 Pro Lys Pro Trp Ile Tyr Ala Thr Ser Asn Leu Ala Ser Gly Val Pro 65 70 75 80 Ala Arg Phe Ser Gly Ser Glu Ser Gly Thr Ser Tyr Ser Leu Thr Ile 85 90 95 Ser Arg Val Glu Ala Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Trp 100 105 110 Ser Ser Asp Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys 115 120 125 Arg Gly Ser Thr Ser Gly Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser 130 135 140 Gln Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Met Lys Pro Gly Ala 145 150 155 160 Ser Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe Ser Ser Tyr 165 170 175 Trp Ile Glu Trp Val Lys Gln Arg Pro Gly His Gly Leu Glu Trp Ile 180 185 190 Gly Glu Met Leu Pro Gly Ser Gly Ser Ser Asn Tyr Asn Glu Lys Phe 195 200 205 Lys Gly Lys Ala Thr Phe Thr Ala Asp Thr Ser Ser Asn Thr Ala Tyr 210 215 220 Met Gln Leu Ser Ser Leu Thr Ser Glu Asp Ser Ala Val Tyr Tyr Cys 225 230 235 240 Ala Arg Gly Asp Gly Asn Tyr Trp Tyr Phe Asp Val Trp Gly Ala Gly 245 250 255 Thr Thr Val Thr Val Ser Ser Ala Ala Ala Ile Glu Val Met Tyr Pro 260 265 270 Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn Gly Thr Ile Ile His Val 275 280 285 Lys Gly Lys His Leu Cys Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys 290 295 300 Pro Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser 305 310 315 320 Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg 325 330 335 Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro 340 345 350 Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe 355 360 365 Ala Ala Tyr Arg Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro 370 375 380 Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly 385 390 395 400 Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro 405 410 415 Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr 420 425 430 Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly 435 440 445 Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln 450 455 460 Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln 465 470 475 480 Ala Leu Pro Pro Arg 485 <210> 22 <211> 1468 <212> DNA <213> Artificial sequence <220> <223> CAR as described in the example <400> 22 gaattccacc atggattttc aagtgcagat tttcagcttc ctgctaatca gtgcttcagt 60 cataatgtcc agaggacaaa ttgttctctc ccagtctcca gcaatcctgt ctgcatctcc 120 aggggagaag gtcacaatga cttgcagggc cagctcaagt gtaggttaca tgcactggtt 180 ccagcagaag ccaggatcct cccccaaacc ctggatttat gccacatcca acctggcttc 240 tggagtccct gctcgcttca gtggcagtga gtctgggacc tcttactctc tcacaatcag 300 cagagtggag gctgaagatg ctgccactta ttactgccag cagtggagta gtgacccacc 360 gacgttcggt ggaggcacca agctggaaat caaacggggc tccactagcg gttccggcaa 420 acctggcagc ggagaaggca gccaggttca gctgcagcag tctggagctg agctgatgaa 480 gcctggggcc tcagtgaaga tatcctgcaa ggcttctggc tacacattca gtagctactg 540 gatagagtgg gtaaagcaga ggcctggaca tggccttgag tggattggag agatgttacc 600 tggaagtggt agttctaact acaatgagaa gttcaagggc aaggccacat tcactgcaga 660 tacatcctcc aacacagcct acatgcaact cagcagcctg acatctgagg actctgccgt 720 ctattactgt gcaagggggg atggtaacta ctggtacttc gatgtctggg gcgcagggac 780 cacggtcacc gtctcctcag cggccgcaat tgaagttatg tatcctcctc cttacctaga 840 caatgagaag agcaatggaa ccattatcca tgtgaaaggg aaacaccttt gtccaagtcc 900 cctatttccc ggaccttcta agcccttttg ggtgctggtg gtggttggtg gagtcctggc 960 ttgctatagc ttgctagtaa cagtggcctt tattattttc tgggtgagga gtaagaggag 1020 caggctcctg cacagtgact acatgaacat gactccccgc cgccccgggc ccacccgcaa 1080 gcattaccag ccctatgccc caccacgcga cttcgcagcc tatcgctcca gagtgaagtt 1140 cagcaggagc gcagacgccc ccgcgtacca gcagggccag aaccagctct ataacgagct 1200 caatctagga cgaagagagg agtacgatgt tttggacaag agacgtggcc gggaccctga 1260 gatgggggga aagccgagaa ggaagaaccc tcaggaaggc ctgtacaatg aactgcagaa 1320 agataagatg gcggaggcct acagtgagat tgggatgaaa ggcgagcgcc ggaggggcaa 1380 ggggcacgat ggcctttacc agggtctcag tacagccacc aaggacacct acgacgccct 1440 tcacatgcag gccctgcccc ctcgctaa 1468 <210> 23 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 23 gaattccacc atggattttc aagtgcagat t 31 <210> 24 <211> 42 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 24 gccggaaccg ctagtggagc cccgtttgat ttccagcttg gt 42 <210> 25 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 25 gctgccttct ccgctgccag gtttgccgga accgctagtg gagcc 45 <210> 26 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Primer <400> 26 aaacctggca gcggagaagg cagccaggtt cagctgcagc agtc 44 <210> 27 <211> 20 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 27 tgaggagacg gtgaccgtgg 20 <210> 28 <211> 44 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 28 atacataact tcaattgcgg ccgctgagga gacggtgacc gtgg 44 <210> 29 <211> 30 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 29 ctaggcgccg gaattccacc atggattttc 30 <210> 30 <211> 29 <212> DNA <213> Artificial Sequence <220> <223> Primer <400> 30 aatgtcgacc tcgagtggct gttagcgag 29 <210> 31 <211> 798 <212> PRT <213> Homo sapiens <400> 31 Met Val Ala Leu Pro Met Val Leu Val Leu Leu Leu Val Leu Ser Arg 1 5 10 15 Gly Glu Ser Glu Leu Asp Ala Lys Ile Pro Ser Thr Gly Asp Ala Thr 20 25 30 Glu Trp Arg Asn Pro His Leu Ser Met Leu Gly Ser Cys Gln Pro Ala 35 40 45 Pro Ser Cys Gln Lys Cys Ile Leu Ser His Pro Ser Cys Ala Trp Cys 50 55 60 Lys Gln Leu Asn Phe Thr Ala Ser Gly Glu Ala Glu Ala Arg Arg Cys 65 70 75 80 Ala Arg Arg Glu Glu Leu Leu Ala Arg Gly Cys Pro Leu Glu Glu Leu 85 90 95 Glu Glu Pro Arg Gly Gln Gln Glu Val Leu Gln Asp Gln Pro Leu Ser 100 105 110 Gln Gly Ala Arg Gly Glu Gly Ala Thr Gln Leu Ala Pro Gln Arg Val 115 120 125 Arg Val Thr Leu Arg Pro Gly Glu Pro Gln Gln Leu Gln Val Arg Phe 130 135 140 Leu Arg Ala Glu Gly Tyr Pro Val Asp Leu Tyr Tyr Leu Met Asp Leu 145 150 155 160 Ser Tyr Ser Met Lys Asp Asp Leu Glu Arg Val Arg Gln Leu Gly His 165 170 175 Ala Leu Leu Val Arg Leu Gln Glu Val Thr His Ser Val Arg Ile Gly 180 185 190 Phe Gly Ser Phe Val Asp Lys Thr Val Leu Pro Phe Val Ser Thr Val 195 200 205 Pro Ser Lys Leu Arg His Pro Cys Pro Thr Arg Leu Glu Arg Cys Gln 210 215 220 Ser Pro Phe Ser Phe His His Val Leu Ser Leu Thr Gly Asp Ala Gln 225 230 235 240 Ala Phe Glu Arg Glu Val Gly Arg Gln Ser Val Ser Gly Asn Leu Asp 245 250 255 Ser Pro Glu Gly Gly Phe Asp Ala Ile Leu Gln Ala Ala Leu Cys Gln 260 265 270 Glu Gln Ile Gly Trp Arg Asn Val Ser Arg Leu Leu Val Phe Thr Ser 275 280 285 Asp Asp Thr Phe His Thr Ala Gly Asp Gly Lys Leu Gly Gly Ile Phe 290 295 300 Met Pro Ser Asp Gly His Cys His Leu Asp Ser Asn Gly Leu Tyr Ser 305 310 315 320 Arg Ser Thr Glu Phe Asp Tyr Pro Ser Val Gly Gln Val Ala Gln Ala 325 330 335 Leu Ser Ala Ala Asn Ile Gln Pro Ile Phe Ala Val Thr Ser Ala Ala 340 345 350 Leu Pro Val Tyr Gln Glu Leu Ser Lys Leu Ile Pro Lys Ser Ala Val 355 360 365 Gly Glu Leu Ser Glu Asp Ser Ser Asn Val Val Gln Leu Ile Met Asp 370 375 380 Ala Tyr Asn Ser Leu Ser Ser Thr Val Thr Leu Glu His Ser Ser Leu 385 390 395 400 Pro Pro Gly Val His Ile Ser Tyr Glu Ser Gln Cys Glu Gly Pro Glu 405 410 415 Lys Arg Glu Gly Lys Ala Glu Asp Arg Gly Gln Cys Asn His Val Arg 420 425 430 Ile Asn Gln Thr Val Thr Phe Trp Val Ser Leu Gln Ala Thr His Cys 435 440 445 Leu Pro Glu Pro His Leu Leu Arg Leu Arg Ala Leu Gly Phe Ser Glu 450 455 460 Glu Leu Ile Val Glu Leu His Thr Leu Cys Asp Cys Asn Cys Ser Asp 465 470 475 480 Thr Gln Pro Gln Ala Pro His Cys Ser Asp Gly Gln Gly His Leu Gln 485 490 495 Cys Gly Val Cys Ser Cys Ala Pro Gly Arg Leu Gly Arg Leu Cys Glu 500 505 510 Cys Ser Val Ala Glu Leu Ser Ser Pro Asp Leu Glu Ser Gly Cys Arg 515 520 525 Ala Pro Asn Gly Thr Gly Pro Leu Cys Ser Gly Lys Gly His Cys Gln 530 535 540 Cys Gly Arg Cys Ser Cys Ser Gly Gln Ser Ser Gly His Leu Cys Glu 545 550 555 560 Cys Asp Asp Ala Ser Cys Glu Arg His Glu Gly Ile Leu Cys Gly Gly 565 570 575 Phe Gly Arg Cys Gln Cys Gly Val Cys His Cys His Ala Asn Arg Thr 580 585 590 Gly Arg Ala Cys Glu Cys Ser Gly Asp Met Asp Ser Cys Ile Ser Pro 595 600 605 Glu Gly Gly Leu Cys Ser Gly His Gly Arg Cys Lys Cys Asn Arg Cys 610 615 620 Gln Cys Leu Asp Gly Tyr Tyr Gly Ala Leu Cys Asp Gln Cys Pro Gly 625 630 635 640 Cys Lys Thr Pro Cys Glu Arg His Arg Asp Cys Ala Glu Cys Gly Ala 645 650 655 Phe Arg Thr Gly Pro Leu Ala Thr Asn Cys Ser Thr Ala Cys Ala His 660 665 670 Thr Asn Val Thr Leu Ala Leu Ala Pro Ile Leu Asp Asp Gly Trp Cys 675 680 685 Lys Glu Arg Thr Leu Asp Asn Gln Leu Phe Phe Phe Leu Val Glu Asp 690 695 700 Asp Ala Arg Gly Thr Val Val Leu Arg Val Arg Pro Gln Glu Lys Gly 705 710 715 720 Ala Asp His Thr Gln Ala Ile Val Leu Gly Cys Val Gly Gly Ile Val 725 730 735 Ala Val Gly Leu Gly Leu Val Leu Ala Tyr Arg Leu Ser Val Glu Ile 740 745 750 Tyr Asp Arg Arg Glu Tyr Ser Arg Phe Glu Lys Glu Gln Gln Gln Leu 755 760 765 Asn Trp Lys Gln Asp Ser Asn Pro Leu Tyr Lys Ser Ala Ile Thr Thr 770 775 780 Thr Ile Asn Pro Arg Phe Gln Glu Ala Asp Ser Pro Thr Leu 785 790 795

Claims

1. Use of an antibody or a cell in the manufacture of a medicament for preventing or treating hematological cancer, wherein, the antibody comprises a heavy chain variable region and a light chain variable region, the heavy chain variable region comprises: a heavy chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 1, a heavy chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 2, and a heavy chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 3, the light chain variable region comprises: a light chain CDR1 consisting of the amino acid sequence shown in SEQ ID NO: 6, a light chain CDR2 consisting of the amino acid sequence shown in SEQ ID NO: 7, and a light chain CDR3 consisting of the amino acid sequence shown in SEQ ID NO: 8, the antibody is an anti-human integrin β7 antibody, the cell carries a polynucleotide encoding a chimeric antigen receptor comprising the antigen recognition site of the antibody, the antigen recognition site of the antibody comprises the heavy chain variable region and the light chain variable region of the antibody, and the cell is a chimeric antigen receptor T cell or an NK cell, the hematological cancer is multiple myeloma.

2. The application according to claim 1, wherein, the antibody comprises a heavy chain variable region consisting of the amino acid sequence shown in SEQ ID NO: 4, and a light chain variable region consisting of the amino acid sequence shown in SEQ ID NO:

9.

3. The application according to claim 1, wherein the antibody is a multispecific antibody.

4. The application according to claim 1, wherein, the polynucleotide consists of the base sequence shown in SEQ ID NO: 22.

Images