mut - methylotrophic yeast

By reducing the expression of AOX1 and AOX2 and increasing the expression of ADH2 in methanol-nutritional yeast, the oxygen demand and carbon source utilization in the recombinant protein production process were improved, the production cost was reduced, and the yield was increased.

CN114026239BActive Publication Date: 2025-10-24UNIV FUR BODENKULTUR WIEN
View PDF 16 Cites 0 Cited by

Patent Information

Application Number
CN202080040100.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-04-01
Filing Date
2020-04-01
Publication Date
2025-10-24
Estimated Expiration
2040-04-01

AI Technical Summary

Technical Problem

The current production process of recombinant protein from Pichia pastoris requires a high amount of oxygen, generates a lot of heat, and has low carbon source utilization efficiency, which leads to increased production costs.

Method used

By genetically modifying methanol-producing yeast, the expression of alcohol oxidase 1 (AOX1) and alcohol oxidase 2 (AOX2) was reduced, while the expression of alcohol dehydrogenase (ADH2) was increased, thus forming a recombinant methanol utilization pathway-deficient yeast (Mut-) host cell.

Benefits of technology

It reduces the demand for oxygen and heat, improves the utilization efficiency of carbon sources, and increases the production yield of recombinant proteins.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003380956470000482
    Figure BDA0003380956470000482
  • Figure BDA0003380956470000491
    Figure BDA0003380956470000491
  • Figure BDA0003380956470000501
    Figure BDA0003380956470000501
Patent Text Reader

Abstract

A recombinant methanol utilization pathway-deficient methanol auxotroph yeast (Mut-) host cell engineered by a) one or more genetic modifications to reduce expression of a first endogenous gene and a second endogenous gene compared to the host cell prior to the one or more genetic modifications, wherein i. the first endogenous gene encodes an alcohol oxidase 1 (AOX1) comprising an amino acid sequence identified as SEQ ID NO: 1 or a homolog thereof, and ii. the second endogenous gene encodes an alcohol oxidase 2 (AOX2) comprising an amino acid sequence identified as SEQ ID NO: 3 or a homolog thereof, and b) one or more genetic modifications to increase expression of an alcohol dehydrogenase (ADH2) gene compared to the host cell prior to the one or more genetic modifications, wherein the ADH2 gene encodes an alcohol dehydrogenase (ADH2).
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates to the production of a protein of interest (POI) in recombinant methylotrophic yeasts lacking alcohol oxidase 1 (AOX1) and alcohol oxidase 2 (AOX2). BACKGROUND

[0002] Proteins produced in recombinant host cell cultures are of increasing importance as diagnostic and therapeutic agents. For this purpose, cells are engineered and / or selected to produce abnormally high levels of recombinant or heterologous proteins of interest. Optimization of cell culture conditions is important for the successful commercial production of recombinant or heterologous proteins.

[0003] Successful production of proteins of interest (POI) has been achieved in cell culture with both prokaryotic host cells and eukaryotic host cells. Eukaryotic host cells, in particular mammalian host cells, yeasts or filamentous fungi, or bacteria are commonly used as production hosts for biopharmaceutical proteins as well as bulk chemicals. The most prominent example is the methylotrophic yeast, such as Pichia pastoris, which is well known for its high efficiency in secreting heterologous proteins. P. pastoris has been reclassified into the new genus Komagataella and is divided into three species: K. pastoris, K. phaffii and K. pseudopastoris. The strains commonly used for biotechnological applications belong to two of the proposed species, K. pastoris and K. phaffii. Strains GS115, X-33, CBS2612 and CBS7435 are K. phaffii, whereas strain DSMZ 70382 is classified as the model species K. pastoris, which is the reference strain for all available P. pastoris strains (Kurtzman 2009, J Ind Microbiol Biotechnol. 36(11): 1435-8). Mattanovich et al. (Microbial Cell Factories 2009, 8:29 doi:10.1186 / 1475-2859-8-29) describe the genome sequencing of the model strain DSMZ 70382 of K. pastoris and analyze its secretome and sugar transporters.

[0004] P. pastoris strains have been used which lack both AOX genes AOX1 and AOX2 (called Mut-), or lack only AOX2 (called Mut S ) or lack neither AOX gene (called Mut + ).

[0005] Promoters used for protein production in recombinant host cells are either regulated (e.g. induced upon addition of methanol to the culture medium, methanol-controlled) or continuously active (constitutive). The methanol-inducible promoter pAOX1 has been described as controlling protein expression in Mut-, Mut + or Mut S strains.

[0006] Chiruvolu et al. (Enzyme Microb. Technol. 1997, 21 :277-283) describe the construction of Mut- strains for recombinant protein production. It is determined that Mut- strains cannot grow on methanol, which necessitates the use of another carbon source to provide for growth, maintenance and protein production. The POI is expressed under the control of pAOX1, which is induced by the injection of methanol into the fermenter to maintain a concentration of about 0.5% (v / v).

[0007] Chauhan et al. (Process Biochemistry 1999, 34: 139-145) describe the use of an AOX1 -deleted host (designated Mut-, however, understood to be Mut S carrying a gene expressing HBsAg under the pAOX1 promoter. Protein expression is induced by methanol, but it is found that high concentrations of methanol in the broth are toxic to the cells, as it is found that Mut S cells are sensitive to methanol concentrations.

[0008] Karaoglan et al. (Biotechnol. Lett. 1995, DOI 10.1007 / s10529-015-1993-z) describe a functional analysis of alcohol dehydrogenase (ADH) genes in Pichia pastoris. The ADH3 (XM_002491337) and ADH (FN392323) genes are disrupted. The double knock-out strain also produces ethanol. It is concluded that ADH genes do not play a role in ethanol metabolism; and PpADH3 is the only gene responsible for ethanol consumption in Pichia pastoris.

[0009] Singh and Narang (bioRxiv, DOI: 10.1101 / 573519, preprint) describe beta-galactosidase expression in Mut + , Mut s (AOX1-) and Mut - (AOX1-AOX2-) strains of Komagataella phaffii (Pichia pastoris). It is concluded that formate and / or formaldehyde are likely to be the true inducers, as both induce intracellular methanol synthesis from formate or formaldehyde in Mut- P in AOX1 expressed, and formate is proposed as a promising alternative to methanol, as it does not appear to suffer from the drawbacks that affect methanol.

[0010] Wei Shen et al. (Microbial Cell Factories 2016, 15(1):1-11) described a methanol-free protein expression system in Pichia pastoris. Two kinase mutants, Δgut1 and Δdak, exhibited strong alcohol oxidase activity under non-methanol carbon sources and were used to construct a methanol-free expression system.

[0011] Ia Pla et al. (Biotechnol Prog, 2006, pp 881-888) describe the use of the AOX promoter and methanol to induce the expression of scFv Mut S and Mut+ Pichia pastoris strains.

[0012] EP 1905836 A1 discloses a Pichia pastoris strain for producing recombinant human interferon alpha and proposes the use of an AOX1 disrupted clone comprising a mutated AOX1 gene but without a complete deletion of the AOX1 locus.

[0013] Ching-Hsiang Chang et al. (BMC Biotechnology 2018, 18(1):81) proposed a flexible pAOX1 induction system in Pichia pastoris for reprogramming cells using methanol expression regulator 1 (Mxr1).

[0014] Russmayer H. et al. (BMC Biology 2015, 13(1):80) described the importance of AOX in regulating the Pichia pastoris expression system.

[0015] Tomas-Gamisans M. et al. (Microbial Biotechnology 2018, 11(1):224-237) describe a genome-scale metabolic model of Pichia pastoris for improved predictions on methanol or glycerol as the sole carbon source.

[0016] Moser et al. (Microbial Cell Factories 2017, 16(1):49) describe adaptive laboratory evolution to improve growth and recombinant protein production in Pichia pastoris.

[0017] Recombinant protein production in Pichia pastoris requires high intensity process regimes resulting in high oxygen demand and heat production, requiring high biomass concentrations and methanol consumption. Oxygen transfer, cooling and biomass separation in downstream processing is expensive. It is therefore desirable to develop a process with low oxygen demand and heat production. It is further desirable to increase the yield of protein production, in particular through efficient use of carbon source. SUMMARY

[0018] It is an object of the present invention to improve recombinant protein production in methanol- utilising yeasts.

[0019] The object is solved by the subject matter of the claims and as further described herein.

[0020] The present invention provides a recombinant methanol utilisation pathway-deficient methanol- utilising yeast (Mut-) host cell, which is engineered by:

[0021] a) one or more genetic modifications to reduce expression of a first endogenous gene and a second endogenous gene compared to the host cell prior to the one or more genetic modifications, wherein

[0022] i. the first endogenous gene encodes an alcohol oxidase 1 (AOX1) comprising an amino acid sequence identified as SEQ ID NO: 1 or a homologue thereof, and

[0023] ii. the second endogenous gene encodes an alcohol oxidase 2 (AOX2) comprising an amino acid sequence identified as SEQ ID NO: 3 or a homologue thereof,

[0024] and

[0025] b) one or more genetic modifications to increase expression of an alcohol dehydrogenase (ADH2) gene compared to the host cell prior to the one or more genetic modifications, wherein the ADH2 gene encodes an alcohol dehydrogenase (ADH2).

[0026] In particular, the ADH2 protein is an alcohol dehydrogenase classified as EC 1.1.1.1.

[0027] As described herein, the term "ADH2" shall refer to a native alcohol dehydrogenase, such as a Pichia pastoris alcohol dehydrogenase comprising or consisting of an amino acid sequence identified as SEQ ID NO: 50 (UniProtKB - F2QSX6_KOMPC; FR839629 genomic DNA translation: CCA38504.1; Gene: PP7435_Chr2-0821), or a sequence having a certain homology (or sequence identity) to SEQ ID NO: 50.

[0028] In particular, the ADH2 can be derived from a Pichia pastoris strain or can be a homolog or an ortholog of the same, which is naturally occurring, derived from or endogenous to a wild-type cell of an organism, such as a eukaryote, including for example a yeast, in particular a methanol- utilizable yeast strain, species or genus, or is a mutant of such a naturally occurring ADH2.

[0029] In particular, the ADH2 protein is naturally occurring or endogenous in the host cell species or is a mutant thereof.

[0030] In particular, the gene encoding the Pichia pastoris alcohol dehydrogenase (herein referred to as ADH2 gene) comprises or consists of a nucleotide sequence identified as SEQ ID NO: 51 or a homologous polynucleotide (gene) encoding ADH2 (which has a certain homology (or sequence identity) to SEQ ID NO: 50).

[0031] In particular, the ADH2 gene is endogenous or heterologous to the Mut- host cell. In particular, the Mut- host cell comprises one or more copies of said ADH2 gene.

[0032] In particular, the ADH2 is any one of:

[0033] a) ADH2 which is a P. pastoris ADH2 comprising an amino acid sequence identified as SEQ ID NO: 50 or a homolog thereof, which is endogenous to a yeast species, in particular a methanol-utilizable yeast; or

[0034] b) a mutant of the ADH2 of a), which has at least 60% identity to SEQ ID NO: 50.

[0035] Homologous sequences are also referred to as ADH2 homologs or ADH2 homologs.

[0036] Exemplary homologs are described in Figure 1

[0037] SEQ ID NO: 52: ADH2 amino acid sequence of P. pastoris ATCC 28485

[0038] SEQ ID NO: 53: ADH2 gene sequence of P. pastoris ATCC 28485

[0039] ​SEQ ID NO: 54: ADH2 amino acid sequence of Ogataea parapolymorpha DL-1

[0040] SEQ ID NO: 55: ADH2 gene sequence of Ogataea parapolymorpha DL-1

[0041] SEQ ID NO: 56: ADH2 amino acid sequence of Ogataea parapolymorpha DL-1

[0042] SEQ ID NO: 57: ADH2 gene sequence of Ogataea parapolymorpha DL-1

[0043] SEQ ID NO: 58: ADH amino acid sequence of Ogataea polymorpha NCYC 495 leul.1

[0044] SEQ ID NO: 59: ADH gene sequence of Ogataea polymorpha NCYC 495 leul.1

[0045] SEQ ID NO: 60: ADH amino acid sequence of Ogataea polymorpha NCYC 495 leul.1

[0046] SEQ ID NO: 61: ADH gene sequence of Ogataea polymorpha NCYC 495 leul.1

[0047] SEQ ID NO: 62: ADH2 amino acid sequence of Saccharomyces cerevisiae YJM627

[0048] SEQ ID NO: 63: ADH2 gene sequence of Saccharomyces cerevisiae YJM627

[0049] SEQ ID NO: 64: ADH2 amino acid sequence of Candida maltosa Xu316

[0050] SEQ ID NO: 65: ADH2 gene sequence of Candida maltosa Xu316

[0051] SEQ ID NO: 66: ADH4 amino acid sequence of Kluyveromyces marxianus DMKU3- 1042

[0052] SEQ ID NO: 67: ADH4 gene sequence of Kluyveromyces marxianus DMKU3- 1042

[0053] SEQ ID NO: 68: ADH1 amino acid sequence of Escherichia coli 7.1982

[0054] SEQ ID NO: 69: ADH1 gene sequence of Escherichia coli 7.1982

[0055] SEQ ID NO: 70: ADH1 amino acid sequence of Fusarium graminearum PH-1

[0056] SEQ ID NO: 71 : ADH1 gene sequence of Fusarium graminearum PH-1

[0057] In particular, the ADH2 homolog has a sequence identity of at least any one of 60%, 70%, 80%, 85%, 90%, or 95% to SEQ ID NO: 50. An ADH2 homolog is understood herein to encode an ADH2 homolog. In particular, the sequence identity is determined as further disclosed herein, e.g. when comparing full-length sequences.

[0058] In particular, the homolog or homologous sequence is characterized by the same qualitative function of an ADH2 protein in a wild-type host cell, such as in Pichia pastoris, in particular Pichia commata or Pichia farinosa, e.g. as an alcohol dehydrogenase (EC 1.1.1.1.).

[0059] In particular, the homologous sequence of SEQ ID NO: 50 is of a species other than Pichia pastoris, in particular Pichia commata or Pichia farinosa, e.g. another yeast of the genus Pichia or of the genus Komagataella, and the expression of the corresponding endogenous coding sequence is increased (e.g. knock-in), as described herein.

[0060] If the host cell is Pichia pastoris, in particular Pichia commata or Pichia farinosa, the ADH2 protein can comprise an endogenous sequence of a different strain or species, e.g. SEQ ID NO: 50) or a homolog of SEQ ID NO: 50, or a mutated ADH2 protein of an artificial sequence or consisting of an artificial sequence which is not naturally occurring in a wild-type strain or organism, in particular which is not naturally occurring in a methanol- utilizable yeast.

[0061] According to a specific embodiment, the homologous sequence has at least any one of 0.2-fold, 0.3-fold, 0.4-fold, 0.5-fold, 0.6-fold, 0.7-fold, 0.8-fold, 0.9-fold, 1-fold, 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, or even higher alcohol dehydrogenase activity compared to the activity of the endogenous, naturally occurring Pichia pastoris alcohol dehydrogenase in wild-type Pichia pastoris. Alcohol dehydrogenase activity can be measured in a suitable assay, e.g. by an alcohol dehydrogenase assay using cell-free extracts. Cell-free extracts can be obtained by mechanical disruption of the cell culture with zirconium oxide / silicon dioxide / glass beads as described by Karaoglan et al. (Biotechnol Lett. 2016; 38(3): 463-9). Alcohol dehydrogenase activity can be measured by measuring the increase in absorbance at a wavelength of 340 nm after formation of NADH as described by Walker (Biochemical Education. 1992 21(1): 42-43). NAD + and alcohol can be used as substrates and consumed in equimolar concentrations. The production of NADH is negatively correlated with the consumption of NAD + Alternatively, a commercial colorimetric alcohol dehydrogenase activity assay kit (MAK053, Sigma-Aldrich) can be used. An exemplary assay is described herein in the example section.

[0062] As described herein, the term “AOX1” shall refer to a native alcohol oxidase 1, such as a Pichia pastoris alcohol oxidase 1 comprising or consisting of the amino acid sequence identified as SEQ ID NO: 1 (UniProtKB - F2QY27), or a sequence having a certain homology (or sequence identity) to SEQ ID NO: 1, which can be a homolog of Pichia pastoris alcohol oxidase 1, which is endogenous to a methanol- utilizable yeast species, in particular to the methanol-utilizable yeast used as host cell prior to the one or more genetic modifications reducing the expression of said endogenous alcohol oxidase 1 herein. In particular, the AOX1 protein is an ortholog to the species of the host cell species.

[0063] In particular, the gene encoding Pichia pastoris alcohol oxidase 1, herein referred to as AOX1 gene, comprises or consists of the nucleotide sequence identified as SEQ ID NO: 2.

[0064] The homologous sequence is also referred to as AOX1 homolog or AOX1 homolog. In particular, the AOX1 protein or AOX1 homolog is an alcohol oxidase classified as EC 1.1.3.13.

[0065] In particular, the AOX1 homolog has at least any one of 60%, 70%, 80%, 85%, 90%, or 95% sequence identity with SEQ ID NO: 1. The AOX1 homolog is understood herein to encode an AOX1 homolog. In particular, the sequence identity is determined as further disclosed herein, e.g. when comparing full-length sequences.

[0066] The term "AOX2" as described herein shall refer to a native alcohol oxidase 2, such as a Pichia pastoris alcohol oxidase 2 comprising or consisting of the amino acid sequence identified as SEQ ID NO: 3 (UniProtKB - F2R038), or a sequence having a certain homology (or sequence identity) to SEQ ID NO: 3, which can be a homolog of a Pichia pastoris alcohol oxidase 2, which is endogenous to a methanol- utilizable yeast species, in particular to the methanol-utilizable yeast used as host cell prior to the one or more genetic modifications reducing the expression of said endogenous alcohol oxidase 2 herein. In particular, the AOX2 protein is an ortholog which is endogenous to the species of the host cell species.

[0067] In particular, the gene encoding a Pichia pastoris alcohol oxidase 2 (referred to herein as AOX2 gene) comprises or consists of the nucleotide sequence identified as SEQ ID NO: 4.

[0068] The homologous sequence is also referred to as AOX2 homolog or AOX2 homolog. In particular, the AOX2 protein or AOX2 homolog is an alcohol oxidase classified as EC 1.1.3.13.

[0069] In particular, the AOX2 homolog has at least any one of 60%, 70%, 80%, 85%, 90%, or 95% sequence identity with SEQ ID NO: 3. The AOX2 homolog is understood herein to encode an AOX2 homolog. In particular, the sequence identity is determined as further disclosed herein, e.g. when comparing full-length sequences.

[0070] Specifically, the AOX1 and / or AOX2 protein is of Pichia pastoris origin, in particular of Pichia commata or Pichia famula origin, if the host cell is Pichia pastoris, in particular Pichia commata and Pichia famula, respectively. Alternatively, each of the AOX1 and AOX2 proteins comprises a homolog (or ortholog) sequence of the respective protein of Pichia pastoris, in particular of Pichia commata or Pichia famula, which is endogenous to the wild-type host cell, if of another origin or species. For example, if the host cell is Pichia famula, the endogenous AOX1 or AOX2 protein comprises or consists of the amino acid sequence identified as SEQ ID NO: 1 and SEQ ID NO: 3, respectively.

[0071] According to another embodiment, if the host cell is Pichia commata, the endogenous AOX1 protein comprises or consists of the amino acid sequence identified as SEQ ID NO: 9 (Pichia commata, ATCC 28485), which is 99.85% identical to SEQ ID NO: 1.

[0072] According to another embodiment, if the host cell is Pichia commata, the endogenous AOX2 protein comprises or consists of the amino acid sequence identified as SEQ ID NO: 11, which is 99.40% identical to SEQ ID NO: 3.

[0073] Exemplary homologs are described in Figure 1

[0074] SEQ ID NO: 9: AOX1 amino acid sequence of Pichia commata ATCC 28485

[0075] SEQ ID NO: 10: AOX1 nucleotide sequence of Pichia commata ATCC 28485

[0076] SEQ ID NO: 11: AOX2 amino acid sequence of Pichia commata ATCC 28485

[0077] SEQ ID NO: 12: AOX2 nucleotide sequence of Pichia commata ATCC 28485

[0078] ​SEQ ID NO: 13: MOD1 amino acid sequence of Ogataea methanolica JCM 10240

[0079] SEQ ID NO: 14: MOD1 nucleotide sequence of Ogataea methanolica JCM 10240

[0080] SEQ ID NO: 15: MOD2 amino acid sequence of Ogataea methanolica JCM 10240

[0081] SEQ ID NO: 16: MOD2 nucleotide sequence of Ogataea methanolica JCM 10240

[0082] SEQ ID NO: 17: pMOD1 promoter sequence of Ogataea methanolica JCM 10240

[0083] SEQ ID NO: 18: pMOD2 promoter sequence of Ogataea methanolica JCM 10240

[0084] SEQ ID NO: 19: MOX amino acid sequence of Ogataea polymorpha NCYC 495 leu 1.1

[0085] SEQ ID NO: 20: MOX nucleotide sequence of Ogataea polymorpha NCYC 495 leu 1.1

[0086] SEQ ID NO: 21 : pMOX promoter sequence of Ogataea polymorpha NCYC 495 leu 1.1

[0087] However, if the host cell belongs to a different species (other than Pichia pastoris and / or Pichia finlandica), the AOX1 or AOX2 protein sequence endogenous to the host cell is a homolog of SEQ ID NO: 1 and SEQ ID NO: 3, respectively, and for the purposes described herein, the expression of such homologs (orthologous sequences of SEQ ID NO: 1 and SEQ ID NO: 3, respectively) in the host cell is reduced.

[0088] In particular, any or each homologous sequence is characterized by the same qualitative function of the respective AOX1 and AOX2 protein in a wild-type host cell, such as in Pichia pastoris, in particular Pichia commata or Pichia finlandica, for example as an alcohol oxidase (EC 1.1.3.13).

[0089] Specifically, the respective homologous sequences of SEQ ID NO: 1 and SEQ ID NO: 3 are of a species other than Pichia pastoris, in particular Komagataella pastoris or Komagataella phaffii, e.g., another yeast of the genus Komagataella or Pichia, and expression of the respective endogenous coding sequence is reduced or eliminated (knocked out), as described herein.

[0090] Specifically, both AOX1 and AOX2 proteins are endogenous to the host cell, and expression of the genes encoding AOX1 and AOX2, respectively, is reduced or absent.

[0091] Specifically, both AOX1 and AOX2 proteins are of the same origin, derived from or endogenous to the same host cell (or host cell species) prior to its engineering to reduce expression of the first and second endogenous genes.

[0092] Specifically, both AOX1 and AOX2 proteins are of Pichia pastoris origin, in particular proteins encoded by respective genes endogenous to the host cell, wherein the host cell is Pichia pastoris.

[0093] Specifically, both AOX1 and AOX2 proteins are of Komagataella phaffii origin, in particular proteins encoded by respective genes endogenous to the host cell, wherein the host cell is Komagataella phaffii.

[0094] Specifically, both AOX1 and AOX2 proteins are of Komagataella pastoris origin, in particular proteins encoded by respective genes endogenous to the host cell, wherein the host cell is Komagataella pastoris.

[0095] According to a specific aspect, the one or more genetic modifications comprise a disruption, substitution, deletion, knock-in or knock-out of (i) one or more polynucleotides or a portion thereof; or (ii) an expression control sequence.

[0096] According to a specific aspect, the one or more genetic modifications are directed to one or more endogenous polynucleotides of the host cell described herein, such as a coding polynucleotide, including, e.g., the polynucleotide (or gene) encoding the respective AOX1, AOX2 or ADH2 protein, in particular the wild-type (unmodified or native) protein naturally present in the host cell species, type or strain; or a nucleotide sequence controlling expression of the polynucleotide (or gene).

[0097] According to a specific aspect, the one or more genetic modifications are directed to an expression control sequence, including for example a promoter, a ribosomal binding site, a transcriptional or translational initiation and termination sequence; or to an enhancer or activator sequence.

[0098] A variety of methods of engineering host cells can be employed to modulate (reduce or increase) the expression of an endogenous polynucleotide, such as

[0099] a) reducing the expression of a gene encoding a corresponding AOX1 or AOX2 protein, including for example disrupting a polynucleotide encoding a corresponding AOX1 or AOX2 protein, disrupting a promoter operably linked to such a polynucleotide, replacing such a promoter with another promoter having a lower promoter activity; or

[0100] b) increasing the expression of a gene encoding an ADH2 protein, including for example introducing a polynucleotide encoding an ADH2 protein into the host cell genome, disrupting a promoter operably linked to such a polynucleotide, replacing such a promoter with another promoter having a higher promoter activity.

[0101] Specific methods of modifying gene expression employ modulating (e.g., activating, upregulating, inactivating, repressing, or downregulating) a regulatory sequence that modulates the expression of a polynucleotide (gene), such as by using a corresponding transcriptional regulator targeting the relevant sequence using an RNA-guided ribonuclease used in methods of modifying host cells based on CRISPR, for example a regulatory sequence selected from the group consisting of a promoter, a ribosomal binding site, a transcriptional initiation or termination sequence, a translational initiation or termination sequence, an enhancer or activator sequence, a repressor or inhibitor sequence, a signal or leader sequence, in particular those sequences that control protein expression and / or secretion.

[0102] According to a specific aspect, the one or more genetic modifications include a gain-of-function alteration of the ADH2 gene that results in an increase in ADH2 levels or activity.

[0103] Specifically, the gain-of-function alteration includes knocking-in an ADH2 gene.

[0104] Specifically, the gain-of-function alteration upregulates ADH2 gene expression in the cell.

[0105] Specifically, the gain-of-function alteration includes inserting a heterologous expression cassette to overexpress an ADH2 gene in the cell.

[0106] Specifically, the heterologous expression cassette comprises a heterologous polynucleotide comprising an ADH2 gene under the control of a promoter sequence. Such a promoter can be any of a constitutive promoter, a repressible promoter, or an inducible promoter.

[0107] In particular, the one or more genetic modifications that increase expression of a gene comprise one or more genomic mutations, including insertions or activation of a gene or genomic sequence (e.g., by knocking in a heterologous gene or increasing the copy number of an endogenous gene), that increase expression of a gene or portion of a gene by at least 50%, 60%, 70%, 80%, 90%, or 95% or even more compared to the corresponding host that is not so genetically modified.

[0108] In particular, the one or more genetic modifications that increase expression comprise a genomic mutation that constitutively improves or otherwise increases expression of one or more endogenous polynucleotides.

[0109] In particular, the one or more genetic modifications that increase expression comprise a genomic mutation that introduces one or more inducible or repressible regulatory sequences that conditionally improve or otherwise increase expression of one or more endogenous polynucleotides. Such conditionally active modifications are particularly directed to those regulatory elements and genes that are active and / or expressed dependent on cell culture conditions.

[0110] In particular, expression of a polynucleotide encoding an ADH2 protein is increased when the host cell is used in a method of producing a protein of interest (POI). In particular, expression of the ADH2 protein is increased under host cell culture conditions for producing the POI after the genetic modification.

[0111] In particular, the host cell is genetically modified to increase the amount (e.g., level, activity, or concentration) of ADH2 protein by at least any of the following: 50%, 60%, 70%, 80%, 90%, or 95% (mol / mol) or even more compared to a host cell that is not so modified (e.g., by knocking in one or more corresponding ADH2 genes). According to a particular embodiment, the host cell is genetically modified for one or more insertions of genomic sequences, in particular genomic sequences encoding a corresponding ADH2 protein that are integrated into the host cell genome. Such host cells are typically provided as knock-in strains.

[0112] According to a particular embodiment, the total amount of ADH2 protein in the host cell or host cell culture once the host cell described herein is cultured in a cell culture is increased by at least any of the following: 50%, 60%, 70%, 80%, 90%, or 95% (activity% or mol / mol) or even 100% or more compared to a reference amount expressed or produced by a host cell prior to or without such genetic modification, or compared to a reference amount produced in a corresponding host cell culture, or compared to a host cell prior to or without the modification.

[0113] In particular, the one or more genetic modifications that reduce expression of a gene, such as the AOX1 and / or AOX2 gene, comprise one or more genomic mutations, including deletions or inactivation of a gene or genomic sequence (e.g., by gene knockout), which reduce expression of the gene or portion of the gene by at least 50%, 60%, 70%, 80%, 90%, or 95% or even completely eliminate expression thereof as compared to a corresponding host that is not so genetically modified.

[0114] In particular, the one or more genetic modifications that reduce expression comprise a genomic mutation that constitutively impairs or otherwise reduces expression of one or more endogenous polynucleotides.

[0115] In particular, the one or more genetic modifications that reduce expression comprise a genomic mutation that introduces one or more inducible or repressible regulatory sequences that conditionally impair or otherwise reduce expression of one or more endogenous polynucleotides. Such conditionally active modifications are particularly directed to those regulatory elements and genes that are active and / or expressed in dependence of cell culture conditions.

[0116] In particular, when the host cell is used in a method of producing a protein of interest (POI), expression of the one or more endogenous polynucleotides is reduced, thereby reducing expression of the polynucleotide encoding the corresponding AOX1 or AOX2 protein. In particular, after the genetic modification, expression of both the AOX1 and AOX2 protein is reduced under host cell culture conditions for producing the POI.

[0117] In particular, the host cell is genetically modified (e.g., by knocking out the corresponding AOX1 and AOX2 genes) to reduce the amount (e.g., level, activity, or concentration) of both the AOX1 and AOX2 protein by at least any of the following: 50%, 60%, 70%, 80%, 90%, or 95% (activity % or mol / mol) or even 100%, e.g., to an undetectable amount, as compared to a host cell that is not so modified, thereby completely eliminating production of both the AOX1 and AOX2 protein. According to a particular embodiment, the host cell is genetically modified to comprise one or more deletions of genomic sequence(s), in particular of a gene encoding the corresponding AOX1 and / or AOX2 protein. Such host cells are typically provided as deletion or knockout strains.

[0118] According to a particular aspect, the first and / or second endogenous gene is knocked out by the one or more genetic modifications. In particular, the Mut- host cell is a AAOX1 / AAOX2 knockout strain.

[0119] According to one specific aspect, the first and / or second endogenous gene is knocked out by the one or more genetic modifications; and the ADH2 gene is knocked in by the one or more genetic modifications. Specifically, the Mut- host cell is a AOX1 / AOX2 + ADH2-OE strain.

[0120] According to one specific embodiment, once the host cell described herein is cultivated in a cell culture, the total amount of the respective AOX1 and / or AOX2 protein in the host cell or host cell culture is reduced by at least any of the following: 50%, 60%, 70%, 80%, 90% or 95% (mol / mol) or even 100%, e.g. to an undetectable amount, compared to a reference amount expressed or produced by a host cell prior to such genetic modification or without such genetic modification, or compared to a reference amount produced in a respective host cell culture, or compared to a host cell prior to the modification or without the modification.

[0121] When comparing the host cells described herein for the effect of the genetic modification on increasing or decreasing the production of the respective ADH2, AOX1 or AOX2 protein, it is typically compared to a comparable host cell prior to such genetic modification or without such genetic modification. Typically, the comparison is made to the same host cell species or type without such genetic modification (or prior to such genetic modification), which is engineered to produce a recombinant or heterologous POI, particularly when cultivated under conditions to produce the POI. However, it can also be compared to the same host cell species or type without further engineering to produce a recombinant or heterologous POI.

[0122] According to one specific aspect, the increase or decrease of the respective ADH2, AOX1 or AOX2 protein is determined by an increase or decrease of the amount (e.g. level, activity or concentration) of the respective protein in the cell. In particular, the amount of said protein is determined by a suitable method such as employing Western Blotting, immunofluorescence imaging, flow cytometry or mass spectrometry, in particular wherein mass spectrometry is liquid chromatography-mass spectrometry (LC-MS) or liquid chromatography tandem mass spectrometry (LC-MS / MS), e.g. as described by Doneanu et al. (MAbs. 2012; 4(1): 24-44). According to one specific embodiment, alcohol dehydrogenase activity can be measured by an activity assay using cell-free extracts. Cell-free extracts can be obtained by mechanical disruption of the cell culture with zirconium dioxide / silicon dioxide / glass beads as described by Karaoglan et al. (Biotechnol Lett. 2016; 38(3): 463-9). Alcohol dehydrogenase activity is measured by measuring the increase in absorption at a wavelength of 340 nm directly after formation of NADH as described by Walker (Biochemical Education. 1992 21(1): 42-43). NADH production is negatively correlated with NAD + and alcohol is used as substrate and consumed in equimolar concentration. NADH production is negatively correlated with NAD + consumption. Alternatively, a commercial colorimetric alcohol dehydrogenase activity assay kit (MAK053, Sigma-Aldrich) can be used. Alcohol oxidase activity can be measured calorimetrically with 2,2'-azino-bis-(3-ethylbenzothiazoline-6-sulfonic acid reacting with hydrogen peroxide as described by Verduyn et al. (Journal of Microbiological Methods. 1984 (2) 1: 15-25) or by measuring the amount of formaldehyde formed as described by Couder and Baratti (Agric. Bioi. Chern. 1980; 44(10): 2279-2289). Detailed assays are described in the example section herein.

[0123] According to one specific aspect, the Mut-host cell comprises a heterologous gene of interest expression cassette (GOIEC) comprising an expression cassette promoter (ECP) operably linked to a gene of interest (GOI) encoding a protein of interest (POI).

[0124] According to one specific aspect, the Mut-host cell is a recombinant host cell comprising at least one heterologous GOIEC, wherein at least one component or combination of components comprised in the GOIEC is heterologous to the host cell. Specifically, using artificial expression cassettes, in particular wherein the promoter and the GOI are heterologous to each other, do not occur in nature in such a combination, e.g. wherein either (or only one) of the promoter and the GOI is artificial or heterologous relative to the other and / or the host cell described herein; the promoter is an endogenous promoter and the GOI is a heterologous GOI; or the promoter is an artificial or heterologous promoter and the GOI is an endogenous GOI; wherein both the promoter and the GOI are artificial, heterologous or from different origins, such as from a different species or type (strain) of cell compared to the host cell described herein. Specifically, in the cell used as the host cell described herein, the ECP is not naturally associated with the GOI and / or is not operably linked thereto.

[0125] Specifically, the GOIEC comprises a constitutive promoter, an inducible promoter or a repressible promoter.

[0126] Specific examples of constitutive promoters include, e.g., pGAP and functional variants thereof, any constitutive promoter disclosed in WO 2014139608, such as pCS1.

[0127] Specific examples of inducible promoters or repressible promoters include, e.g., native pAOX1 or pAOX2 and functional variants thereof, any regulated promoter disclosed in WO 2013050551, such as pG1-pG8 and fragments thereof; any regulated promoter disclosed in WO 2017021541 Al, such as pG1 and pG1-x.

[0128] Suitable promoters for yeast host cells are described in Mattanovich et al. (Methods Mol. Biol. (2012) 824:329-58) and include glycolytic enzymes such as triose phosphate isomerase (TPI), phosphoglycerate kinase (PGK), glyceraldehyde-3-phosphate dehydrogenase (GAPDH or GAP) and variants thereof, lactase (LAC) and galactosidase (GAL), Pichia pastoris glucose-6-phosphate isomerase promoter (PPGI), 3-phosphoglycerate kinase promoter (PPGK), glyceraldehyde phosphate dehydrogenase promoter (pGAP), translation elongation factor promoter (PTEF), and Pichia pastoris enolase 1 (PENOI) promoter, triose phosphate isomerase (PTPI), ribosomal subunit proteins (PRPS2, PRPS7, PRPS31, PRPL1), alcohol oxidase promoter (PAOX1, PAOX2) or variants thereof with modified characteristics, formaldehyde dehydrogenase promoter (PFLD), isocitrate lyase promoter (PICL), alpha-ketoisovalerate decarboxylase promoter (PTHI), heat shock protein family members (PSSA1, PHSP90, PKAR2) promoters, 6-phosphogluconate dehydrogenase (PGND1), phosphoglyceromutase (PGPM1), transketolase (PTKL1), phosphatidylinositol synthase (PPIS1), ferro-02-oxidoreductase (PFET3), high-affinity ferrous permease (PFTR1), repressible alkaline phosphatase (PPH08), N-myristoyltransferase (PNMT1), pheromone response transcription factor (PMCM1), ubiquitin (PUBI4), single-stranded DNA endonuclease (PRAD2), promoter for the major ADP / ATP carrier of the inner mitochondrial membrane (PPET9) (WO 2008 / 128701), and formate dehydrogenase (FMD) promoter.

[0129] Other examples of suitable promoters include the Saccharomyces cerevisiae enolase (ENOl), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase (PGK), and maltose gene promoter (MAL).

[0130] GAP promoter (pGAP), AOX1 (pAOX1) or AOX2 (pAOX2) promoters or as functional variants thereof and promoters derived from any one of pGAP or pAOX1 or pAOX2 are particularly preferred. pAOX promoters can be induced by methanol and repressed by glucose. In particular, a functional variant has at least any one of 80%, 85%, 90%, 95% or 100% sequence identity to the promoter from which it is derived and has about the same promoter activity (e.g., + / - any one of 50%, 40%, 30%, 20% or 10%; although the promoter activity can be improved) as the promoter from which it is derived.

[0131] According to one specific embodiment, the ECP is methanol inducible. In particular, the ECP is controlled by methanol. In particular, the ECP can be induced completely in a cell culture containing methanol. In this case, methanol can not only be used as an energy source supplied to the cell culture, but also to induce POI expression when inducing the ECP.

[0132] According to one specific aspect, the ECP is methanol inducible by the amount of methanol present in the cell culture used as carbon source for the production of the POI. In particular, the GOI expression by the heterologous expression cassette can be induced by the methanol inducible ECP.

[0133] In particular, the ECP is methanol inducible and, for example, repressed in the absence of an amount of methanol in the cell culture medium or supernatant (referred to herein as promoter repressing amount) of less than any one of 0.1 %, 0.05% or 0.01 % (v / v).

[0134] In particular, the ECP is methanol inducible and, for example, induced in the presence of an amount of methanol in the cell culture medium or supernatant (referred to herein as promoter inducing amount) of at least one of 0.1 %, 0.5%, 1 %, 1.5%, 2.0%, 2.5% or 3% (v / v) above the promoter repressing amount.

[0135] In particular, the amount of methanol used in the cell culture process as described herein induces the ECP completely. The ECP promoter is considered to be induced completely if the culture conditions provide about the maximum induction.

[0136] Such an amount in the cell culture medium or supernatant is in particular understood as an amount that can be detected after feeding to the host cell and being consumed by the host cell. Typically, when the POI is produced in the production phase of the cell culture, the cell culture is fed by adding a supplemental carbon source, but the amount thereof is immediately consumed by the cells during POI production, thus, leaving no or only a low residual amount, e.g. an amount of at most 1.0 g / L, in the cell culture medium or supernatant.

[0137] In particular, the ECP is endogenous or heterologous to the host cell.

[0138] In particular, the ECP is any one of:

[0139] a) a pAOXl promoter comprising or consisting of a sequence identity to any one of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of SEQ ID NO: 5; or

[0140] b) a pAOX2 promoter comprising or consisting of a sequence identity to any one of at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% of SEQ ID NO: 6; or

[0141] c) a promoter comprising or consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 36-49.

[0142] In particular, any of the methanol inducible promoters listed in Table 38 can be used, in particular those comprising or consisting of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 36-49.

[0143] Functional pAOXl and pAOX2 promoter variants characterized by a sequence identity of at least 60% are exemplified by the exemplary methanol inducible promoters further described herein. For example, SEQ ID NO: 17 (pMODl promoter sequence of Ogataea minuta JCM 10240) has a sequence identity of 54.0% compared to SEQ ID NO: 5; and SEQ ID NO: 18 (pMOD2 promoter sequence of Ogataea minuta JCM 10240) has a sequence identity of 53.7% compared to SEQ ID NO: 6. The sequence identity of the pMODl and pMOD2 promoters compared to the respective pAOXl and pAOX2 promoters has been determined by alignment using LALIGN version 36.3.8g December 2017; the results involve sequences aligned to the same sequence orientation and highest overlap (parameters: Matrix: +5 / -4; Gap open: -5; Gap extend: -4; E() threshold 10.0; Output format: MARKX 0; Graphics: yes).

[0144] Other exemplary methanol inducible promoters are listed in Table 38 or are pSHB17, pALD4, pFDH1, pDAS1, pDAS2, pPMP20, pFBA1-2 pPMP47, pFLD, pFGH1, pTAL1-2, pDAS2, pCAM1, pPP7435_Chr1-0336, as described in Gasser et al. (Gasser, Steiger and Mattanovich, 2015, Microb Cell Fact. 14: 196).

[0145] As described herein, the term "pAOX1" shall refer to both a promoter comprising the sequence identified as SEQ ID NO: 5 or a sequence having a certain homology (or sequence identity) to SEQ ID NO: 5. Homologous sequences are also referred to as pAOX1 homologues. The pAOX1 homologues can be the natural, naturally occurring sequence or a mutant thereof, e.g. generated by any suitable mutagenesis method.

[0146] As described herein, the term "pAOX2" shall refer to both a promoter comprising the sequence identified as SEQ ID NO: 6 or a sequence having a certain homology (or sequence identity) to SEQ ID NO: 6. Homologous sequences are also referred to as pAOX2 homologues. The pAOX2 homologues can be the natural, naturally occurring sequence or a mutant thereof, e.g. generated by any suitable mutagenesis method.

[0147] A pAOX1 or pAOX2 mutant as described herein is specifically characterized by an increased promoter strength of any one of about 0.5-fold to at least 1.1-fold, 1.2-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.1-fold, 2.2-fold, 2.3-fold, 2.4-fold, 2.5-fold, 2.6-fold, 2.7-fold, 2.8-fold, 2.9-fold, 3-fold, 3.3-fold, 3.5-fold, 3.8-fold, 4-fold, 4.5-fold, 5-fold, 5.5-fold or at least 6-fold compared to the respective natural pAOX1 or pAOX2 promoter when in an induced state, as determined in a comparable expression system or production host cell line.

[0148] Specifically, the promoter strength is determined by the expression level of a POI, such as a model protein (e.g. green fluorescent protein GFP, including e.g. enhanced GFP, eGFP, Gene Bank accession number U57607) and / or the transcriptional strength compared to a reference promoter. Preferably, the transcriptional analysis is quantitative or semi-quantitative, preferably employing qRT-PCR, DNA microarray, RNA sequencing and transcriptome analysis.

[0149] In particular, the recombinant host cell described herein comprises only one or more heterologous GOIEC, e.g. multiple copies of the expression cassette, such as at least 2, 3, 4 or 5 copies (gene copy number, GCN). For example, the recombinant host cell comprises up to 2, 3, 4 or 5 copies. Each copy can comprise or consist of the same or different sequence, also including an ECP operably linked to the GOI.

[0150] According to one particular aspect, the heterologous expression cassette is comprised in an autonomously replicating vector or plasmid, or is integrated in the chromosome of the host cell.

[0151] The expression cassette can be introduced into the host cell and integrated into the host cell genome (or any of its chromosomes), e.g. at a specific integration site or randomly, whereby high- producing host cell lines are selected. Alternatively, the expression cassette can be integrated in an extrachromosomal genetic element such as a plasmid or artificial chromosome (e.g. a yeast artificial chromosome (YAC)). According to one particular example, the expression cassette is introduced into the host cell by a vector, in particular an expression vector, which is introduced into the host cell by suitable transformation techniques. For this purpose, the GOI can be ligated into the expression vector.

[0152] Preferred yeast expression vectors, which are preferably used for expression in yeast, are selected from the group consisting of plasmids derived from pPICZ, pGAPZ, pPIC9, pPICZalfa, pGAPZalfa, pPIC9K, pGAPHis, pPUZZLE or GoldenPiCS.

[0153] Techniques for transfecting or transforming host cells to introduce vectors or plasmids are well known in the art. They can include electroporation, spheroplast formation, lipid vesicle-mediated uptake, heat shock-mediated uptake, calcium phosphate-mediated transfection (co-precipitation of calcium phosphate / DNA), viral infection, and in particular the use of modified viruses such as for example modified adenoviruses, microinjection and electroporation.

[0154] Transformants as described herein can be obtained by introducing the expression cassette, vector or plasmid DNA into the host and selecting for transformants expressing the relevant protein or selection marker. The host cell can be treated to introduce the heterologous or foreign DNA by methods conventionally used for transforming host cells such as the electroporation method, the protoplast method, the lithium acetate method and modifications thereof. P. pastoris is preferably transformed by electroporation. Preferred transformation methods for uptake of recombinant DNA fragments by microorganisms include chemical transformation, electroporation or by protoplast transformation.

[0155] According to a specific aspect, the heterologous GOI EC described herein comprises or consists of an artificial fusion of polynucleotides comprising an ECP operably linked to a GOI and optionally further sequences such as signal, leader or terminator sequences.

[0156] In particular, the expression cassette comprises an ECP operably linked to a GOI and optionally further comprises signal and leader sequences which are necessary for the expression and production of the POI as a secreted protein.

[0157] According to a specific aspect, the GOI EC comprises a nucleotide sequence encoding a signal peptide capable of secreting the POI.

[0158] In particular, the nucleotide sequence encoding the signal peptide is fused adjacent to the 5’ end of the GOI.

[0159] In particular, the signal peptide is selected from the group consisting of the signal sequence from the S. cerevisiae a-mating factor prepro-peptide, the signal peptide from the Pichia pastoris acid phosphatase gene (PHO1) and extracellular protein X (EPX1) (Heiss, S., V. Puxbaum, C. Gruber, F. Altmann, D. Mattanovich & B. Gasser, Microbiology 2015; 161(7): 1356-68).

[0160] In particular, any signal and / or leader sequence as described in WO2014067926 Al can be used, in particular SEQ ID NO: 22 or SEQ ID NO: 23.

[0161] In particular, the signal sequence as described in WO2012152823 Al can be used, in particular the signal sequence of the S. cerevisiae native a mating factor identified as SEQ ID NO: 24 or a mutant thereof.

[0162] According to a specific aspect, the host cell described herein can be subjected to one or more further genetic modifications, for example for improving protein production.

[0163] In particular, the host cell is further engineered to modify one or more genes affecting proteolytic activity for the production of protease-deficient strains, in particular carboxypeptidase Y activity deficient strains. Particular examples are described in WO1992017595 Al. Further examples of protease-deficient Pichia strains with a deficiency in vacuolar protease (such as protease A or protease B) function are described in US6153424A. Other examples are Pichia strains with a deletion of ade2 and / or a deletion of one or both of the protease genes PEP4 and PRB1, provided by e.g. ThermoFisher Scientific.

[0164] In particular, the host cell is engineered to modify at least one nucleic acid sequence encoding a functional gene product, in particular a protease, selected from the group consisting of PEP4, PRB1, YPS1, YPS2, YMP1, YMP2, YMP1, DAP2, GRH1, PRD1, YSP3 and PRB3, as disclosed in WO 2010099195 Al.

[0165] Particularly, overexpression or underexpression of genes encoding accessory factors is applied to enhance expression of the GOI, e.g. as described in WO2015158800 Al.

[0166] The POI can be any of a eukaryotic, prokaryotic or synthetic peptide, polypeptide, protein or metabolite of the host cell.

[0167] According to one particular aspect, the POI is heterologous to the Mut-host cell or ECP.

[0168] In particular, the POI is heterologous to the host cell species.

[0169] In particular, the POI is a secreted peptide, polypeptide or protein, i.e. secreted from the host cell into the cell culture supernatant.

[0170] In particular, the POI is a eukaryotic protein, preferably a mammalian derived or related protein (such as a human protein or a protein comprising a human protein sequence) or a bacterial protein or a bacterial derived protein.

[0171] Preferably, the POI is a therapeutic protein acting in mammals.

[0172] In particular cases, the POI is a multimeric protein, in particular a dimer or tetramer.

[0173] In particular, the POI is a peptide or protein selected from the group consisting of an antigen binding protein, a therapeutic protein, an enzyme, a peptide, a protein antibiotic, a toxin fusion protein, a carbohydrate-protein conjugate, a structural protein, a regulatory protein, a vaccine antigen, a growth factor, a hormone, a cytokine, a processing enzyme.

[0174] In particular, the antigen binding protein is selected from the group consisting of:

[0175] a) an antibody or antibody fragment, such as any of a chimeric antibody, a humanized antibody, a bispecific antibody, a Fab, a Fd, a scFv, a diabody, a triabody, a Fv tetramer, a minibody, a single domain antibody (such as a VH, VHH, IgNAR or V-NAR);

[0176] b) an antibody mimetic, such as an Adnectin, an Affibody, an Affilin, an Affimer, an Affitin, an alphabody, an Anticalin, an Avimer, a DARPin, a Fynomer, a Kunitz domain peptide, a monobody or a NanoCLAMPS; or

[0177] c) a fusion protein comprising one or more immunoglobulin fold domains, antibody domains or antibody mimetics.

[0178] A specific POI is an antigen binding molecule, such as an antibody or fragment thereof, in particular an antibody fragment comprising an antigen binding domain. A specific POI is an antibody, such as a monoclonal antibody (mAb), an immunoglobulin (Ig) or a class G immunoglobulin (IgG), a heavy chain antibody (HcAb); or a fragment thereof, such as an antigen binding fragment (Fab), Fd, a single chain variable fragment (scFv); or an engineered variant thereof, such as for example a Fv dimer (diabody), a Fv trimer (triabody), a Fv tetramer or a minibody and a single domain antibody (such as a VH, VHH, IgNAR or V-NAR) or any protein comprising an immunoglobulin fold domain. Other antigen binding molecules can be selected from antibody mimetics or (alternative) scaffold proteins, such as for example an engineered Kunitz domain, an Adnectin, an Affibody, an Affilin, an Anticalin or a DARPin.

[0179] According to one specific aspect, the POI is, for example, BOTOX, Myobloc, Neurobloc, Dysport (or other serotypes of botulinum neurotoxin), Aridase alpha, Daptomycin, YH-16, Chorionic Gonadotropin alpha, Filgrastim, Cetrorelix, Interleukin-2, Aldesleukin, Teceleulin, Denileukin diftitox, Interferon alpha-n3 (Injection), Interferon alpha-nl, DL-8234, Interferon, Suntory (gamma- la), Interferon gamma, Thymosin alpha 1, Tasonermin, DigiFab, ViperaTAb, EchiTAb, CroFab, Neksim, Abatilcept, Alefacept, Rebif, Eptoterminalfa, Teriparatide (osteoporosis), Injected Calcitonin (osteopathy), Calcitonin (nasal, osteoporosis), Etanercept, Hemoglobin glutamer 250 (bovine), Drotrecogin alpha, Collagenase, Caplacizumab, Recombinant human epidermal growth factor (topical gel, wound healing), DWP401, Darbepoetin alpha, Epoetin omega, Epoetin beta, Epoetin alpha, Desirudin, Lepirudin, Bivalirudin, Nonacog alpha, Mononine, Eptacog alpha (activated), Recombinate, Recombinant factor VIII + VWF, Recombinate, Recombinant factor VIII, Factor VIII (recombinant), Alphnmate, Octocog alpha, Factor VIII, Palifermin, Indikinase, Tenecteplase, Alteplase, Pamiteplase, Reteplase, Nateplase, Monteplase, Follitropin alpha, rFSH, hpFSH, Micafungin, Pegfilgrastim, Lenograstim, Nartograstim, Semorelin, Glucagon, Exenatide, Pramlintide, Iniglucerase, Galafungin, Leucotropin, Molgramostirn, Triptorelin acetate, Histrelin (subcutaneous implant,Hydron), deslorelin, histrelin, nafarelin, leuprolide depot (ATRIGEL), leuprolide implant (DUROS), goserelin, Eutropin, KP-102 program, somatropin, mecasermin (Somavert), enlfavirtide, Org-33408, insulin glargine, insulin glulisine, insulin (inhaled), insulin lispro, insulin deternir, insulin (buccal, RapidMist), mecasermin-rhPF4, anakinra, simocta, 99mTc-apcitide injection, myelopid, Betaseron, glatiramer acetate, Gepon, sargramostim, oprelvekin, human leukocyte-derived alpha interferon s, Bilive, insulin (recombinant), recombinant human insulin, insulin aspart, mecaserenin, Roferon-A, interferon-alpha 2, Alfaferone, interferon alfacon-1, interferon alpha, Avonex, recombinant human luteinizing hormone, dornase alpha, triazinum, ziconotide, histrelin, diboterminal alpha, atacicept, becaplermin, eptifibatide, Zemaira, CTC-111, Shanvac-B, HPV vaccine (quadrivalent), octreotide, lanreotide, ancestirn, agalsidase beta, agalsidase alpha, rasburicase, pre zatide copper acetate (topical gel), rasburicase, ranibizumab, Actimmune, PEG-Intron, Tricomin, recombinant house dust mite allergy desensitization injection, recombinant human parathyroid hormone (PTH) 1-84 (subcutaneous, osteoporosis), epoetin delta, transgenic antithrombin III, Granditropin, Vitrase, recombinant insulin, interferon-alpha (oral tablet), GEM-21S, vapreotide, idursulfase, omnapatrilat, recombinant serum albumin, certolizumab pegol, glucarpidase, human recombinant C1 esterase inhibitor (angioedema), lanoteplase, recombinant human growth hormone, enfuvirtide (needle-free injection),Biojector 2000), VGV-1, interferon (alpha), lucinactant, aviptadil (inhaled, pulmonary disorders), icatibant, ecallantide, omiganan, Aurograb, pexiganan acetate, ADI-PEG-20, LDI-200, degarelix, cintredegin besudotox, FavId, MDX-1379, ISAtx-247, liraglutide, teriparatide (osteoporosis), tifacogin, AA4500, T4N5 liposome lotion, catumaxomab, DWP413, ART-123, Chrysalin, desirudin, amediplase, corifollitropin alfa, TH-9507, teduglutide, Diamyd, DWP-412, growth hormone (sustained-release injection), recombinant G-CSF, insulin (inhaled, AIR), insulin (inhaled, Technosphere), insulin (inhaled, AERx), RGN-303, DiaPep277, interferon beta (hepatitis C virus infection (HCV)), interferon alpha-n3 (oral), belatacept, transdermal insulin patch, AMG-531, MBP-8298, Xerecept, opebacan, AIDSVAX, GV-1001, LymphoScan, ranpirnase, Lipoxysan, lusupultide, MP52 (beta-tricalcium phosphate carrier, bone regeneration), melanoma vaccine, sipuleucel-T, CTP-37, Insegia, vitespen, human thromboplastin (frozen, surgical bleeding), thrombin, TransMID, alfimeprase, Puricase, terlipressin (intravenous, hepatorenal syndrome), EUR-1008M, recombinant FGF-I (injectable, vascular disorders), BDM-E, rotigaptide, ETC-216, P-113, MBI-594AN, duramycin (inhaled,Cystic fibrosis), SCV-07, OPI-45, Endostatin, Angiostatin, ABT-510, Bowman Birk inhibitor concentrate, XMP-629, 99mTc-Hynic-Annexin V, kahalalide F, CTCE-9908, Teverelix (extended release), ozarelix, romidepsin, BAY-504798, Interleukin 4, PRX-321, Pepscan, iboctadekin, recombinant human lactoferrin (rh lactoferrin), TRU-015, IL-21, ATN-161, cilengitide, albumin interferon (Albuferon), Biphasix, IRX-2, omega interferon, PCK-3145, CAP-232, pasireotide, huN901-DMI, Ovarium, SB-249553, Oncovax-CL, OncoVax-P, BLP-25, CerVax-16, polyepitope peptide melanoma vaccine (MART-1, gp100, tyrosinase), nemifitide, rAAT (inhaled), rAAT (dermatological), CGRP (inhaled, asthma), pegsunercept, thymosin beta 4, plitidepsin, GTP-200, ramoplanin, GRASPA, OBI-1, AC-100, salmon calcitonin (oral, eligen), calcitonin (oral, osteoporosis), examorelin, capromorelin, Cardeva, velafermin, 131I-TM-601, KK-220, T-10, ularitide, depelestat, hematide, Chrysalin (topical), rNAPc2, recombinant Factor V111 (PEGylated liposome), bFGF, PEGylated recombinant staphylokinase variant, V-10153, SonoLysis Prolyse, NeuroVax, CZEN-002, pancreatic islet neogenesis therapy, rGLP-1, BIM-51077, LY-548806, Exenatide (controlled release, Medisorb), AVE-0010, GA-GCB, avorelin, ACM-9604, linaclotide acetate, CETi-1, Hemospan, VAL (injectable), rapid acting insulin (injectable, Viadel), intranasal insulin, insulin (inhaled), insulin (oral,eligen), recombinant methionyl human leptin, pitrakinra subcutaneous injection, eczema), pitrakinra (inhaled dry powder, asthma), Multikine, RG-1068, MM-093, NBI-6024, AT-001, PI-0824, Org-39141, Cpn10 (autoimmune disease / inflammation), talactoferrin (topical), rEV-131 (ophthalmology), rEV-131 (respiratory disease), oral recombinant human insulin (diabetes), RPI-78M, oprelvekin (oral), CYT-99007 CTLA4-Ig, DTY-001, valategrast, interferon alpha-n3 (topical), IRX-3, RDP-58, Tauferon, bile salt-stimulated lipase, Merispase, alkaline phosphatase, EP-2104R, Melanotan-II, bremelanotide, ATL-104, recombinant human microplasmin, AX-200, SΕMAX, ACV-1, Xen-2174, CJC-1008, dynorphin A, SI-6603, LAB GHRH, AER-002, BGC-728, malaria vaccine (virus particle, PeviPRO), ALTU-135, parvovirus B19 vaccine, influenza vaccine (recombinant neuraminidase), malaria / HBV vaccine, anthrax vaccine, Vacc-5q, Vacc-4x, HIV vaccine (oral), HPV vaccine, Tat toxoid, YSPSL, CHS-13340, PTH (1-34) liposome cream (Novasome), Ostabolin-C, PTH analog (topical, psoriasis), MBRI-93.02, MTB72F vaccine (tuberculosis), MVA-Ag85A vaccine (tuberculosis), FARA04, BA-210, recombinant distemper FIV vaccine, AG-702, OxSODrol, rBetVl, Der-p1 / Der-p2 / Der-p7 allergen-targeting vaccine (dust mite allergy), PR1 peptide antigen (leukemia), mutant ras vaccine, HPV-16 E7 lipopeptide vaccine, labyrinthin vaccine (adenocarcinoma), CML vaccine, WT1-peptide vaccine (cancer), IDD-5, CDX-110, Pentrys, Norelin, CytoFab, P-9808, VT-111, icrocaptide, telbermin (dermatology,diabetic foot ulcers), rupintrivir, reticulose, rGRF, HA, alpha-galactosidase A, ACE-011, ALTU-140, CGX-1160, angiotensin treatment vaccine, D-4F, ETC-642, APP-018, rhMBL, SCV-07 (oral, tuberculosis), DRF-7295, ABT-828, ErbB2-specific immunotoxin (anti-cancer), DT3SS IL-3, TST-10088, PRO-1762, Combotox, enterocrastin-B / gastrin-releasing peptide receptor binding peptide, 111In-hEGF, AE-37, trasnizumab-DM1, antagonist G, IL-12 (recombinant), PM-02734, IMP-321, rhIGF-BP3, BLX-883, CUV-1647 (topical), L-19-based radioimmunotherapy (cancer), Re-188-P-2045, AMG-386, DC / 1540 / KLH vaccine (cancer), VX-001, AVE-9633, AC-9301, NY-ESO-1 vaccine (peptide), NA17.A2 peptide, melanoma vaccine (pulsed antigen therapy), prostate cancer vaccine, CBP-501, recombinant human lactoferrin (dry eye), FX-06, AP-214, WAP-8294A (injectable), ACP-HIP, SUN-11031, Peptide YY [3-36] (obesity, intranasal), FGLL, atacicept, BR3-Fc, BN-003, BA-058, human parathyroid hormone 1-34 (nasal, osteoporosis), F-18-CCR1, AT-1100 (celiac disease / diabetes), JPD-003, PTH (7-34) liposomal cream (Novasome), duramycins (ophthalmic, dry eye), CAB-2, CTCE-0214, glycosylated pegylated erythropoietin, EPO-Fc, CNTO-528, AMG-114, JR-013, Factor XIII, aminocandin, PN-951, 716155, SUN-E7001, TH-0318, BAY-73-7977, teverelix (immediate release), EP-51216, hGH (controlled release,Biosphere), OGP-I, sifuvirtide, TV4710, ALG-889, Org-41259, rhCC10, F-991, thymopentin (pulmonary diseases), r(m)CRP, liver-selective insulin, subalin, L19-IL-2 fusion protein, elastin, NMK-150, ALTU-139, EN-122004, rhTPO, thrombopoietin receptor agonist (thrombocytopenic disorders), AL-108, AL-208, nerve growth factor antagonist (pain), SLV-317, CGX-1007, INNO-105, eligen, GEM-OS1, AC-162352, PRX-302, LFn-p24 fusion vaccine (Therapore), EP-1043, S pneumoniae pediatric vaccine, malaria vaccine, Neisseria meningitidis group B vaccine, group B streptococcus vaccine for newborns, anthrax vaccine, HCV vaccine (gpE1+gpE2+MF-59), otitis media therapy, HCV vaccine (core antigen+ISCOMATRIX), hPTH(1-34) (transdermal, ViaDerm), 768974, SYN-101, PGN-0052, aviscumnine, BIM-23190, tuberculosis vaccine, polyepitopic tyrosinase peptide, cancer vaccine, enkastim, APC-8024, GI-5005, ACC-001, TTS-CD3, vascular-targeted TNF (solid tumors), desmopressin (buccal controlled release), onercept, or TP-9201, adalimumab (HUMIRA), infliximab (REMICADE, TM ), rituximab (RITUXAN TM / MAB THERA TM ), etanercept (ENBREL TM ), bevacizumab (AVASTIN TM ), trastuzumab (HERCEPTIN TM ), pegfilgrastim (NEULASTA TM ), or any other suitable POI, including biosimilars and biobetters.

[0180] According to one specific aspect, the fermentation product is isolated from the cell culture, the fermentation product comprising the POI or a host cell metabolite obtained from the Mut-host cell.

[0181] According to a specific aspect, the Mut- host cell is a yeast cell of the genus Pichia, Komagataella, Hansenula, Ogataea or Candida.

[0182] In particular, the Mut- host cell is derived from a yeast strain selected from the group consisting of Pichia species, such as Pichia pastoris, Pichia methanolica, Pichia kluyveri and Pichia angusta; Komagataella species, such as Komagataella pastoris, Komagataella pseudopastoris or Komagataella phaffii; Hansenula species, such as Hansenula polymorpha; Ogataea species, such as Ogataea polymorpha or Ogataea parapolymorpha; and Candida species, such as Candida utilis, Candida cacaoi and Candida boidinii.

[0183] Pichia pastoris species are preferred. In particular, the host cell is a Pichia pastoris strain selected from the group consisting of CBS 704, CBS 2612, CBS 7435, CBS 9173-9189, DSMZ 70877, X-33, GS115, KM71, KM71H and SMD1168.

[0184] Origins: CBS 704 (= NRRL Y-1603 = DSMZ 70382), CBS 2612 (= NRRL Y-7556), CBS 7435 (= NRRL Y-11430), CBS 9173-9189 (CBS strains: Fungal Biodiversity Centre, Centraalbureau voor Schimmelculturen, Utrecht, The Netherlands) and DSMZ 70877 (German Collection of Microorganisms and Cell Cultures); strains from Invitrogen, such as X-33, GS115, KM71, KM71H and SMD1168.

[0185] According to one specific aspect, the application provides a method of producing a protein of interest (POI), comprising culturing a Mut-host cell as described herein using methanol as a carbon source to produce the POI, in particular such an amount of methanol induced by methanol used as an energy source and not (only) for the ECP.

[0186] According to one specific aspect, the method comprises culturing a Mut-host cell using methanol as a carbon source to produce the POI, the Mut-host cell comprising a heterologous gene of interest expression cassette (GOIEC) comprising an expression cassette promoter (ECP) operably linked to a gene of interest (GOI) encoding a protein of interest (POI),

[0187] wherein the Mut-host cell is engineered by one or more genetic modifications to reduce expression of a first endogenous gene and a second endogenous gene compared to the host cell prior to the one or more genetic modifications, wherein

[0188] a) the first endogenous gene encodes an alcohol oxidase 1 (AOX1) comprising an amino acid sequence identified as SEQ ID NO: 1 or a homolog thereof, and

[0189] b) the second endogenous gene encodes an alcohol oxidase 2 (AOX2) comprising an amino acid sequence identified as SEQ ID NO: 3 or a homolog thereof.

[0190] In particular, the Mut-host cell is cultured using methanol as the sole carbon source or in a mixture with other carbon sources (or carbohydrates), in particular as an energy source, such as for growth and / or POI production (synthesis).

[0191] In particular, such other carbon source (also referred to herein as "non-methanol carbon source") is a carbohydrate.

[0192] In particular, the non-methanol carbon source is selected from a saccharide, a polyol, an alcohol, or a mixture of any one or more of the foregoing.

[0193] In particular, the saccharide can be any one or more of a monosaccharide (such as a hexose, e.g. glucose, fructose, galactose or mannose) or a disaccharide (such as sucrose); or an alcohol or polyol, e.g. ethanol, or any diol or triol, e.g. glycerol, or a mixture of any of the foregoing. Any such non-methanol carbon source can be used in addition to the amount of methanol used as carbon source as described herein, in an amount to produce the POI in the cell culture.

[0194] According to one particular embodiment, the cell line is a Mut-host cell.

[0195] In particular, the cell line is cultured under batch culture conditions, fed-batch culture conditions or continuous culture conditions. The culturing can be performed in a microtiter plate, a shake flask or a bioreactor, and optionally starts with a batch phase as first step, followed by a fed-batch phase or a continuous culture phase as second step.

[0196] According to one particular aspect, the method described herein comprises a growth phase and a production phase.

[0197] In particular, the method comprises the following steps:

[0198] a) culturing the host cell under growth conditions (growing phase or "growth phase"); and the further step of

[0199] b) culturing the host cell under growth limiting conditions in the presence of methanol as carbon source (production phase), during which the GOI is expressed to produce the POI.

[0200] In particular, the second step b) follows the first step a).

[0201] In particular,

[0202] a) a growth phase during which the Mut-host cell is cultured using a basic carbon source as energy source; followed by

[0203] b) a production phase during which the Mut-host cell is cultured using a methanol feed, thereby producing a POI.

[0204] In particular, the host cell is cultured in a cell culture medium comprising, e.g., a first carbon source in an amount sufficient to enable the host cell to grow in the cell culture, optionally until the amount of carbon source is consumed, and further cultivation can be carried out under growth limiting conditions, in a first step under growth conditions.

[0205] In particular, the second carbon source is methanol and optionally one or more further carbon sources (in addition to methanol), which is referred to as a supplemental carbon source.

[0206] In particular, the base carbon source and / or supplemental carbon source (in addition to methanol) can be selected from a saccharide, a polyol, an alcohol, or a mixture of any one or more of the foregoing.

[0207] According to one particular embodiment, the base carbon source is different from the supplemental carbon source, e.g., quantitatively and / or qualitatively. Quantitative differences typically provide for different conditions that repress or induce ECP promoter activity.

[0208] According to yet another particular embodiment, the base carbon source and the supplemental carbon source comprise the same type of molecule or carbohydrate, preferably in different concentrations. According to yet another particular embodiment, the carbon source is a mixture of two or more different carbon sources.

[0209] Any type of organic carbon source can be used, in particular those typically used for host cell cultivation, in particular eukaryotic host cell cultivation. According to one particular embodiment, the carbon source is a hexose sugar, such as glucose, fructose, galactose or mannose; a disaccharide, such as sucrose; an alcohol, such as glycerol or ethanol, or a mixture thereof.

[0210] According to one particularly preferred embodiment, the base carbon source is selected from the group consisting of glucose, glycerol, ethanol or a mixture thereof. According to one preferred embodiment, the base carbon source is glycerol.

[0211] According to yet another particular embodiment, the supplemental carbon source comprises (in addition to methanol) a hexose sugar, such as glucose, fructose, galactose and mannose; a disaccharide, such as sucrose; an alcohol, such as glycerol or ethanol; or a mixture thereof. According to one preferred embodiment, the supplemental carbon source comprises glucose in addition to methanol.

[0212] The two cultivation steps in particular comprise cultivating the cell line in the presence of the carbon source.

[0213] In particular, the growth phase (step a)) is cultivated in a batch phase; and the production phase (step b)) is cultivated in a fed-batch cultivation phase or a continuous cultivation phase.

[0214] In particular, the host cells are grown in a carbon-rich source medium comprising a basic carbon source during a high growth rate phase (under growth conditions) step a) (e.g. at least 50% or at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, at least 99% or up to the maximum growth rate) and the POI is produced while the carbon source is limited during a low growth rate phase (under growth limiting conditions) step b) (e.g. less than 90%, preferably less than 80%, less than 70%, less than 60%, less than 50% or less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 2%, less than 1 %, less than 0.5%, less than 0.4%, less than 0.3% or less than 0.2% of the maximum growth rate), in particular by feeding a basic medium comprising only the amount of carbon source which is completely consumed when maintaining the cell culture during the production phase.

[0215] In particular, an average methanol concentration of at least 0.5%, 0.55%, 0.6%, 0.65%, 0.7%, 0.75%, 0.8%, 0.85%, 0.9%, 0.95% or 1.0% (v / v), e.g. at most any of 3%, 2.5%, 2%, 1.5% or 1% (v / v) is used in the host cell culture, in particular in the cell culture medium or supernatant, in particular during the production phase.

[0216] In particular, the average methanol concentration is preferably maintained at at least any of 0.1%, 0.5%, 1%, 1.5%, 2%, 2.5% or 3% (v / v) during the production phase of at least 24 hours.

[0217] According to one particular embodiment, the average methanol concentration is 0.5-2% (v / v) during the production phase of at least 24 hours.

[0218] The average amount or concentration can be calculated as the sum of the methanol concentrations measured in the cell culture, in particular in the cell culture medium or supernatant, as measured at least at the beginning and end of the observation period and within the observation period (e.g. at least every 24 h) or as continuously measured, divided by the number of measurements.

[0219] The methanol concentration in the cell culture can be measured using a suitable standard assay such as HPLC, e.g. determined as the residual concentration in the culture medium after consumption by the cell culture.

[0220] In particular, the average feed rate of the methanol feed is at least any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 mg methanol / (g dry biomass*h) or more, e.g. 2-20 or 2-15 mg methanol / (g dry biomass*h) during the production phase.

[0221] Methanol can be added to the cell culture in one or more portions, for example by one or more injections, or can be added continuously over a certain period of time while the POI is produced. The average amount can be calculated as the sum of all methanol additions over the observation period divided by the average total dry biomass and divided by the duration of the observation period. The average total dry biomass is calculated by measuring the dry biomass concentration at least at the beginning and at the end of the observation period and optionally within the observation period. The dry biomass concentration is then interpolated between the beginning and the end of the observation period. The interpolated dry biomass concentration is multiplied by the reactor volume at each interval, the calculated values of all intervals are added and divided by the number of intervals. The interval duration is less than or equal to 1 h.

[0222] In particular, the average feed rate is preferably maintained at least at any of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 mg methanol / (g dry biomass*h) or more, for example 2-20 or 2-15 mg methanol / (g dry biomass*h) during the production phase of at least 24 hours.

[0223] The observation period is understood herein as a certain period of time in which the cell culture produces the POI and in particular as the production phase, in particular the production phase of a fed-batch or continuous cell culture process. While the actual POI production process or production phase can be longer than the observation period, the average amount is calculated over the defined observation period.

[0224] In particular, the duration of the POI production process is 10 to 500 h.

[0225] In particular, the batch phase is performed for about 10 to 36 h.

[0226] The term "about" in relation to the cultivation time shall mean + / - 5% or + / - 10%.

[0227] For example, the specific batch execution time of about 10 to 36 h can be 18-39.6 h, in particular 19-37.8 h.

[0228] According to one specific embodiment, the batch phase is performed using 10 to 50 g / L of glycerol, in particular 20 to 40 g / L of glycerol as the base carbon source in the batch medium and the cultivation is performed for about 27 to 30 h at 25°C, or for about 23 to 36 h at 30°C, or for a cultivation time of 23 to 36 h at any temperature between 25°C and 30°C. Reducing the glycerol concentration in the batch medium will reduce the length of the batch phase, while increasing the glycerol in the batch medium will even prolong the batch phase. As an alternative to glycerol, glucose can be used, for example in about the same amount.

[0229] In a typical cell culture and POI expression system in which a batch phase is followed by a fed-batch phase, specifically, the fed-batch phase of cultivation is carried out for a duration of any one of the following: about 15 to 100 h, about 15 to 80 h, about 15 to 70 h, about 15 to 60 h, about 15 to 50 h, about 15 to 45 h, about 15 to 40 h, about 15 to 35 h, about 15 to 30 h, about 15 to 35 h, about 15 to 25 h, or about 15 to 20 h; preferably about 20 to 40 h. Specifically, the fed-batch phase of cultivation is carried out for a duration of any one of the following: about 100 h, about 80 h, about 70 h, about 60 h, about 55 h, about 50 h, about 45 h, about 40 h, about 35 h, about 33 h, about 30 h, about 25 h, about 20 h, or about 15 h.

[0230] Specifically, the volumetric product formation rate (rP) is the amount of product (mg) formed per unit volume (L) and unit time (h) (mg(L h) -1 ). The volumetric product formation rate is also referred to as the space-time yield (STY) or the volumetric productivity.

[0231] Specifically, the fed-batch cultivation of the methods described herein is carried out such that the space-time yield is about 30 mg(L h) -1 (meaning 30 mg(L h) -1 + / - 5% or + / - 10%). Specifically, a space-time yield of about 30 mg(L h) -1 is achieved within about 30 h of fed-batch, specifically, at least any one of the following can be achieved within a fed-batch time of less than 33 h, 32 h, 31 h, 30 h, 29 h, 28 h, 27 h, 26 h, or 25 h: 27, 28, 29, 30, 31, 32, or 33 mg(L h) -1 .

[0232] Specifically, the POI is expressed under growth limiting conditions in the production phase, for example by culturing the cell line at a growth rate that is less than the maximum growth rate, typically less than 90%, preferably less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, less than 3%, less than 2%, less than 1%, less than 0.5%, less than 0.4%, less than 0.3%, or less than 0.2% of the maximum growth rate of the cell. Typically, the maximum growth rate is determined individually for each type of host cell.

[0233] According to a specific aspect, the Mut-host cell is cultured during the production phase under conditions that limit growth of the host cell to less than any of 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% (w / w biomass).

[0234] In particular, the production phase employs a feed medium that provides a growth limiting amount of supplemental carbon source to maintain a specific growth rate in the range of 0.0001 h -1 to 0.2 h -1 , preferably 0.005 h -1 to 0.15 h -1 .

[0235] According to a specific aspect, the present application provides use of a recombinant methanol utilization pathway-deficient methanol auxotrophic yeast (Mut-) host cell in a method of producing a fermentation product, the method comprising culturing the Mut-host cell under conditions that allow the Mut-host cell to use methanol as a substrate for alcohol dehydrogenase (ADH2) and to produce the fermentation product.

[0236] In particular, the Mut-host cell lacks alcohol oxidase 1 (AOX1) and alcohol oxidase 2 (AOX2).

[0237] In particular, in the Mut-host cell, a gene encoding alcohol oxidase 1 (AOX1) and alcohol oxidase 2 (AOX2) is knocked out or deleted.

[0238] According to a specific aspect, the present application provides use of a recombinant methanol utilization pathway-deficient methanol auxotrophic yeast (Mut-) host cell in a method of producing a fermentation product, the method comprising culturing the Mut-host cell under conditions that allow the Mut-host cell to use methanol as a carbon source to produce the fermentation product, the Mut-host cell engineered by one or more genetic modifications

[0239] a) to reduce expression of a first endogenous gene and a second endogenous gene as compared to the host cell prior to the one or more genetic modifications, wherein

[0240] i. the first endogenous gene encodes alcohol oxidase 1 (AOX1) comprising an amino acid sequence identified as SEQ ID NO: 1 or a homolog thereof, and

[0241] ii. the second endogenous gene encodes alcohol oxidase 2 (AOX2) comprising an amino acid sequence identified as SEQ ID NO: 3 or a homolog thereof, and

[0242] b) increasing the expression of an alcohol dehydrogenase (ADH2) gene, wherein the ADH2 gene encodes an alcohol dehydrogenase (ADH2).

[0243] According to one specific aspect, the present application provides a method for producing a protein of interest (POI) in a host cell, comprising the steps of:

[0244] a) genetically engineering the host cell to reduce the expression (underexpression) of the first and second genes encoding AOX1 and AOX2, respectively;

[0245] b) genetically engineering the host cell to increase the expression (overexpression) of a gene encoding ADH2;

[0246] c) introducing a heterologous expression cassette into the host cell, the heterologous expression cassette comprising a gene of interest (GOI) encoding the POI under the control of an expression cassette promoter (ECP);

[0247] d) cultivating the host cell using methanol as a carbon source under conditions that the POI is produced, thereby in particular providing energy for growth and / or POI production;

[0248] e) optionally isolating the POI from the cell culture; and

[0249] f) optionally purifying the POI.

[0250] In particular, step a) of the method described herein is performed before, after or simultaneously with step b).

[0251] In particular, steps a) and b) of the method described herein are performed before, after or simultaneously with step c).

[0252] According to one specific aspect, the host cell is first genetically modified to reduce the expression of the first and second genes encoding AOX1 and AOX2, respectively, and to increase the expression of a gene encoding ADH2, and then engineered to produce a POI. According to one specific example, a wild-type host cell is genetically modified according to steps a) and b) of the method described herein. In particular, the host cell is provided after introducing the one or more genetic modifications into a wild-type host cell strain to reduce the first and second genes encoding AOX1 and AOX2, respectively, and to increase the expression of a gene encoding ADH2.

[0253] According to yet another aspect, the host cell is first engineered to produce a heterologous or recombinant POI, and then further genetically modified to reduce expression of the first and second genes encoding AOX1 and AOX2, respectively, and to increase expression of a gene encoding ADH2. According to a specific example, a wild-type host cell can first be engineered to comprise an expression cassette for POI production. Such an engineered host cell can then be further modified to reduce expression of the first and second genes encoding AOX1 and AOX2, respectively, and to increase expression of a gene encoding ADH2.

[0254] According to yet another aspect, the host cell is undergoing engineering steps, including engineering for POI production, and at the same time (i.e. in one method step) genetic modification to reduce expression of the first and second genes encoding AOX1 and AOX2, respectively, and to increase expression of a gene encoding ADH2, e.g. employing respective expression cassettes, reagents and tools in one or more reaction mixtures.

[0255] In particular, the method employs method steps for producing a recombinant Mut- host cell as further described herein.

[0256] In particular, the heterologous expression cassette comprises an ECP as further described herein.

[0257] In particular, the POI can be produced by culturing the Mut-host cell in a suitable medium, producing the POI using a cell culture production medium comprising methanol during the culturing step, and isolating the expressed POI from the cell culture, in particular from the cell culture supernatant or medium after separation of the cells, and optionally purifying it by methods suitable for the expressed product. Thus, a purified POI preparation can be produced.

[0258] Surprisingly, it was found that the Mut-host cell is not sensitive to methanol and can effectively take up and use significant amounts of methanol as required for energy provision for POI production. This is surprising because in the prior art, methanol was found to be toxic to Mut S strains.

[0259] According to a specific example of a cell culture as described herein, the growth of the Mut-host cell is advantageously limited during the production phase, which reduces the necessity for oxygen supply and cooling.

[0260] Even more surprisingly, the yield of POI production is increased by the hitherto underestimated alcohol dehydrogenase mechanism and ADH2 activity in the methanol- utilizing yeast, resulting in methanol uptake and effective methanol consumption despite the knock-out of the AOX1 and AOX2 genes in the methanol utilization pathway deficient methanol-utilizing yeast.

[0261] According to one specific embodiment, a methanol inducible ECP has been advantageously used in the GOI EC. The amount of methanol used as carbon source in the cell culture is sufficient to induce the expression of the GOI. BRIEF DESCRIPTION OF DRAWINGS

[0262] Figure 1 : Sequences referred to herein. DETAILED DESCRIPTION

[0263] Specific terms as used throughout the specification have the following meanings.

[0264] The term "carbon source" as used herein shall mean a fermentable carbon substrate suitable as an energy source for a microorganism, typically a carbohydrate source such as those capable of being metabolized by the host organism or production cell line, in particular a source selected from the group consisting of monosaccharides, oligosaccharides, polysaccharides, alcohols including glycerol, in purified form, in a minimal medium or provided in a raw material such as a complex nutrient material. The carbon source can be used as a single carbon source or as a mixture of different carbon sources as described herein.

[0265] Methanol is used as a carbon source as described herein, for example, as the only carbon source in the production phase, or in a mixture with non-methanol carbon sources. In particular, methanol is co-fed to the cell culture with any non-methanol carbon source.

[0266] A non-methanol carbon source is understood herein as any carbon source other than methanol, in particular a carbon source that does not contain methanol.

[0267] A "base carbon source" such as described herein is typically a carbon source suitable for cell growth, such as a nutrient for the host cell, in particular for a eukaryotic cell. The base carbon source can be provided in a medium such as a basal medium or a complex medium, but also in a chemically defined medium containing a purified carbon source. The base carbon source is provided in an amount that typically provides for cell growth, in particular during the growth phase of the cultivation process, for example to obtain a cell density of at least 5 g / L of cell dry mass, preferably at least 10 g / L of cell dry mass or at least 15 g / L of cell dry mass, for example exhibiting a viability of more than 90%, preferably more than 95% during standard subcultivation steps.

[0268] The base carbon source is typically used in excess or surplus, which is understood as an excess that provides for an increased biomass, for example during cultivation of the cell line at high specific growth rates, such as during the growth phase of the cell line in a batch or fed-batch cultivation process. This surplus in particular exceeds the limiting amount of the supplemental carbon source (as used under growth limiting conditions) to reach a residual concentration in the fermentation broth that is measurable and typically at least 10-fold, preferably at least 50-fold or at least 100-fold during the supplemental carbon source at the fed limiting amount.

[0269] A "supplemental carbon source" as described herein is generally a supplemental substrate that facilitates the production of a fermentation product by a production cell line, in particular during the production phase of a cultivation process. The production phase is in particular subsequent to the growth phase, e.g. in batch, fed-batch and continuous cultivation processes. The supplemental carbon source can in particular be comprised in the feed of a fed-batch process. The supplemental carbon source is typically employed in cell cultures under carbon substrate limiting conditions (i.e. using a limiting amount of carbon source).

[0270] In particular, in the methods described herein, methanol is used as supplemental carbon source.

[0271] A "limiting amount" of a carbon source or a "limited carbon source" is herein understood to specifically refer to the type and amount of carbon substrate that facilitates the production of a fermentation product by a production cell line, in particular in a cultivation process with a controlled growth rate that is less than the maximum growth rate. The production phase is in particular subsequent to the growth phase, e.g. in batch, fed-batch and continuous cultivation processes. The cell cultivation process can employ batch cultivation, continuous cultivation and fed-batch cultivation. Batch cultivation is a cultivation process in which a small amount of seed culture solution is added to the culture medium and the cells are grown without addition of further culture medium or discharge of the culture solution during the cultivation.

[0272] Continuous cultivation is a cultivation process in which culture medium is continuously added and discharged during the cultivation. Continuous cultivation also includes perfusion cultivation. Fed-batch cultivation is an intermediate way between batch and continuous cultivation and is also referred to as semi-batch cultivation and is a cultivation process in which culture medium is continuously or sequentially added during the cultivation, but unlike continuous cultivation, the culture solution is not continuously discharged.

[0273] Particularly preferred is a fed-batch process based on the feeding of a growth limiting nutrient substrate into the culture. Fed-batch strategies, including single fed-batch or repeated fed-batch fermentation, are commonly used in biotechnological processes to achieve high cell densities in bioreactors. The controlled addition of carbon substrate directly influences the growth rate of the culture and helps to avoid overflow metabolism or the formation of unwanted metabolic by-products. The carbon source can in particular be comprised in the feed of a fed-batch process under carbon source limiting conditions. Thus, the carbon substrate is provided in a limiting amount.

[0274] Also in a chemostat or continuous cultivation as described herein, the growth rate can be strictly controlled.

[0275] A limiting amount of carbon source is herein specifically understood as the amount of carbon source required to keep the production cell line under growth limiting conditions (e.g. in the production phase or production mode). Such a limiting amount can be used in a fed-batch process, wherein the carbon source is comprised in the feed medium and supplied to the culture at a low feed rate for continuous energy delivery, e.g. to produce a POI, while keeping the biomass at a low specific growth rate. The feed medium is typically added to the fermentation broth during the production phase of the cell culture.

[0276] The limiting amount of carbon source can for example be determined from the residual amount of carbon source in the cell culture broth, which is below a predetermined threshold or even below the detection limit as measured in a standard (carbohydrate) assay. The residual amount will typically be determined in the fermentation broth after harvesting the fermentation product.

[0277] The limiting amount of carbon source can also be determined by defining an average feed rate of carbon source into the fermenter, e.g. as determined by the amount added per cultivation time over the whole cultivation process (e.g. fed-batch phase) to determine a calculated average amount / time. This average feed rate is kept low to ensure that the cell culture fully uses the supplemented carbon source, e.g. between 0.6 g L -1 h -1 (g carbon source / L initial fermentation volume and h time) and 25 g L -1 h -1 , preferably between 1.6 g L -1 h -1 and 20 g L -1 h -1 .

[0278] The limiting amount of carbon source can also be determined by measuring the specific growth rate (which is kept low, e.g. below the maximum specific growth rate) during the production phase (e.g. within a predetermined range), such as in the range between 0.001 h -1 and 0.20 h -1 , or between 0.005 h -1 and 0.20 h -1 , preferably between 0.01 h -1 and 0.15 h -1 .

[0279] In particular, a feed medium is used which is chemically defined and comprises methanol.

[0280] The term "chemically defined" in relation to a cell culture medium, such as a basal medium or a feed medium in a fed-batch process, shall mean a medium suitable for in vitro cell culture of a production cell line, wherein all chemical components and (poly)peptides are known. Typically, a chemically defined medium is completely free of animal-derived components and represents a pure and consistent cell culture environment.

[0281] The term "cell" or "host cell" as used herein shall mean a single cell, a single cell clone or a cell line of a host cell. The term "host cell" shall particularly apply to a methanol- auxotrophic yeast cell which is suitable for recombinant purposes to produce a POI or a host cell metabolite. It is well understood that the term "host cell" does not include humans. In particular, the host cells as described herein are artificial organisms and derivatives of natural (wild-type) host cells. It is well understood that the host cells, methods and uses described herein, for example, those specifically referring to one or more genetic modifications, the heterologous expression cassette or construct, the transfected or transformed host cell and the recombinant protein, are non-naturally occurring, "artificial" or synthetic and thus not considered as a result of the "laws of nature".

[0282] The term "cell line" as used herein refers to an established clone of a particular cell type which has acquired the ability to proliferate over an extended period of time. Cell lines are typically used to express endogenous or recombinant genes, or products of metabolic pathways to produce polypeptides or cell metabolites mediated by such polypeptides.

[0283] Host cells producing a POI as described herein are also referred to as "production host cells" and the corresponding cell lines are referred to as "production cell lines". A "production cell line" is generally understood to be a cell line which is prepared for cell cultivation in a bioreactor to obtain a product of a production process such as a POI.

[0284] The specific embodiments described herein relate to Mut-production host cells which can efficiently use ADH2 to enzymatically process methanol to provide energy to the cell.

[0285] The specific embodiments described herein relate to production cell lines which are engineered to underexpress endogenous genes encoding AOX1 and AOX2 proteins and to overexpress a gene encoding ADH2 and which are characterized by a high POI production yield using methanol as carbon source under the control of an ECP described herein.

[0286] The term "cell culture" or "culturing" or "cultivation" as used herein in relation to a host cell means that the cell is maintained in an artificial (e.g., in vitro) environment under conditions which are favorable for the growth, differentiation or sustained viability (in an active or resting state) of the cell according to methods known in the industry, in particular in a controlled bioreactor.

[0287] When culturing cell cultures using appropriate media, the cells are contacted with the medium in the culture vessel or with the substrate under conditions suitable to support the culturing of the cells in the cell culture. As described herein, media can be provided that can be used for the growth of host cells (e.g., methanol auxotrophic yeast). Standard cell culture techniques are well known in the art.

[0288] Cell cultures as described herein in particular employ techniques that provide for the production of a secreted POI, such as to obtain the POI in the cell culture medium, which can be separated from the cell biomass herein referred to as “cell culture supernatant” and can be purified to obtain a higher purity of the POI. When host cells in a cell culture produce and secrete a protein, such as for example a POI, it is herein understood that such protein is secreted into the cell culture supernatant and can be obtained by separating the cell culture supernatant from the host cell biomass and, optionally, further purifying the protein to produce a purified protein preparation.

[0289] Cell culture media provide the nutrients required to maintain and grow cells in a controlled, artificial, and in vitro environment. The characteristics and composition of cell culture media vary depending on the specific cell requirements. Important parameters include osmolarity, pH, and nutritional formulation. Feeding of nutrients can be performed in continuous or discontinuous mode according to methods known in the art.

[0290] While in a batch process, all nutrients required to culture the cells are contained in the initial medium, and no additional nutrients are supplied to the culture during the fermentation, in a fed-batch process, a feeding phase is performed after the batch phase, wherein one or more nutrients are supplied to the culture by feeding. Although the feeding mode is critical and important in most processes, the host cells and methods described herein are not limited to a certain cell culture mode.

[0291] Recombinant POIs can be produced using the host cells and corresponding cell lines described herein by culturing in an appropriate medium, isolating the expressed product or metabolite from the culture, and, optionally, purifying it by suitable methods.

[0292] Several different methods for producing POIs as described herein are preferred. POIs can be expressed, processed, and, optionally, secreted by transfecting or transforming a host cell with an expression vector containing recombinant DNA encoding the relevant protein, preparing a culture of the transfected or transformed cells, growing the culture, inducing transcription and POI production, and recovering the POI.

[0293] In certain embodiments, the cell culture process is a fed-batch process. Specifically, host cells transformed with a nucleic acid construct encoding a desired recombinant POI are cultured in a growth phase and transitioned to a production phase in order to produce the desired recombinant POI.

[0294] In another embodiment, the host cells described herein are cultured in a continuous mode, for example using a chemostat. Continuous fermentation processes are characterized by the feeding of fresh medium into the bioreactor at a defined, constant and continuous rate, whereby the culture broth is simultaneously removed from the bioreactor at the same defined, constant and continuous removal rate. By keeping the medium, the feed rate and the removal rate at the same constant level, the cell culture parameters and conditions in the bioreactor are kept constant.

[0295] A stable cell culture as described herein is specifically understood to mean a cell culture which maintains the genetic properties, in particular maintains a high (e.g. at the pg level) POI production level, even after about 20, preferably at least 30, more preferably at least 40, most preferably at least 50 generations of cultivation. Specifically, a stable recombinant host cell line is provided which is considered a great advantage when used for industrial scale production.

[0296] The cell culture described herein is particularly advantageous for methods of industrial manufacturing scale, for example in terms of the combination of volume and technical system with the mode of cultivation based on the feeding of nutrients, in particular fed-batch or batch processes or continuous or semi-continuous processes (e.g. chemostat).

[0297] The host cells described herein are typically tested for their ability to express a GOI for POI production, and the POI yield is tested by any of the following tests: ELISA, activity assay, HPLC, or other suitable tests such as SDS-PAGE and Western blot techniques or mass spectrometry.

[0298] In order to determine the effect of the one or more genetic modifications on the underexpression or reduced expression of the genes encoding the AOX1 and / or AOX2 proteins in the respective cell culture and, for example, on the POI production compared to a strain without such one or more genetic modifications in the respective cell, the host cell line can be cultivated in a microtiter plate, shake flask or bioreactor using fed-batch or chemostat fermentation.

[0299] The production methods described herein specifically allow for fermentation at pilot or industrial scale. The industrial process scale will preferably employ a volume of at least 10 L, in particular at least 50 L, preferably at least 1 m 3 , preferably at least 10 m 3 , most preferably at least 100 m 3 .

[0300] Production conditions on an industrial scale are preferred, which means, for example, a reactor volume of 100 L to 10 m 3 or more, fed-batch cultivation with a typical process time of several days, or a fermentation tank volume of about 50-1000 L or more, with a dilution rate of about 0.02-0.15 h -1 for a continuous process.

[0301] The apparatuses, facilities, and methods for the purposes described herein are particularly suitable for use in and with the cultivation of any desired cell line, including prokaryotic and / or eukaryotic cell lines. Furthermore, in embodiments, the apparatuses, facilities, and methods are suitable for the cultivation of any cell type, including suspension cells or adherent-dependent (adherent) cells, and for production operations configured for the production of pharmaceutical and biopharmaceutical products, such as polypeptide products (POIs), nucleic acid products (e.g., DNA or RNA), or cells and / or viruses, such as those for cell and / or viral therapy.

[0302] In certain embodiments, the cells express or produce a product, such as a recombinant therapeutic or diagnostic product. As described in greater detail herein, examples of products produced by the cells include, but are not limited to, POIs, such as the POIs exemplified herein, including antibody molecules (e.g., monoclonal antibodies, bispecific antibodies), antibody mimetics (polypeptide molecules that specifically bind to an antigen but are not structurally related to antibodies, such as, for example, DARPins, affibodies, adnectins, or IgNARs), fusion proteins (e.g., Fc fusion proteins, chimeric cytokines), other recombinant proteins (e.g., glycosylated proteins, enzymes, hormones), or viral therapies (e.g., anti-cancer oncolytic viruses, viral vectors for gene therapy, and viral immunotherapies), cell therapy drugs (e.g., pluripotent stem cells, mesenchymal stem cells, and adult stem cells), vaccines, or lipid-encapsulated particles (e.g., exosomes, virus-like particles), RNA (such as, for example, siRNA) or DNA (such as, for example, plasmid DNA), antibiotics, or amino acids. In embodiments, the apparatuses, facilities, and methods can be used for the production of biosimilars.

[0303] As noted, in certain embodiments, the apparatuses, facilities, and methods allow for the production of eukaryotic cells, such as, for example, yeast cells, for example, POIs synthesized in a large-scale manner by the cells, including proteins, peptides, or antibiotics, amino acids, nucleic acids (such as DNA or RNA). Unless otherwise specified herein, the apparatuses, facilities, and methods can include any desired volume or production capacity, including, but not limited to, laboratory scale, pilot scale, and full production scale capacity.

[0304] Further and unless otherwise indicated herein, the devices, facilities, and methods can include any one or more suitable reactors, including but not limited to stirred tank, airlift, fiber, microfiber, hollow fiber, ceramic matrix, fluidized bed, fixed bed, and / or spouted bed bioreactors. As used herein, “reactor” can include a fermenter or fermentation unit or any other reaction vessel, and the term “reactor” can be used interchangeably with “fermenter.” For example, in some aspects, an exemplary bioreactor unit can perform one or more or all of the following: feeding of nutrients and / or carbon sources, injection of suitable gases (e.g., oxygen), inlet and outlet flow of fermentation or cell culture media, separation of gas and liquid phases, maintenance of temperature, maintenance of oxygen and CO2 levels, maintenance of pH levels, agitation (e.g., stirring), and / or cleaning / sterilization. An exemplary reactor unit, such as a fermentation unit, can contain multiple reactors within the unit, for example, a unit can have 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, or 100 or more bioreactors in each unit and / or a facility can contain multiple units with single or multiple reactors in the facility. In various embodiments, the bioreactor can be suitable for batch, semi-fed batch, fed batch, perfusion, and / or continuous fermentation processes. Any suitable reactor diameter can be used. In embodiments, the bioreactor can have a volume of between about 100 mL and about 50,000 L. Non-limiting examples include a volume of 100 mL, 250 mL, 500 mL, 750 mL, 1 liter, 2 liters, 3 liters, 4 liters, 5 liters, 6 liters, 7 liters, 8 liters, 9 liters, 10 liters, 15 liters, 20 liters, 25 liters, 30 liters, 40 liters, 50 liters, 60 liters, 70 liters, 80 liters, 90 liters, 100 liters, 150 liters, 200 liters, 250 liters, 300 liters, 350 liters, 400 liters, 450 liters, 500 liters, 550 liters, 600 liters, 650 liters, 700 liters, 750 liters, 800 liters, 850 liters, 900 liters, 950 liters, 1000 liters, 1500 liters, 2000 liters, 2500 liters, 3000 liters, 3500 liters, 4000 liters, 4500 liters, 5000 liters, 6000 liters, 7000 liters, 8000 liters, 9000 liters, 10,000 liters, 15,000 liters, 20,000 liters, and / or 50,000 liters. Additionally, the suitable reactor can be multi-use, single-use, disposable, or non-disposable, and can be formed of any suitable material, including metal alloys such as stainless steel (e.g., 316L or any other suitable stainless steel) and Inconel, plastics, and / or glass.

[0305] In embodiments and unless otherwise indicated herein, the apparatuses, facilities, and methods described herein can also include any suitable unit operations and / or equipment not otherwise mentioned, such as operations and / or equipment for isolating, purifying, and isolating such products. Any suitable facility and environment can be used, such as a traditional stick-built facility, a modular, mobile, and temporary facility, or any other suitable construction, facility, and / or layout. For example, in some embodiments, a modular clean room can be used. Further and unless otherwise indicated, the apparatuses, systems, and methods described herein can be housed and / or performed at a single location or facility, or alternatively housed and / or performed at separate or multiple locations and / or facilities.

[0306] Suitable techniques can include cultivation in a bioreactor starting with a batch phase, followed by a short exponential fed-batch phase at a high specific growth rate, and then a fed-batch phase at a low specific growth rate. Another suitable cultivation technique can include a batch phase, followed by a fed-batch phase at any suitable specific growth rate or combination of specific growth rates, such as from high to low growth rate over the POI production time or from low to high growth rate over the POI production time. Another suitable cultivation technique can include a batch phase, followed by a continuous cultivation phase at a low dilution rate.

[0307] Preferred embodiments include a batch cultivation to provide biomass, followed by a fed-batch cultivation for high yield POI production.

[0308] It is preferred to cultivate host cells as described herein in a bioreactor under growth conditions to obtain a cell density of at least 1 g / L of cell dry weight, more preferably at least 10 g / L of cell dry weight, preferably at least 20 g / L of cell dry weight, preferably at least any of 30, 40, 50, 60, 70, or 80 g / L of cell dry weight. It is advantageous to provide such biomass production yields at pilot or industrial scale.

[0309] Growth media, in particular minimal growth media, that allow biomass accumulation typically comprise a carbon source, a nitrogen source, a sulfur source, and a phosphate source. Typically, such media additionally comprise trace elements and vitamins, and can further comprise amino acids, peptone, or yeast extract.

[0310] Preferred nitrogen sources include NH4H2PO4or NH3or (NH4)2SO4;

[0311] Preferred sulfur sources include MgSO4or (NH4)2SO4or K2SO4;

[0312] Preferred phosphate sources include NH4H2PO4, or H3PO4, or NaH2PO4, KH2PO4, Na2HPO4 or K2HPO4;

[0313] Other typical medium components include KCI, CaCI2, and trace elements such as: Fe, Co, Cu, Ni, Zn, Mo, Mn, I, B;

[0314] Preferably, the medium is supplemented with vitamin B7;

[0315] A typical growth medium for P. pastoris comprises glycerol, sorbitol or glucose, NH4H2PO4, MgSO4, KCI, CaCI2, biotin and trace elements.

[0316] In the production phase, specifically a production medium with only a limited amount of supplemental carbon source is used.

[0317] Preferably, the host cell line is cultivated in a mineral medium with a suitable carbon source, thereby further significantly simplifying the isolation process. An example of a preferred mineral medium is a mineral medium containing utilizable carbon sources (in particular methanol as described herein, optionally in combination with e.g. glucose, glycerol or sorbitol), salts containing macro elements (potassium, magnesium, calcium, ammonium, chloride, sulfate, phosphate) and trace elements (copper, iodide, manganese, molybdate, cobalt, zinc and iron salts and boric acid), and optionally vitamins or amino acids (e.g. to complement nutritional deficiencies).

[0318] Specifically, the cells are cultivated under conditions suitable for expression of the desired POI, which can be purified from the cells or the culture medium, depending on the expression system and the nature of the expressed protein, e.g. whether the protein is fused to a signal peptide and whether the protein is soluble or membrane-bound. As will be appreciated by the skilled person, the cultivation conditions will vary depending on factors including the type of host cell and the particular expression vector employed.

[0319] A typical production medium comprises a supplemental carbon source, in addition to NH4H2PO4, MgSO4, KCI, CaCI2, biotin and trace elements.

[0320] For example, the feed of supplemental carbon source added to the fermentation can comprise a carbon source with up to 50 wt% utilizable sugar.

[0321] The fermentation is preferably carried out at a pH in the range from 3 to 8.

[0322] A typical fermentation time is about 24 to 120 hours, with a temperature range of 20°C to 35°C, preferably 22°C-30°C.

[0323] It is preferred to express the POI under conditions that yield titers of at least 1 mg / L, preferably at least 10 mg / L, preferably at least 100 mg / L, most preferably at least 1 g / L.

[0324] The term "expression" or "expression cassette" as used herein refers to a nucleic acid molecule containing a desired coding sequence and control sequences operably linked, such that a host transformed or transfected with these sequences is able to produce the encoded protein or host cell metabolite. To effect the transformation, the expression system can be included in a vector; however, the relevant DNA can also be integrated into the host cell chromosome. Expression can refer to secreted or non-secreted expression products, including polypeptides or metabolites.

[0325] The expression cassette is conveniently provided as an expression construct, e.g., in the form of a "vector" or "plasmid," which is generally a DNA sequence required for the transcription of a cloned recombinant nucleotide sequence (i.e., a recombinant gene) and the translation of its mRNA in a suitable host organism. Expression vectors or plasmids typically comprise an origin of autonomous replication or a locus for genomic integration in a host cell, a selection marker (e.g., an amino acid synthesis gene or a gene conferring resistance to an antibiotic such as bleomycin, kanamycin, G418, or hygromycin, nourseothricin), a number of restriction enzyme sites, a suitable promoter sequence, and a transcription terminator, which components are operably linked together. The terms "plasmid" and "vector" as used herein include autonomously replicating nucleotide sequences as well as genome-integrated nucleotide sequences, such as artificial chromosomes, e.g., yeast artificial chromosomes (YACs).

[0326] Expression vectors can include, but are not limited to, cloning vectors, modified cloning vectors, and specially designed plasmids. Preferred expression vectors described herein are expression vectors suitable for expression of a recombinant gene in a eukaryotic host cell and are selected according to the host organism. Suitable expression vectors typically comprise regulatory sequences suitable for expression of the DNA encoding the POI in a eukaryotic host cell. Examples of regulatory sequences include promoters, operators, enhancers, ribosome binding sites, and sequences controlling transcriptional and translational initiation and termination. Regulatory sequences are typically operably linked to the DNA sequence to be expressed.

[0327] Particular expression constructs described herein comprise a promoter operably linked to a nucleotide sequence encoding a POI under transcriptional control of the promoter. In particular, the promoter is not naturally associated with the coding sequence of the POI.

[0328] To allow expression of a recombinant nucleotide sequence in a host cell, the expression cassette or vector described herein as a GOIEC comprises an ECP, typically a promoter nucleotide sequence, adjacent to the 5' end of the coding sequence, e.g., upstream of and adjacent to the gene of interest (GOI) or, if a signal or leader sequence is used, upstream of and adjacent to the signal and leader sequence, respectively, to facilitate expression and secretion of the POI. The promoter sequence generally regulates and initiates transcription of the downstream nucleotide sequence operably linked thereto, including particularly the GOI.

[0329] Particular expression constructs described herein comprise a polynucleotide encoding a POI linked to a leader sequence that causes secretion of the POI from a host cell. The presence of such a secretion leader sequence in an expression vector is generally required when the POI intended for recombinant expression and secretion is a non-naturally secreted protein and thus lacks a native secretion leader sequence or its nucleotide sequence has been cloned without its native secretion leader sequence. In general, any secretion leader sequence that is effective to cause secretion of the POI from a host cell can be used. The secretion leader sequence can be derived from a yeast source, e.g., derived from a yeast alpha-factor (such as M Fa of S. cerevisiae) or a yeast phosphatase; from a mammalian or plant source; or other.

[0330] In particular embodiments, a multicloning vector can be used, which is a vector having a multiple cloning site. Specifically, the desired heterologous gene can be integrated or incorporated at the multiple cloning site to make an expression vector. In the case of a multicloning vector, a promoter is generally placed upstream of the multiple cloning site.

[0331] The term "gene expression" or "expressing a polynucleotide" as used herein is intended to include at least one step selected from the group consisting of DNA transcription into mRNA, mRNA processing, mRNA maturation, mRNA export, translation, protein folding, and / or protein transport.

[0332] The term "increased expression" also referred to herein as "overexpression" means any amount of expression above that exhibited by a reference standard, which can be a host cell prior to a genetic alteration to increase expression of a certain polynucleotide, or the level of expression is otherwise expressed in a host cell of the same type or species that has not been engineered to increase expression of the polynucleotide.

[0333] It is possible to introduce a gene product into a host cell for expression if the host cell does not comprise the given gene product; in this case, any detectable expression is encompassed by the term "overexpression."

[0334] Overexpression of a gene encoding a protein (e.g., ADH2) is also referred to as overexpression of the protein (e.g., ADH2). Overexpression can be achieved in any manner known to those of skill in the art. Typically, it can be achieved by increasing transcription / translation of the gene, for example, by increasing the copy number of the gene or altering or modifying regulatory sequences or sites associated with expression of the gene. For example, the gene can be operably linked to a strong promoter in order to achieve high expression levels. Such promoters can be endogenous or heterologous, particularly recombinant promoters. One can replace the promoter with a heterologous promoter that increases expression of the gene. The use of inducible promoters additionally makes it possible to increase expression during cultivation. Furthermore, overexpression can also be achieved by, for example, modifying the chromosomal location of a particular gene, altering nucleic acid sequences adjacent to a particular gene, such as ribosome binding sites or transcription terminators, introducing frameshifts in the open reading frame, modifying proteins involved in transcription of the gene and / or translation of the gene product (e.g., regulatory proteins, repressors, enhancers, transcriptional activators, etc.), or any other conventional means of deregulating expression of a particular gene as is customary in the art, including but not limited to the use of antisense nucleic acid molecules, for example, to block expression of repressor proteins or to delete or mutate transcription factors that normally repress expression of a gene whose overexpression is desired. Prolonging the lifetime of the mRNA can also increase expression levels. For example, certain terminator regions can be used to prolong the half-life of the mRNA. If multiple copies of the gene are included, the gene can be located in a plasmid of variable copy number or integrated in the chromosome and amplified. It is possible to introduce one or more genes or genomic sequences into a host cell for expression.

[0335] According to one specific embodiment, the polynucleotide encoding the ADH2 protein can be present in a single copy or multiple copies per cell. The copies can be adjacent to or remote from each other. According to another specific embodiment, overexpression of the ADH2 protein employs a recombinant nucleotide sequence encoding the ADH2 protein provided in a single copy or multiple copies per cell on one or more plasmids suitable for integration into the genome of the host cell (i.e., knock-in). The copies can be adjacent to or remote from each other. Overexpression can be achieved by expressing multiple copies of the polynucleotide, such as 2, 3, 4, 5, 6, or more copies of the polynucleotide per host cell.

[0336] The recombinant nucleotide sequence comprising the GOI and the polynucleotide (gene) encoding the ADH2 protein can be provided on one or more autonomously replicating plasmids and introduced in a single copy or multiple copies per cell.

[0337] Alternatively, the recombinant nucleotide sequence comprising the GOI and the polynucleotide (gene) encoding the ADH2 protein can be present on the same plasmid and introduced in a single copy or multiple copies per cell.

[0338] The heterologous polynucleotide (gene) encoding the ADH2 protein or the heterologous recombinant expression construct comprising the polynucleotide (gene) encoding the ADH2 protein is preferably integrated into the genome of the host cell.

[0339] The term "genome" generally refers to the complete genetic information of an organism encoded in DNA (or RNA). It can be present in a chromosome, on a plasmid or vector, or both. Preferably, the polynucleotide (gene) encoding the ADH2 protein is integrated into the chromosome of the cell.

[0340] The polynucleotide (gene) encoding the ADH2 protein can be integrated into its natural locus. By "natural locus" is meant the location on a particular chromosome where the polynucleotide (gene) encoding the ADH2 protein is located in a naturally occurring wild-type cell. However, in another embodiment, the polynucleotide (gene) encoding the ADH2 protein is present in the genome of the host cell not at its natural locus, but is integrated ectopically. The term "ectopic integration" means the insertion of a nucleic acid into a site in the genome of a microorganism other than its usual chromosomal locus, i.e., predetermined or random integration. In another embodiment, the polynucleotide (gene) encoding the ADH2 protein is integrated into the natural locus and is ectopic. Heterologous recombination can be used to achieve random or non-targeted integration. Heterologous recombination refers to recombination between DNA molecules that are significantly different in sequence.

[0341] For yeast cells, the polynucleotide (gene) encoding the ADH2 protein and / or the GOI can be inserted into a desired locus, such as AOX1, GAP, ENOl, TEF, HIS4 (Zamir et al., Proc. NatL Acad. Sci. USA (1981) 78(6):3496-3500), HO (Voth et al. Nucleic Acids Res. 2001 Jun 15;29(12):e59), TYR1 (Mirisola et al., Yeast 2007;24:761-766), His3, Leu2, Ura3 (Taxis et al., BioTechniques (2006) 40:73-78), Lys2, ADE2, TRP1, GAL1, ADH1, or on integration of the 5S ribosomal RNA gene.

[0342] In other embodiments, the polynucleotide (gene) encoding the ADH2 protein and / or the GOI can be integrated into a plasmid or vector. Preferably, the plasmid is a eukaryotic expression vector, preferably a yeast expression vector. Suitable plasmids or vectors are further described herein.

[0343] Overexpression of an endogenous or heterologous polynucleotide in a recombinant host cell can be achieved by modifying the expression control sequences. Expression control sequences are known in the art and include, for example, promoters, enhancers, polyadenylation signals, transcription terminators, internal ribosome entry sites (IRES), and the like, which provide for expression of a polynucleotide sequence in a host cell. Expression control sequences specifically interact with cell proteins involved in transcription. Exemplary expression control sequences are described in, for example, Goeddel, Gene Expression Technology: Methods in Enzymology, Vol. 185, Academic Press, San Diego, CA (1990).

[0344] In preferred embodiments, overexpression is achieved by use of an enhancer expression polynucleotide. Transcription enhancers are independent of relative orientation and position, have been found 5' and 3' to the transcriptional unit, within introns, and within the coding sequence itself. Enhancers can be spliced into expression vectors at locations 5' or 3' to the coding sequence, but are preferably located at a site 5' to the promoter. Most yeast genes contain only one UAS, which is usually located within a few hundred base pairs of the cap site, and most yeast enhancers (UAS) do not function when placed 3' to the promoter, but enhancers of higher eukaryotes can function both 5' and 3' to the promoter.

[0345] Many enhancer sequences are known from mammalian genes (globin, RSV, SV40, EMC, elastase, albumin, alpha fetoprotein, and insulin). One can also use enhancers derived from viruses such as the SV40 late side, cytomegalovirus early promoter enhancer, the polyoma enhancer on the replication origin, and adenovirus enhancers.

[0346] In particular, the GOI and / or ADH2-encoding polynucleotide (gene) as described herein is operably linked to transcriptional and translational regulatory sequences that provide for expression in a host cell. The term "translational regulatory sequence" as used herein refers to a nucleotide sequence that is associated with a gene nucleic acid sequence and that regulates translation of the gene. The transcriptional and / or translational regulatory sequences can be located in a plasmid or vector or integrated into the chromosome of the host cell. The transcriptional and / or translational regulatory sequences are located in the same nucleic acid molecule as the gene that they regulate.

[0347] In particular, overexpression of the ADH2 protein can be achieved by methods known in the art, for example by genetically modifying their endogenous regulatory regions, as described in Marx et al., 2008 (Marx, H., Mattanovich, D., and Sauer, M. Microb Cell Fact 7 (2008): 23), such methods include, for example, integration of a recombinant promoter that increases gene expression.

[0348] For example, overexpression of an endogenous or heterologous polynucleotide in a recombinant host cell can be achieved by modifying the promoter controlling such expression, for example, by replacing the promoter operably linked to the polynucleotide (e.g., an endogenous promoter or a promoter naturally linked to the polynucleotide in a wild-type organism) with another, stronger promoter in order to achieve high expression levels. Such promoters can be inducible or constitutive. Modification of promoters can also be performed by mutagenesis methods known in the art.

[0349] In a preferred embodiment, expression of both the polynucleotide encoding the ADH2 protein and the polynucleotide encoding the POI is driven by an inducible promoter. In another preferred embodiment, expression of both the polynucleotide encoding the ADH2 protein and the polynucleotide encoding the POI is driven by a constitutive promoter. In yet another preferred embodiment, expression of the polynucleotide encoding the ADH2 protein is driven by a constitutive promoter and expression of the polynucleotide encoding the POI is driven by an inducible promoter. In yet another preferred embodiment, expression of the polynucleotide encoding the ADH2 protein is driven by an inducible promoter and expression of the polynucleotide encoding the POI is driven by a constitutive promoter.

[0350] In particular, methanol inducible promoters can be used in expression constructs for overexpressing the gene encoding ADH2 and / or expressing the GOI, as further described herein.

[0351] For example, expression of the polynucleotide encoding the ADH2 protein can be driven by a constitutive GAP promoter and expression of the polynucleotide encoding the POI can be driven by a methanol inducible AOX1 or AOX2 promoter.

[0352] In one embodiment, expression of the polynucleotide encoding the ADH2 protein and the POI is driven by the same promoter or the same type of promoter in terms of promoter activity (e.g., promoter strength) and / or expression behavior (e.g., inducible or constitutive).

[0353] The term "reduced expression", also referred to herein as "under-expression", means any amount or level (e.g., activity or concentration) that is less than the amount or level (e.g., activity or concentration) exhibited by a reference standard, which can be a host cell prior to a genetic alteration to reduce expression of a certain polynucleotide, or which is otherwise expressed in a host cell of the same type or species that has not been engineered to reduce expression of the polynucleotide. The reduction in expression as described herein specifically refers to a polynucleotide or gene encoding a defined AOX1 protein or AOX2 protein, in particular a gene that is endogenous to the host cell prior to engineering. In particular, the respective gene product is a defined AOX1 protein or AOX2 protein as described herein. After engineering of the host cell by a genetic modification to reduce expression of the gene, the expression level of the gene product or polypeptide is less than the expression of the same gene product or polypeptide in the host cell prior to the genetic modification or in a comparable host that has not been genetically modified. "Less than" includes, for example, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more. The term "reduction in expression" or "under-expression" also includes no expression of the gene product or polypeptide.

[0354] According to specific embodiments described herein, the host cell is engineered to knock down or knock out (for inactivation or deletion of a gene or a portion thereof) an endogenous host cell gene encoding an AOX1 protein or AOX2 protein (as defined herein, including, for example, a homolog or ortholog of a sequence naturally occurring in wild-type P. pastoris) or other (coding or non-coding) nucleotide sequence conferring to the host cell the ability to express or produce said AOX1 protein or AOX2 protein.

[0355] In particular, a deletion strain is provided, wherein a nucleotide sequence is disrupted.

[0356] The term "disruption" as used herein refers to a significant reduction to complete removal of the expression or activity of one or more endogenous proteins in a host cell, such as by knockdown or knock out. This can be measured as the presence of the one or more endogenous proteins in a cell culture or culture medium of the host cell, such as by mass spectrometry, wherein the total content of the endogenous protein can be below a threshold or not detectable. Alternatively, it can be measured as the enzymatic activity of the endogenous protein.

[0357] The term "disruption" specifically refers to the result of genetic engineering by at least one step selected from the group consisting of gene silencing, gene knockdown, gene knockout, delivery of a dominant negative construct, conditional gene knockout, and / or by a genetic alteration to a specific gene.

[0358] The terms "knockdown," "reduction," or "deletion" in the context of gene expression as used herein refers to an experimental method that results in a reduction of expression of a given gene compared to expression in a control cell. Knockdown of a gene can be achieved by various experimental means such as introducing into a cell a nucleic acid molecule that hybridizes to a portion of the mRNA of the gene resulting in its degradation (e.g., shRNA, RNAi, miRNA), or altering the sequence of the gene in a manner that results in reduced transcription, reduced mRNA stability, reduced translation of the mRNA, or reduced activity of the encoded protein.

[0359] A complete inhibition of the expression of a given gene is referred to as "knockout." Knockout of a gene means that no functional transcript is produced from the gene, resulting in a loss of the function normally provided by this gene. Knockout of a gene is achieved by altering the DNA sequence resulting in a disruption or deletion of the gene or its regulatory sequences or a portion of such gene or regulatory sequence. Knockout techniques include the use of homologous recombination techniques to replace, interrupt or delete critical portions or the entire gene sequence, or the use of DNA modifying enzymes such as zinc fingers or meganucleases to introduce double-strand breaks into the DNA of the target gene, for example, as described by Gaj et al. (Trends Biotechnol. 2013; 31(7):397-405).

[0360] Particular embodiments employ one or more knockout plasmids or cassettes that are transformed or transfected into a host cell. By homologous recombination, the target gene in the host cell can be disrupted. This procedure is typically repeated until all alleles of the target gene are stably removed.

[0361] One particular method for knocking out a particular gene as described herein is the CRISPR-Cas9 method, as described in, for example, Weninger et al. (J. Biotechnol. 2016, 235: 139-49). Another method includes the split marker method as described by, for example, Heiss et al. 2013 (Appl Microbiol Biotechnol. 97(3): 1241-9.).

[0362] Another embodiment relates to target mRNA degradation by transfecting a host cell with a small interfering RNA (siRNA) and targeting the mRNA encoding a target protein that is endogenously expressed by the host cell.

[0363] Inhibition or reduction of the expression of a gene can be achieved by methods that directly interfere with the expression of the gene, including but not limited to inhibition or reduction of DNA transcription, for example by using specific promoter-associated repressors, by site-specific mutagenesis of a given promoter, by promoter exchange; or inhibition or reduction of translation, for example by RNAi or non-coding RNA-induced post-transcriptional gene silencing. Expression of a dysfunctional or inactive gene product with reduced activity can be achieved, for example, by site-specific mutagenesis or random mutagenesis, insertion or deletion within the coding gene.

[0364] Inhibition or reduction of the activity of a gene product can be achieved, for example, by administering an inhibitor of the respective enzyme prior to or simultaneously with the expression of the protein or incubating it therewith. Examples of such inhibitors include, but are not limited to, inhibitory peptides, antibodies, aptamers, fusion proteins or antibody mimetics, or inhibitory peptides or nucleic acids against the enzyme or its ligands or receptors, or small molecules with similar binding activity.

[0365] Gene silencing, gene knockdown and gene knockout refer to techniques to reduce gene expression by genetic modification or by treatment with oligonucleotides having a sequence complementary to the mRNA transcript or the gene. If a genetic modification of the DNA is made, the result is a knockdown or knockout of the organism. If the change in gene expression is caused by oligonucleotides that bind to the mRNA or transiently to the gene, this leads to a transient change in gene expression without modification of the chromosomal DNA and is referred to as transient knockdown.

[0366] In transient knockdown, which is also included by the above terms, binding of this oligonucleotide to the active gene or its transcript causes a reduction in expression by blocking of transcription (in the case of gene binding), degradation of the mRNA transcript (for example, by small interfering RNA (siRNA) or antisense RNA) or blocking of mRNA translation.

[0367] Other methods of performing gene silencing, knockdown or knockout are known to the skilled person from the respective literature and their use in the context of the present application is considered routine. Gene knockout refers to a technique to completely block gene expression, i.e. the respective gene does not work or is even removed. Methodological approaches to achieve this goal are manifold and known to the skilled person. An example is the generation of a mutant of a given gene that is dominant negative. Such mutants can be generated by site-directed mutagenesis (e.g. deletion, partial deletion, insertion or nucleic acid substitution), by using suitable transposons, or by other methods known to the skilled person from the respective literature, the use of which is therefore considered routine in the context of the present application. One example is knockout by using targeted zinc finger nucleases. A corresponding kit is provided by Sigma Aldrich under "Compo ZR Knockout ZFN". Another method includes the use of transcription activator-like effector nucleases (TALEN).

[0368] Delivery of dominant negative constructs involves the introduction of a sequence encoding a dysfunctional gene expression product, for example by transfection. The encoding sequence is functionally coupled to a strong promoter in such a way that the gene expression of the dysfunctional enzyme overrules the natural expression of the gene expression product, which in turn leads to an effective physiological deficiency of the respective activity of the gene expression product.

[0369] Conditional gene knock-out allows for blocking gene expression in a tissue- or time-specific manner. This is for example done by introducing short sequences called loxP sites around the gene of interest. Likewise, other methods are known to the skilled person from the respective literature and their application in the context of the present application is considered routine.

[0370] One other method is gene alteration, which can result in a dysfunctional gene product or in a gene product with reduced activity. This method involves the introduction of a frameshift mutation, a nonsense mutation (i.e. the introduction of a premature stop codon) or a mutation leading to an amino acid substitution which either makes the entire gene product dysfunctional or causes reduced activity. Such gene alterations can for example be generated by mutagenesis (e.g. deletion, partial deletion, insertion or nucleic acid substitution), either non-specific (random) mutagenesis or site-directed mutagenesis. Protocols describing the practical application of gene silencing, gene knock-down, gene knock-out, delivery of dominant negative constructs, conditional gene knock-out, and / or gene alteration are generally available to the person skilled in the art and are within his routine repertoire. Thus, the technical teachings provided herein are fully feasible for all conceivable methods leading to the inhibition or reduction of gene expression of a gene product or to the expression of a gene product which is either dysfunctional or inactive or a gene product with reduced activity.

[0371] The genetic modifications described herein can employ tools, methods and techniques known in the art, such as described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual (3rded.), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York (2001).

[0372] The term "endogenous" as used herein is meant to include those molecules and sequences that are present in a wild-type (natural) host cell prior to modification thereof that reduces expression of the corresponding endogenous gene and / or reduces production of the endogenous protein, particularly an endogenous gene or protein. In particular, an endogenous nucleic acid molecule (e.g., gene) or protein that is indeed present in (and can be obtained from) a particular host cell as it is found in nature is understood to be "endogenous to the host cell" or "endogenous to the host cell." Furthermore, a cell that "endogenously expresses" a nucleic acid or protein expresses that nucleic acid or protein as the same particular type of host as it is found in nature. Furthermore, a host cell that "endogenously produces" or "endogenously produces" a nucleic acid, protein, or other compound produces that nucleic acid, protein, or compound as the same particular type of host as it is found in nature.

[0373] Thus, even if a host cell in which a protein-encoding gene is inactivated or deleted, such as a knockout mutant of a host cell, no longer produces the endogenous protein, the protein is referred to herein as "endogenous."

[0374] The term "heterologous" as used herein with respect to a nucleotide sequence, a construct such as an expression cassette, an amino acid sequence, or a protein refers to a compound that is foreign, i.e., "exogenous," to a given host cell, such as not found in nature in the host cell; or the compound is naturally occurring in a given host cell, e.g., "endogenous," however, in the context of a heterologous construct or integrated into such a heterologous construct, e.g., with a heterologous nucleic acid fused or bound to an endogenous nucleic acid, such that the construct is heterologous. A heterologous nucleotide sequence as found endogenously can also be produced in a cell in an amount that is not natural, e.g., greater than expected or greater than found naturally. A heterologous nucleotide sequence or a nucleic acid comprising a heterologous nucleotide sequence can differ in sequence from an endogenous nucleotide sequence, but encodes the same protein as found endogenously. In particular, heterologous nucleotide sequences are those that are not found in the same relationship to a host cell in nature. Any recombinant or artificial nucleotide sequence is understood to be heterologous. An example of a heterologous polynucleotide is a nucleotide sequence that is not naturally associated with a promoter, e.g., to obtain a hybrid promoter, or operably linked to a coding sequence, as described herein. As a result, hybrid or chimeric polynucleotides can be obtained. Another example of a heterologous compound is a POI-encoding polynucleotide that is operably linked to a transcription control element (e.g., a promoter) that is not normally operably linked to an endogenous, naturally occurring POI-encoding sequence.

[0375] The term "operably linked" as used herein refers to the association of nucleotide sequences on a single nucleic acid molecule (e.g., a vector or expression cassette) in a manner such that the function of one or more of the nucleotide sequences is affected by at least one other nucleotide sequence present on the nucleic acid molecule. By operably linked, nucleic acid sequences are placed into a functional relationship with another nucleic acid sequence on the same nucleic acid molecule. For example, a promoter is operably linked to a coding sequence of a recombinant gene when it is capable of influencing the expression of that coding sequence. By way of further example, a nucleic acid encoding a signal peptide is operably linked to a nucleic acid sequence encoding a POI when the nucleic acid encoding the signal peptide is capable of expressing a pre-form of a protein such as a pre-form of a mature protein or a mature protein in a secreted form. In particular, such nucleic acids operably linked to each other can be immediately contiguous, i.e. there are no other elements or nucleic acid sequences between the nucleic acid encoding the signal peptide and the nucleic acid sequence encoding the POI.

[0376] The term "methanol auxotrophic yeast" as used herein belongs to the genera and species of yeasts that share a common metabolic pathway that enables them to use methanol as the sole carbon source for their growth. In response to the transcriptional regulation by methanol induction, several enzymes are rapidly synthesized at high levels. Since the promoter that controls the expression of these genes is one of the strongest and most tightly regulated yeast promoters, methanol auxotrophic yeast is very attractive as a host for large-scale production of recombinant proteins.

[0377] The methanol auxotrophic yeast as described herein is mutated by one or more genetic modifications to make it deficient in the methanol utilization pathway, in particular by under-expression of one or both of the genes encoding the endogenous AOX1 and AOX2 proteins, respectively. Methanol auxotrophic yeast under-expressing both the gene encoding the AOX1 protein and the gene encoding the AOX2 protein or otherwise deficient in the expression of both the gene encoding the AOX1 protein and the gene encoding the AOX2 protein are understood herein as "Mut-". For the purposes described herein, such Mut- yeast is still referred to as "methanol auxotrophic yeast" as it comprises a functional methanol utilization pathway prior to such one or more genetic modifications.

[0378] A "promoter" sequence is generally understood to be operably linked to a coding sequence if the promoter controls the transcription of the coding sequence. If the promoter sequence is not naturally associated with the coding sequence, its transcription is not controlled by the promoter in a native (wild-type) cell, or the sequence is recombinant with a different contiguous sequence.

[0379] The promoter used for the purposes described herein is referred to herein as "ECP". The ECP can be a constitutive promoter, an inducible promoter or a repressible promoter. In a particular embodiment, the ECP is a promoter inducible by methanol and a carbon source of methanol, respectively.

[0380] ECPs as described herein specifically initiate, regulate or otherwise mediate or control the expression of POI-encoding DNA. The promoter DNA and the encoding DNA can be from the same gene or from different genes and can be from the same or different organisms.

[0381] Inducible ECPs as described herein are specifically understood as regulatable promoters, which have different promoter strengths in the repressed and induced state. The term "regulatable" with respect to an inducible or repressible regulatory element, such as a promoter as described herein, shall mean an element which is repressed in the presence of excess substances, such as nutrients in the cell culture medium, in a host cell, e.g. in the growth phase of a batch culture, and which is derepressed to induce strong activity, e.g. in the production phase, such as after feeding of a substrate or addition of methanol for methanol induction, according to a fed-batch strategy. Regulatory elements can also be designed to be regulatable such that the element is inactive without the addition of a cell culture additive, and active in the presence of such an additive. Thus, the expression of a POI under the control of such a regulatory element can be induced after the addition of such an additive.

[0382] The strength of an ECP specifically refers to its transcription strength, expressed by the efficiency of the transcriptional initiation occurring at the promoter with high or low frequency. The higher the transcription strength, the more frequently transcription will occur at the promoter. Promoter strength is a typical feature of a promoter, as it determines the frequency of transcription of a given mRNA sequence, effectively providing a higher priority for the transcription of certain genes over others, resulting in higher transcript concentrations. For example, genes encoding for large amounts of required proteins usually have a relatively strong promoter. RNA polymerase can only perform one transcription task at a time and thus has to prioritize its work to be efficient. Differences in promoter strength are selected to allow this prioritization.

[0383] Strong ECPs are preferred herein, in particular ECPs which are relatively strong in the fully induced state, which state is generally understood as the state of about maximum activity. The relative strength is generally determined relative to a comparable promoter, which is referred to herein as a reference promoter, which can be a standard promoter, such as the respective pGAP promoter as used for the cells of the host cell.

[0384] Transcription frequency is generally understood as transcription rate, e.g. as determined by the amount of transcripts in a suitable assay, e.g. RT-PCR or Northern Blot. For example, the transcription strength of a promoter according to the present application is determined in a host cell which is Pichia pastoris and compared to the native pGAP promoter of Pichia pastoris.

[0385] The strength of the promoter expressing the gene of interest is generally understood as the expression strength or capacity supporting high expression levels / rates. For example, the expression and / or transcription strength of the inventive promoter is determined in a host cell being Pichia pastoris and compared to the native pGAP promoter of Pichia pastoris.

[0386] The comparative transcription strength compared to the reference promoter can be determined by standard methods, such as by measuring the amount of transcripts, e.g. using microarrays, or else in cell culture, such as by measuring the amount of the expression product of the respective gene in the recombinant cell. In particular, the transcription rate can be determined by the transcription strength on microarrays, Northern blots or with quantitative real-time PCR (qRT-PCR) or with RNA sequencing (RNA-seq), wherein the data show a difference in expression levels between conditions with high growth rates and conditions with low growth rates or conditions employing different medium compositions and a high signal strength compared to the reference promoter.

[0387] For example, the expression rate can be determined by the amount of expression of a reporter gene, such as eGFP.

[0388] The ECP as described herein exert a relatively high transcription strength, for example, reflected by a transcription rate or transcription strength of at least 15% compared to the native pGAP promoter in the host cell (also referred to as “homologous pGAP promoter”). Preferably, the transcription rate or strength is at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% or even any of higher, such as at least 110%, 120%, 130%, 140%, 150%, 160%, 170%, 180%, 190% or 200% or even any of higher, compared to the native pGAP promoter, such as determined in the (e.g. eukaryotic) host cell selected as host cell for the recombinant purposes to produce the POI.

[0389] The native pGAP promoter generally initiates the expression of the gap gene encoding glycerolaldehyde-3-phosphate dehydrogenase (GAPDH), which is a constitutive promoter present in most living organisms. GAPDH (EC 1.2.1.12) is a key enzyme of glycolysis and gluconeogenesis, playing a crucial role in catabolic and anabolic carbohydrate metabolism.

[0390] The native pGAP promoter is specifically active in recombinant eukaryotic cells in a manner similar to that in native eukaryotic cells of the same species or strain (including unmodified (non-recombinant) or recombinant eukaryotic cells). Such native pGAP promoters are generally understood to be endogenous promoters and are therefore homologous to the host cell and can serve as standard or reference promoters for comparison purposes. The relative expression or transcriptional strength of a promoter as described herein is typically compared to a native pGAP promoter of a cell of the same species or strain used as a host for POI production.

[0391] As used herein, the term "mutagenesis" shall refer to a method for providing a nucleotide sequence mutant, for example, by inserting, deleting and / or replacing one or more nucleotides to obtain a variant thereof having at least one change in a non-coding region or a coding region. Mutagenesis can be performed by random, semi-random or site-directed mutagenesis. Variants can be generated by suitable mutagenesis methods using the parental sequence as a reference. Certain mutagenesis methods include those methods that use the corresponding parental sequence information as a template to engineer nucleic acids or synthesize nucleotide sequences de novo. Specific mutagenesis methods are suitable for the rational engineering of mutants.

[0392] As used herein, the term "nucleotide sequence" or "nucleic acid sequence" refers to DNA or RNA. A "nucleic acid sequence" or "polynucleotide sequence" or simply "polynucleotide" refers to a single- or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5' end to the 3' end. This includes expression cassettes, self-replicating plasmids, infectious polymers of DNA or RNA, and non-functional DNA or RNA.

[0393] As used herein, the term "protein of interest (POI)" refers to a polypeptide or protein produced in a host cell with the aid of recombinant technology. More specifically, the protein may be a polypeptide that does not naturally occur in the host cell, i.e., a heterologous protein, or may be native to the host cell, i.e., a homologous protein of the host cell, but produced, for example, by transformation with a self-replicating vector containing a nucleic acid sequence encoding the POI, or by integrating one or more copies of a nucleic acid sequence encoding the POI into the genome of the host cell by recombinant technology, or by recombinantly modifying one or more regulatory sequences (e.g., promoter sequences) that control the expression of a gene encoding the POI. In some cases, the term POI as used herein also refers to any metabolite product of the host cell, such as that mediated by the recombinantly expressed protein.

[0394] The term "sequence identity" for variants, homologues or orthologues refers to the degree of identity of two or more sequences compared to a parent nucleotide or amino acid sequence. Two or more amino acid sequences can have identical or conserved amino acid residues at corresponding positions, to a certain extent, up to 100%. Two or more nucleotide sequences can have identical or conserved base pairs at corresponding positions, to a certain extent, up to 100%.

[0395] Sequence similarity searching is an efficient and reliable strategy for identifying homologs with excess (eg, at least 50%) sequence identity. Frequently used sequence similarity search tools are, for example, BLAST, FASTA, and HMMER.

[0396] Sequence similarity searches can identify such homologous proteins or genes by detecting excess similarity and statistically significant similarity reflecting a common ancestor. Homologs can include orthologs, which are understood herein to be identical proteins in different organisms, e.g., variants of such proteins in different organisms or species.

[0397] Orthologous sequences of the same protein in different organisms or species are generally homologous to protein sequences, particularly orthologs derived from the same genus. Typically, orthologs have at least about any of 25%, 30%, 35%, 40%, 50%, 60%, 70%, 80%, 85%, 90% or 95% identity, up to 100% sequence identity.

[0398] In particular, orthologues of a protein can be determined after replacing said protein or the gene encoding said protein with an orthologous sequence in a knockout host cell which has been modified prior to such replacement to knockout the corresponding gene or protein.

[0399] For example, if a putative ADH2, AOX1 or AOX2 protein is functional in a Pichia pastoris host cell in which the gene encoding such endogenous protein has been knocked out, replacing the corresponding endogenous protein, then for the purposes described herein, such putative ADH2, AOX1 or AOX2 can be considered a corresponding homolog.

[0400] The AOX1 protein comprising or consisting of the amino acid sequence identified as SEQ ID NO:1 is derived from the yeast P. pastoris. It is well understood that homologous sequences exist in other methylotrophic yeast host cells. For example, the yeast Pichia pastoris contains corresponding homologous sequences. Pichia pastoris has been reclassified into the new genus P. pastoris and is divided into three species: P. pastoris, P. pastoris, and P. pseudopasteur.

[0401] Particular homologous sequences of SEQ ID NO: 1 are for example found in Pichia pastoris (e.g., SEQ ID NO: 9, such as encoded by a nucleotide sequence comprising or consisting of SEQ ID NO: 10), Pichia polymorpha (e.g., SEQ ID NO: 19, such as encoded by a nucleotide sequence comprising or consisting of SEQ ID NO: 20) or Pichia methanolica (e.g., SEQ ID NO: 13, such as encoded by a nucleotide sequence comprising or consisting of SEQ ID NO: 14).

[0402] The AOX2 protein comprising or consisting of the amino acid sequence identified as SEQ ID NO: 3 is of Pichia famata origin. It is well understood that homologous sequences exist in other methanol- utilizing yeast host cells. For example, the yeast of Pichia pastoris comprises a corresponding homologous sequence. Pichia pastoris has been reclassified into the new genus Komagataella and is divided into three species: Komagataella pastoris, Komagataella phaffii and Komagataella pseudopastoris.

[0403] Particular homologous sequences of SEQ ID NO: 3 are for example found in Pichia pastoris (e.g., SEQ ID NO: 11, such as encoded by a nucleotide sequence comprising or consisting of SEQ ID NO: 12), Pichia polymorpha (e.g., SEQ ID NO: 19, such as encoded by a nucleotide sequence comprising or consisting of SEQ ID NO: 20) or Pichia methanolica (e.g., SEQ ID NO: 15, such as encoded by a nucleotide sequence comprising or consisting of SEQ ID NO: 16).

[0404] Pichia polymorpha has only one alcohol oxidase, exemplified herein as SEQ ID NO: 19. Thus, the reduction of expression of AOX1 and AOX2 in Pichia polymorpha as described herein is effectively performed by reducing the expression of the endogenous alcohol oxidase of Pichia polymorpha.

[0405] Any homologous sequence of an AOX1 or AOX2 protein having some sequence identity as described herein, in particular any such protein being an ortholog of the Pichia pastoris AOX1 or AOX2 protein, is included in the definition of the respective AOX1 protein or AOX2 protein as described herein.

[0406] The ADH2 protein comprising or consisting of the amino acid sequence identified as SEQ ID NO: 50 is of a Guehomyces pullulans origin. It is well understood that homologous sequences exist in other methanol- utilizable yeast host cells. For example, the yeast of Pichia pastoris comprises a corresponding homologous sequence. Pichia pastoris has been reclassified into the new genus of Guermyces and is divided into three species: G. pastoris, G. fafii, and G. pseudopastoris.

[0407] A particular homologous sequence of SEQ ID NO: 50 is, for example, any one of SEQ ID NO: 52, 54, 56, 58, 60, 62, 64, 66, 68, or 70.

[0408] Any homologous sequence of an ADH2 protein having some sequence identity as described herein, in particular any such protein that is an ortholog of a Pichia pastoris ADH2 protein as described herein.

[0409] “Percent (%) amino acid sequence identity” with respect to an amino acid sequence, homolog, and ortholog described herein is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the specific polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. One of skill in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve the maximum alignment over the full length of the sequences being compared.

[0410] For purposes herein, sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTP 2.8.1 with the following exemplary parameters: Program: blastp, Word size: 6, Expect value: 10, Hitlist size: 100, Gap penalties: 11.1, Matrix: BLOSUM62, Filter string: F, Composition adjustment: Conditional compositional score matrix adjustment.

[0411] “Percent (%) identity” with respect to a nucleotide sequence (e.g., a promoter or gene) is defined as the percentage of nucleotides in a candidate DNA sequence that are identical with the nucleotides in the DNA sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent nucleotide sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve the maximum alignment over the full length of the sequences being compared.

[0412] For the purposes described herein (unless otherwise indicated), sequence identity between two amino acid sequences is determined using the NCBI BLAST program version BLASTN 2.8.1 with the following exemplary parameters: Program: blastn, Word size: 11, Expect threshold: 10, Hitlist size: 100, Gap penalties: 5.2, Match / Mismatch Rewards: 2,-3, Filter string: Low complexity regions, Only lookup table flags.

[0413] The term "isolated" or "isolation" as used herein in reference to a POI shall mean a compound which has been sufficiently separated from the environment with which it is naturally associated, in particular cell culture supernatant, so as to exist in "purified" or "substantially pure" form. However, "isolated" does not necessarily imply that the artificial or synthetic admixture with other compounds or materials is excluded, or the presence of impurities which do not interfere with the basic activity is excluded, and which impurities can be present, for example, due to incomplete purification. The isolated compound can be further formulated to produce a formulation thereof, and still be isolated for practical purposes - for example, a POI can be mixed with a pharmaceutically acceptable carrier or excipient when used in diagnosis or therapy.

[0414] The term "purified" as used herein shall mean a formulation comprising at least 50% (mol / mol), preferably at least 60%, 70%, 80%, 90% or 95% of a compound (e.g., a POI). Purity is measured by methods appropriate to the compound (e.g., chromatographic methods, polyacrylamide gel electrophoresis, HPLC analysis, etc.). An isolated purified POI as described herein can be obtained by purifying a cell culture supernatant to reduce impurities.

[0415] Isolation and purification methods for obtaining recombinant polypeptide or protein products can be used, such as methods utilizing solubility differences, such as salting out and solvent precipitation; methods utilizing molecular weight differences, such as ultrafiltration and gel electrophoresis; methods utilizing charge differences, such as ion-exchange chromatography; methods utilizing specific affinities, such as affinity chromatography; methods utilizing hydrophobic differences, such as reverse-phase high-performance liquid chromatography; and methods utilizing isoelectric point differences, such as isoelectric focusing.

[0416] The following standard methods are preferred: cell (debris) separation and washing by microfiltration or tangential flow filters (TFF) or centrifugation, POI purification by precipitation or heat treatment, POI activation by enzymatic digestion, POI purification by chromatography (such as ion exchange (IEX), hydrophobic interaction chromatography (HIC), affinity chromatography, size exclusion (SEC) or HPLC chromatography), concentration and washing of POI precipitates by ultrafiltration steps.

[0417] Highly purified products are essentially free of contaminating proteins and preferably have a purity of at least 90%, more preferably at least 95%, or even at least 98%, up to 100%. Purified products can be obtained by purification from cell culture supernatant or otherwise from cell debris.

[0418] Isolated and purified POIs can be identified by conventional methods, such as Western blotting, HPLC, activity assays, or ELISA.

[0419] The term "recombinant" as used herein means "prepared or derived by genetic engineering or is the result thereof. A recombinant host can be engineered to delete and / or inactivate one or more nucleotides or nucleotide sequences and can in particular comprise an expression or cloning vector containing a recombinant nucleic acid sequence, in particular employing nucleotide sequences that are foreign to the host. Recombinant proteins are produced by expression of the corresponding recombinant nucleic acid in a host. The term "recombinant" as used herein in connection with a POI includes a POI that is prepared, expressed, produced, or isolated by recombinant means, such as from a host cell that has been transformed to express the POI. According to the present application, molecular biology, microbiology, and recombinant DNA techniques within the skill of the art are employed. Such techniques are explained fully in the literature. See, e.g., Maniatis, Fritsch and Sambrook, "Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, (1982).

[0420] Certain recombinant host cells are "engineered" host cells, which are understood to be host cells that have been manipulated using genetic engineering, i.e., by human intervention. When a host cell is engineered to reduce expression or underexpress a given gene or corresponding protein, the host cell is manipulated such that it no longer has the ability to express such gene and protein, compared to the host cell under the same conditions before the manipulation or compared to a host cell that has not been engineered to underexpress the gene and protein, respectively.

[0421] The foregoing description will be more fully understood with reference to the following Examples. Such Examples, however, are merely representative of methods of practicing one or more embodiments of the application and should not be construed as limiting the scope of the application.

[0422] Example

[0423] Example 1: Generation of methanol utilization negative strains of Pichia pastoris.

[0424] To generate methanol utilization negative strains (Mut -), two genes responsible for methanol utilization named AOX1 and AOX2 were deleted from the genome of Pichia pastoris (synonym Komagataella phaffii).

[0425] a) For this purpose, Pichia pastoris strain (CBS 2612, CBS-KNAW Fungal Biodiversity Center, Centraalbureau voor Schimmelcultures, Utrecht, The Netherlands) was made electrocompetent. The strain was inoculated into 100 mL YPD medium (main culture) for 16-20 hours (25°C; 180 rpm) and harvested by centrifugation (5 min; 1500 g; 4°C) in two 50 mL falcon tubes at an optical density (OD 600 ) of 1.8-3. The cell pellet was resuspended in 10 mL YPD + 20 mM HEPES + 25 mM DTT and incubated (30 min; 25°C; 180 rpm). After the incubation period, the falcon tubes were filled with 40 mL ice-cold sterile distilled water and centrifuged (5 min; 1500 g; 4°C) (Eppendorf AG, Germany). The cell pellet was resuspended in ice-cold sterile 1 mM HEPES buffer pH 8 and centrifuged (5 min; 1500 g; 4°C). The cell pellet was resuspended in 45 mL ice-cold 1 M sorbitol and centrifuged (5 min; 1500 g; 4°C). The pellet was resuspended in 500 μL ice-cold 1 M sorbitol and aliquoted in 80 μL into ice-cold 1.5 mL Eppendorf tubes. The aliquoted electrocompetent cells were kept at -80°C until use.

[0426] b) Cultures of the yeast strains were performed in YPD medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose) or YPD agar plates (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose, 20 g / L agar-agar) containing 500 μg / mL geneticin or 200 μg / mL hygromycin (when needed for selection).

[0427] c) To generate the AOX1 and AOX2 deletion strains, the split marker cassette method (Gasser et al., 2013) was used. The DNA fragments used for the generation of the gene deletions are found in Table 1. The split marker cassette carries an antibiotic resistance cassette for geneticin flanked by LoxP sites.

[0428] d) Deletion by adding 0.5 pg of AOX1 split marker cassette 1 and 0.5 pg of AOX1 split marker cassette 2 to an aliquot of electrocompetent cells and incubating on ice for 5 min. Electroporation was performed at 2 kV for 4 msec (GenePulser, Bio-Rad Laboratories, Inc, USA). After transformation, the electroporated cells were suspended in 1 mL YPD medium and regenerated at 30 °C on a thermoshaker (Eppendorf AG, Germany) at 700 rpm for 1.5 to 3 h. Subsequently, 20 pL and 150 pL of the cell suspension were plated on YPD plates containing 500 pg / mL geneticin for selection and incubated at 28 °C for 48 h. Emerging colonies were re-streaked onto fresh YPD plates containing 500 pg / mL geneticin. The correct disruption of the AOX1 locus was verified by performing PCR on genomic DNA using primers AOX1_ctrl_Fwd and AOX1_ctrl_Rev (Table 2) binding outside the deletion cassette. One clone was selected based on PCR amplification and sequencing of the PCR amplicon confirming the correct deletion of the desired gene, resulting in the Pichia pastoris aox1A::KanMX strain. Liquid cultures were incubated from single positive colonies and made electrocompetent as explained in Example la), with the difference that 500 pg / mL geneticin was added to the liquid culture medium to produce the master culture. The strain was electroporated with 500 pg of the pTAC_Cre_Hph_Mx4 plasmid, which carries the Cre recombinase required for deletion of the geneticin antibiotic resistance cassette between the LoxP regions and a hygromycin resistance cassette for selection (Marx, Mattanovich and Sauer, 2008). Electroporation was performed as described and loss of geneticin resistance was selected by re-streaking transformants in parallel on YPD with 500 pg / mL geneticin and 200 pg / mL hygromycin and YPD plates with only 200 pg / mL hygromycin. Clones that were unable to grow on YPD plates with 500 pg / mL geneticin and 200 pg / mL hygromycin but could grow on YPD plates with only 200 pg / mL hygromycin were selected. Successful deletion of the AOX1 coding region and the antibiotic marker was verified by PCR amplification with primers AOX1_ctrl_Fwd and AOX1_ctrl_Rev (Table 2) and sequencing of the PCR amplicon (Microsynth AG, Switzerland). The resulting strain was called Pichia pastoris CBS2612 Aaox1 and has the genotype Mut S Phenotype. It was selected for further genetic manipulation.

[0429] e) Using Pichia pastoris CBS2612 Aaoxl to generate electrocompetent cells with the protocol described in a) and electroporting with 0.5 pg AOX2 split marker cassette 1 and 0.5 pg AOX2 split marker cassette 2 (Table 1) with the procedure described in d). Removing the antibiotic marker with the same procedure as described in d). Successful deletion of the AOX2 coding region and the antibiotic marker is verified by PCR amplification with primers AOX2_ctrl_fwd and AOX2_ctrl_rev (Table 2) and sequencing the PCR amplicon (Microsynth AG, Switzerland). The resulting strain is called Pichia pastoris CBS2612 Aaoxl Aaox2 and has the methanol utilization negative (Mut-) phenotype.

[0430] f) Using Pichia pastoris CBS2612 Aaoxl Aaox2 to generate electrocompetent cells with the protocol described in a) and electroporting with 0.5 pg AOX1 split marker cassette 1 and 0.5 pg AOX1 split marker cassette 2 (Table 1) with the procedure described in d). Removing the antibiotic marker with the same procedure as described in d). Successful deletion of the AOX1 coding region and the antibiotic marker is verified by PCR amplification with primers AOX1_ctrl_fwd and AOX1_ctrl_rev (Table 2) and sequencing the PCR amplicon (Microsynth AG, Switzerland). The resulting strain is called Pichia pastoris CBS2612 Aaoxl Aaox2 Aaoxl and has the methanol utilization negative (Mut-) phenotype. Genomic DNA was isolated for PCR amplification with the QIAamp® DNA Mini Kit (QIAGEN, Germany) following the manufacturer's recommendations. PCR amplification reactions were completed with Q5 polymerase (New England Biolabs, Inc., USA) following the manufacturer's recommendations.

[0431] Table 1 : Split marker cassette DNA sequences used for the generation of AOX1 and AOX2 deletion strains.

[0432]

[0433]

[0434]

[0435]

[0436] Table 2: Polymerase chain reaction primers

[0437] Primer name DNA sequence 5' to 3' AOX1_ctrl_Fwd GGCTGGAAATAGATGTAGGGAG (SEQ ID NO: 29) AOX1_ctrl_Rev TCGCATCTCCGCAAATTTCTC (SEQ ID NO: 30) AOX2_ctrl_fwd GATCCCATTCCCTATCCATGT (SEQ ID NO: 31) AOX2_ctrl_rev CTCTCCCCCCTCGTAATCTT (SEQ ID NO: 32)

[0438] Example 2: Production of intracellular eGFP with Pichia pastoris Aaoxl and Pichia pastoris Aaoxl Aaox2 under the control of the methanol inducible AOX1 promoter.

[0439] For testing protein production capacity and promoter activity, Pichia pastoris Aaoxl Aaox2 and Pichia pastoris Aaoxl strains were transformed with expression constructs for enhanced green fluorescent protein (eGFP) (Table 4). The eGFP coding sequence is under the expression control of the P AOX1 :PP7435_chr4(237941...238898).

[0440] a) The expression construct BB3aN_pAOX1_GFP_ScCYCtt was assembled from plasmids BB1_12_pAOX1, BB1_23_eGFP, BB1_34_ScCYC1tt and BB3aN_14* using the Golden Gate assembly procedure as described (Prielhofer et al., 2017). Plasmids and sequences are available in the Golden PiCS kit #1000000133 (Addgene, USA). Prior to electroporation, plasmids were linearized with the restriction enzyme Ascl (New England Biolabs, USA) according to the manufacturer’s protocol and purified with the Gel / PCR DNA Fragment Extraction Kit (Süd-Laborbedarf GmbH, Germany). 500 ng of linearized plasmid were transformed into electrocompetent P. pastoris Aaox1 Aaox2 and P. pastoris Aaox1 as described in previous examples 1 a) and 1 d). Positive transformants were selected on YPD with 100 pg / L nourseothricin and used for further screening experiments. Gel / PCR DNA Fragment Extraction Kit (Süd-Laborbedarf GmbH, Germany). 500 ng of linearized plasmid were transformed into electrocompetent P. pastoris Aaox1 Aaox2 and P. pastoris Aaox1 as described in previous examples 1 a) and 1 d). Positive transformants were selected on YPD with 100 pg / L nourseothricin and used for further screening experiments.

[0441] b) Small scale screening experiments for intracellular eGFP expression in P. pastoris Aaox1 Aaox2 and P. pastoris Aaox1. Ten transformants from example 2a) were picked and inoculated into overnight cultures in a 24 deep well plate containing 2 mL YPD and 100 pg / L nourseothricin per well. All transformants were tested in duplicates. The 24 well plate was sealed with an air-permeable membrane and incubated at 25 °C and 280 rpm. To screen for intracellular expression levels of eGFP, the overnight cultures were transferred to a 24 deep well plate with 2.5 mL base ASMv6 medium with 25 g / L polysaccharide and 0.3% amylase (m2p-labs GmbH, Germany) for slow glucose release and incubated for two hours before 0.2% (v / v) or 1 % (v / v) methanol was added to induce eGFP production. eGFP measurements were performed at 4 and 20 hours post induction using a Gallios flow cytometer (Beckman Coulter, Inc., USA). For this purpose, cells were diluted in phosphate buffered saline containing 0.24 g / L KH2PO4, 1.8 g / L Na2HPO4*2H2O, 0.2 g / L KC1, 8 g / L NaCl to an OD of 0.5. The flow rate was set to 1.5 mL / min and the laser power to 50 mW. Measurements were performed in duplicates. 20,000 events were measured. The FX value was calculated using the following equation with the software FACS Express version 3 (De Novo Software, USA): 600 . Measurements were performed in duplicates. 20,000 events were measured. The FX value was calculated using the following equation with the software FACS Express version 3 (De Novo Software, USA):

[0442]

[0443] FX = dimensionless value

[0444] FL1 = fluorescence measured with 505-545 nm filter

[0445] FSC = forward scatter

[0446] The method has been described (Ata, Prielhofer, Gasser, Mattanovich and 2017; Hohenblum, Borth and Mattanovich, 2003; Prielhofer et al., 2013).

[0447] c) Minimal medium ASMv6: 6.3 g / L (NH4)2HPO4, 0.8 g / L (NH4)2SO4, 0.49 g / L MgSO4*7H2O, 2.64 g / L KCl, 0.054 g / L CaCl2*2H2O, 22 g / L citric acid monohydrate, 1.47 mL / L PTM0 trace metals, 0.8 mg / L biotin, 20 mL / L NH4OH (25%); pH set to 6.5 with KOH.

[0448] d) The results are shown in Table 3. Fluorescence is a representative indicator to determine the intracellular eGFP level and the intracellular eGFP level is a representative indicator to determine the P AOX1 activity. The results show that the promoter is active in the Pichia pastoris Aaox1 Aaox2 strain and eGFP is produced under 1% methanol induction for 20h. After 20h, induction of the Pichia pastoris Aaox1 Aaox2 BB3aN_pAOX1_GFP_ScCYCtt strain is better under 1% methanol than under 0.2% methanol and no difference between the methanol concentrations is observed in the Pichia pastoris Aaox1 strain.

[0449] Table 3: Results (FX values) with standard deviation from the experiments described in example 2 b)

[0450]

[0451] Table 4: Coding sequences of the genes of interest expressed in Pichia pastoris Aaox1 Aaox2 and Pichia pastoris Aaox1.

[0452]

[0453]

[0454]

[0455]

[0456] Example 3: Production of P. pastoris Δaox1 and P. pastoris Δaox1 Δaox2 strains producing secreted HSA and VHH under the methanol inducible AOX1 promoter.

[0457] To test the ability to produce secreted recombinant proteins in P. pastoris Δaox1 Δaox2 strains and to compare them to P. pastoris Δaox1 strains, the strains were transformed with expression constructs for the following two model secreted proteins: (1) human serum albumin (HSA) with its native secretory leader or (2) a camelid antibody variable region (VHH) with the S. cerevisiae alpha-mating factor secretory leader. The coding sequences (codon-optimized and externally synthesized) for these genes of interest can be found in Table 4.

[0458] a) The pPM2pN21_pAOX1_HSAopt_CycTT and pPM2pZ30_pAOX1_alphaMF-vHH_CycTT expression constructs for HSA and VHH production are derivatives of the pPuzzle ZeoR vector described in WO 2008128701 A2, which consists of an E. coli pUC19 ori and a Zeocin antibiotic resistance cassette. In the case of pPM2pN21_pAOX1_HSAopt_CycTT, the Zeocin resistance was exchanged for a nourseothricin resistance by restriction and ligation. In addition, the vectors carry integration sequences homologous to the PGI locus PP7435_Chr3 (1366329...1367193) to enable efficient integration. The expression vectors are described in more detail elsewhere (Gasser et al., 2013; Stadlmayr et al., 2010). Expression of the gene of interest (GOI) is mediated by the P AOX1 PP7435_chr4 (237941...238898) and the S. cerevisiae CYC1 transcriptional terminator. The gene for human serum albumin (HSA) (GenBank NP_000468) was codon-optimized for P. pastoris and synthesized. It has the native secretory leader and is thus secreted into the supernatant. The gene for VHH was codon-optimized for P. pastoris and synthesized (Table 4) with an N-terminal S. cerevisiae alpha-mating factor leader for secretion into the supernatant. For the purpose of transformation of the expression constructs, the circular vectors were linearized by restriction in the PGI1 homology sequence with XmnI (New England Biolabs, USA) and transformed into the P. pastoris strains by electroporation (2.5 kV, 25 μF, 200 Ω). Transformants were selected on YPD agar plates with 100 μg / ml Zeocin or 300 μg / ml nourseothricin. Gel / PCR DNA fragment extraction kit (Süd-Laborbedarf GmbH, Germany) purification.

[0459] b) Electroporation of electrocompetent P. pastoris Δaox1 Δaox2 and P. pastoris Δaox1 with 500 ng of linearized pPM2pN21_pAOX1_HSAopt_CycTT and pPM2pZ30_pAOX1_aMF-vHH_CycTT plasmids was performed as described in previous Example 1a) and Example 1d). Selection was performed on YPD plates with 100 pg / mL nourseothricin or 25 pg / mL

[0460] Example 4: Small scale screening of P. pastoris Δaox1 Δaox2 and P. pastoris Δaox1 producing HSA and VHH.

[0461] a) For pre-cultures, transformants were inoculated in 2 mL YPD with 100 pg / mL nourseothricin or 25 pg / mL boleticin based on the antibiotic resistance used for selection. For each expression construct, twelve transformants were picked for screening. Pre-cultures and screening cultures were cultivated in 24-well plates sealed with air-permeable membranes and incubated at 25 °C with 280 rpm. Screening cultures were inoculated in 2 mL minimal medium (ASMv6) with a starting optical density (OD 600 ) of 8 in 2 mL minimal medium (ASMv6) with a slow glucose release system based on a 6 mm feeding needle (Kuhner Shaker GmbH, Germany) to keep the cultures within the glucose limit. Strains were compared to different methanol feeding procedures differing in the total amount of methanol received and the duration (Table 5).

[0462] b) After the incubation period, 1 mL of each culture was removed and centrifuged in pre- weighed Eppendorf tubes. The supernatant was removed and the protein concentration was measured with a Caliper LabChip GXII Touch (PerkinElmer, inc., USA) following the manufacturer’s instructions. Wet cell weight was determined by weighing the Eppendorf tube with the cell pellet and calculated as follows: weight (full) - weight (empty) = wet cell weight (WCW) (g / L). From this data the yield was calculated: yield (pg / g) = protein concentration / wet cell weight. Data from transformants with a two-fold concentration or no detectable protein in the supernatant were removed from the analysis as outliers. Outliers were considered to be transformants with two copies or no copies at all of the expression construct (Aw & Polizzi, 2013; Schwarzhans et al., 2016).

[0463] Table 5: Overview of the screening strategy used to test the secreted protein production yield of the transformed strains. * First injection is 0.5% methanol.

[0464]

[0465] c) The results show that Pichia pastoris Aaox1 Aaox2 can produce secreted proteins under induction of P AOX1 and the yield is comparable to Pichia pastoris Aaox1, which is used as industry standard (Table 6). In the “two injection - extended” strategy, Pichia pastoris Aaox1 Aaox2 shows a better yield, indicating that Pichia pastoris Aaox1 Aaox2 has a yield advantage at longer incubation times and less methanol. Furthermore, this shows that it is possible to use limited glucose conditions to screen for P AOX1 and methanol induction controlled secreted protein producing Pichia pastoris Aaox1 Aaox2 strains.

[0466] Table 6: Average secreted product yield in pg product / g WCW of the tested strains under different screening conditions with standard deviation.

[0467]

[0468] Example 5: Bioreactor cultivation

[0469] To determine the behavior and process parameters of Pichia pastoris Aaox1 Aaox2 in a fed-batch mode in a recombinant protein production environment, bioreactor cultivations were performed. The cultivations were performed as follows.

[0470] a) A DASGIP bioreactor (Eppendorf AG, Germany) with a working volume of 0.7 L was used. One bioreactor system consists of four reactors arranged in a bioblock for temperature control. Each reactor is connected to 4 peristaltic pumps controlled by software. In addition, each reactor has 2 scales available connected to the DASGIP control software (Eppendorf AG, Germany) for adjusting the pump speed gravimetrically. Each reactor is connected to a controllable gas supply (pressurized air, N2, O2 can be mixed in any desired amount) and a gas analyzer for measuring the O2 and CO2 concentration in the reactor off-gas. The reactors have a pH probe and a dissolved oxygen (DO) probe connected to the DASGIP control software. The DASGIP control software records all parameters at one minute intervals.

[0471] b) The bioreactor medium consists of BSM medium (Mellitzer et al., 2014): 11.48 g / L H3PO4, 0.5 g / L CaCl2*2H2O, 7.5 g / L MgSO4*7H2O, 9 g / L K2SO4, 2 g / L KOH, 40 g / L glycerol, 0.25 g / L NaCl, 4.35 mL / L PTM0, 0.87 mg / L biotin, 0.1 mL / L Glanapon 2000, pH set to 5.5 with 25% NH3.

[0472] c) PTM0 consists of: 6.0 g CuSO4*5H2O, 0.08 g Nal, 3.36 g MnSO4*H2O, 0.2 g Na2MoO4*2H2O, 0.02 g H3BO3, 0.82 g CoCl2, 20.0 g ZnCl2, 65.0 g FeSO4*7H2O, 5 mL / L H2SO4(95-98%).

[0473] d) The glucose feed medium consists of: 50% (w / w) glucose, 2.08 mg / kg biotin, 10.4 mL / kg PTM0. The methanol feed medium is: 50% (v / v) or 100% (v / v) methanol. The glycerol feed medium consists of: 60% (w / w) glycerol, 2.08 mg / kg biotin, 10.4 mL / kg PTM0.

[0474] e) The dissolved oxygen (DO) set point was 20%. In some cases, the DO control was disabled and the agitation and aeration were manually set to constant 750 rpm and 9.5 sL / h. The pH was set to 5.0 or 5.5 with 12.5% or 25% NH3 controlled by the DASGIP control software. Acid control was achieved by manual addition of 10% H3PO4 when necessary. The temperature was set at 25°C. The initial OD 600 was 2 and the initial volume was 300 mL + 15 mL inoculum.

[0475] f) Sampling was performed on a daily basis (approximately every 24 hours). First, 3 mL of draw was removed from the reactor to remove the dead volume of the sampling port. Then, 9 mL of sample was taken. 3 x 2 mL was pipetted into a re-weighed 2 mL Eppendorf tube and 1 x 1.5 mL was pipetted into a 1.5 mL Eppendorf tube. The samples were centrifuged (16,000 g, 10 min, 4°C). The supernatant was collected for protein and HPLC analysis and stored at -20°C. The pellet was washed by re-suspension in 1 mL 0.1 M HC1 to remove trace salts and centrifuged again (16,000 g, 10 min, 4°C). The pellet was then dried at 105°C for 24 hours to determine the dry cell weight. The dry cell weight was calculated as follows: (weight (full) - weight (empty)) / 2 = dry cell weight (g / L) and calculated as the average of three replicates. If only an HPLC sample was required, only 2 mL of sample was taken.

[0476] g) Cell viability was measured by staining the cell suspension with propidium iodide. For this, the cell suspension from the reactor sample was diluted to an OD 600 of 0.5 with phosphate buffered saline and mixed with a propidium iodide stock solution to a final concentration of 10 mM, which was then measured with a Gallios flow cytometer (Beckman Coulter, USA) with a 590-650 nm filter. 50,000 events were measured per sample.

[0477] Example 6: The evaporation rate of methanol from the bioreactor without cells was determined.

[0478] To assess the evaporation rate of methanol from the reactor due to aeration and agitation, the reactor was filled with sterile medium and pulsed with methanol, a sample was taken to determine the methanol concentration.

[0479] a) For this example, two reactors were filled with 310 mL of glycerol-free BSM medium and two reactors were filled with 500 mL of glycerol-free BSM medium to simulate the medium at the end of the batch phase when the glycerol is consumed by the growing culture.

[0480] b) The reactor stirrer speed was set to 760 rpm and the aeration to 9.5 sL / h, which is the same as for the cultivation of P. pastoris Aaox1 Aaox2. The parameters can be found in Table 7.

[0481] c) A 50% (v / v) methanol pulse was added manually to increase the methanol concentration to 1% (v / v) and samples were taken to determine the actual concentration reached. Samples were taken at 3.4, 6.5, 22.4, 31.0, 47.9 hours by first removing 3 mL dead volume from the sample port and discarding the aspirate. 4 mL samples were taken immediately thereafter.

[0482] d) HPLC measurements of the methanol concentration were performed as described previously (Blumhoff, Steiger, Marx, Mattanovich and Sauer, 2013). Identification and quantification were performed using pure standards. The column was Aminex HPX-87H (Bio-Rad Laboratories, Inc., USA) run with 4 mM H2SO4 flow phase at 0.6 mL / min. The detector was a refractive index detector RID-10A (Shimadzu, Corp., Japan) and calculations were performed with LabSolutions v5.85 software (Shimadzu, Corp., Japan).

[0483] e) Evaporation rates were calculated only from the first and last sample with the largest time and concentration difference. The concentration change between adjacent samples was small and measurement errors can have a significant impact on the calculation. Data can be found in Table 8. R1 and R2 filled with 500 mL medium had an average of 0.063 g*L -1 *h -1 .

[0484] Table 7: Reactor parameters and methanol pulse volume.

[0485]

[0486] Table 8: Methanol concentration at sampling time points and calculated evaporation rates.

[0487]

[0488] * Too low, considered an outlier.

[0489] Example 7: Determination of the methanol uptake rate of P. pastoris Aaox1 Aaox2

[0490] ​To determine the methanol uptake rate, the P. pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT strain was cultivated in a bioreactor. The culture was grown until a certain biomass concentration. Then a methanol pulse was applied and samples were taken immediately after the pulse and after approximately 20 hours. The goal was to determine the methanol uptake rate of the Mut - strain and compare it to the methanol evaporation rate measured in Example 6.

[0491] a) Pre-culture: 24 hours before inoculation of the reactor, 50 mL YPD containing 100 pg / L nourseothricin was inoculated with P. pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT. 3 hours before inoculation of the reactor, the pre-culture was diluted with another 50 mL YPD containing 100 pg / L nourseothricin. Just before inoculation, an appropriate amount of the culture was centrifuged (1500 g, 5 min, 20 °C) and resuspended in 15 mL BSM medium at an OD 600 of 42. b) A reactor filled with 300 mL BSM medium was inoculated with 15 mL P. pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT culture. The target inoculation OD 600 in the reactor was 2. At the end of the batch phase, indicated by a dissolved oxygen spike, a 50% (w / w) glucose feed was started at 2.4 mL / h for 24 hours to increase the biomass. Two hours after the start of the glucose feed, a 9.5 mL 50% (v / v) methanol injection was given to increase the methanol concentration to 1.5% (measured concentrations were R1 = 1.47% and R2 = 1.48%). This was done to induce methanol consumption. At the end of the glucose feed phase, samples were taken for cell dry weight and HPLC.

[0492] c) After the glucose phase, the agitation and aeration were set to constant 750 rpm and 9.5 sL / h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and a sample was taken immediately (measured concentrations were R1 = 1.36% and R2 = 1.36%). The concentration was measured again after 19.5 hours and used to determine the specific methanol uptake rate (q 甲醇 ).

[0493] d) Compared to the values obtained for the evaporation rate in Example 6e) which ranged from 0.022 to 0.063 g L -1 h -1 , the methanol concentration decrease (dc / dt) of this experiment was significantly higher, with an average of 0.37 g L -1 h -1 .

[0494] The specific methanol uptake rate was calculated based on the data shown in Table 9 as follows.

[0495]

[0496] The volume was constant over the measured time period. The average specific methanol uptake rate (q 甲醇 ) was 5.07 mg g -1 h -1 For the calculation of the specific methanol uptake rate corrected for evaporation, the evaporation rate was estimated to be 22 mg L -1 h -1 based on the results in Table 8, example 6e). This outcome is completely new and unexpected. Hitherto, it was reported and accepted in the published literature that Mut - cannot metabolize methanol, and the decrease in methanol was due to evaporation loss (Looser et al., 2015).

[0497] Table 9: Overview of data of specific methanol uptake rate (q 甲醇 ) and apparent methanol loss (dc / dt)

[0498]

[0499] Example 8: Cultivation strategy 1 - application of constant glucose / methanol co-feeding to Pichia pastoris Aaox1 Aaox2

[0500] Pichia pastoris Aaox1 Aaox2 pPM2 pN21_pAOX1_HSAopt_CycTT strain was cultivated in the context of recombinant protein production. The strain was fed with a constant, limited glucose feed and protein production was induced with methanol.

[0501] a) Inoculation was performed as described in example 7a)b). The cultivation was divided into two phases. (1) First phase: batch at an OD 600 The end of the batch phase was indicated by a dissolved oxygen spike at 22.27 h for reactor R1 and at 21.52 h for reactor R2.

[0502] b) (2) Second phase: after the first phase a fed-batch phase was started with a feed rate of 2.4 mL / h of 50% (w / w) glucose, for 97 hours. Simultaneously 50% (v / v) methanol pulses were added with the aim to increase the methanol concentration to 1.5% (v / v). HPLC samples were taken as described in example 6d) to measure the exact concentration and additional pulses were added if necessary. The feed rate of methanol was adjusted based on the predicted biomass concentration and the specific methanol uptake rate of 5 mg g -1 h-1 Calculated methanol feed. Methanol concentration was measured daily on-line by HPLC.

[0503] c) Calculate the methanol feed at hourly intervals as follows:

[0504] R 甲醇 =q 甲醇 *X 预测 *t 间隔

[0505]

[0506] A 甲醇 =V 反应器 *C 甲醇,目标 -T 甲醇

[0507]

[0508] V 反应器 =V 反应器-前一间隔 +F 葡萄糖 +F 甲醇

[0509]

[0510] q 甲醇 = specific methanol uptake rate (mg g -1 h -1 )

[0511] X 预测 = predicted total biomass based on dry cell weight (g)

[0512] t 间隔 = time interval (h)

[0513] R 甲醇 = at t 间隔 Methanol consumption at 37°C (mg)

[0514] T 甲醇 =Total methanol (mg)

[0515] A 甲醇 = Methanol added (mg)

[0516] F 甲醇 = 50% (v / v) methanol feed (mL)

[0517] C 甲醇目标 = Target methanol concentration (mg / mL)

[0518] V 反应器 = Reactor volume (mL)

[0519] F 葡萄糖= 50% (v / v) glucose feed (mL)

[0520] V 样品 = sample volume if applicable to interval, otherwise it is 0

[0521]

[0522] d) The methanol concentration can be kept in excess during the bioreactor cultivation, 1.19% to 1.5% (v / v) of methanol, based on the predicted specific methanol uptake rate of example 7d), and online methanol concentration measurement and feed adjustment is only done once a day.

[0523] e) Process and productivity data can be found in Table 10. The overall average specific productivity is 29.4 pg g -1 h -1 For reactors R1 and R2, the methanol concentration at the end of the cultivation was 10.4 and 10.0 g / L (1% (v / v) methanol corresponds to 7.92 g / L). The total amount of methanol consumed by reactors R1 and R2 in the second phase was 25.03 g and 24.07 g. This was calculated by the following equation:

[0524]

[0525] T 消耗的甲醇 = total methanol consumed (g)

[0526] m 开始 = 50% methanol container weight at the start of the phase (g)

[0527] m 结束 = 50% methanol container weight at the end of the feed (g)

[0528] p 50%甲醇 = 50% methanol density (g / mL)

[0529] p 甲醇 = 100% methanol density (g / mL)

[0530] C 甲醇–结束 = methanol concentration at the end of the feed (g / L)

[0531] V 反应器–结束 = reactor volume at the end of the feed (L)

[0532] Table 10: Bioreactor cultivation process data and specific productivity (q P ) of Example 8. The methanol concentration was adjusted by an additional 50% (v / v) methanol pulse 2.22 hours after the sampling, R1 = 5.6 mL, R2 = 2.3 mL.

[0533]

[0534] * represents control sample after methanol pulse.

[0535] Example 9: Culture strategy 2 - feeding strategy with separate glucose feed phase and methanol only feed phase.

[0536] The P. pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT strain was tested in a recombinant protein production scenario, where first a limited glucose feed was applied to increase biomass, followed by a separate phase with methanol pulses and feed to induce protein production.

[0537] a) The bioreactor cultivation was divided into three phases. (1) The first phase was started at an OD600 of 2 with a glucose feed of 2.4 g / L / h for 24 hours to increase biomass. 600 The batch phase on BSM medium consisted of. Inoculation was done as described in Example 7 a) b). The batch phase lasted for 19.68 and 19.50 hours for reactors R3 and R4, respectively. (2) The second phase was a 50% (w / w) glucose feed at 4.8 mL / h for 25 hours to increase biomass concentration. (3) The third phase started with a 50% (v / v) methanol pulse to reach a target concentration of 1.5% (v / v) and a methanol feed profile was calculated for 72.7 hours based on the predicted cell dry weight and specific methanol uptake rate as described in Example 8 c). The methanol concentration was measured daily online with HPLC to measure the exact concentration and additional compensation pulses were added if necessary as described in Example 6 d). During this phase the reactor stirrer speed was set to a constant 760 rpm and the aeration was set to 9.5 sL / h.

[0538] b) Process and productivity data can be found in Table 11. The maximum and minimum methanol concentration range during the whole cultivation was 4.3 g / L to 12.55 g / L. The overall average specific productivity was 32.9 pg g -1 h -1 . The methanol concentration at the end of the cultivation was 7.10 and 7.47 g / L for reactors R3 and R4, respectively. The amount of methanol consumed by reactors R3 and R4 during the third phase was 12.0 g and 12.6 g, respectively. This was calculated as in Example 8 e). Because the biomass was constant during the third phase, the methanol uptake rate (q 甲醇 ) during the third phase was calculated as in the following equation.

[0539]

[0540] T 消耗的甲醇 = total methanol consumed in the 3rd phase (mg)

[0541] X 生物质-平均 = average biomass in phase 3 (g)

[0542] t 第3阶段 = duration of phase 3 (h)

[0543] In the third phase, q 甲醇 is 3.79 mg g -1 h -1 and for reactor R4 it is 3.92 mg g - 1 h -1 .

[0544] c) The total biomass in table 11 is corrected for a sample of 12 mL and shows that the biomass did not increase. Overall, the total biomass in the third phase decreased by 4.5% and 3.4% for reactors R3 and R4. Surprisingly, the cultures produced the secreted recombinant protein. This shows that the P. pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT strain can efficiently produce the recombinant secreted protein even when only fed with methanol without apparent growth. The average total amount of protein produced in the third phase with methanol as the only carbon source was 105 mg.

[0545] T 生物质 = V 反应器 * CDW + ∑ (CDW 前一个 * V 样品 )

[0546] T 生物质 = total corrected biomass

[0547] CDW = cell dry weight

[0548] V 样品 = sample volume

[0549] Table 11: bioreactor cultivation process data and productivity (q P ) of example 9. The total biomass was corrected for a sample of 12 mL as in example 9 b).

[0550]

[0551]

[0552] * represents a control sample after a methanol pulse.

[0553] Example 10: Cultivation strategy 3 - feeding strategy with a glucose / methanol co-feeding phase and a separate methanol only feeding phase.

[0554] The P. pastoris Aaox1 Aaox2 pPM2 pN21_pAOX1_HSAopt_CycTT strain was tested in a recombinant protein production scenario, wherein after the batch phase, a limited glucose feed and additional methanol pulses and feed were applied to simultaneously achieve biomass increase and recombinant protein production. Upon reaching the desired biomass, the glucose feed was stopped, but the methanol feed was continued during the remaining cultivation.

[0555] a) This bioreactor cultivation was divided into three phases. (1) The first phase was the batch phase. For this, the reactor was inoculated with the production strain P. pastoris Aaox1 Aaox2 pPM2 pN21_pAOX1_HSAopt_CycTT at an initial OD 600 of 2. Inoculation was performed as described in Example 7 a) b). The batch phase lasted for 19.35 and 19.37 hours for reactor R1 and R2, respectively. The end of the batch phase was indicated by a dissolved oxygen peak. (2) At this point, the second phase started. The second phase consisted of a 50% (w / w) glucose feed at 4.8 mL / h for 25 hours. At the start of the second phase, a 50% (v / v) methanol pulse was applied to increase the methanol concentration to the target of 1.5% (v / v), and the subsequent methanol feed was started to compensate for methanol consumption, evaporation and dilution by the glucose feed. (3) The third phase consisted of a methanol feed only, lasting for 72.9 hours. During this phase, the reactor stirrer speed was set to a constant 760 rpm and the aeration was set to 9.5 sL / h. The methanol concentration was measured online with HPLC every day as described in Example 6 d). If necessary, additional compensation pulses were added.

[0556] b) The methanol feed as calculated per hour interval in Example 9 b) was:

[0557] c) Process and productivity data can be found in Table 12. The maximum and minimum methanol concentration during the whole cultivation for the two replicates ranged from 6.9 g / L to 11.4 g / L. The overall average specific productivity was 45.8 pg g -1 h -1 -1h-1. The overall specific productivity of the third phase was 34.0 pg g -1 h -1 -1h-1. The methanol concentration at the end of the cultivation for reactor R1 and R2 was 8.0 g / L. The amount of methanol consumed by reactor R1 and R2 during the third phase was 14.4 g and 14.1 g. This was calculated by the equation as shown in Example 9 b). Because the biomass was constant during the third phase, the methanol uptake rate (q 甲醇 ) of the third phase was calculated as shown in Example 9 b). The q 甲醇 of reactor R1 during the third phase was 4.61 mg g-1 h -1 , and for reactor R2 it was 4.54 mg g -1 h -1 Overall, in the third phase, the biomass decreased for reactors R1 and R2 by 5.7% and 5.5%, respectively. This again shows that production is possible with the P. pastoris Aaox1 Aaox2 strain without significant growth. The average total amount of recombinant protein produced in the third phase with methanol as the sole carbon source was 106 mg, which is similar to the 105 mg of recombinant protein produced in the third phase of Example 9. This is also illustrated by the similar specific production rates of 32.9 pg g -1 h -1 and 34.0 pg g - 1 h -1 in the third phase in this example. In summary, the production rate of the third phase (methanol only feeding phase) does not depend on whether the culture was induced in the second phase (glucose feeding phase). Since the recombinant protein production is independent of growth, the methanol only feeding strategy has several advantages when using the P. pastoris Aaox1 Aaox2 strain. In bioreactor cultures without a methanol only feeding phase as in Example 8, the process is limited by the maximum reactor volume and the yeast dry mass concentration. This limitation stops the cultivation process after a certain time by reaching the maximum volume or the maximum desired biomass concentration. By using a methanol feeding phase in combination with P. pastoris Aaox1 Aaox2 as in Example 9, the cultivation time is no longer limited by the biomass concentration or the volume, because the biomass does not increase and the volume increase is negligible. Therefore, a culture with high biomass concentration can be kept in the bioreactor for a longer period of time without reaching these limitations and allows a longer production phase, which increases the concentration of the protein of interest. The methanol only feeding phase also applies when using a slow methanol utilizing P. pastoris Aaox1 strain as shown in Example 12 below, but these advantages are not present, because P. pastoris Aaox1 grows continuously on methanol only and therefore exhibits the same limitations as discussed. Limiting P. pastoris Aaox1 to the same methanol feeding rate as P. pastoris Aaox1 Aaox2 results in a loss of production rate. Further process related improvements of the P. pastoris Aaox1 Aaox2 strain are discussed in Example 12.

[0558] Table 12: Bioreactor cultivation process data and specific production rates (q P ) of Example 10. Total biomass was corrected for 12 mL sampling as in Example 9 b).

[0559]

[0560]

[0561] * represents control samples after methanol pulse.

[0562] Example 11: Cultivation strategy 3 - Feeding strategy with glucose / methanol co-feeding phase and separate methanol feeding phase applied to P. pastoris Δaox1 Δaox2 secreting VHH.

[0563] To check the production of secreted recombinant proteins with another secreted protein, the bioreactor cultivation described in example 10a) was repeated with strain P. pastoris Δaox1 Δaox2 pPM2pZ30_pAOX1_αMF-vHH_CycTT.

[0564] a) As in example 10a), this bioreactor cultivation was divided into three phases. (1) The first phase was a batch phase. For this, the reactor was inoculated with the production strain P. pastoris Δaox1 Δaox2 pPM2pZ30_pAOX1_αMF-vHH_CycTT at an initial OD600 of 0.2, as described in example 7a) b). The batch phase lasted for 18.79 and 19.33 hours for reactors R1 and R2, respectively. The end of the batch phase was indicated by a peak in dissolved oxygen. (2) At this point, the second phase started. The second phase consisted of a 50% (w / w) glucose feed at 4.8 mL / h for 33.9 hours to increase the biomass, which was even higher than in example 10. At the start of the second phase, a 50% (v / v) methanol pulse was added to increase the methanol concentration to the target value of 1.5% (v / v) and the subsequent methanol feed was started to compensate for methanol consumption, evaporation and dilution by the glucose feed. (3) The third phase consisted of a methanol feed only for 63.9 hours. The stirrer speed was set to a constant 760 rpm and the aeration to 9.5 sL / h. The methanol concentration was measured online with HPLC every day as described in example 6d). Additional compensation pulses were added if necessary. 600 For 2, as described in example 7a) b). The batch phase lasted for 18.79 and 19.33 hours for reactors R1 and R2, respectively. The end of the batch phase was indicated by a peak in dissolved oxygen. (2) At this point, the second phase started. The second phase consisted of a 50% (w / w) glucose feed at 4.8 mL / h for 33.9 hours to increase the biomass, which was even higher than in example 10. At the start of the second phase, a 50% (v / v) methanol pulse was added to increase the methanol concentration to the target value of 1.5% (v / v) and the subsequent methanol feed was started to compensate for methanol consumption, evaporation and dilution by the glucose feed. (3) The third phase consisted of a methanol feed only for 63.9 hours. The stirrer speed was set to a constant 760 rpm and the aeration to 9.5 sL / h. The methanol concentration was measured online with HPLC every day as described in example 6d). Additional compensation pulses were added if necessary.

[0565] b) The methanol feed was calculated as described in example 9b):

[0566] Process and productivity data can be found in table 13. The maximum and minimum methanol concentration ranges over the whole cultivation process for the two replicates were 8.7 g / L (R1) to 11.3 g / L (R1). The overall average specific productivity was 118.0 pg g -1 h -1 and 88.2 pg g -1 h -1. For reactors R1 and R2, the methanol concentration at the end of the cultivation was 10.5 and 10.8 g / L. The amount of methanol consumed by reactors R1 and R2 was 26.6 g and 26.0 g. This was calculated by the following equation as shown in Example 8e). This amount is higher due to the higher biomass concentration than in Example 10, but still significantly (5-fold) lower than Mut S strains (as described in Example 12). Because the biomass in the third phase was constant, the methanol uptake rate (q 甲醇 ) in the third phase was calculated as shown in Example 9b). In the third phase, q 甲醇 for reactor R1 was 4.75 mg g -1 h -1 and for reactor R2 it was 4.68 mg g -1 h -1 .

[0567] c) Overall, as in the previous examples, the biomass decreased in the third phase for reactors R1 and R2 by 4.4% and 4.9%. The data in Table 13 clearly show that P. pastoris Δaox1 Δaox2 strains can produce secreted recombinant proteins even in amounts of gram per liter. The vHH concentration increased by 815.5 mg / L in the only methanol fed phase, which means that an average total of 323.1 mg of antibody fragment was produced using methanol as the sole carbon source.

[0568] Table 13: Bioreactor cultivation process data and productivity (qP) of Example 11. Total biomass was corrected for 12 mL sampling as in Example 9b).

[0569]

[0570] * represents control samples after methanol pulse.

[0571] Example 11.1: Process parameters obtained with P. pastoris Δaox1 Δaox2 (Mut-) strains compared to methanol utilizing slow P. pastoris Δaox1 (Mut S ) cultivated with established bioreactor cultivation protocols.

[0572] For comparison, P. pastoris Δaox1 pPM2 pN21_pAOX1_HSAopt_CycTT was cultivated with established cultivation protocols for Mut S phenotype (Potvin, Ahmad and Zhang, 2012).

[0573] a) The bioreactor cultivation was divided into four phases. (1) The first phase was a batch phase. For this, the reactors were inoculated with the production strain Pichia pastoris ΔaoxlpPM2pN21_pAOX1_HSAopt_CycTT, starting OD 600 was 2, as described in example 7a) b). The batch phase lasted for 20.17 and 20.30 hours for reactors R1 and R2, respectively. The end of the batch phase was indicated by a peak in dissolved oxygen. (2) The second phase was a linear increase (y = 0.225x + 1.95) of 60% glycerol feed for 8 hours. (3) The third phase was a co-feed phase with a linear increase (y = 3.75 - 0.111x) of 60% glycerol feed and a linear increase (y = 0.028x + 0.6) of 100% methanol feed for 18 hours. (4) The fourth phase was a methanol only feed phase with a linear increase (y = 0.028x + 1.10) of 100% methanol feed for 72 hours. The total run time was 119.25 hours.

[0574] b) The glycerol and methanol feeds were controlled gravimetrically by the DASGIP control software (Eppendorf AG, Germany) based on the equations in a).

[0575] c) Process and productivity data can be found in Table 13.1. The overall average specific productivity from the third to the fourth phase (production phase) was 61.7 pg g -1 h -1 The total amount of methanol consumed was 165.8 g over the entire cultivation period and 150.6 g in the fourth phase (methanol only feed phase). The residual methanol concentration in the cultivation broth was considered to be zero, as this was a methanol limited cultivation. The fourth phase in this example corresponds to the third phase in examples 9, 10 and 11. Based on the average biomass in the fourth phase, the methanol uptake rate (q 甲醇 ) was calculated as shown in example 9b). q 甲醇 was 37.1 mg g -1 h -1 for reactor R1 and 37.6 mg g -1 h -1 for reactor R2. q 甲醇 facilitated an unwanted biomass increase. At the end of the cultivation 53.2% (R1) and 52.4% (R2) of the total biomass was produced during the fourth phase growth on methanol.

[0576] d) A comparison of strain-dependent process parameters is depicted in the table of Table 13.2, and an overview of specific methanol uptake rates and feed rates from the presented examples can be found in Table 13.3. - For recombinant protein production, several key process parameters were significantly improved compared to the process using Pichia pastoris Δaox1. The heat of reaction was significantly reduced by >80%, resulting in a reduced cooling requirement. The specific oxygen uptake rate and oxygen transfer rate were reduced by >80%, resulting in reduced mixing and aeration requirements, lowering aeration flow rates and the need to supply pure oxygen to the bioreactor vessel. The lower specific methanol uptake rate reduced the amount of methanol required for cultivation. Methanol is toxic and flammable.

[0577] Mut - The use of the strain represents a technical and safety improvement because it reduces the amount of methanol that needs to be handled and stored in the production facility. Another advantage is that Pichia pastoris Δaox1Δaox2 is less sensitive to high concentrations of methanol. This is confirmed by the cell viability data of the strain Pichia pastoris Δaox1Δaox2 in Example 10 and the Pichia pastoris Δaox1 in this example. In Example 10, at the end of the process, the Mut - The cell viability was 99.8% and 99.7%. S The cell viability of the cells was 95.9% and 96.5%. The lower sensitivity and higher viability of the Pichia pastoris Δaox1Δaox2 strain have an impact on the purity of the recombinant secreted protein. Lysed cells release proteases that degrade the target protein and add unwanted soluble proteins to the supernatant, both of which lead to lower purity and loss of the target protein in the supernatant. In this example, the purity of Pichia pastoris Δaox1 was 72% and 77% for reactors R1 and R2. In comparison, the purity of Pichia pastoris Δaox1Δaox2 in Example 10 was 85% for both reactors R1 and R2.

[0578] Table 13.1: Bioreactor culture process data and specific productivity (q 产物 ).

[0579]

[0580]

[0581] Table 13.2: Comparison of overall key bioreactor cultivation parameters and key bioreactor cultivation parameters during the methanol-only feed phase for P. pastoris Aaox1 Aaox2 pPM2 pN21 pAOX1 HSAopt CycTT in Example 10 and P. pastoris Aaox1 pPM2 pN21 pAOX1 HSAopt CycTT in Example 11.1.

[0582]

[0583] Table 13.3: Specific methanol uptake rates and methanol feed rates based on average cell dry weight during the methanol-only feed phase. * q 甲醇 and the feed rate was considered equal.

[0584]

[0585] Example 12: Generation of methanol utilization negative and alcohol dehydrogenase deficient strains.

[0586] The P. pastoris Mut - Methanol consumption by the strains was unexpected and novel. Based on this knowledge, the hypothesis was formed that alcohol dehydrogenases can be responsible for this trait. To test the effect of alcohol dehydrogenases on methanol consumption in P. pastoris Aaox1 Aaox2, two potential alcohol dehydrogenases, ADH2: PP7435_Chr2-0821 and ADH900: PP7435_Chr2-0990, were selected for deletion. By exchanging the coding region of the genes with antibiotic resistance, three strains were generated: (1) ADH2 deficient strain, (2) ADH900 deficient strain, and (3) double deletion ADH2 and ADH900 strain. Effectively, the strains (1) P. pastoris Aaox1 Aaox2 adh2A::HphR, (2) P. pastoris Aaox1 Aaox2 Adh900A::KanMX, and (3) P. pastoris Aaox1 Aaox2 adh2A::HphRadh900A::KanMX were generated.

[0587] a) P. pastoris Aaoxl Aaox2 was made electrocompetent as described in example la). To generate the ADH2 deletion, the split-tagging method described in example lb) was used. The electrocompetent cells were transformed with 500 ng of Adh2 split-tag cassette 1 and 500 ng of Adh2 split-tag cassette 2 as described in example Id). The cassette sequences can be found in Table 14. Transformants were selected on YPD plates with 200 pg / mL hygromycin. One clone was selected based on PCR amplification and sequencing of the PCR amplicon. The ADH2 coding region was successfully replaced by the antibiotic marker was verified by PCR amplification with primers Adh2_KO_ctrl_fwd and Adh2_KO_ctrl_rev (Table 15) and sequencing of the PCR amplicon (Microsynth AG, Switzerland). The resulting strain was called (1) P. pastoris Aaoxl Aaox2 adh2A::HphR.

[0588] b) P. pastoris Aaoxl Aaox2 strain was made electrocompetent as described in example la). The electrocompetent cells were transformed with 500 ng of Adh900 split-tag cassette 1 and 500 ng of Adh900 split-tag cassette 2 as described in example Id). The cassette sequences can be found in Table 14. Transformants were selected on YPD plates with 500 pg / mL geneticin. One clone was selected based on PCR amplification and sequencing of the PCR amplicon. The ADH900 coding region was successfully replaced by the antibiotic marker was verified by PCR amplification with primers Adhl l_KO_Ctrl_fwd and Adhl l_KO_Ctrl_rev (Table 15) and sequencing of the PCR amplicon (Microsynth AG, Switzerland). The resulting strain was called (2) P. pastoris Aaoxl Aaox2 Adh900A::KanMX.

[0589] c) Pichia pastoris strain Aaox1 Aaox2 adh2A::HphR was made electrocompetent as described in example la) except that 200 pg / mL hygromycin was added to the main culture medium. The electrocompetent cells were transformed with 500 ng of Adh900 split tagging cassette 1 and 500 ng of Adh900 split tagging cassette 2 as described in example Id). The cassette sequences can be found in Table 14. Transformants were selected on YPD plates with 200 pg / mL hygromycin and 500 pg / mL geneticin. One clone was selected based on PCR amplification and sequencing of the PCR amplicon. The successful replacement of the ADH900 coding region by the antibiotic marker was verified by PCR amplification with primers Adhll_KO_Ctrl_fwd and Adhll_KO_Ctrl_rev (Table 15) and sequencing of the PCR amplicon (Microsynth AG, Switzerland). The resulting strain was called (3) Pichia pastoris Aaox1 Aaox2 Adh2A::HphR Adh900A::KanMX.

[0590] d) Pichia pastoris strain Aaox1 Aaox2 Adh2A::HphR was made electrocompetent as described in example la) except that 200 pg / mL hygromycin was added to the main culture medium. The electrocompetent cells were transformed with 500 ng of Adh900 split tagging cassette 1 and 500 ng of Adh900 split tagging cassette 2 as described in example Id). The cassette sequences can be found in Table 14. Transformants were selected on YPD plates with 200 pg / mL hygromycin and 500 pg / mL geneticin. One clone was selected based on PCR amplification and sequencing of the PCR amplicon. The successful replacement of the ADH900 coding region by the antibiotic marker was verified by PCR amplification with primers Adhll_KO_Ctrl_fwd and Adhll_KO_Ctrl_rev (Table 15) and sequencing of the PCR amplicon (Microsynth AG, Switzerland). The resulting strain was called (3) Pichia pastoris Aaox1 Aaox2 Adh2A::HphR Adh900A::KanMX. Genomic DNA for PCR amplification was isolated with the Genomic DNA Purification Kit (Promega, USA) following the manufacturer’s recommendations. PCR amplification reactions were done with Q5 polymerase (New England Biolabs, USA) following the manufacturer’s recommendations.

[0591] Table 14: Split tagging cassette DNA sequences used to generate Adh2 and Adh900 deletion strains.

[0592]

[0593]

[0594]

[0595]

[0596] Table 15: Polymerase chain reaction primers.

[0597] Primer name DNA sequence 5' to 3' Adh2_KO_ctrl_fwd GAATTGAGCCAAAAAAGGAGAGG (SEQ ID NO: 76) Adh2_KO_ctrl_rev GATGGAATAGGAGACTAGGTGTG (SEQ ID NO: 77) AdhII_KO_Ctrl_fwd TGGTTGAGACGTTTGTATTG (SEQ ID NO: 78) AdhII_KO_Ctrl_rev TGGGTTGGGAGTTTAGTG (SEQ ID NO: 79)

[0598] Example 13: Generation of Adh2 and Adh900 overexpressing methanol utilization negative strains.

[0599] For the purpose of checking the effect of ADH2 and ADH900 overexpression. Expression constructs were generated, which consist of the constitutive promoter P GAP: PP7425_Chr1 (596296...596790) and ADH2 or ADH900 coding sequences, respectively. The ADH2 and ADH900 coding sequences (Table 16) were modified to eliminate Bbsl and Bsal restriction sites in the coding sequence without affecting the amino acid sequence of the gene product. The resulting strains were named Pichia pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh2_CycTT and Pichia pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh900_CycTT.

[0600] a) For the purpose of using the Golden Gate assembly method, the restriction sites of the restriction enzymes Bbsl and Bsal (New England Biolabs, USA) need to be removed from the coding sequence without affecting the amino acid sequence of the gene product. This process is called curing. The coding sequence of ADH2 PP7435_Chr2-0821 was modified at c.45G>A and c.660C>G. The coding sequence of ADH900 PP7435_Chr2-0990 was modified at c.42C>G. The cured sequences for Golden Gate assembly can be found in Table 15. Note that the first 12 base pairs and the last 15 base pairs are not part of the coding sequence but are required for Golden Gate assembly.

[0601] b) The Golden Gate assembly as used here has been described (Prielhofer et al., 2017). (1) The expression construct BB3aZ_pGAP_Adh2_CycTT was assembled as follows. The Adh2_GG_cured DNA fragment (Table 15) was cloned into the BB1_23 backbone, resulting in BB1_23_Adh2. The expression construct was generated by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh2 (coding sequence), BB1_12_pGAP (promoter), BB1_34_ScCYC1tt (terminator). (2) The expression construct BB3aZ_pGAP_Adh900_CycTT was assembled as follows. The Adh900_GG_cured DNA fragment (Table 15) was cloned into the BB1_23 backbone, resulting in BB1_23_Adh900. The expression construct was generated by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh900 (coding sequence), BB1_12_pGAP (promoter), BB1_34_ScCYC1tt (terminator). The plasmids and sequences are available in the Golden PiCS kit #1000000133 (Addgene, USA).

[0602] Table 16: ADH2 and ADH900 native coding sequences and ADH2 eliminated coding sequence with c.45G>A and c.660C>G mutations and ADH900 eliminated coding sequence with c.42C>G mutation, which were used for Golden Gate assembly. The first 12 base pairs and the last 15 base pairs are not part of the coding sequence and were used for Golden Gate assembly.

[0603]

[0604]

[0605]

[0606] c) P. pastoris Aaoxl Aaox2 strains were made electrocompetent as described in Example la). BB3aZ_pGAP_Adh2_CycTT expression construct and BB3aZ_pGAP_Adh900_CycTT expression construct were linearized with AscI (New England Biolabs, USA) according to the manufacturer’s protocol and transformed into electrocompetent P. pastoris Aaoxl Aaox2 as described in Example la) and Id). Positive transformants were selected on YPD plates with 25 pg / mL of boleticin. Successful integration of the expression constructs was verified by PCR amplification with primer 109_BB3aZ_ctrl_fwd and pGAP_goi_rev_v2 (Table 17) with genomic DNA as template. The resulting strains were called P. pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh2_CycTT and P. pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh900_CycTT. Gel / PCR DNA fragment extraction kit (Süd-Laborbedarf GmbH, Germany). 500 ng of linearized plasmid were transformed into electrocompetent P. pastoris Aaoxl Aaox2 as described in previous Examples la) and Id). Positive transformants were selected on YPD plates with 25 pg / mL of boleticin. Successful integration of the expression constructs was verified by PCR amplification with primer 109_BB3aZ_ctrl_fwd and pGAP_goi_rev_v2 (Table 17) with genomic DNA as template. The resulting strains were called P. pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh2_CycTT and P. pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh900_CycTT.

[0607] d) The expression constructs were linearized with AscI (New England Biolabs, USA) according to the manufacturer’s protocol and transformed into electrocompetent P. pastoris Aaoxl Aaox2 as described in previous Examples la) and Id). Positive transformants were selected on YPD plates with 25 pg / mL of boleticin. Successful integration of the expression constructs was verified by PCR amplification with primer 109_BB3aZ_ctrl_fwd and pGAP_goi_rev_v2 (Table 17) with genomic DNA as template. The resulting strains were called P. pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh2_CycTT and P. pastoris Aaoxl Aaox2 BB3aZ_pGAP_Adh900_CycTT. Genomic DNA was isolated for PCR amplification with Genomic DNA Purification Kit (Promega, USA) according to the manufacturer’s recommendations. PCR amplification reactions were done with Q5 polymerase (New England Biolabs, USA) according to the manufacturer’s recommendations.

[0608] Table 17: Polymerase chain reaction primers.

[0609] Primer name DNA sequence 5' to 3' 109_BB3aN_ctrl_fwd TTGATCTTTTCTACGGGGTGG (SEQ ID NO: 84) pGAP_goi_rev_v2 GGTGTTTTGAAGTGGTACGG (SEQ ID NO: 85)

[0610] Example 14:Measurement of alcohol dehydrogenase activity in cell-free extracts of methanol utilizing negative alcohol dehydrogenase deficient strains.

[0611] To examine the successful deletion of alcohol dehydrogenase at the phenotypic level, alcohol dehydrogenase activity in cell-free extracts with ethanol as substrate was measured. Ethanol is generally considered the main substrate for Adh2.

[0612] a) Over-night cultivation in 2 mL YPD medium in 24-well plates sealed by air-permeable membranes at 25 °C and 280 rpm. The strains used were from Example 12a) Pichia pastoris Aaox1 Aaox2 Adh2A::HphR, Example 12b) Pichia pastoris Aaox1 Aaox2 Adh2A::HphR Adh900A::KanMX and Example 1e) Pichia pastoris Aaox1 Aaox2. As additional controls, Pichia pastoris X33 (Thermo Fisher Scientific, USA) and Pichia pastoris X33 AAdh2 (Nocon et al., 2014) were used.

[0613] b) Preparation of cell-free extracts by centrifugation (16.000 g, 5 min, 4 °C) of the over-night culture and resuspension in 1 mL phosphate buffered saline. After a second centrifugation step (16.000 g, 5 min, 4 °C), the cells were resuspended in 0.5 mL cell lysis buffer and glass-beat. Cultures were lysed in a Ribolyser (MP Biomedicals, Inc., USA) by bead-beating at 6 m / s for 3 x 20 seconds and cooling on ice for 1 minute between steps. After the lysis step, the culture was centrifuged (16.000 g, 5 min, 4 °C) and the supernatant was transferred to a fresh Eppendorf tube and centrifuged again (16.000 g, 30 min, 4 °C) to remove any carried cell debris. After the second centrifugation step, the supernatant was stored at -20 °C until use.

[0614] c) Each 50 mL cell lysis buffer consisted of 20 mM HEPES, 420 mM NaCl, 1.5 mM MgCl2, 10% glycerol, 1 SIGMAFAST TM Protease Inhibitor Cocktail (Sigma-Aldrich, LLC) was composed. Assay buffer consisted of 100 mM MOPS, 5 mM MgS04, 2 mM NAD + pH 8.9.

[0615] d) The Pierce TMBCA protein assay (Thermo Scientific, USA) was used to measure the protein concentration of the cell-free extracts according to the manufacturer's recommendations and adjusted to a common concentration of 3.8 mg / mL for all samples.

[0616] e) Alcohol dehydrogenase activity assay was performed in 96-well plates. The measurement was performed in a microplate reader (Tecan Group Ltd., Switzerland) by measuring the absorbance of NADH at 340 nm. The temperature was set at 42°C. To start the assay, 20 μL of cell-free extract was added to the assay buffer and equilibrated for 10 to 15 minutes, then 1 M ethanol was added as substrate. The total final volume was 300 μL. Activity was calculated in mU / mg from the maximum linear increase in absorbance after addition of the substrate ethanol. One activity unit corresponds to 1 μmol of consumed substrate (NAD + ) / minute. This is using the Lambert-Beer law and the coefficient ε NADH = 6220 M -1 cm -1 calculated from the absorbance data.

[0617] f) The results clearly show the effect of AHD gene deletion on alcohol dehydrogenase activity of the cell-free extracts (Table 18). By deletion of the ADH2 gene, a 94% reduction in activity was achieved. This was additionally confirmed by the P. pastoris X33 strain. By also deleting the second alcohol dehydrogenase gene ADH900, a 99% combined activity reduction was observed.

[0618] Table 18: Alcohol dehydrogenase activity of cell-free extracts on ethanol as substrate.

[0619]

[0620] Example 15: Measurement of methanol uptake rates of methanol utilization negative and alcohol dehydrogenase deficient strains.

[0621] To determine the methanol uptake rates, Mut - and alcohol dehydrogenase deficient strains were cultivated in bioreactors. The strains tested were P. pastoris Aaox1 Aaox2 Adh2A::HphR, P. pastoris Aaox1 Aaox2 Adh900A::KanMX and P. pastoris Aaox1 Aaox2 Adh2A::HphR Adh900A::KanMX. The cultures were grown until a certain biomass concentration. Then a methanol pulse was applied and the methanol concentration was measured immediately after the pulse and after approximately 20 hours. The experimental setup has been described in detail in Example 7. The goal was to determine the specific methanol uptake rate of the alcohol dehydrogenase deficient strains and to compare it to the methanol uptake rates measured in Example 7.

[0622] a) Reactors filled with 300 mL BSM medium were inoculated with 15 mL of Pichia pastoris Aaoxl Aaox2 adh2A::HphR (reactors aR2 and aR4) and Pichia pastoris Aaoxl Aaox2 adh900A::KanMX (reactors aRl and aR3). The target starting OD 600 was 2. At the end of the batch phase indicated by a dissolved oxygen spike, a 50% (w / w) glucose feed was started at 2.8 mL / h for 24 hours to increase biomass. Two hours after the start of the glucose feed, a 50% (v / v) methanol injection was given to increase the methanol concentration to 1.5% (measured concentrations were aRl = 1.64%, aR2 = 1.66%, aR3 = 1.59% and aR4 = 1.67%). This was done to induce methanol consumption. At the end of the glucose feed phase, samples were taken for cell dry weight and HPLC.

[0623] b) After the glucose feed phase, agitation and aeration were set to constant 750 rpm and 9.5 sL / h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and an HPLC sample was taken immediately (measured concentrations were aRl = 1.36%, aR2 = 1.44%, aR3 = 1.34% and aR4 = 1.45%). The concentrations were measured again after 18.4 hours and used to determine the specific methanol uptake rate (q 甲醇 ).

[0624] c) Separate bioreactor cultures were started to measure the uptake rate of the double ADH deletion strain Pichia pastoris Aaoxl Aaox2 adh2A::HphR adh900A::KanMX. The cultures were performed as explained in this example and example 7. Pichia pastoris Aaoxl Aaox2 Adh2A::HphR Adh900A::KanMX was inoculated into reactors cR3 and cR4. The target starting OD 600 was 2. At the end of the batch phase indicated by a dissolved oxygen spike, a 50% (w / w) glucose feed was started at 2.4 mL / h for 24 hours to increase biomass. Two hours after the start of the glucose feed, a 50% (v / v) methanol injection was given to increase the methanol concentration to 1.5% (measured concentrations were cR3 = 1.50% and cR4 = 1.47%). This was done to induce methanol consumption. At the end of the glucose feed phase, samples were taken for cell dry weight and HPLC.

[0625] d) After the glucose feed phase, agitation and aeration were set to constant 750 rpm and 9.5 sL / h. An additional 50% methanol pulse was added to increase the concentration to 1.5%, and an HPLC sample was taken immediately (measured concentrations were cR3 = 1.37% and cR4 = 1.49%). The concentrations were measured again after 19.5 hours and used to determine the specific methanol uptake rate (q 甲醇 ).

[0626] e) The specific methanol uptake rate was calculated as in example 7 d). A surprising and significant decrease in the methanol uptake rate was achieved by deletion of ADH2 (Table 19). The dc / dt of methanol was 0.07 to 0.06 g L -1 h -1 , which was only slightly higher than the evaporation observed in example 6. In contrast, the methanol uptake rate of the ADH900 deletion strain did not decrease and was in fact slightly higher than the measured uptake rate of P. pastoris Aaox1 Aaox2 in example 7. This difference can be attributed to the slightly different conditions between example 7 and this example, the difference being a slightly higher reactor volume and methanol concentration after the methanol pulse. The double ADH deletion strain did not show an observable decrease in the methanol uptake rate compared to the already low uptake rate of the ADH2 deletion strain. These results unexpectedly confirm that the ADH2 gene and its product enzyme Adh2 are mostly responsible for the observed characteristics for P. pastoris Aaox1 Aaox2 and that the observations in example 7 are not the result of spontaneous methanol oxidation or any other enzyme’s promiscuous activity.

[0627] Therefore, it was concluded that the gene and enzyme mostly responsible for methanol uptake in P. pastoris Aaox1 Aaox2 is the ADH2 gene and its product enzyme Adh2.

[0628] Table 19: Overview of the specific methanol uptake rate (q 甲醇 ) and apparent methanol loss (dc / dt) of the ADH deletion strains. * Methanol concentration was measured at 19.5 h.

[0629]

[0630]

[0631] Example 16: Measurement of the methanol uptake rate of the methanol utilization negative and alcohol dehydrogenase overexpression strains.

[0632] To confirm that Adh2 is the enzyme responsible for methanol consumption in P. pastoris Δaox1 Δaox2 and to investigate if it is possible to increase the methanol uptake rate with overexpression of the ADH2 or ADH900 gene, the specific methanol uptake rate of P. pastoris Δaox1 Δaox2 BB3aZ_pGAP_Adh2_CycTT and P. pastoris Δaox1 Δaox2 BB3aZ_pGAP_Adh900_CycTT strains was measured in bioreactor cultivations. The experiments were performed as described in examples 7 and 15.

[0633] a) Reactors filled with 300 mL BSM medium were inoculated with 15 mL P. pastoris Δaox1 Δaox2 BB3aZ_pGAP_Adh2_CycTT (reactors R1 and R3) and P. pastoris Δaox1 Δaox2 BB3aZ_pGAP_Adh900_CycTT (R2 and R4). The target starting OD 600 was 2. At the end of the batch phase indicated by a dissolved oxygen spike, a 50% (w / w) glucose feed was started at 2.8 mL / h for 24 hours to increase the biomass. Two hours after the start of the glucose feed, a 50% (v / v) methanol injection was given to increase the methanol concentration to 1.5% (measured concentrations were R1 = 1.56%, R2 = 1.53%, R3 = 1.52% and R4 = 1.54%). This was done to induce methanol consumption. At the end of the glucose feed phase, samples for cell dry weight and HPLC were taken.

[0634] b) After the glucose feed phase, the agitation and aeration was set to constant 750 rpm and 9.5 sL / h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and an HPLC sample was taken immediately (measured concentrations were R1 = 1.30%, R2 = 1.30%, R3 = 1.35% and R4 = 1.30%). The concentrations were measured again after 4.1, 20.1 hours and used to determine the specific methanol uptake rate (q 甲醇 ).

[0635] c) The additional sampling time point at 4.1 hours was chosen because a higher methanol uptake rate was expected. The average methanol uptake rate at 4.1 hours was 7.72 mg g -1 h -1 for the ADH2 overexpressing strain P. pastoris Δaox1 Δaox2 BB3aZ_pGAP_Adh2_CycTT and 5.61 mg g -1 h -1.20.1 hours, the average uptake rate decreased to 6.35 mg g -1 h -1 and to 5.16 mg g -1 h -1 for the ADH900 overexpressing strain (Table 20). As discussed previously in Example 15e), no significant difference from the parental P. pastoris Δaox1 Δaox2 could be observed upon deletion of the ADH900 gene, and the same was true for overexpression of the ADH900 gene. On the other hand, the ADH2 overexpressing strain had a 37% and 23% higher uptake rate at 4.1 and 21.7 hours compared to the ADH900 overexpressing strain. This further emphasizes the unexpected finding that Adh2 is the enzyme responsible for methanol consumption and that it is possible to increase methanol consumption in case of overexpression of the ADH2 gene.

[0636] Table 20: Summary of specific methanol uptake rates (q 甲醇 ) and apparent methanol loss (dc / dt) for ADH overexpressing strains.

[0637]

[0638] Example 17: Generation of strains with methanol inducible promoters for ADH2 overexpression.

[0639] For the purpose of investigating the impact of methanol inducible ADH2 overexpression, two overexpression constructs were generated, which consist of the methanol inducible promoters P AOX1 PP7435_chr4(237941...238898) and P FLD1 PP7435_Chr3(262922...263518) controlling the expression of the ADH2 coding sequence. The ADH2 coding sequence was modified to eliminate the Bbsl and Bsal restriction sites in the coding sequence without affecting the amino acid sequence of the gene product (Table 16). The generated strains were named P. pastoris Δaox1 Δaox2 BB3aZ_pAOX1_Adh2_CycTT and P. pastoris Δaox1 Δaox2 BB3aZ_pFLD1_Adh2_CycTT.

[0640] a) Generate expression constructs using Golden Gate assembly as described (Prielhofer et al., 2017). (1) Assemble the expression construct BB3aZ_pAOX1_Adh2_CycTT as follows. The Adh2_GG_deleted DNA fragment (Table 16) was cloned into the BB1_23 backbone to generate BB1_23_Adh2. Generate expression constructs by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh2 (coding sequence), BB1_12_pAOX1 (promoter), BB1_34_ScCYC1tt (terminator). (2) Generate expression construct BB3aZ_pFLD1_Adh2_CycTT by Golden Gate assembly of BB3aZ_14* (backbone), BB1_23_Adh2 (coding sequence), BB1_12_pFLD1 (promoter), BB1_34_ScCYC1tt (terminator). Plasmids and sequences are available in Golden PiCS kit #1000000133 (Addgene, USA).

[0641] b) The Pichia pastoris Δaox1Δaox2 strain was made electrocompetent as described in Example 1a). The BB3aZ_pAOX1_Adh2_CycTT expression construct and the BB3aZ_pFLD1_Adh2_CycTT expression construct were linearized with AscI (New England Biolabs, USA) according to the manufacturer's protocol and stained with Hi- The expression construct of the present invention is expressed as pichia pastoris Δaox1Δaox2.The expression construct of pichia pastoris Δaox1Δaox2 is expressed as pichia pastoris Δaox1Δaox2.The expression construct of pichia pastoris Δaox1Δaox2 is expressed as pichia pastoris Δaox1Δaox2.The expression construct of pichia pastoris Δaox1Δaox2 is expressed as pichia pastoris Δaox1Δaox2.

[0642] c) Use Genomic DNA for PCR amplification was isolated using a genomic DNA purification kit (Promega, USA) according to the manufacturer's recommendations. PCR amplification was performed using Q5 polymerase (New England Biolabs, USA) according to the manufacturer's recommendations.

[0643] Example 18: Measurement of specific methanol uptake rate of methanol utilizing negative strains with methanol inducible promoter for AHD2 overexpression.

[0644] To investigate the influence of ADH2 overexpression with a methanol inducible promoter on the specific methanol uptake rate, bioreactor cultivations were set up as described in Example 7 and Example 16. For this purpose, the strains Pichia pastoris Aaox1 Aaox2 BB3aZ_pAOX1_Adh2_CycTT and Pichia pastoris Aaox1 Aaox2 BB3aZ_pFLD1_Adh2_CycTT produced in Example 17 were used.

[0645] a) Reactors filled with 300 mL BSM medium were inoculated with 15 mL Pichia pastoris Aaox1 Aaox2 BB3aZ_pAOX1_Adh2_CycTT (reactors R1 and R2) and Pichia pastoris Aaox1 Aaox2 BB3aZ_pFLD1_Adh2_CycTT (R3 and R4). The target starting OD 600 was 2. At the end of the batch phase indicated by a dissolved oxygen spike, a 50% (w / w) glucose feed was started at 2.8 mL / h for 24 hours to increase biomass. Two hours after the start of the glucose feed, a 50% (v / v) methanol injection was given to increase the methanol concentration to 1.5% (measured concentrations were R1 = 1.57%, R2 = 1.57%, R3 = 1.57% and R4 = 1.70%). This was done to induce methanol consumption and the methanol inducible promoter. At the end of the glucose feed phase, samples for cell dry weight and HPLC were taken.

[0646] b) After the glucose feed phase, agitation and aeration were set to constant 750 rpm and 9.5 sL / h. An additional 50% methanol pulse was added to increase the concentration to 1.5% and an HPLC sample was taken immediately (measured concentrations were R1 = 1.42%, R2 = 1.39%, R3 = 1.39% and R4 = 1.42%). The concentration was measured again after 4.2 hours and used to determine the specific methanol uptake rate (q 甲醇 ) for the first time. After the initial pulse was almost consumed, a second methanol pulse was applied and an HPLC sample was taken immediately (measured concentrations were R1 = 1.61%, R2 = 1.65%, R3 = 1.50% and R4 = 1.47%). The concentration was measured again after 6.2 hours and used to determine the specific methanol uptake rate (q 甲醇 ) for the second time.

[0647] c) The specific methanol uptake rate (q 甲醇). The time between the first pulse and the sampling time point was 4.2 hours. The time between the second methanol pulse and the sampling point was 6.2 hours. The average methanol uptake rate after 4.2 hours from the first pulse was 8.3 mg g FLD1 The ADH2 overexpressing strain Pichia pastoris Aaox1 Aaox2 BB3aZ_pFLD1_Adh2_CycTT was 8.3 mg g -1 h -1 and for P AOX1 The ADH2 overexpressing strain Pichia pastoris Aaox1 Aaox2 BB3aZ_pAOX1_Adh2_CycTT was 11.6 mg g -1 h -1 (Table 21). 6.2 hours after the second methanol pulse, the average uptake rate was 10.1 mg g FLD1 The ADH2 overexpressing strain Pichia pastoris Aaox1 Aaox2 BB3aZ_pFLD1_Adh2_CycTT was 8.3 mg g -1 h -1 and for P AOX1 The ADH2 overexpressing strain Pichia pastoris Aaox1 Aaox2 BB3aZ_pAOX1_Adh2_CycTT was 11.6 mg g -1 h -1 (Table 22). This data shows that longer methanol induction times result in increased Adh2 expression and specific methanol uptake rates when using a methanol inducible promoter. Thus, the strains can maintain and even increase specific methanol uptake rates over time in media with methanol as the sole energy and carbon source. The specific methanol uptake rate was on average 1.6 fold higher for Pichia pastoris Aaox1 Aaox2 BB3aZ_pFLD1_Adh2_CycTT and 2.3 fold higher for Pichia pastoris Aaox1 Aaox2 BB3aZ_pAOX1_Adh2_CycTT compared to the Pichia pastoris Aaox1 Aaox2 pPM2pN21_pAOX1_HSAopt_CycTT strain described in Example 7.

[0648] Table 21: Overview of specific methanol uptake rates (q 甲醇 ) in case of methanol inducible ADH2 overexpression after the first methanol pulse.

[0649]

[0650] Table 22: Overview of specific methanol uptake rates (q 甲醇 ) in case of methanol inducible ADH2 overexpression after the second methanol pulse.

[0651]

[0652] Example 19: Generation of ADH2 overexpressing strains producing secreted recombinant proteins.

[0653] To investigate whether ADH2 overexpression and the consequent increase in specific methanol uptake rate has an impact on recombinant protein production, P. pastoris Aaox1 Aaox2 producing HSA and vHH from Example 3 were transformed with the ADH2 overexpression constructs and subjected to small scale screening with the adapted protocol described in Example 4. AOX1 ADH2 and P FLD1 ADH2 overexpression constructs were transformed and subjected to small scale screening with the adapted protocol described in Example 4.

[0654] a) Overexpression constructs were done using Golden Gate assembly as already described (Prielhofer et al., 2017). (1) Expression construct BB3aK_pAOX1_Adh2_CycTT was created by Golden Gate assembly of BB3aK_14* (backbone), BB1_23_Adh2 (coding sequence) from Example 17, BB1_12_pAOX1 (promoter), BB1_34_ScCYC1tt (terminator). (2) Expression construct BB3aK_pFLD1_Adh2_CycTT was created by Golden Gate assembly of BB3aK_14* (backbone), BB1_23_Adh2 (coding sequence) from Example 17, BB1_12_pFLD1 (promoter), BB1_34_ScCYC1tt (terminator). Plasmids and sequences are available in Golden PiCS kit #1000000133 (Addgene, USA).

[0655] b) P. pastoris Aaox1 Aaox2 pPM2pN21_pAOX1_HSAopt_CycTT and P. pastoris Aaox1 Aaox2 pPM2pZ30_pAOX1_aMF-vHH_CycTT strains were made electrocompetent as described in Example 1 a). BB3aK_pAOX1_Adh2_CycTT expression construct and BB3aK_pFLD1_Adh2_CycTT expression construct were linearized with AscI (New England Biolabs, USA) following the manufacturer’s protocol and transformed into the electrocompetent strains using the Biorad Gene Pulser Xcell (Biorad, USA) according to the manufacturer’s protocol. Transformants were selected on YPD plates containing 100 pg / mL Zeocin (InvivoGen, USA) and 1 g / L Geneticin (InvivoGen, USA). Gel / PCR DNA fragment extraction kit (Süd-Laborbedarf GmbH, Germany) was used for purification. 500 ng of linearized plasmid were transformed into electrocompetent Pichia pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT and Pichia pastoris Δaox1 Δaox2 pPM2 pZ30_pAOX1_αMF-vHH_CycTT as described in previous examples 1 a) and 1 d). Positive transformants were selected on YPD plates with 500 μg / mL geneticin and 25 μg / mL boleticin for Pichia pastoris Δaox1 Δaox2 pPM2 pZ30_pAOX1_αMF-vHH_CycTT_BB3aK_pAOX1_Adh2_CycTT and Pichia pastoris Δaox1 Δaox2 pPM2 pZ30_pAOX1_αMF-vHH_CycTT_BB3aK_pFLD1_Adh2_CycTT transformants. Pichia pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT_BB3aK_pAOX1_Adh2_CycTT and Pichia pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT_BB3aK_pFLD1_Adh2_CycTT transformants were selected on YPD plates with 500 μg / mL geneticin and 100 μg / L nourseothricin. Several clones were selected for each transformation for further screening (Example 20). The strains generated were named: Pichia pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT_BB3aK_pAOX1_Adh2_CycTT AOX1 HSA P AOX1 ADH2, Pichia pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT_BB3aK_pFLD1_Adh2_CycTT AOX1 HSA P FLD1 ADH2, Pichia pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT_BB3aK_pFLD1_Adh2_CycTT AOX1 vHH P AOX1 ADH2 and Pichia pastoris Δaox1 Δaox2 pPM2 pN21_pAOX1_HSAopt_CycTT_BB3aK_pFLD1_Adh2_CycTT AOX1 vHH P FLD1 ADH2.

[0656] Example 20: Small scale screening to generate ADH2 overexpressing strains secreting recombinant proteins.

[0657] Several clones from the transformants described in Example 19 were tested in a small scale screening to investigate the effect of ADH2 overexpression on the production of recombinant proteins. The screening procedure was adapted from the two-shot- expansion protocol and the standard protocol described in Example 4.

[0658] a) for Pichia pastoris Δaox1 Δaox2 P AOX1 HSAP AOX1 ADH2 and Pichia pastoris Δaox1 Δaox2 P AOX1 HSA P FLD1 ADH2 pre-cultures, clones were inoculated in 2 mL YPD with 500 pg / mL geneticin and 100 pg / mL nourseothricin, Pichia pastoris Δaox1 Δaox2 P AOX1 vHH P AOX1 ADH2 and Pichia pastoris Δaox1 Δaox2 P AOX1 vHH P FLD1 ADH2 clones were inoculated on 500 pg / mL geneticin and 25 pg / mL boleticin. Based on the antibiotic resistance used for selection, the parental strain was inoculated in two replicates on YPD with 100 pg / mL nourseothricin or 25 pg / mL boleticin. For each expression construct, eleven clones were picked for screening. Pre-cultures and screening cultures were cultivated in 24-well plates sealed with air-permeable membranes and incubated at 25 °C with 280 rpm. Screening cultures were inoculated into 2 mL minimal medium (ASMv6) with the polysaccharide solution-based and enzyme- based slow glucose release system EnPump 200 (Enpresso GmbH, Germany) to keep the cultures within the glucose limit with a starting optical density (OD 600 ) of 8 into 2 mL minimal medium (ASMv6) with the polysaccharide solution-based and enzyme-based slow glucose release system EnPump 200 (Enpresso GmbH, Germany) to keep the cultures within the glucose limit. The strains were compared to two different methanol feeding procedures differing in the total amount of methanol received and the incubation time (Table 23).

[0659] b) After the incubation period, 1 mL of each culture was taken and centrifuged in pre- weighed Eppendorf tubes. The supernatant was removed and the protein concentration was measured with a Caliper LabChip GXII Touch (PerkinElmer, USA) following the manufacturer’s instructions. The wet cell weight was determined by weighing the Eppendorf tube with the cell pellet and calculated as follows: weight (full) - weight (empty) = wet cell weight (WCW) (g / L). From this data the yield was calculated: yield (pg / g) = protein concentration / wet cell weight.

[0660] Table 23: Overview of the screening strategy for testing the secreted protein production yield of the transformed strains in Example 20. *The first injection was 0.5% (v / v) methanol.

[0661]

[0662] c) The results are summarized in Table 24. Surprisingly, when compared to the parental Mut -Overexpression resulted in up to 1.7-fold increase in protein yield (pg / g) for vHH and 2.3-fold increase for HSA compared to the parent strain. Indeed, it was demonstrated that overexpression of ADH2 improves recombinant protein production by P. pastoris Aaox1 Aaox2.

[0663] d) Selecting the average performing strain for bioreactor cultivation. Successful integration of the expression construct was verified by PCR amplification with primers 109_BB3aN_ctrl_fwd and pGAP_goi_rev_v2 (Table 17) with genomic DNA as template. The production strain was used as control. Genomic DNA for PCR amplification was isolated with the Genomic DNA Purification Kit (Promega, USA) according to the manufacturer's recommendations. The Q5 polymerase (New England Biolabs, USA) was used for the PCR amplification reactions according to the manufacturer's recommendations.

[0664] PCR amplification reactions were done according to the manufacturer's recommendations.

[0665] Table 24: Average secreted product yield in pg product / g WCW with standard deviation under different screening conditions. *t-test, statistically significant difference (p<0.05) to the parent strain.

[0666]

[0667] Example 21: Methanol utilization negative strains with ADH2 overexpression producing HSA as model protein. Cultivation with strategy 3 - feeding strategy with a glucose / methanol co-feeding phase and separate methanol-only feeding phase.

[0668] Bioreactor cultivations were performed to evaluate the recombinant protein production capacity of the methanol utilization negative ADH2 overexpression strains produced in Example 19 and selected in Example 20. For this purpose, P. pastoris Aaox1 Aaox2 pPM2 pN21_pAOX1_HSAopt_CycTT BB3aK_pAOX1_Adh2_CycTT (Aaox1 Aaox2 P AOX1 HSA P AOX1 ADH2) and P. pastoris Aaox1 Aaox2 pPM2 pN21_pAOX1_HSAopt_CycTT BB3aK_pFLD1_Adh2_CycTT (Aaox1 Aaox2 P AOX1 HSA P FLD1 ADH2) strains.

[0669] a) This bioreactor cultivation was divided into three phases. (1) The first phase was a batch phase. The production strains were cultivated in a 2 L bioreactor with a starting OD of 0.1 in 500 mL of BMMY medium at 28°C and 800 rpm agitation. The pH was not controlled. The medium was sparged with air at 1 vvm. The cultivation was started with 0.5% (v / v) methanol and 0.5% (w / v) glucose. After 24 h, the glucose was removed from the medium. The methanol feed was started at 0.1% (v / v) and increased to 0.5% (v / v) after 48 h.600 The reactors were inoculated. Inoculation was performed as described in Example 7a) b). The end of the batch phase was indicated by a dissolved oxygen spike. (2) At this point, the second phase began. The second phase consisted of a 50% (w / w) glucose feed at 4.8 mL / h for 25 hours. At the start of the second phase, a 50% (v / v) methanol pulse was applied to increase the methanol concentration to a target of 1.5% (v / v), and subsequent methanol feeds were started to offset methanol consumption, evaporation, and dilution by the glucose feed. (3) The third phase consisted of a methanol-only feed for 19.6 (R1, R2) and 21.6 (R5, R6) hours. The methanol concentration was measured online by HPLC as described in Example 6d). Additional compensation pulses were added if necessary. The methanol feed was calculated at hourly intervals as in Examples 8 and 9b). The strains used in each of reactors R1, R2, R5, and R6 are identified in Table 25.

[0670] b) Process and productivity data can be found in Tables 26 and 27. The maximum and minimum methanol concentrations during the entire cultivation process for reactors R1, R2, R5, and R6 ranged from 8.0 g / L to 13.6 g / L. Reactors R1, R2, R5, and R6 produced HSA as a model protein. Compared to Example 10, the specific productivity (q P ) shows that in P AOX1 or P FLD1 The positive effect of ADH2 overexpression under the condition of q was calculated for the time points 45.02 to 69.58 hours in Example 10. P The weighted average of the values ​​of Example 10 from time point 45.02 to 69.58 h is used to make comparison easier. P The average was 40.9 μg g - 1 h -1 In this embodiment, P AOX1 The q of ADH2 overexpression reactors (R1, R2) from time point 49.1 to 68.7 hours P The average was 84.3 μg g -1 h -1 This is a 2-fold increase compared to Example 10 (Table 28). FLD1 ADH2 overexpression (R5, R6) showed an average q P 71 μg g -1 h -1 This represents a 1.7-fold increase in q P Increase (Table 29). The volumetric productivity at time point 68.7 hours is AOX1ADH2 overexpression increased 1.21 fold (Table 30) and for P FLD1 ADH2 overexpression increased 1.13 (Table 31). The increased q P and volumetric productivity demonstrate the benefit of ADH2 overexpression in the P. pastoris Δaoxl Δaox2 strain on recombinant protein production.

[0671] Table 25: Summary of strains used in Example 21 and Example 22.

[0672]

[0673]

[0674] Table 26: Bioreactor run data from Example 21 and P AOX1 ADH2 overexpression. q P ) for HSA. * represents control samples after methanol pulse.

[0675]

[0676] Table 27: Bioreactor run data from Example 21 and P FLD1 ADH2 overexpression. q P ) for HSA. * represents control samples after methanol pulse.

[0677]

[0678] Table 28: Comparison of q P ) for HSA from methanol utilization negative strains from Example 10 to P AOX1 ADH2 overexpression strains from Example 21, Phase 3.

[0679]

[0680] Table 29: Comparison of q P ) for HSA from methanol utilization negative strains from Example 10 to P FLD1 ADH2 overexpression strains from Example 21, Phase 3.

[0681]

[0682] Table 30: Comparison of volumetric productivity for HSA from methanol utilization negative strains from Example 10 to P AOX1 ADH2 overexpression strains from Example 21. * correction for biomass volume (C cP ), CcP = C p *(1 - C x * F c ), F c = 0.0033.

[0683]

[0684]

[0685] Table 31: Volume productivity of HSA producing methanol utilizing negative strains from Example 10 compared to P FLD1 ADH2 overexpressing strains. *Correction for biomass volume (C cP ), C cP = C p *(1 - C x * F c ), F c = 0.0033.

[0686]

[0687] Example 22: Methanol utilizing negative strains with ADH2 overexpression producing vHH as model protein. Cultivation with strategy 3 - feeding strategy with glucose / methanol co-feeding phase and separate methanol only feeding phase.

[0688] Bioreactor cultivations were performed to evaluate the recombinant protein production capacity of the methanol utilizing negative ADH2 overexpressing strains produced in Example 19 and selected in Example 20. For this purpose, Pichia pastoris AaoxlAaox2 pPM2 pZ30_pAOX1_vHH_CycTT BB3aK_pFLD1_Adh2_CycTT (AaoxlAaox2 P AOX1 vHH P AOX1 ADH2) and Pichia pastoris AaoxlAaox2 pPM2 pZ30_pAOX1_vHH_CycTT BB3aK_pFLD1_Adh2_CycTT (AaoxlAaox2 P AOX1 vHH P FLD1 ADH2) strains were cultivated with strategy 3 as described in Example 10 and Example 11.

[0689] a) This bioreactor cultivation was divided into three phases. (1) The first phase was a batch phase. The production strains were inoculated with a starting OD 600Inoculation of reactors. Inoculation was performed as described in Example 7 a) b). The end of the batch phase was indicated by a dissolved oxygen spike. (2) At this point, the second phase started. The second phase consisted of a 50% (w / w) glucose feed at 4.8 mL / h for 25 hours. At the start of the second phase, a 50% (v / v) methanol pulse was applied to increase the methanol concentration to the target of 1.5% (v / v) and subsequent methanol feeding was started to compensate for methanol consumption, evaporation and dilution by the glucose feed. (3) The third phase consisted of methanol feeding only for 43.6 (R3, R4) and 44.6 (R7, R8) hours. Methanol concentration was measured online with HPLC as described in Example 6 d). If necessary, additional compensation pulses were added. Methanol feeding was calculated in hourly intervals as in Example 8 and 9 b). The strains used in each reactor R3, R4, R7 and R8 can be found in Table 25.

[0690] b) Process and productivity data can be found in Table 32 and Table 33. The range of maximum and minimum methanol concentrations during the entire cultivation process of reactors R3, R4, R7 and R8 was 8.6 g / L to 14.4 g / L. Reactors R3, R4 and R7, R8 produced vHH as model protein. Compared to Example 11, ADH2 overexpression had a positive effect on specific productivity (q P ). For easier comparison, the weighted average of q P of the second phase (time points 20.0 to 53.6 hours) of Example 11 was calculated. The comparison shows a 1.71-fold increase for q P of the second phase for P AOX1 ADH2 overexpression (R3, R4) and a 1.78-fold increase for P FLD1 ADH2 overexpression (R7, R8) (Table 34, Table 35). The improvement was even greater at later time points of the third phase. At time points 92.7 and 91.7, q P increased by 3.76-fold (P AOX1 ADH2 overexpression) and 3.86-fold (P FLD1 ADH2 overexpression) (Table 34, Table 35). In addition, in both cases, the volumetric productivity was increased by at least 1.9-fold compared to the parent strain in Example 11 (Table 35, Table 36). The increased q P and volumetric productivity in this example demonstrate the benefit of ADH2 overexpression in Pichia pastoris Δaoxl Δaox2 strains for the production of recombinant proteins.

[0691] Table 32: Bioreactor cultivation process data from Example 22 and specific productivity (q AOX1 ) of vHH with P P ADH2 overexpression. * represents a control sample after a methanol pulse.

[0692]

[0693] Table 33: Bioreactor culture process data and P FLD1 ADH2 overexpressing vHH specific productivity (q P ). * represents control sample after methanol pulse.

[0694]

[0695]

[0696] Table 34: vHH producing methanol utilizing negative strains from Example 11 specific productivity (q P ) compared to P AOX1 ADH2 overexpressing strains from Example 22.

[0697]

[0698] Table 35: vHH producing methanol utilizing negative strains from Example 11 specific productivity (q P ) compared to P FLD1 ADH2 overexpressing strains from Example 22.

[0699]

[0700]

[0701] Table 36: vHH producing methanol utilizing negative strains from Example 11 volumetric productivity compared to P AOX1 ADH2 overexpressing strains from Example 22. * Recombinant concentration (C cP ) corrected for biomass volume (C cP = C p *(1-C x *F c ), F c = 0.0033.

[0702]

[0703] Table 37: vHH producing methanol utilizing negative strains from Example 11 volumetric productivity compared to P FLD1 ADH2 overexpressing strains from Example 22. * Recombinant concentration (C cP ) corrected for biomass volume (C cP = C p *(1-C x *Fc ), F c =0.0033.

[0704]

[0705] Table 38: Methanol-inducible promoters and their corresponding chromosomal locations in strain Pichia pastoris CBS7435 (Gasser, Steiger and Mattanovich, 2015)

[0706]

[0707]

[0708]

[0709]

[0710]

[0711]

[0712]

[0713]

[0714]

[0715] References:

[0716] Ata, Prielhofer, R., Gasser, B., Mattanovich, D., & P.(2017).Transcriptional engineering of the glycera1dehyde-3-phosphate dehydrogenasepromoter for improved heterologous protein production in Pichia pastoris: Transcriptional Engineering of the PGAP for Gene Overexpression in P.pastoris.Biotechnology and Bioengineering, 114(10), 2319-2327. https: / / doi.org / 10.1002 / bit.26363

[0717] Aw, R., & Polizzi, K. M. (2013). Can too many copies spoil the broth? Microbial Cell Factories, 12, 128. https: / / doi.org / 10.1186 / 1475-2859-12-128

[0718] Blumhoff, M., Steiger, M. G., Marx, H., Mattanovich, D., & Sauer, M. (2013). Six novel constitutive promoters for metabolic engineering of Aspergillus niger. Applied Microbiology and Biotechnology, 97(1), 259-267. https: / / doi.org / 10.1007 / s00253-012-4207-9

[0719] Gasser, B., Prielhofer, R., Marx, H., Maurer, M., Nocon, J., Steiger, M.,... Mattanovich, D. (2013). Pichia pastoris: protein production host and model organism for biomedical research. Future Microbiology, 8(2), 191-208. https: / / doi.org / 10.2217 / fmb.12.133

[0720] Gasser, B., Steiger, M. G., & Mattanovich, D. (2015). Methanol regulated yeast promoters: production vehicles and toolbox for synthetic biology. Microbial Cell Factories, 14(1). https: / / doi.org / 10.1186 / s12934-015-0387-1

[0721] Hohenblum, H., Borth, N., & Mattanovich, D. (2003). Assessing viability and cell-associated product of recombinant protein producing Pichia pastoris with flow cytometry. Journal of Biotechnology, 102(3), 281-290. https: / / doi.org / 10.1016 / S0168-1656(03)00049-X

[0722] Looser, V., Bruhlmann, B., Bumbak, F., Stenger, C., Costa, M., Camattari, A.,... Kovar, K. (2015). Cultivation strategies to enhance productivity of Pichia pastoris: A review. Biotechnology Advances, 33(6), 1177-1193. https: / / doi.org / 10.1016 / jj.biotechadv.2015.05.008

[0723] Marx, H., Mattanovich, D., & Sauer, M. (2008). Overexpression of the riboflavin biosynthetic pathway in Pichia pastoris. Microbial Cell Factories, 7(1), 23. https: / / doi.org / 10.1186 / 1475-2859-7-23

[0724] Mellitzer, A., Ruth, C, Gustafsson, C, Welch, M., Bimer-Grϋnberger, R., Weis, R.,... Glieder, A. (2014). Synergistic modular promoter and gene optimization to push cellulase secretion by Pichia pastoris beyond existing benchmarks. Journal of Biotechnology, 191, 187-195. https: / / doi.org / 10.1016 / j.jbiotec.2014.08.035

[0725] Nocon, J., Steiger, M.G., Pfeffer, M., Sohn, S.B., Kim, T.Y., Maurer, M.,... Mattanovich, D. (2014). Model based engineering of Pichia pastoris central metabolism enhances recombinant protein production. Metabolic Engineering, 24, 129-138. https: / / doi.org / 10.1016 / j.ymben.2014.05.011

[0726] Prielhofer, R., Barrero, J.J., Steuer, S., Gassler, T., Zahrl, R., Baumann, K.,... Marx, H. (2017). GoldenPiCS: a Golden Gate-derived modular cloning system for applied synthetic biology in the yeast Pichia pastoris. BMC Systems Biology, 11(1). https: / / doi.org / 10.1186 / s12918-017-0492-3

[0727] Prielhofer, R., Maurer, M., Klein, J., Wenger, J., Kiziak, C., Gasser, B., & Mattanovich, D. (2013). Induction without methanol: novel regulated promoters enable high-level expression in Pichia pastoris. Microbial Cell Factories, 12(1), 5. https: / / doi.org / 10.1186 / 1475-2859-12-5

[0728] Schwarzhans, J.-P., Wibberg, D., Winkler, A., Luttermann, T., Kalinowski, J., & Friehs, K. (2016). Integration event induced changes in recombinant protein productivity in Pichia pastoris discovered by whole genome sequencing and derived vector optimization. Microbial Cell Factories, 15, 84. https: / / doi.org / 10.1186 / s12934-016-0486-7

[0729] Stadlmayr, G., A., Rothmuller, M., Maurer, M., Sauer, M., Mattanovich, D., & Gasser, B. (2010). Identification and characterisation of novel Pichia pastoris promoters for heterologous protein production. Journal of Biotechnology, 150(4), 519-529. https: / / doi.org / 10.1016 / j.jbiotec.2010.09.957 SEQUENCE LISTING <110> University of Natural Resources and Life Sciences, Vienna <120> MUT-methanol auxotrophic yeast <130> LO009P3 <150> PCT / EP2019 / 058190 <151> 2019-04-01 <150> PCT / EP2019 / 058191 <151> 2019-04-01 <160> 85 <170> PatentIn version �.5 <210> 1 <211> 663 <212> PRT <213> Komagataella phaffii <400> 1 Met Ala Ile Pro Glu Glu Phe Asp Ile Leu Val Leu Gly Gly Gly Ser 1 5 10 15 Ser Gly Ser Cys Ile Ala Gly Arg Leu Ala Asn Leu Asp His Ser Leu 20 25 30 Lys Val Gly Leu Ile Glu Ala Gly Glu Asn Asn Leu Asn Asn Pro Trp 35 40 45 Val Tyr Leu Pro Gly Ile Tyr Pro Arg Asn Met Lys Leu Asp Ser Lys 50 55 60 Thr Ala Ser Phe Tyr Thr Ser Asn Pro Ser Pro His Leu Asn Gly Arg 65 70 75 80 Arg Ala Ile Val Pro Cys Ala Asn Ile Leu Gly Gly Gly Ser Ser Ile 85 90 95 Asn Phe Met Met Tyr Thr Arg Gly Ser Ala Ser Asp Tyr Asp Asp Phe 100 105 110 It should be noted that there may be some inaccuracies in the above translation, especially in the chemical name "法夫驹形氏酵母" which is translated as "Komagataella phaffii" based on common usage in the field. For more accurate translation, it is recommended to refer to more specific professional materials. Glu Ala Glu Gly Trp Lys Thr Lys Asp Leu Leu Pro Leu Met Lys Lys 115 120 125 Thr Glu Thr Tyr Gln Arg Ala Cys Asn Asn Pro Glu Ile His Gly Phe 130 135 140 Glu Gly Pro Ile Lys Val Ser Phe Gly Asn Tyr Thr Tyr Pro Val Cys 145 150 155 160 Gln Asp Phe Leu Arg Ala Thr Glu Ser Gln Gly Ile Pro Tyr Val Asp 165 170 175 Asp Leu Glu Asp Leu Val Thr Ala His Gly Ala Glu His Trp Leu Lys 180 185 190 Trp Ile Asn Arg Asp Thr Gly Arg Arg Ser Asp Ser Ala His Ala Phe 195 200 205 Val His Ser Thr Met Arg Asn His Asp Asn Leu Tyr Leu Ile Cys Asn 210 215 220 Thr Lys Val Asp Lys Ile Ile Val Glu Asp Gly Arg Ala Ala Ala Val 225 230 235 240 Arg Thr Val Pro Ser Lys Pro Leu Asn Ala Lys Lys Pro Thr His Lys 245 250 255 Val Tyr Arg Ala Arg Lys Gln Ile Val Leu Ser Cys Gly Thr Ile Ser 260 265 270 Ser Pro Leu Val Leu Gin Arg Ser Gly Phe Gly Asp Pro lie Lys Leu 275 280 285 Arg Ala Ala Gly Val Lys Pro Leu Val Asn Leu Pro Gly Val Gly Arg 290 295 300 Asn Phe Gin Asp His Tyr Cys Phe Phe Ser Pro Tyr Arg lie Lys Pro 305 310 315 320 Gln Tyr Glu Ser Phe Asp Asp Phe Val Arg Gly Asp Ala Asn lie Gin 325 330 335 Lys Lys Val Phe Asp Gin Trp Tyr Ala Asn Gly Thr Gly Pro Leu Ala 340 345 350 Thr Asn Gly lie Glu Ala Gly Val Lys lie Arg Pro Thr Pro Gin Glu 355 360 365 Leu Ser Gin Met Asp Glu Ser Phe Gin Glu Gly Tyr Arg Glu Tyr Phe 370 375 380 Glu Asp Lys Pro Asp Lys Pro Val Met His Tyr Ser lie lie Ala Gly 385 390 395 400 Phe Phe Gly Asp His Thr Lys lie Pro Pro Gly Lys Tyr Met Thr Met 405 410 415 Phe His Phe Leu Gin Tyr Pro Phe Ser Arg Gly Ser lie His lie Thr 420 425 430 Ser Pro Asp Pro Tyr Ala Thr Pro Asp Phe Asp Pro Gly Phe Met Asn 435 440 445 Asp Glu Arg Asp Met Ala Pro Met Val Trp Ser Tyr Lys Lys Ser Arg 450 455 460 Glu Thr Ala Arg Lys Met Asp His Phe Ala Gly Glu Val Thr Ser His 465 470 475 480 His Pro Leu Phe Pro Tyr Ser Ser Glu Ala Arg Ala Tyr Glu Met Asp 485 490 495 Leu Glu Thr Ser Asn Ala Tyr Gly Gly Pro Leu Asn Leu Thr Ala Gly 500 505 510 Leu Ala His Gly Ser Trp Thr Gln Pro Leu Lys Lys Pro Ala Gly Arg 515 520 525 Asn Glu Gly His Val Thr Ser Asn Gln Val Glu Leu His Pro Asp Ile 530 535 540 Glu Tyr Asp Glu Glu Asp Asp Lys Ala Ile Glu Asn Tyr Ile Arg Glu 545 550 555 560 His Thr Glu Thr Thr Trp His Cys Leu Gly Thr Cys Ser Ile Gly Pro 565 570 575 Arg Glu Gly Ser Lys lie Val Lys Trp Gly Gly Val Leu Asp His Arg 580 585 590 Ser Asn Val Tyr Gly Val Lys Gly Leu Lys Val Gly Asp Leu Ser Val 595 600 605 Cys Pro Asp Asn Val Gly Cys Asn Thr Tyr Thr Thr Ala Leu Leu Ile 610 615 620 Gly Glu Lys Thr Ala Thr Leu Val Gly Glu Asp Leu Gly Tyr Thr Gly 625 630 635 640 Glu Ala Leu Asp Met Thr Val Pro Gln Phe Lys Leu Gly Thr Tyr Glu 645 650 655 Lys Thr Gly Leu Ala Arg Phe 660 <210> 2 <211> 1992 <212> DNA <213> Yarrowia lipolytica <400> 2 atggctatcc ccgaagagtt tgatatccta gttctaggtg gtggatccag tggatcctgt 60 attgccggaa gattggcaaa cttggaccac tccttgaaag ttggtcttat cgaagcaggt 120 gagaacaacc tcaacaaccc atgggtctac cttccaggta tttacccaag aaacatgaag 180 ttggactcca agactgcttc cttctacact tctaacccat ctcctcactt gaatggtaga 240 agagccattg ttccatgtgc taacgtctlg ggtggtggtt cttctatcaa cttcatgatg 300 tacaccagag gttctgcttc tgattacgat gacttccaag ccgagggctg gaaaaccaag 360 gacttgcttc cattgatgaa aaagactgag acctaccaaa gagcttgcaa caaccctgac 420 attcacggtt tcgaaggtcc aatcaaggtt tctttcggta actacaccta cccagtttgc 480 caggacttct tgagggcttc tgagtcccaa ggtattccat acgttgacga cttggaagac 540 ttggttactg ctcacggtgc tgaacactgg ttgaagtgga tcaacagaga cactggtcgt 600 cgttccgact ctgctcatgc atttgtccac tctactatga gaaaccacga caacttgtac 660 ttgatctgta acacgaaggt cgacaaaatt attgtcgaag acggaagagc tgctgctgtt 720 agaaccgttc caagcaagcc tttgaaccca aagaagccaa gtcacaagat ctaccgtgct 780 agaaagcaaa tcgttttgtc ttgtggtacc atctcctctc cattggtttt gcaaagatcc 840 ggttttggtg acccaatcaa gttgagagcc gctggtgtta agcctttggt caacttgcca 900 ggtgtcggaa gaaacttcca agaccactac tgtttcttca gtccttacag aatcaagcct 960 cagtacgagt ctttcgatga cttcgtccgt ggtgatgctg agattcaaaa gagagtcttt 1020 gaccaatggt acgccaatgg tactggtcct cttgccacta acggtatcga agctggtgtc 1080 aagatcagac caacaccaga agaactctct caaatggacg aatccttcca ggagggttac 1140 agagaatact tcgaagacaa gccagacaag ccagttatgc actactccat cattgctggt 1200 ttcttcggtg accacaccaa gattcctcct ggaaagtaca tgactatgtt ccacttcttg 1260 gaatacccat tctccagagg ttccattcac attacctccc cagacccata cgcagctcca 1320 gacttcgacc caggtttcat gaacgatgaa agagacatgg ctcctatggt ttgggcttac 1380 aagaagtcta gagaaaccgc tagaagaatg gaccactttg ccggtgaggt cacttctcac 1440 caccctctgt tcccatactc atccgaggcc agagccttgg aaatggattt ggagacctct 1500 aatgcctacg gtggaccttt gaacttgtct gctggtcttg ctcacggttc ttggactcaa 1560 cctttgaaga agccaactgc aaagaacgaa ggccacgtta cttcgaacca ggcgagctt 1620 catccagaca tcgagtacga tgaggaggat gacaaggcca ttgagaacta cattcgtgag 1680 CACAATGGCA CTGTCTGGGA CCTGTTCCTA CGGTCCAAGA GAAGGTTCCT 1740 AAGATCGTCA AATGGGGTGG TTTTTGGACC ACAGATCCAA CGTTTACGGA GTC AAGGGC 1800 TTGAAGGTTG GTGACTTGTC CGTGTGCCCAG ACAATGTTG TTGTAACACC TACACCACC 1860 GCTCTTTTGA TCGGTGAAAA GACTGCCACT TTGGTTGGAG AAGATTTAGG ATACTCTGGT 1920 GAGG CCTTAGAC ATGACTGTTCC TCAGTTC AAGTTGGGCA CTTACGAGAAG ACCGGTCTT 1980 GCTAGATTCT AA 1992 <210> 3 <211> 663 <212> PRT <213> Fari mula sp. (Fari mula patriciana) <400> 3 Met Ala Ile Pro Glu Glu Phe Asp Ile Leu Val Leu Gly Gly Gly Ser 1 5 10 15 Ser Gly Ser Cys Ile Ala Gly Arg Leu Ala Asn Leu Asp His Ser Leu 20 25 30 Lys Val Gly Leu Ile Glu Ala Gly Glu Asn Asn Leu Asn Asn Pro Trp 35 40 45 Val Tyr Leu Pro Gly Ile Tyr Pro Arg Asn Met Lys Leu Asp Ser Lys 50 55 60 Thr Ala Ser Phe Tyr Thr Ser Asn Pro Ser Pro His Leu Asn Gly Arg 65 70 75 80 Arg Ala Ile Val Pro Cys Ala Asn Ile Leu Gly Gly Gly Ser Ser Ile 85 90 95 Asn Phe Met Met Tyr Thr Arg Gly Ser Ala Ser Asp Tyr Asp Asp Phe 100 105 110 Glu Ala Glu Gly Trp Lys Thr Lys Asp Leu Leu Pro Leu Met Lys Lys 115 120 125 Thr Glu Thr Tyr Gln Arg Ala Cys Asn Asn Pro Glu Ile His Gly Phe 130 135 140 Glu Gly Pro Ile Lys Val Ser Phe Gly Asn Tyr Thr Tyr Pro Val Cys 145 150 155 160 Gln Asp Phe Leu Arg Ala Thr Glu Ser Gln Gly Ile Pro Tyr Val Asp 165 170 175 Asp Leu Glu Asp Leu Val Thr Ala His Gly Ala Glu His Trp Leu Lys 180 185 190 Trp Ile Asn Arg Asp Thr Gly Arg Arg Ser Asp Ser Ala His Ala Phe 195 200 205 Val His Ser Thr Met Arg Asn His Asp Asn Leu Tyr Leu Ile Cys Asn 210 215 220 Thr Lys Val Asp Lys lie lie Val Glu Asp Gly Arg Ala Ala Ala Val 225 230 235 240 Arg Thr Val Pro Ser Lys Pro Leu Asn Ala Lys Lys Pro Thr His Lys 245 250 255 Val Tyr Arg Ala Arg Lys Gin lie Val Leu Ser Cys Gly Thr lie Ser 260 265 270 Ser Pro Leu Val Leu Gin Arg Ser Gly Phe Gly Asp Pro lie Lys Leu 275 280 285 Arg Ala Ala Gly Val Lys Pro Leu Val Asn Leu Pro Gly Val Gly Arg 290 295 300 Asn Phe Gin Asp His Tyr Cys Phe Phe Ser Pro Tyr Arg lie Lys Pro 305 310 315 320 Gln Tyr Glu Ser Phe Asp Asp Phe Val Arg Gly Asp Ala Asn lie Gin 325 330 335 Lys Lys Val Phe Asp Gin Trp Tyr Ala Asn Gly Thr Gly Pro Leu Ala 340 345 350 Thr Asn Gly lie Glu Ala Gly Val Lys lie Arg Pro Thr Pro Glu Glu 355 360 365 Leu Ser Gin Met Asp Glu Ser Phe Gin Glu Gly Tyr Arg Glu Tyr Phe 370 375 380 Glu Asp Lys Pro Asp Lys Pro Val Met His Tyr Ser Ile Ile Ala Gly 385 390 395 400 Phe Phe Gly Asp His Thr Lys Ile Pro Pro Gly Lys Tyr Met Thr Met 405 410 415 Phe His Phe Leu Glu Tyr Pro Phe Ser Arg Gly Ser Ile His Ile Thr 420 425 430 Ser Pro Asp Pro Tyr Ala Thr Pro Asp Phe Asp Pro Gly Phe Met Asn 435 440 445 Asp Glu Arg Asp Met Ala Pro Met Val Trp Ser Tyr Lys Lys Ser Arg 450 455 460 Glu Thr Ala Arg Lys Met Asp His Phe Ala Gly Glu Val Thr Ser His 465 470 475 480 His Pro Leu Phe Pro Tyr Ser Ser Glu Ala Arg Ala Tyr Glu Met Asp 485 490 495 Leu Glu Thr Ser Asn Ala Tyr Gly Gly Pro Leu Asn Leu Thr Ala Gly 500 505 510 Leu Ala His Gly Ser Trp Thr Gln Pro Leu Lys Lys Pro Ala Gly Arg 515 520 525 Asn Glu Gly His Val Thr Ser Asn Gln Val Glu Leu His Pro Asp Ile 530 535 540 Glu Tyr Asp Glu Glu Asp Asp Lys Ala Ile Glu Asn Tyr Ile Arg Glu 545 550 555 560 His Thr Glu Thr Thr Trp His Cys Leu Gly Thr Cys Ser Ile Gly Pro 565 570 575 Arg Glu Gly Ser Lys Ile Val Lys Trp Gly Gly Val Leu Asp His Arg 580 585 590 Ser Asn Val Tyr Gly Val Lys Gly Leu Lys Val Gly Asp Leu Ser Val 595 600 605 Cys Pro Asp Asn Val Gly Cys Asn Thr Tyr Thr Thr Ala Leu Leu Ile 610 615 620 Gly Glu Lys Thr Ala Thr Leu Val Gly Glu Asp Leu Gly Tyr Thr Gly 625 630 635 640 Glu Ala Leu Asp Met Thr Val Pro Gln Phe Lys Leu Gly Thr Tyr Glu 645 650 655 Lys Thr Gly Leu Ala Arg Phe 660 <210> 4 <211> 1992 <212> DNA <213> Yarrowia lipolytica <400> 4 atggccattc ctgaagaatt cgatattctt gtcctgggtg gtggatccag tggatcctgt 60 attgccggaa gattggccaa cttggaccac tccttgaaag ttggtcttat cgaggctggt 120 gagaacaatc ttaacaaccc atgggtctac cttccaggta tttacccaag aaacatgaag 180 ttggactcca aaactgcttc tttctacacc tccaaccctt ctcctcattt gaatggtaga 240 agagctattg tcccatgtgc caacatcttg ggtggtggtt cttcgatcaa cttcatgatg 300 tacaccagag gttccgcttc tgattacgat gactttgaag ctgagggatg gaagaccaag 360 gatttgcttc ctttgatgaa gaagactgag acttaccaaa gagcttgcaa caaccctgaa 420 attcacggtt ttgaaggtcc aatcaaggtt tctttcggta actacactta cccagtttgt 480 caagacttct tgagagcaac tgaatcccaa ggtattccat acgttgacga cttggaagac 540 ttggtgactg ctcatggtgc tgaacactgg ctgaaatgga tcaacagaga cactggtcgt 600 cgttccgact ctgctcatgc cttcgttcat tctacgatga gaaaccacga caatctgtac 660 ttgatctgca acaccaaagt tgacaagatt attgttgaag acggaagagc tgctgctgtc 720 agaaccgttc caagtaaacc tttgaacgca aagaagccaa ctcacaaggt ttatcgtgct 780 agaaagcaaa tcgttttgtc ttgtggtacc atctcttctc ctctggttct gcaaagatcc 840 ggttttggtg acccaatcaa attgagagcc gctggtgtta agcctttggt caacttgcca 900 ggtgttggaa gaaacttcca agaccactac tgcttcttct ctccttacag aattaagccc 960 caatacgagt ctttcgatga cttcgtacgt ggtgacgcta acattcaaaa gaaggtattc 1020 gaccaatggt acgctaacgg tactggtcca ttggccacca acggtattga agccggtgtc 1080 aagattagac caactccaga agaattatct cagatggacg agtccttcca agagggttac 1140 agagagtact tcgaagacaa accagacaag ccagttatgc actattccat cattgctggt 1200 ttcttcggtg accacaccaa gattccacct ggaaagtaca tgaccatgtt ccacttcttg 1260 gagtacccat tctccagagg ttctatccac atcacctctc cagacccata cgcaactcca 1320 gactttgacc caggtttcat gaacgatgaa agagacatgg ctcctatggt ctggtcttac 1380 aagaagtcca gagagactgc cagaaaaatg gaccactttg ctggtgaggt tacttcccac 1440 caccctctgt tcccatactc atccgaggcc agagcttacg agatggattt ggagacctcc 1500 aacgcctacg gtggaccact gaacttgact gctggtcttg ctcacggttc ttggactcag 1560 cctttgaaga agcctgctgg aagaaacgaa ggacatgtta cttccaacca agtcgagctt 1620 catccagaca ttgagtacga tgaggaggat gataaggcca ttgagaacta cattcgtgag 1680 cacactgaga ccacatggca ctgtctggga acctgttcca ttggtccaag agagggttcc 1740 aagatcgtca aatggggtgg tgttttggat cacagatcta acgtttacgg agtcaagggc 1800 ctgaaggttg gtgacttgtc cgtctgtcca gacaatgttg gttgtaacac ctacaccacc 1860 gctcttttga tcggtgaaaa gactgccacc ttggttggtg aagacttagg atacacaggt 1920 gaggccttag acatgactgt acctcagttc aagttgggca cttacgagaa gactggtctt 1980 gctagattct ag 1992 <210> 5 <211> 1000 <212> DNA <213> Saccharomycete <400> 5 catgttggta ttgtgaaata gacgcagatc gggaacactg aaaaataaca gttattattc 60 gagatctaac atccaaagac gaaaggttga atgaaacctt tttgccatcc gacatccaca 120 ggtccattct cacacataag tgccaaacgc aacaggaggg gatacactag cagcagaccg 180 ttgcaaacgc aggacctcca ctcctcttct cctcaacacc cacttttgcc atcgaaaaac 240 cagcccagtt attgggcttg attggagctc gctcattcca attccttcta ttaggctact 300 aacaccatga ctttattagc ctgtctatcc tggcccccct ggcgaggttc atgtttgttt 360 atttccgaat gcaacaagct ccgcattaca cccgaacatc actccagatg agggctttct 420 gagtgtgggg tcaaatagtt tcatgttccc caaatggccc aaaactgaca gtttaaacgc 480 tgtcttggaa cctaatatga caaaagcgtg atctcatcca agatgaacta agtttggttc 540 gttgaaatgc taacggccag ttggtcaaaa agaaacttcc aaaagtcggc ataccgtttg 600 tcttgtttgg tattgattga cgaatgctca aaaataatct cattaatgct tagcgcagtc 660 tctctatcgc ttctgaaccc cggtgcacct gtgccgaaac gcaaatgggg aaacacccgc 720 tttttggatg attatgcatt gtctccacat tgtatgcttc caagattctg gtgggaatac 780 tgctgatagc ctaacgttca tgatcaaaat ttaactgttc taacccctac ttgacagcaa 840 tatataaaca gaaggaagct gccctgtctt aaaccttttt tttatcatca ttattagctt 900 actttcataa ttgcgactgg ttccaattga caagcttttg attttaacga cttttaacga 960 caacttgaga agatcaaaaa acaactaatt attcgaaacg 1000 <210> 6 <211> 1000 <212> DNA <213> Wickerhamomyces anomalus <400> 6 gcttaaagga ctccatttcc taaaatttca agcagtcctc tcaactaaat ttttttccat 60 tcctctgcac ccagccctct tcatcaaccg tccagccttc tcaaaagtcc aatgtaagta 120 gcctgcaaat tcaggttaca acccctcaat tttccatcca agggcgatcc ttacaaagtt 180 aatatcgaac agcagagact aagcgagtca tcatcaccac ccaacgatgg tgaaaaactt 240 taagcataga ttgatggagg gtgtatggca cttggcggct gcattagagt ttgaaactat 300 ggggtaatac atcacatccg gaactgatcc gactccgaga tcatatgcaa agcacgtgat 360 gtaccccgta aactgctcgg attatcgttg caattcatcg tcttaaacag tacaagaaac 420 tttattcatg ggtcattgga ctctgatgag gggcacattt ccccaatgat tttttgggaa 480 agaaagccgt aagaggacag ttaagcgaaa gagacaagac aacgaacagc aaaagtgaca 540 gctgtcagct acctagtgga cagttgggag tttccaattg gttggttttg aatttttacc 600 catgttgagt tgtccttgct tctccttgca aacaatgcaa gttgataaga catcaccttc 660 caagataggc tatttttgtc gcataaattt ttgtctcgga gtgaaaaccc cttttatgtg 720 aacagattac agaagcgtcc tacccttcac cggttgagat ggggagaaaa ttaagcgatg 780 aggagacgat tattggtata aaagaagcaa ccaaaatccc ttattgtcct tttctgatca 840 gcatcaaaga atattgtctt aaaacgggct tttaactaca ttgttcttac acattgcaaa 900 cctcttcctt ctatttcgga tcaactgtat tgactacatt gatctttttt aacgaagttt 960 acgacttact aaatccccac aaacaaatca actgagaaaa 1000 <210> 7 <211> 1000 <212> DNA <213> Pichia pastoris <400> 7 atatcgtgaa atagacccaa atccggacac tgtgaaataa aacagttagt atgcgaaatc 60 taacatccaa gaacgagaaa ctaaataaga cattttgcca tccgacatct acaaaccaca 120 TCACCCTCAC ACATAAGTGC CAAAACGCAG CAGGAGGGAC ACCCAGCAGC AGAAGCCGTG 180 TCGAACGCAG GACCTCCACT TCTCTTCTCC TCAACATCCA CTTTCGTTAT TGAAAACCAA 240 CCTGCTTAAA AAACTGATTG GAGCTCGCTC ATTCCAGTCC CCTTTGTTAG GCTACTAAG 300 ACCACGACTT TATTAGCCTG TCCATTCTGG TTCCTGGCGA GACTTATTCT TGTTTGTTTA 360 TTTTTGAATG CAACAAAGCT CCGCATTACA TCCGAACATC ACTTTCATG AGGGGCTTTC 420 GAGTGTGGGG TCGAATAGTT TCATGTTCCC CCAATGGCCC AAAACTGACA CTTTAAACGC 480 TGTCTTCGAA CTTAATATGG CAAAAGCGTG ATCTCATCCA AGACGAACTA AGTTTGGTTC 540 GTTGAAATGC TAACGGCCAG TTGGTCAAAA AGAAACTTCC AAAAGTCGGC ATATCGTTTG 600 TCTTGTTTGG TATTCAAGAC GAATGCTCAA GAATATTCCT ATAATGCTTA GCAGTC 660 TCTGTATCGC TTCTGGACCC CGGTGCAGTT GTGCCGAAAC GCAATGGGGA AACACCCGC 720 TTTTTGGATG ATTATGCATT GTCTCCACAT TGTTATGCTT CCAAGATTCT GGTGGGAATA 780 TACTGATAGC CTAACGTTC ATGATCAATA TCAAACTGTT CTAACCCCTA CTTGAAC 840 aatataaac aggaggaaac ttcccagtcg aaaaccttct ttcatcatca ttattagctt 900 actttcataa ttgtgactgg ttccaattga caagcttttg attctaacga cttttaacga 960 caatttgaga agatcaaaaa acaactaatt attcgaaacg 1000 <210> 8 <211> 1000 <212> DNA <213> Pichia pastoris <400> 8 gcttgcacga ctcagttacc tgaaaatttc agcctgtcct ctttaataaa atttcacccg 60 ttcctctgca tgtccactca gctctattca tctatccttg agccttctcg agcgtctaat 120 gaacagcctg cgaattcagg ttacaacccc tcattttttc gtctcggtcg atctctacaa 180 agtcaacagc caactttgat gttaagcgag tcatcaccag ccagcgatag tgaaaaactt 240 taagcataga ttgatggtgg gtttatgtca cttggcggct gcattagagt ttgaaactat 300 ggggtaatgc atcacatccg gaactgatcc gactcggaga tcatatgcaa accacgtgat 360 gtaccccgta aactgctcgg attactgttc caattcatcg tcttaaacag tataagaaac 420 tttattcatg ggtcattgga ctctgatgag gggcacattt ccccattgat ttttgggaca 480 gtaagccata aaaggactgt taagcgaagc agacaagaca acgaacagct agaataacaa 540 ctatctaccg ccttgtggac cgttgggagt ttccaattgg ttggttttgg atttctgagc 600 ccatgttgtg ttgtccatgc ttctccttgc acacaatgca agttgataag atatcacctt 660 ccaagatagg ctatttttgt cgcataaatt ttggtctcag agtgaaaccc ccttttatgt 720 gaacggatta gagaagcctc ctacccttca ccggctgaga tggggagaaa ttaagcgatg 780 aggagacgat aattgctata aaagaagcaa ccaaaacccc ttattgtctc tttctgatca 840 gcatcaaaga atattgtctt aaaacgggct tttaactaca ttgttcttac acattgcaaa 900 cctcctcctt caatttcgga tcagctgtat tgactacatt gatctttttt aacgaagttc 960 acgacttact aaatccccat aaacaaacca actgagaaaa 1000 <210> 9 <211> 663 <212> PRT <213> Pichia pastoris <400> 9 Met Ala Ile Pro Glu Glu Phe Asp Ile Leu Val Leu Gly Gly Gly Ser 1 5 10 15 Ser Gly Ser Cys Ile Ala Gly Arg Leu Ala Asn Leu Asp His Ser Leu 20 25 30 Lys Val Gly Leu Ile Glu Ala Gly Glu Asn Asn Leu Asn Asn Pro Trp 35 40 45 Val Tyr Leu Pro Gly Ile Tyr Pro Arg Asn Met Lys Leu Asp Ser Lys 50 55 60 Thr Ala Ser Phe Tyr Thr Ser Asn Pro Ser Pro His Leu Asn Gly Arg 65 70 75 80 Arg Ala Ile Val Pro Cys Ala Asn Val Leu Gly Gly Gly Ser Ser Ile 85 90 95 Asn Phe Met Met Tyr Thr Arg Gly Ser Ala Ser Asp Tyr Asp Asp Phe 100 105 110 Gln Ala Glu Gly Trp Lys Thr Lys Asp Leu Leu Pro Leu Met Lys Lys 115 120 125 Thr Glu Thr Tyr Gln Arg Ala Cys Asn Asn Pro Asp Ile His Gly Phe 130 135 140 Glu Gly Pro Ile Lys Val Ser Phe Gly Asn Tyr Thr Tyr Pro Val Cys 145 150 155 160 Gln Asp Phe Leu Arg Ala Ser Glu Ser Gln Gly Ile Pro Tyr Val Asp 165 170 175 Asp Leu Glu Asp Leu Val Thr Ala His Gly Ala Glu His Trp Leu Lys 180 185 190 Trp Ile Asn Arg Asp Thr Gly Arg Arg Ser Asp Ser Ala His Ala Phe 195 200 205 Val His Ser Thr Met Arg Asn His Asp Asn Leu Tyr Leu Ile Cys Asn 210 215 220 Thr Lys Val Asp Lys Ile Ile Val Glu Asp Gly Arg Ala Ala Ala Val 225 230 235 240 Arg Thr Val Pro Ser Lys Pro Leu Asn Pro Lys Lys Pro Ser His Lys 245 250 255 Ile Tyr Arg Ala Arg Lys Gln Ile Val Leu Ser Cys Gly Thr Ile Ser 260 265 270 Ser Pro Leu Val Leu Gln Arg Ser Gly Phe Gly Asp Pro Ile Lys Leu 275 280 285 Arg Ala Ala Gly Val Lys Pro Leu Val Asn Leu Pro Gly Val Gly Arg 290 295 300 Asn Phe Gln Asp His Tyr Cys Phe Phe Ser Pro Tyr Arg Ile Lys Pro 305 310 315 320 Gln Tyr Glu Ser Phe Asp Asp Phe Val Arg Gly Asp Ala Glu Ile Gln 325 330 335 Lys Arg Val Phe Asp Gln Trp Tyr Ala Asn Gly Thr Gly Pro Leu Ala 340 345 350 Thr Asn Gly Ile Glu Ala Gly Val Lys Ile Arg Pro Thr Pro Glu Glu 355 360 365 Leu Ser Gln Met Asp Glu Ser Phe Gln Glu Gly Tyr Arg Glu Tyr Phe 370 375 380 Glu Asp Lys Pro Asp Lys Pro Val Met His Tyr Ser Ile Ile Ala Gly 385 390 395 400 Phe Phe Gly Asp His Thr Lys Ile Pro Pro Gly Lys Tyr Met Thr Met 405 410 415 Phe His Phe Leu Glu Tyr Pro Phe Ser Arg Gly Ser Ile His Ile Thr 420 425 430 Ser Pro Asp Pro Tyr Ala Ala Pro Asp Phe Asp Pro Gly Phe Met Asn 435 440 445 Asp Glu Arg Asp Met Ala Pro Met Val Trp Ala Tyr Lys Lys Ser Arg 450 455 460 Glu Thr Ala Arg Arg Met Asp His Phe Ala Gly Glu Val Thr Ser His 465 470 475 480 His Pro Leu Phe Pro Tyr Ser Ser Glu Ala Arg Ala Leu Glu Met Asp 485 490 495 Leu Glu Thr Ser Asn Ala Tyr Gly Gly Pro Leu Asn Leu Ser Ala Gly 500 505 510 Leu Ala His Gly Ser Trp Thr Gin Pro Leu Lys Lys Pro Thr Ala Lys 515 520 525 Asn Glu Gly His Val Thr Ser Asn Gin Val Glu Leu His Pro Asp He 530 535 540 Glu Tyr Asp Glu Glu Asp Asp Lys Ala He Glu Asn Tyr He Arg Glu 545 550 555 560 His Thr Glu Thr Thr Trp His Cys Leu Gly Thr Cys Ser He Gly Pro 565 570 575 Arg Glu Gly Ser Lys He Val Lys Trp Gly Gly Val Leu Asp His Arg 580 585 590 Ser Asn Val Tyr Gly Val Lys Gly Leu Lys Val Gly Asp Leu Ser Val 595 600 605 Cys Pro Asp Asn Val Gly Cys Asn Thr Tyr Thr Thr Ala Leu Leu He 610 615 620 Gly Glu Lys Thr Ala Thr Leu Val Gly Glu Asp Leu Gly Tyr Thr Gly 625 630 635 640 Glu Ala Leu Asp Met Thr Val Pro Gin Phe Lys Leu Gly Thr Tyr Glu 645 650 655 Lys Thr Gly Leu Ala Arg Phe 660 <210> 10 <211> 1992 <212> DNA <213> Pichia pastoris <400> 10 atggctatcc ctgaagagtt tgatatcctt gttttaggtg gtggatccag tggatcctgt 60 attgccggaa gattggccaa cttggaccac tccttgaaag ttggtcttat cgaggcaggt 120 gagaacaacc tcaacaaccc atgggtttac cttccaggta tttacccaag aaacatgaag 180 ttggactcca agactgcatc cttctacact tctaaccctt ctcctcactt gaacggtaga 240 agagctattg ttccatgtgc taacgtcttg ggtggtggtt cttccattaa cttcatgatg 300 tacaccagag gttctgcttc tgattatgac gacttccaag ccgagggctg gaaaaccaag 360 gacttgcttc cattgatgaa aaagaccgag acctaccaaa gagcttgcaa caaccctgac 420 attcacgggt tcgaaggtcc aatcaaggtt tctttcggta actacaccta cccagtttgc 480 caggacttct tgagagcttc tgaatcccaa ggtattccat acgttgacga cttggaagac 540 ttggttactg ctcacggtgc tgaacactgg ctgaaatgga tcaacagaga cactggtcgt 600 cgttccgact ccgctcatgc atttgtccac tctactatga gaaaccacga caacttgtac 660 ttgatttgta acacaaaggt tgacaagatt attgtcgaag acggaagagc tgctgctgtt 720 agaactgttc caagcaagcc tttgaaccca aagaagccaa gtcacaagat ctaccgtgct 780 agaaagcaaa tcgttttgtc ttgtggtacc atctcatctc cttttggttct gcaaagatcc 840 ggttcggtg acccaatcaa gttgagagcc gctggtgtta agcctttggt caacttgcct 900 ggtgtcggaa gaaacttcca agaccactac tgtttcttca gtccttacag aatcaagcct 960 cagtacgaat cttcgatga cttcgtgcgt ggtgatgctg agatccaaaa gagattttc 1020 gaccaatggt acgccaatgg tactggtcct cttgccacta acggtatcga agccggtgtc 1080 aagattagac caacaccaga ggaactgtct caaatggacg aatctttcca agagggttac 1140 agagaatact ttgaggacaa gccagacaag ccagttatgc actactccat tattgctggt 1200 ttcttcggtg accacaccaa gattcctcct ggaaagtaca tgaccatgtt ccactttttg 1260 gaatacccat tctccagagg ttccattcac attacctctc cagatccata cgcagctcca 1320 gacttcgacc caggtttcat gaacgatgaa agagacatgg ctcctatggt ctgggcctac 1380 aagaagtcta gagagacagc tagaagaatg gaccactttg ccggtgaggt tacttctcac 1440 cacccattgt tcccatactc atccgaggcc agagctttgg agatggattt ggagacctcc 1500 aatgcctacg gtggaccttt gaacttgtct gctggtcttg cccacggttc ttggactcaa 1560 cctttgaaga agccaactgc aaagaacgaa ggccatgtta cctccaacca agtcgagctt 1620 catccagaca tcgagtacga cgaggaggac gacaaggcca ttgaaaacta catccgtgag 1680 cacactgaga ccacatggca ctgtctggga acctgttcca tcggtccaag agagggttcc 1740 aagatcgtca aatggggtgg tgttttggac cacagatcca acgtttacgg agtcaagggc 1800 ctgaaggttg gtgacttgtc tgtctgtcca gacaatgttg gttgtaacac ctacaccacc 1860 gctcttttga tcggtgagaa gactgccact ttggttggag aagacttagg atacaccggt 1920 gaagccttag acatgactgt tcctcagttc aagttgggca cttacgagaa gaccggtctt 1980 gctagattct aa 1992 <210> 11 <211> 663 <212> PRT <213> Pichia kudriavzevii <400> 11 Met Ala Ile Pro Glu Glu Phe Asp Ile Leu Val Leu Gly Gly Gly Ser 1 5 10 15 Ser Gly Ser Cys Ile Ala Gly Arg Leu Ala Asn Leu Asp His Ser Leu 20 25 30 Lys Val Gly Leu Ile Glu Ala Gly Glu Asn Asn Leu Asn Asn Pro Trp 35 40 45 Val Tyr Leu Pro Gly Ile Tyr Pro Arg Asn Met Lys Leu Asp Ser Lys 50 55 60 Thr Ala Ser Phe Tyr Thr Ser Asn Pro Ser Pro His Leu Asn Gly Arg 65 70 75 80 Arg Ala Ile Val Pro Cys Ala Asn Ile Leu Gly Gly Gly Ser Ser Ile 85 90 95 Asn Phe Met Met Tyr Thr Arg Gly Ser Ala Ser Asp Tyr Asp Asp Phe 100 105 110 Glu Ala Glu Gly Trp Lys Thr Lys Asp Leu Leu Pro Leu Met Lys Lys 115 120 125 Thr Glu Thr Tyr Gln Arg Ala Cys Asn Asn Pro Glu Ile His Gly Phe 130 135 140 Glu Gly Pro lie Lys Val Ser Phe Gly Asn Tyr Thr Tyr Pro Val Cys 145 150 155 160 Gln Asp Phe Leu Arg Ala Thr Glu Ser Gln Gly lie Pro Tyr Val Asp 165 170 175 Asp Leu Glu Asp Leu Glu Thr Ala His Gly Ala Glu His Trp Leu Lys 180 185 190 Trp lie Asn Arg Asp Thr Gly Arg Arg Ser Asp Ser Ala His Ala Phe 195 200 205 Val His Ser Thr Met Arg Asn His Asp Asn Leu Tyr Leu lie Cys Asn 210 215 220 Thr Lys Val Asp Lys lie lie Val Glu Asp Gly Arg Ala Ala Gly Val 225 230 235 240 Arg Thr Val Pro Ser Lys Pro Leu Asn Ala Lys Lys Pro Thr His Lys 245 250 255 Val Tyr Arg Ala Arg Lys Gln lie Val Leu Ser Cys Gly Thr lie Ser 260 265 270 Ser Pro Leu Val Leu Gln Arg Ser Gly Phe Gly Asp Pro lie Lys Leu 275 280 285 Arg Ala Ala Gly Val Lys Pro Leu Val Asn Leu Pro Gly Val Gly Arg 290 295 300 Asn Phe Gin Asp His Tyr Cys Phe Phe Ser Pro Tyr Arg lie Lys Pro 305 310 315 320 Gln Tyr Glu Ser Phe Asp Asp Phe Val Arg Gly Asp Ala Asn lie Gin 325 330 335 Lys Lys Val Phe Asp Gin Trp Tyr Ala Asn Gly Thr Gly Pro Leu Ala 340 345 350 Thr Asn Gly lie Glu Ala Gly Val Lys lie Arg Pro Thr Pro Glu Glu 355 360 365 Leu Ser Gin Met Asp Glu Ser Phe Gin Glu Gly Tyr Arg Glu Tyr Phe 370 375 380 Glu Asp Lys Pro Asp Lys Pro Val Met His Tyr Ser lie lie Ala Gly 385 390 395 400 Phe Phe Gly Asp His Thr Lys lie Pro Pro Gly Lys Tyr Met Thr Met 405 410 415 Phe His Phe Leu Glu Tyr Pro Phe Ser Arg Gly Ser lie His lie Thr 420 425 430 Ser Pro Asp Pro Tyr Ala Thr Pro Asp Phe Asp Pro Gly Phe Met Asn 435 440 445 Asp Glu Arg Asp Met Ala Pro Met Val Trp Ser Tyr Lys Lys Ser Arg 450 455 460 Glu Thr Ala Arg Lys Met Asp His Phe Ala Gly Glu Val Thr Ser His 465 470 475 480 His Pro Leu Phe Pro Tyr Ser Ser Glu Ala Arg Ala Tyr Glu Met Asp 485 490 495 Leu Glu Thr Ser Asn Ala Tyr Gly Gly Pro Leu Asn Leu Thr Ala Gly 500 505 510 Leu Ala His Gly Ser Trp Thr Gln Pro Leu Lys Lys Pro Ala Ala Arg 515 520 525 Asn Glu Gly His Val Thr Ser Asn Gln Val Glu Leu His Pro Asp Ile 530 535 540 Glu Tyr Asp Glu Glu Asp Asp Lys Ala Ile Glu Asn Tyr Ile Arg Glu 545 550 555 560 His Thr Glu Thr Thr Trp His Cys Leu Gly Thr Cys Ser Ile Gly Pro 565 570 575 Arg Glu Gly Ser Lys Ile Val Lys Trp Gly Gly Val Leu Asp His Arg 580 585 590 Ser Asn Val Tyr Gly Val Lys Gly Leu Lys Val Gly Asp Leu Ser Val 595 600 605 Cys Pro Asp Asn Val Gly Cys Asn Thr Tyr Thr Thr Ala Leu Leu Ile 610 615 620 Gly Glu Lys Thr Ala Thr Leu Val Gly Glu Asp Leu Gly Tyr Thr Gly 625 630 635 640 Asp Ala Leu Asp Met Thr Val Pro Gln Phe Lys Leu Gly Thr Tyr Glu 645 650 655 Lys Thr Gly Leu Ala Arg Phe 660 <210> 12 <211> 1992 <212> DNA <213> Saccharomyces pastori <400> 12 atggctattc ctgaagaatt cgatattctt gtcctaggtg gtggatccag tggatcctgt 60 attgccggaa gattggccaa cttggaccac tctttgaaag ttggtcttat cgaggccggt 120 gagaacaatc ttaacaaccc ttgggtctac cttccaggta tttacccaag aaacatgaaa 180 ttggactcca agaccgcttc tttctacacc tccaacccat ctcctcattt gaatggtaga 240 agagctattg tcccatgtgc taacatcttg ggtggtggtt cttccatcaa cttcatgatg 300 tacaccagag gttccgcttc tgattacgat gacttcgaag ctgagggctg gaaaaccaag 360 gatttgcttc ctttgatgaa gaagactgag acctaccaaa gagcttgcaa caaccctgag 420 atccacggtt tcgaaggtcc aatcaaggtt tctttcggta actacactta cccggtttgt 480 caagacttct tgagagcaac tgaatcccaa ggtattccat acgttgacga cttggaagac 540 ttggagactg ctcatggtgc cgaacactgg ttgaaatgga tcaacagaga cactggtcgt 600 cgttccgact ctgctcatgc tttcgtccat tctactatga gaaaccatga taacttgtac 660 ttgatctgca acaccaaggt tgacaagatt attgttgaag acggaagagc tgctggtgtc 720 agaaccgtcc caagtaaacc tttgaacgca aagaagccaa ctcacaaggt ttaccgtgct 780 agaaagcaga tcgttttgtc ttgtggtacc atttcttccc ctctggtttt gcaaagatcc 840 ggttttggtg atccaatcaa attgagagcc gctggtgtta agcctttggt caacttgcca 900 ggtgttggaa ggaacttcca ggaccattac tgcttcttct ctccttacag aatcaagccc 960 caatacgagt cttttgatga cttcgtccgt ggtgacgcta acatccaaaa gaaggtattc 1020 gaccaatggt acgctaacgg tactggtcca ttggccacca atggtattga agccggtgtc 1080 aagatcagac caactccaga ggaattatct caaatggacg agtcgttcca ggagggttac 1140 agagagtact ttgaagacaa accagacaaa ccagttatgc actattccat cattgctggt 1200 ttcttcggtg accacaccaa gattccgcct ggaaagtaca tgaccatgtt ccacttcttg 1260 gagtacccat tctccagagg ttctattcat atcacctctc cagacccata cgcaactcca 1320 gactttgacc caggtttcat gaatgatgaa agagacatgg ctcctatggt ttggtcttac 1380 aagaagtcca gagagactgc cagaaagatg gatcactttg ctggtgaggt tacttcccac 1440 caccctctgt tcccatactc atccgaggcc agagcttacg agatggactt ggagacctcc 1500 aacgcctacg gtggaccact gaacttgact gctggtcttg ctcacggttc ttggactcag 1560 cctttgaaga agcctgccgc aagaaacgaa ggacatgtta cctctaacca agttgagctt 1620 catccagaca ttgaatacga tgaggaggat gacaaggcca ttgagaacta catccgtgag 1680 cacactgaga ccacatggca ctgtctcgga acctgttcca tcggtccaag agaaggttcc 1740 aagatagtca aatggggtgg tgttttggac cacagatcca acgtttacgg agtcaagggc 1800 ctgaaggttg gtgacttgtc tgtctgccca gacaatgttg gttgtaacac ctacaccacc 1860 gctcttttaa tcggtgaaaa gactgcaacc ttggtgggtg aagacttagg atacacaggt 1920 gatgccttag acatgactgt tcctcagttc aagttgggca cttacgagaa gactggtctt 1980 gctagattct ag 1992 <210> 13 <211> 664 <212> PRT <213> Ogataea minuta <400> 13 Met Ala Ile Pro Asp Glu Phe Asp Ile Ile Val Val Gly Gly Gly Ser 1 5 10 15 Thr Gly Cys Ala Leu Ala Gly Arg Leu Gly Asn Leu Asp Glu Asn Val 20 25 30 Thr Val Ala Leu Ile Glu Gly Gly Glu Asn Asn Ile Asn Asn Pro Trp 35 40 45 Val Tyr Leu Pro Gly Val Tyr Pro Arg Asn Met Arg Leu Asp Ser Lys 50 55 60 Thr Ala Thr Phe Tyr Ser Ser Arg Pro Ser Pro His Leu Asn Gly Arg 65 70 75 80 Arg Ala Ile Val Pro Cys Ala Asn Ile Leu Gly Gly Gly Ser Ser Ile 85 90 95 Asn Phe Leu Met Tyr Thr Arg Ala Ser Ala Ser Asp Tyr Asp Asp Trp 100 105 110 Glu Ser Glu Gly Trp Thr Thr Asp Glu Leu Leu Pro Leu Met Lys Lys 115 120 125 Ile Glu Thr Tyr Gln Arg Pro Cys Asn Asn Arg Glu Leu His Gly Phe 130 135 140 Asp Gly Pro Ile Lys Val Ser Phe Gly Asn Tyr Thr Tyr Pro Asn Gly 145 150 155 160 Gln Asp Phe Ile Arg Ala Ala Glu Ser Gln Gly Ile Pro Phe Val Asp 165 170 175 Asp Ala Glu Asp Leu Lys Cys Ser His Gly Ala Glu His Trp Leu Lys 180 185 190 Trp Ile Asn Arg Asp Leu Gly Arg Arg Ser Asp Ser Ala His Ala Tyr 195 200 205 Ile His Pro Thr Met Arg Asn Lys Gln Asn Leu Phe Leu Ile Thr Ser 210 215 220 Thr Lys Cys Glu Lys Ile Ile Ile Glu Asn Gly Val Ala Thr Gly Val 225 230 235 240 Lys Thr Val Pro Met Lys Pro Thr Gly Ser Pro Lys Thr Gln Val Ala 245 250 255 Arg Thr Phe Lys Ala Arg Lys Gln Ile Ile Val Ser Cys Gly Thr Ile 260 265 270 Ser Ser Pro Leu Val Leu Gin Arg Ser Gly lie Gly Ser Ala His Lys 275 280 285 Leu Arg Gin Val Gly lie Lys Pro lie Val Asp Leu Pro Gly Val Gly 290 295 300 Met Asn Phe Gin Asp His Tyr Cys Phe Phe Thr Pro Tyr His Val Lys 305 310 315 320 Pro Asp Thr Pro Ser Phe Asp Asp Phe Val Arg Gly Asp Lys Ala Val 325 330 335 Gln Lys Ser Ala Phe Asp Gin Trp Tyr Ala Asn Lys Asp Gly Pro Leu 340 345 350 Thr Thr Asn Gly lie Glu Ala Gly Val Lys lie Arg Pro Thr Gin Glu 355 360 365 Glu Leu Ala Thr Ala Asp Asp Glu Phe Arg Ala Ala Tyr Asp Asp Tyr 370 375 380 Phe Gly Asn Lys Pro Asp Lys Pro Leu Met His Tyr Ser Leu lie Ser 385 390 395 400 Gly Phe Phe Gly Asp His Thr Lys lie Pro Asn Gly Lys Tyr Met Cys 405 410 415 Met Phe His Phe Leu Gin Tyr Pro Phe Ser Arg Gly Phe Val His Val 420 425 430 Val Ser Pro Asn Pro Tyr Asp Ala Pro Asp Phe Asp Pro Gly Phe Met 435 440 445 Asn Asp Pro Arg Asp Met Trp Pro Met Val Trp Ser Tyr Lys Lys Ser 450 455 460 Arg Glu Thr Ala Arg Arg Met Asp Cys Phe Ala Gly Glu Val Thr Ser 465 470 475 480 His His Pro His Tyr Pro Tyr Asp Ser Pro Ala Arg Ala Ala Asp Met 485 490 495 Asp Leu Glu Thr Thr Lys Ala Tyr Ala Gly Pro Asp His Phe Thr Ala 500 505 510 Asn Leu Tyr His Gly Ser Trp Thr Val Pro Ile Glu Lys Pro Thr Pro 515 520 525 Lys Asn Ala Ala His Val Thr Ser Asn Gln Val Glu Lys His Arg Asp 530 535 540 Ile Glu Tyr Thr Lys Glu Asp Asp Ala Ala Ile Glu Asp Tyr Ile Arg 545 550 555 560 Glu His Thr Glu Thr Thr Trp His Cys Leu Gly Thr Cys Ser Met Ala 565 570 575 Pro Arg Glu Gly Ser Lys Val Val Pro Thr Gly Gly Val Val Asp Ser 580 585 590 Arg Leu Asn Val Tyr Gly Val Glu Lys Leu Lys Val Ala Asp Leu Ser 595 600 605 Ile Cys Pro Asp Asn Val Gly Cys Asn Thr Tyr Ser Thr Ala Leu Leu 610 615 620 Ile Gly Glu Lys Ala Ser Thr Leu Val Ala Glu Asp Leu Gly Tyr Ser 625 630 635 640 Gly Asp Ala Leu Lys Met Thr Val Pro Asn Phe Lys Leu Gly Thr Tyr 645 650 655 Glu Glu Ala Gly Leu Ala Arg Phe 660 <210> 14 <211> 1995 <212> DNA <213> Methanococcus maripaludis <400> 14 atggctattc cagatgaatt tgatattatt gttgtcggtg gtggttccac cggttgtgct 60 cttgctggta gattaggtaa cttggacgaa aacgtcacag ttgctttaat cgaaggtggt 120 gaaaacaaca tcaacaaccc atgggtttac ttaccaggtg tttatccaag aaacatgaga 180 ttagactcaa agactgctac tttttactct tcaagaccat caccacactt gaacggtaga 240 agagctattg ttccatgtgc taacatctlg ggtggtggtt cttccatcaa cttcttgatg 300 tacaccagag cctctgcctc cgattacgat gattgggaat ctgaaggttg gactaccgat 360 gaattattac cactaatgaa gaagattgaa acttatcaaa gaccatgtaa caacagagaa 420 ttgcacggtt tcgatggtcc aattaaggtt tcatttggta actatactla tccaaacggt 480 caagatttca ttagagctgc cgaatctcaa ggtattccat ttgttgatga tgctgaagat 540 ttgaaatgtt cccacggtgc tgagcactgg ttgaagtgga tcaacagaga cttaggtaga 600 agatccgatt ctgctcatgc ttacattcac ccaaccatga gaaacaagca aaacttgttc 660 ttgattactt ccaccaagtg tgaaaagatt atcattgaaa acggtgttgc tactggtgtt 720 aagactgttc caatgaagcc aactggttct ccaaagaccc aagttgctag aactttcaag 780 gctagaaagc aaattattgt ttcttgtggt actatctcat caccattagt tttgcaaaga 840 tctggtatcg gttccgctca caagttgaga caagttggta ttaaaccaat tgttgactta 900 ccaggtgttg gtatgaactt ccaagatcac tactgtttct tcactccata ccatgtcaag 960 ttggaatatccattctccagaggtttcgttcacgttgtttctccaaacccatacgatgct 1320 ttcgaccaat ggtatgctaa caaggatggt ccattaacca ctaatggtat tgaggcaggt 1080 gttaagatta gaccaactga agaagaatta gccactgctg atgacgaatt cagagctgct 1140 tatgatgact actttggtaa caagccagat aagccattaa tgcactactc tctaatttct 1200 ggtttctttg gtgaccacac caagattcca aacggtaagt acatgtgcat gttccacttc 1260 ttggaatatc cattctccag aggtttcgtt cacgttgttt ctccaaaccc atacgatgct 1320 cctgactttg atccaggttt catgaacgat ccaagagata tgtggccaat ggtttggtct 1380 tacaagaagt ccagagaaac tgccagaaga atggactgtt ttgccggtga agttacttct 1440 caccacccac actacccata cgactcacca gccagagctg ctgacatgga cttggaaact 1500 actaaagctt atgctggtcc agaccacttt actgctaact tgtaccacgg ttcatggact 1560 gttccaattg aaaagccaac tccaaagaac gctgctcacg ttacttctaa ccaagttgaa 1620 aaacatcgtg acatcgaata caccaaggag gatgatgctg ctatcgaaga ttacatcaga 1680 gaacacactg aaaccacatg gcattgtctt ggtacttgtt caatggctcc aagagaaggt 1740 tctaaggttg tcccaactgg tggtgttgtt gactccagat taaacgttta cggtgttgaa 1800 aagttgaagg ttgctgattt atcaatttgc ccagataatg ttggttgtaa cacttactct 1860 actgctttgt taatcggtga aaaggcttct accttagttg ctgaagactt gggctactct 1920 ggtgatgctt tgaagatgac tgttccaaac ttcaaattgg gtacttatga agaagctggt 1980 ctagctagat tctag 1995 <210> 15 <211> 663 <212> PRT <213> Methanolobus horonobuensis <400> 15 Met Ala Ile Pro Glu Glu Phe Asp Ile Ile Val Val Gly Gly Gly Ser 1 5 10 15 Ala Gly Cys Pro Thr Ala Gly Arg Leu Ala Asn Leu Asp Pro Asn Leu 20 25 30 Thr Val Ala Leu Ile Glu Ala Gly Glu Asn Asn Ile Asn Asn Pro Trp 35 40 45 Val Tyr Leu Pro Gly Val Tyr Pro Arg Asn Met Arg Leu Asp Ser Lys 50 55 60 Thr Ala Thr Phe Tyr Ser Ser Arg Pro Ser Pro His Leu Asn Gly Arg 65 70 75 80 Arg Ala Ile Val Pro Cys Ala Asn Ile Leu Gly Gly Gly Ser Ser Ile 85 90 95 Asn Phe Met Met Tyr Thr Arg Gly Ser Ala Ser Asp Tyr Asp Asp Trp 100 105 110 Glu Ser Glu Gly Trp Thr Thr Asp Glu Leu Leu Pro Leu Met Lys Arg 115 120 125 Leu Glu Thr Tyr Gln Arg Pro Cys Asn Asn Pro Asp Leu His Gly Phe 130 135 140 Asp Gly Pro Ile Lys Val Ser Phe Gly Asn Tyr Thr Tyr Pro Asn Cys 145 150 155 160 Gln Asp Phe Leu Arg Ala Ala Glu Ser Gln Gly Ile Pro Phe Val Asp 165 170 175 Asp Ala Glu Asp Leu Lys Thr Ser His Ala Ser Gln His Trp Leu Lys 180 185 190 Trp Ile Asn Arg Asp Leu Gly Arg Arg Ser Asp Ala Ala His Ala Tyr 195 200 205 Ile His Pro Thr Met Arg Asn Lys Ser Asn Leu Tyr Leu Ile Thr Ser 210 215 220 Thr Lys Ala Asp Lys Val He He Glu Asp Gly Val Ala Ala Gly He 225 230 235 240 Gln Val Val Pro Ser Lys Pro Leu Asn Pro Glu Lys Pro Ala Ala Lys 245 250 255 Ile Tyr Lys Ala Arg Lys Gln He He Leu Ser Cys Gly Thr He Ser 260 265 270 Thr Pro Leu Val Leu Gln Arg Ser Gly He Gly Ser Ala His Lys Leu 275 280 285 Arg Gln Ala Gly He Lys Pro He Val Asp Leu Pro Gly Val Gly Met 290 295 300 Asn Phe Gln Asp His Tyr Cys Phe Phe Thr Pro Tyr His Val Lys Pro 305 310 315 320 Asp Thr Pro Ser Phe Asp Asp Phe Ala Arg Gly Asp Lys Ala Val Gln 325 330 335 Lys Ser Ala Phe Asp Gln Trp Tyr Ala Asn Lys Asp Gly Pro Leu Thr 340 345 350 Thr Asn Gly He Glu Ala Gly Val Lys He Arg Pro Thr Ala Glu Glu 355 360 365 Leu Ala Thr Ala Asp Glu Asp Phe Gln Leu Gly Tyr Ala Ser Tyr Phe 370 375 380 Glu Asn Lys Pro Asp Lys Pro Leu Met His Tyr Ser Leu Ile Ser Gly 385 390 395 400 Phe Phe Gly Asp His Thr Lys Ile Pro Asn Gly Lys Tyr Met Thr Met 405 410 415 Phe His Phe Leu Glu Tyr Pro Phe Ser Arg Gly Phe Val His Val Val 420 425 430 Ser Pro Ser Pro Tyr Asp Ala Pro Asp Phe Asp Pro Gly Phe Met Asn 435 440 445 Asp Pro Lys Asp Met Trp Pro Met Val Trp Ala Tyr Lys Met Ser Arg 450 455 460 Glu Thr Ala Arg Arg Met Glu Cys Phe Ala Gly Glu Val Thr Ser His 465 470 475 480 His Pro Lys Tyr Pro Tyr Asp Ser Pro Ala Arg Ala Lys Asp Leu Asp 485 490 495 Leu Glu Thr Cys Lys Ala Tyr Ala Gly Pro Asp His Phe Thr Ala Asn 500 505 510 Leu Tyr His Gly Ser Trp Thr Ile Pro Leu Glu Lys Pro Thr Pro Lys 515 520 525 Asn Thr Ser His Val Thr Ser Asn Gln Val Glu Leu His Ala Gln Leu 530 535 540 Glu Tyr Ser Lys Glu Asp Asp lie Ala lie Glu Asn Tyr lie Lys Glu 545 550 555 560 His Val Glu Thr Thr Trp His Cys Leu Gly Thr Cys Ser Met Ala Pro 565 570 575 Arg Glu Gly Ser Ser lie Val Pro Thr Gly Gly Val Val Asp Glu Arg 580 585 590 Leu Asn Val Tyr Asp Val Ala His Leu Lys Cys Ala Asp Leu Ser lie 595 600 605 Cys Pro Asp Asn Val Gly Cys Asn Thr Tyr Ser Thr Ala Leu Leu Val 610 615 620 Gly Glu Lys Ala Ser Met lie Val Ala Glu Asp Leu Gly Tyr Ser Gly 625 630 635 640 Ala Glu Leu Asp Met Thr lie Pro Gly Phe Lys Leu Gly Thr Tyr Glu 645 650 655 Ser Thr Gly Leu Gly Arg Phe 660 <210> 16 <211> 1992 <212> DNA <213> Methanolobus horonholis <400> 16 atggctattc ctgaagaatt cgatatcatt gttgtcggtg gtggttctgc cggctgtcct 60 actgctggta gattggctaa cttagaccca aatttaactg ttgctttaat cgaagctggt 120 gaaaacaaca ttaacaaccc atgggtctac ttaccaggcg tttacccaag aaacatgaga 180 ttagactcca aaactgcaac tttctactct tctagacctt ccccacattt aaatggtaga 240 agagctattg ttccatgtgc taatatctla ggtggtggtt cttcaattaa cttcatgatg 300 tacactagag gttcagcttc tgattatgat gactgggaat ccgaaggttg gactaccgat 360 gaattattgc cattgatgaa aagattagaa acttatcaaa gaccatgtaa caaccctgat 420 ttgcacggtt tcgacggccc tatcaaggtc tccttcggta actacactla tcctaactgt 480 caagatttct taagagccgc tgaatctcaa ggtattccat ttgttgatga tgctgaagat 540 ttaaagactt ctcatgcttc ccaacactgg ctgaagtgga ttaacagaga cctgggtaga 600 agatctgatg ctgcgcatgc ttacattcac ccaactatga gaaacaagtc aaacttatac 660 ttgatcactt ccactaaggc tgataaagtt ataattgaag atggagttgc agctggtatt 720 caagttgttc cttccaaacc attgaaccca gaaaagccgg ctgccaagat ctacaaggct 780 agaaagcaaa tcattctatc ctgtggtaca atttctaccc cgttggtcct ac...

Claims

1. A recombinant methanol utilization pathway-deficient methanol auxotroph (Mut-) host cell engineered by: a) one or more genetic modifications to reduce expression of a first endogenous gene and a second endogenous gene compared to the host cell prior to the one or more genetic modifications, wherein i. the first endogenous gene encodes an alcohol oxidase 1 (AOX1) comprising an amino acid sequence identified as SEQ ID NO: 1 or a homolog thereof having at least 95% sequence identity to SEQ ID NO: 1; and ii. the second endogenous gene encodes an alcohol oxidase 2 (AOX2) comprising an amino acid sequence identified as SEQ ID NO: 3 or a homolog thereof having at least 95% sequence identity to SEQ ID NO: 3; and b) one or more genetic modifications to increase expression of an alcohol dehydrogenase (ADH2) gene as compared to the host cell prior to the one or more genetic modifications, wherein ADH2 the ADH2 gene encodes an alcohol dehydrogenase (ADH2) comprising an amino acid sequence identified as SEQ ID NO: 50 or a homolog thereof having at least 95% sequence identity to SEQ ID NO:

50. ADH2 the ADH2 gene encodes an alcohol dehydrogenase (ADH2) comprising an amino acid sequence identified as SEQ ID NO: 50 or a homolog thereof having at least 95% sequence identity to SEQ ID NO:

50.

2. The Mut- host cell of claim 1, wherein the one or more genetic modifications comprise a disruption, substitution, deletion, knock-in, or knock-out of (i) one or more polynucleotides or portions thereof; or (ii) an expression control sequence.

3. The Mut- host cell of claim 2, wherein the expression control sequence is selected from the group consisting of: a promoter, a ribosome binding site, a transcriptional or translational initiation and termination sequence, an enhancer, and an activator sequence.

4. The Mut- host cell of claim 1, wherein the first endogenous gene and / or second endogenous gene is knocked out by the one or more genetic modifications.

5. The Mut-Host cell of claim 1, wherein ADH2 The gene is endogenous or heterologous to the Mut-Host cell.

6. The Mut- host cell of claim 1, wherein ADH2 comprises a Pichia pastoris ADH2 comprising an amino acid sequence identified as SEQ ID NO: 50 or a homolog thereof.

7. The Mut-Host cell of claim 1, wherein the one or more genetic modifications comprise ADH2 a gain-of-function alteration of a gene resulting in increased ADH2 levels or activity.

8. The Mut-Host cell of claim 7, wherein the gain-of-function alteration comprises a knock-in ADH2 gene.

9. The Mut-Host cell of claim 7, wherein the gain-of-function alteration upregulates expression of ADH2 a gene in the cell.

10. The Mut-Host cell of claim 7, wherein the gain-of-function alteration comprises insertion of a heterologous expression cassette to overexpress a gene in the cell. ADH2 gene.

11. The Mut-Host cell of claim 10, wherein the heterologous expression cassette comprises a heterologous polynucleotide comprising a gene under the control of a promoter sequence. ADH2 gene.

12. The Mut- host cell of claim 1, comprising a heterologous gene of interest expression cassette (GOIEC) comprising an expression cassette promoter (ECP) operably linked to a gene of interest (GOI) encoding a protein of interest (POI).

13. The Mut- host cell of claim 12, wherein the ECP is a methanol inducible promoter.

14. The Mut- host cell of claim 13, wherein the ECP is any one of: a) a pAOX1 promoter having at least 95% sequence identity to SEQ ID NO: 5; b) a pAOX2 promoter having at least 95% sequence identity to SEQ ID NO: 6; or c) a promoter comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 36-49.

15. The Mut- host cell of claim 12, wherein the GOIEC further comprises a nucleotide sequence encoding a signal peptide capable of secreting the POI.

16. The Mut-Host cell of claim 15, wherein the nucleotide sequence encoding a signal peptide is fused adjacent to the 5' end of a GOI.

17. The Mut-Host cell of claim 12, wherein a POI is heterologous to the Mut-Host cell or an ECP.

18. The Mut-Host cell of claim 12, wherein a POI is a peptide or protein selected from the group consisting of an antigen binding protein, an enzyme, a toxin fusion protein, a structural protein, a regulatory protein, and a vaccine antigen.

19. The Mut-Host cell of claim 18, wherein the protein is a therapeutic protein.

20. The Mut-Host cell of claim 18, wherein the protein is selected from a protein antibiotic, a growth factor, a hormone, and a cytokine.

21. The Mut-Host cell of claim 18, wherein the enzyme is a processing enzyme.

22. The Mut-Host cell of claim 1, wherein the Mut-Host cell is a yeast cell of the genus Pichia or Komagataella.

23. A method of producing a protein of interest (POI), the method comprising culturing a Mut-Host cell of claim 1 to produce a POI using methanol as a carbon source.

24. The method of claim 23, wherein a fermentation product comprising a POI or a host cell metabolite obtained from a Mut-Host cell is isolated from the cell culture.

25. The method of claim 23, wherein a) a growth phase during which the Mut-Host cell is cultured using a basal carbon source as an energy source; followed by b) a production phase during which the Mut-Host cell is cultured using a methanol feed, thereby producing a POI.

26. The method of claim 25, wherein an average methanol concentration of 0.5-2.0% (v / v) is used in the host cell culture during the production phase of at least 24 hours.

27. The method of claim 25, wherein an average feed rate of the methanol feed is at least 2 mg methanol / (g dry biomass*h) during the production phase of at least 24 hours.

28. The method of claim 25, wherein the Mut-Host cell is cultured during the production phase under conditions that limit host cell growth to less than 10% (w / w biomass).

29. Use of a recombinant methanol utilization pathway-deficient methanol auxotrophic yeast (Mut-) host cell in a method of producing a fermentation product, the method comprising culturing the Mut-Host cell under conditions that allow the Mut-Host cell to use methanol as a substrate for alcohol dehydrogenase (ADH2) and produce a fermentation product, wherein the method is the method of claim 23.

30. Use of a recombinant methanol utilization pathway-deficient methanol auxotroph (Mut ) host cell engineered by one or more genetic modifications a) to reduce expression of a first endogenous gene and a second endogenous gene as compared to the host cell prior to the one or more genetic modifications, wherein i. the first endogenous gene encodes an alcohol oxidase 1 (AOX1) comprising an amino acid sequence identified as SEQ ID NO: 1 or a homolog thereof having at least 95% sequence identity to SEQ ID NO: 1; and ii. the second endogenous gene encodes an alcohol oxidase 2 (AOX2) comprising an amino acid sequence identified as SEQ ID NO: 3 or a homolog thereof having at least 95% sequence identity to SEQ ID NO: 3; and b) To increase alcohol dehydrogenase ( ADH2 ) gene expression, among which ADH2 The gene encodes an alcohol dehydrogenase (ADH2) comprising the amino acid sequence identified as SEQ ID NO: 50 or a homolog thereof having at least 95% sequence identity to SEQ ID NO: 50.

Citation Information

Patent Citations

  • Vaccines for protecting cattle and sheep against bovine leukemia virus

    EP0051216A1

  • Recombinant Pichia pastoris strains and process for the production of recombinant human interferon alpha

    EP1905836A1

  • liquid level

    FR839629A

  • Improvements in or relating to Carburettors or Apparatus for Mixing any Desired Proportion of Air with Gas or Vapour-especially applicable for use on Motor Cars Employing Coal Gas.

    GB122004A

  • Protease-deficient strains of Pichia methanolica

    US6153424A