An antibody targeting 4-1BB and its application

Abstract

The present invention provides an anti-4-1BB nanobody and its derivatives and uses. Specifically, the present invention provides an anti-4-1BB nanobody. The anti-4-1BB nanobody of the present invention has a small molecular weight; it can bind to human 4-1BB and cross-bind to 4-1BB of cynomolgus monkeys; it needs to activate T cells with the help of external cross-linking, indicating that the nanobody of the present invention has both excellent anti-tumor activity and safety. The present invention also provides a nanobody that can bind to the CRD4 region of the 4-1BB protein, which is a new antibody binding site.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to an antibody targeting 4-1BB and an application thereof. Background Art

[0002] Tumor necrosis factor receptor superfamily (4-1BB), also known as CD137 or TNFRF9, is a member of the TNF receptor family. 4-1BB is a type I transmembrane protein with a reading frame containing 255 amino acids (NCBI: NP_001552), consisting of an N-terminal signal peptide containing 17 amino acids, an extracellular region of 169 amino acids, a transmembrane region of 27 amino acids, and a C-terminal intracellular region of 42 amino acids. 4-1BB molecules are mainly expressed in activated T cells, NK cells, regulatory T cells, dendritic cells, monocytes, neutrophils and eosinophils, and endothelial cells of tumor blood vessels have also been reported to express 4-1BB.

[0003] During the activation of T cells, 4-1BB molecules can provide co-stimulatory signals for them. When the T cell receptor contacts the antigen, the expression of 4-1BB will increase. After 4-1BB binds to the ligand, it will cause the activation of the NFκB signaling pathway, leading to the activation and proliferation of T cells, and 4-1BB can also inhibit the apoptosis of activated cells. Animal models and in vitro experiments have confirmed that anti-4-1BB monoclonal antibodies have anti-tumor activity. It can selectively cause the proliferation of CD8+T cells, upregulate the expression of proinflammatory cytokine IFNγ, and enhance the killing effect of antigen-specific effector T cells, thereby promoting tumor clearance. Anti-4-1BB monoclonal antibodies can also cause the proliferation of NK cells and increase the cytotoxic activity of CD8+T cells through them. Anti-4-1BB antibodies can also cause the endothelial cells of the blood vessels of tumor cells to upregulate the expression of adhesion molecules and promote the infiltration of activated T lymphocytes into tumor tissues. In addition, in animal models, anti-4-1BB activating antibodies can also alleviate autoimmune diseases such as autoimmune encephalomyelitis, lupus-like syndrome and collagen-induced arthritis.

[0004] Therefore, 4-1BB is an important target in the treatment of tumors and some autoimmune diseases. Currently, there are two 4-1BB antibodies undergoing clinical trials: Urelumab (BMS-663513, developed by Bristol-Myers Squibb) and Utomilumab (PF-05082566, developed by Pfizer). Studies have shown that Urelumab is a potent activator with good activation activity, but it also has adverse reactions such as liver toxicity and fatigue; while Utomilumab has an advantage in safety, but compared with Urelumab, it has lower receptor agonist activity.

[0005] Therefore, there is an urgent need in the art to develop an antibody and related drugs that can more efficiently target 4-1BB. Summary of the invention

[0006] The purpose of the present invention is to provide an antibody and related drugs that more efficiently target 4-1BB.

[0007] In a first aspect of the present invention, an anti-4-1BB nanobody is provided, wherein the VHH chain of the anti-4-1BB nanobody has an amino acid sequence as shown in any one of SEQ ID NOs: 1-40;

[0008] Among them, any one of the above amino acid sequences also includes a derivative sequence that is optionally added, deleted, modified and / or substituted with 1-8 (preferably 1-5, more preferably 1-3) amino acid residues and can retain the 4-1BB binding affinity of the 4-1BB nanobody.

[0009] In another preferred example, the amino acid sequence of the VHH chain of the anti-4-1BB nanobody is as shown in any one of SEQ ID NO: 3, 35, 37, 38, 39 or 40.

[0010] In the second aspect of the present invention, a fusion protein is provided, wherein the fusion protein has a structure as shown in Formula I from the N-terminus to the C-terminus:

[0011] Z1-L-Z2 (Formula I)

[0012] In the formula,

[0013] Z1 is one or more (preferably 1-2, more preferably 1) VHH chains of the anti-4-1BB nanobody as described in the first aspect of the present invention;

[0014] Z2 is the Fc segment of immunoglobulin;

[0015] L is an optional linker sequence.

[0016] In another preferred embodiment, the fusion protein is a dimer, and the dimer is formed by disulfide bonds between the Fc segments in Z2.

[0017] In another preferred embodiment, the immunoglobulin is IgG1, IgG2, IgG3 or IgG4; preferably IgG1, IgG2 or IgG4.

[0018] In another preferred embodiment, the immunoglobulin is IgG1, or a mutant thereof.

[0019] In another preferred embodiment, the L has an amino acid sequence selected from the group consisting of: GGGGS, (GGGGS) 2 、(GGGGS)3 、(GGGGS) 4 、(GGGGS) 5 , or a combination thereof.

[0020] In another preferred example, the amino acid sequence of Z2 is shown in SEQ ID NO:167.

[0021] In another preferred example, the amino acid sequence of Z2 is identical or substantially identical to the amino acid sequence shown in SEQ ID NO:167.

[0022] In another preferred embodiment, the basic identity means that there are at most 50 (preferably 1-20, more preferably 1-10, more preferably 1-5, and most preferably 1-3) amino acid differences, wherein the differences include amino acid substitutions, deletions or additions.

[0023] In another preferred embodiment, the substantial identity means that the amino acid sequence has a sequence identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the corresponding amino acid sequence.

[0024] In another preferred embodiment, in the formula I of the fusion protein, the amino acid sequence of Z1 is as shown in any one of SEQ ID NOs: 1-40, and L is absent, and the amino acid sequence of Z2 is as shown in SEQ ID NO: 167;

[0025] Among them, any one of the above amino acid sequences also includes a derivative sequence that is optionally added, deleted, modified and / or substituted with 1-8 (preferably 1-5, more preferably 1-3) amino acid residues and can retain 4-1BB binding affinity.

[0026] In another preferred embodiment, in the formula I of the fusion protein, the amino acid sequence of Z1 is shown in any one of SEQ ID NO: 3, 35, 37, 38, 39 or 40, and L is absent, and the amino acid sequence of Z2 is shown in SEQ ID NO: 167;

[0027] Among them, any one of the above amino acid sequences also includes a derivative sequence that is optionally added, deleted, modified and / or substituted with 1-8 (preferably 1-5, more preferably 1-3) amino acid residues and can retain 4-1BB binding affinity.

[0028] In another preferred example, the amino acid sequence of the fusion protein, from N-terminus to C-terminus, is: a sequence as shown in any one of SEQ ID NOs: 1-40 and a sequence as shown in SEQ ID NO: 167.

[0029] In another preferred example, the amino acid sequence of the fusion protein, from N-terminus to C-terminus, is: a sequence as shown in any one of SEQ ID NO: 3, 35, 37, 38, 39 or 40, and a sequence as shown in SEQ ID NO: 167.

[0030] In the third aspect of the present invention, a polynucleotide is provided, which encodes the anti-4-1BB nanobody as described in the first aspect of the present invention or the fusion protein as described in the second aspect of the present invention.

[0031] In another preferred embodiment, the polynucleotide includes DNA or RNA.

[0032] In the fourth aspect of the present invention, an expression vector is provided, wherein the expression vector contains the polynucleotide as described in the third aspect of the present invention.

[0033] In the fifth aspect of the present invention, a host cell is provided, wherein the host cell contains the expression vector as described in the fourth aspect of the present invention, or the polynucleotide as described in the third aspect of the present invention is integrated into its genome.

[0034] In another preferred embodiment, the host cell includes a prokaryotic cell or a eukaryotic cell.

[0035] In another preferred embodiment, the host cell is selected from the following group: Escherichia coli, yeast cells, and mammalian cells.

[0036] In a sixth aspect of the present invention, a method for producing an anti-4-1BB nanobody or fusion protein is provided, comprising the steps of:

[0037] (a) culturing the host cell as described in the fifth aspect of the present invention under conditions suitable for producing anti-4-1BB nanobody or fusion protein, thereby obtaining a culture containing the anti-4-1BB nanobody or fusion protein; and

[0038] (b) separating or recovering the anti-4-1BB nanobody or fusion protein from the culture.

[0039] In a seventh aspect of the present invention, an immunoconjugate is provided, wherein the immunoconjugate comprises:

[0040] (a) the anti-4-1BB nanobody as described in the first aspect of the present invention, or the fusion protein as described in the second aspect of the present invention; and

[0041] (b) a conjugated moiety selected from the group consisting of a detectable label, a drug, a toxin, a cytokine, a radionuclide, or an enzyme.

[0042] In another preferred embodiment, the coupling moiety is a drug or a toxin.

[0043] In another preferred embodiment, the coupling moiety is a detectable label.

[0044] In another preferred embodiment, the conjugate is selected from: fluorescent or luminescent markers, radioactive markers, MRI (magnetic resonance imaging) or CT (computer tomography) contrast agents, or enzymes capable of producing detectable products, radionuclides, biotoxins, cytokines (such as IL-2, etc.), antibodies, antibody Fc fragments, antibody scFv fragments, gold nanoparticles / nanorods, viral particles, liposomes, nanomagnetic particles, prodrug activating enzymes (for example, DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)), chemotherapeutic agents (for example, cisplatin) or any form of nanoparticles, etc.

[0045] In another preferred embodiment, the immunoconjugate contains: a multivalent (eg, bivalent) anti-4-1BB nanobody as described in the first aspect of the present invention, or a fusion protein as described in the second aspect of the present invention.

[0046] In another preferred embodiment, the multivalency refers to the anti-4-1BB nanobody as described in the first aspect of the present invention, or the fusion protein as described in the second aspect of the present invention, which contains multiple repeats in the amino acid sequence of the immunoconjugate.

[0047] In the eighth aspect of the present invention, there is provided the use of the anti-4-1BB nanobody as described in the first aspect of the present invention or the fusion protein as described in the second aspect of the present invention for preparing (a) a reagent for detecting 4-1BB molecules; (b) a drug for treating tumors.

[0048] In another preferred embodiment, the detection includes flow cytometry detection and cell immunofluorescence detection.

[0049] In the ninth aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0050] (i) the anti-4-1BB nanobody as described in the first aspect of the present invention, the fusion protein as described in the second aspect of the present invention, or the immunoconjugate as described in the seventh aspect of the present invention; and

[0051] (ii) a pharmaceutically acceptable carrier.

[0052] In another preferred embodiment, the pharmaceutical composition is in the form of an injection.

[0053] In another preferred embodiment, the pharmaceutical composition is used to prepare a drug for treating tumors, and the tumor is selected from the following group: gastric cancer, liver cancer, leukemia, kidney tumor, lung cancer, small intestine cancer, bone cancer, prostate cancer, colorectal cancer, breast cancer, colon cancer, cervical cancer, lymphoma, adrenal tumor, bladder tumor, melanoma, head and neck cancer, nasopharyngeal cancer, thyroid tumor, tongue cancer or a combination thereof.

[0054] In the tenth aspect of the present invention, one or more uses of the anti-4-1BB nanobody as described in the first aspect of the present invention or the fusion protein as described in the second aspect of the present invention are provided:

[0055] (i) Used to detect human 4-1BB molecule;

[0056] (ii) for flow cytometry;

[0057] (iii) used for cell immunofluorescence detection;

[0058] (iv) for the treatment of tumors; and

[0059] (v) Used in tumor diagnosis.

[0060] In another preferred embodiment, the use is non-diagnostic and non-therapeutic.

[0061] In the eleventh aspect of the present invention, a recombinant protein is provided, wherein the recombinant protein has:

[0062] (i) the anti-4-1BB nanobody as described in the first aspect of the present invention, or the sequence of the fusion protein as described in the second aspect of the present invention; and

[0063] (ii) optionally a tag sequence to facilitate expression and / or purification.

[0064] In another preferred embodiment, the tag sequence includes: 6His tag, HA tag, Flag tag, Fc tag, or a combination thereof.

[0065] In another preferred embodiment, the recombinant protein specifically binds to the 4-1BB protein.

[0066] In the twelfth aspect of the present invention, there is provided the use of the anti-4-1BB nanobody as described in the first aspect of the present invention, the fusion protein as described in the second aspect of the present invention, or the immunoconjugate as described in the seventh aspect of the present invention, which is used to prepare a medicament, a reagent, a detection plate or a kit;

[0067] Wherein, the reagent, detection plate or kit is used for: detecting 4-1BB protein in a sample;

[0068] The medicament is used to treat or prevent various blood tumors and solid tumors.

[0069] In another preferred embodiment, the tumor includes: gastric cancer, lymphoma, liver cancer, leukemia, kidney tumor, lung cancer, small intestine cancer, bone cancer, prostate cancer, colorectal cancer, breast cancer, colon cancer, adrenal tumor, melanoma, head and neck cancer, nasopharyngeal cancer, thyroid tumor, tongue cancer or a combination thereof.

[0070] In the thirteenth aspect of the present invention, a method for detecting 4-1BB protein in a sample is provided, comprising the steps of:

[0071] (1) contacting the sample with the anti-4-1BB nanobody as described in the first aspect of the present invention or the fusion protein as described in the second aspect of the present invention;

[0072] (2) Detecting whether an antigen-antibody complex is formed, wherein the formation of the complex indicates the presence of 4-1BB protein in the sample.

[0073] In another preferred embodiment, the detection includes qualitative detection and quantitative detection.

[0074] In the fourteenth aspect of the present invention, a method for treating a disease is provided, the method comprising administering to a subject in need thereof the anti-4-1BB nanobody as described in the first aspect of the present invention, the fusion protein as described in the second aspect of the present invention, or the immunoconjugate as described in the seventh aspect of the present invention.

[0075] In another preferred embodiment, the subject includes mammals.

[0076] In another preferred embodiment, the mammal is a human.

[0077] In a fifteenth aspect of the present invention, a protein complex is provided, wherein the complex is formed by interaction between a 4-1BB protein and an anti-4-1BB antibody or an antigen-binding fragment thereof.

[0078] In another preferred embodiment, the interaction includes hydrogen bonding and hydrophobic interaction.

[0079] In another preferred embodiment, the anti-4-1BB antibody is an anti-4-1BB nanobody.

[0080] In another preferred embodiment, the anti-4-1BB antibody is the anti-4-1BB nanobody as described in the first aspect of the present invention.

[0081] In another preferred embodiment, the complex is formed by 4-1BB protein and anti-4-1BB antibody or its antigen-binding fragment through hydrogen bonding and / or hydrophobic interactions;

[0082] Wherein, the hydrogen bonding sites include 4 or more (preferably 5 or more, more preferably 6 or more, and most preferably 7) located in the 4-1BB protein and selected from the following groups: Asp at position 118, Leu at position 123, Arg at position 130, Val at position 132, Cys at position 134, Gly at position 135, and Ser at position 137;

[0083] Furthermore, the constituent sites of the hydrophobic interaction interface include two or more (preferably three or more, more preferably four or more) sites located in the 4-1BB protein selected from the following group: Leu at position 123, Val at position 124, Val at position 133, and Pro at position 136;

[0084] The amino acid numbering of the 4-1BB protein is based on that of SEQ ID NO:168.

[0085] In another preferred embodiment, the hydrophobic interaction interface further includes 4 or more (preferably 5 or more, more preferably 6 or more, and most preferably 7 or more or 8 or more) sites located in the anti-4-1BB antibody or its antigen-binding fragment selected from the following group: Val at position 32, Ala at position 33, Tyr at position 37, Leu at position 47, Ile at position 52, Tyr at position 97, Tyr at position 102, and Trp at position 115;

[0086] Wherein, the amino acid numbering of the anti-4-1BB antibody or its antigen-binding fragment is based on the numbering of SEQ ID NO: 169 or 39.

[0087] In another preferred example, the amino acid sequence of the 4-1BB protein in the complex is shown in SEQ ID NO:168.

[0088] In another preferred example, the amino acid sequence of the anti-4-1BB nanobody in the complex is shown in SEQ ID NO: 169 or 39.

[0089] In another preferred embodiment, the hydrogen bonding is located at Asp 118, Leu 123, Arg 130, Val 132, Cys 134, Gly 135, and / or Ser 137 of the 4-1BB protein;

[0090] Wherein, the amino acid numbering is based on the numbering of SEQ ID NO:168.

[0091] In another preferred embodiment, the hydrophobic interaction interface is located at Leu 123, Val 124, Val 133 and / or Pro 136 of the 4-1BB protein, and Val 32, Ala 33, Tyr 37, Leu 47, Ile 52, Tyr 97, Tyr 102 and / or Trp 115 of the VHH chain of the anti-4-1BB nanobody;

[0092] Wherein, the amino acid numbering of the 4-1BB protein is based on the numbering of SEQ ID NO: 168, and the amino acid numbering of the VHH chain of the anti-4-1BB nanobody is based on the numbering of SEQ ID NO: 169 or 39.

[0093] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0094] Figure 1 The 4-1BB antibody of the present invention is shown to bind to CHO cells stably expressing human 4-1BB.

[0095] Figure 2 The 4-1BB antibody of the present invention binds to the cynomolgus monkey 4-1BB protein.

[0096] Figure 3 The 4-1BB antibody of the present invention activates primary T cells to produce IFN-γ.

[0097] Figure 4 The figure shows that the genetically engineered 4-1BB antibody of the present invention binds to CHO cells that stably express human 4-1BB.

[0098] Figure 5 The figure shows the binding of the genetically engineered 4-1BB antibody of the present invention to CHO cells that stably express cynomolgus monkey 4-1BB.

[0099] Figure 6 The figure shows how the genetically engineered 4-1BB antibody of the present invention activates primary T cells to produce IFN-γ.

[0100] Figure 7 A shows the situation where the genetically engineered 4-1BB antibody of the present invention blocks the binding of the 4-1BB ligand to 4-1BB.

[0101] Figure 7B shows the specific binding of the genetically engineered 4-1BB antibody of the present invention to 4-1BB.

[0102] Figure 8 A crystal schematic of the 4-1BB-VHH complex is shown.

[0103] Fig. 9 The crystal structure of the 4-1BB-VHH complex is shown. The green color is the 4-1BB protein, and the blue color is the VHH chain of the anti-4-1BB nanobody.

[0104] Fig.10 The hydrogen bond interaction interface in the crystal structure of the 4-1BB-VHH complex is shown. The green color is the 4-1BB protein, and the blue color is the VHH chain of the anti-4-1BB nanobody.

[0105] Fig.11 The hydrophobic interaction interface in the crystal structure of the 4-1BB-VHH complex is shown. The green color is the 4-1BB protein, and the blue color is the VHH chain of the anti-4-1BB nanobody. DETAILED DESCRIPTION

[0106] After extensive and in-depth research, the inventors have developed a nano antibody against human 4-1BB for the first time after a large amount of screening. Specifically, the inventors of the present invention use human 4-1BB antigen protein to immunize alpacas (Llama) to obtain a high-quality immune nano antibody gene library. Among them, the inventors screened and obtained two anti-4-1BB nano antibodies that can bind to both human and cynomolgus monkey 4-1BB in the immune nano antibody gene library, and at the same time need to use external cross-linking to play an activating role. The sequences of the two nano antibodies are then optimized, the genetically engineered mutants are expressed and purified, and further screening is performed from aspects such as antibody affinity, cross-binding with cynomolgus monkey 4-1BB, and activation of T cells, thereby obtaining a class of nano antibody strains that can be efficiently expressed in vitro and have high specificity. The experimental results show that the anti-4-1BB nano antibody and fusion protein of the present invention have the advantages of small molecular weight, cross-linking with cynomolgus monkeys, not blocking the natural binding of 4-1BB ligands to 4-1BB, strong T cell activation, and good safety. The present invention was completed on this basis.

[0107] the term

[0108] In order that the present disclosure may be more readily understood, certain terms are first defined. As used in this application, unless otherwise expressly provided herein, each of the following terms shall have the meaning given below.

[0109] As used herein, the term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

[0110] As used herein, the terms "administering", "administering" and "administering" are used interchangeably and refer to the physical introduction of the product of the present invention into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, such as by injection or infusion.

[0111] Nanobodies of the present invention

[0112] As used herein, the terms "nanoantibodies of the present invention", "anti-4-1BB nanoantibodies of the present invention", and "4-1BB nanoantibodies of the present invention" are used interchangeably, all referring to nanoantibodies that specifically recognize and bind to 4-1BB (including human 4-1BB). Particularly preferred are nanoantibodies having an amino acid sequence of a VHH chain as shown in any one of SEQ ID NOs: 1-40, and more preferably nanoantibodies having an amino acid sequence of a VHH chain as shown in any one of SEQ ID NOs: 3, 35, 37, 38, 39 or 40.

[0113] As used herein, the terms "single domain antibody (VHH)" and "nanobody" have the same meaning, referring to cloning the variable region of the antibody heavy chain to construct a single domain antibody (VHH) consisting of only one heavy chain variable region, which is the smallest antigen-binding fragment with complete functions. Usually, an antibody naturally lacking the light chain and heavy chain constant region 1 (CH1) is first obtained, and then the variable region of the antibody heavy chain is cloned to construct a single domain antibody (VHH) consisting of only one heavy chain variable region.

[0114] As used herein, the term "antibody" or "immunoglobulin" is a heterotetrameric glycoprotein of about 150,000 daltons with identical structural features, consisting of two identical light chains (L) and two identical heavy chains (H). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide bonds between the heavy chains of different immunoglobulin isotypes varies. Each heavy and light chain also has regularly spaced intrachain disulfide bonds. Each heavy chain has a variable region (VH) at one end, followed by multiple constant regions. Each light chain has a variable region (VL) at one end and a constant region at the other end; the constant region of the light chain is opposite to the first constant region of the heavy chain, and the variable region of the light chain is opposite to the variable region of the heavy chain. Specific amino acid residues form an interface between the variable regions of the light and heavy chains.

[0115] As used herein, the term "variable" means that some parts of the variable region in an antibody are different in sequence, which forms the binding and specificity of various specific antibodies to their specific antigens. However, variability is not evenly distributed throughout the variable region of an antibody. It is concentrated in three fragments called complementary determining regions (CDRs) or hypervariable regions in the variable regions of light and heavy chains. The more conservative part of the variable region is called the framework region (FR). The variable regions of natural heavy and light chains each contain four FR regions, which are roughly in a β-folded configuration, connected by three CDRs forming a connecting loop, and in some cases can form a partial β-folded structure. The CDRs in each chain are closely together through the FR region and together with the CDRs of the other chain form the antigen-binding site of the antibody (see Kabat et al., NIH Publ. No. 91-3242, Volume I, 647-669 pages (1991)). The constant region does not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as participating in the antibody's antibody-dependent cytotoxicity.

[0116] As known to those skilled in the art, immunoconjugates and fusion expression products include: drugs, toxins, cytokines (cytokines), radionuclides, enzymes and other diagnostic or therapeutic molecules combined with antibodies or fragments thereof of the present invention to form conjugates. The present invention also includes cell surface markers or antigens combined with the anti-4-1BB protein antibody or fragment thereof.

[0117] As used herein, the term "heavy chain variable region" is synonymous with "V H ” can be used interchangeably.

[0118] As used herein, the term "variable region" and "complementarity determining region (CDR)" are used interchangeably.

[0119] In a preferred embodiment of the present invention, the heavy chain variable region of the antibody includes three complementarity determining regions CDR1, CDR2, and CDR3.

[0120] In a preferred embodiment of the present invention, the heavy chain of the antibody includes the above-mentioned heavy chain variable region and heavy chain constant region.

[0121] In the present invention, the terms "antibody of the present invention", "protein of the present invention", or "polypeptide of the present invention" are used interchangeably, and all refer to polypeptides that specifically bind to 4-1BB protein, such as proteins or polypeptides having a heavy chain variable region. They may or may not contain an initial methionine.

[0122] The present invention also provides other proteins or fusion expression products having the antibodies of the present invention. Specifically, the present invention includes any protein or protein conjugate and fusion expression product (i.e., immunoconjugate and fusion expression product) having a heavy chain containing a variable region, as long as the variable region is identical to or at least 90% homologous to the heavy chain variable region of the antibodies of the present invention, preferably at least 95% homologous.

[0123] Generally, the antigen binding properties of an antibody can be described by three specific regions located in the variable region of the heavy chain, called the variable region (CDR). This segment is divided into four framework regions (FR). The amino acid sequences of the four FRs are relatively conservative and do not directly participate in the binding reaction. These CDRs form a ring structure, and the β-folds formed by the FRs in between are close to each other in spatial structure. The CDRs on the heavy chain and the CDRs on the corresponding light chain constitute the antigen binding site of the antibody. The amino acid sequences of antibodies of the same type can be compared to determine which amino acids constitute the FR or CDR region.

[0124] The variable regions of the heavy chains of the antibodies of the present invention are of particular interest because they are at least partially involved in binding to antigen. Therefore, the present invention includes molecules having antibody heavy chain variable regions with CDRs, as long as their CDRs have more than 90% (preferably more than 95%, and most preferably more than 98%) homology with the CDRs identified herein.

[0125] The present invention includes not only complete antibodies, but also fragments of antibodies with immunological activity or fusion proteins formed by antibodies and other sequences. Therefore, the present invention also includes fragments, derivatives and analogs of the antibodies.

[0126] As used herein, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially retain the same biological function or activity as the antibodies of the present invention. The polypeptide fragments, derivatives or analogs of the present invention may be (i) polypeptides in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) polypeptides having a substitution group in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence or proprotein sequence used to purify the polypeptide, or a fusion protein formed with a 6His tag). According to the teachings herein, these fragments, derivatives and analogs are within the scope known to those skilled in the art.

[0127] The antibody of the present invention refers to a polypeptide having 4-1BB protein binding activity and including the above-mentioned CDR region. The term also includes variant forms of polypeptides having the same function as the antibody of the present invention and including the above-mentioned CDR region. These variant forms include (but are not limited to): one or more (usually 1-50, preferably 1-30, more preferably 1-20, and optimally 1-10) amino acid deletions, insertions and / or substitutions, and addition of one or several (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. For example, in the art, when amino acids with similar or similar properties are substituted, the function of the protein is usually not changed. For another example, adding one or several amino acids at the C-terminus and / or N-terminus usually does not change the function of the protein. The term also includes active fragments and active derivatives of the antibodies of the present invention.

[0128] Variant forms of the polypeptide include: homologous sequences, conservative variants, allelic variants, natural mutants, induced mutants, proteins encoded by DNA that can hybridize with the encoding DNA of the antibody of the present invention under high or low stringency conditions, and polypeptides or proteins obtained using the antiserum of the antibody of the present invention.

[0129] The invention also provides other polypeptides, such as fusion proteins comprising nanobodies or fragments thereof. In addition to almost full-length polypeptides, the invention also includes fragments of nanobodies of the invention. Typically, the fragment has at least about 50 consecutive amino acids of an antibody of the invention, preferably at least about 50 consecutive amino acids, more preferably at least about 80 consecutive amino acids, and most preferably at least about 100 consecutive amino acids.

[0130] In the present invention, "conservative variants of the antibodies of the present invention" refer to polypeptides formed by replacing at most 10, preferably at most 8, more preferably at most 5, and most preferably at most 3 amino acids with amino acids having similar or similar properties compared to the amino acid sequence of the antibodies of the present invention. These conservative variant polypeptides are preferably generated by amino acid substitution according to Table A.

[0131] Table A

[0132]

[0133]

[0134] The present invention also provides a polynucleotide molecule encoding the above-mentioned antibody or its fragment or its fusion protein. The polynucleotide of the present invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand.

[0135] The polynucleotide encoding the mature polypeptide of the present invention includes: a coding sequence encoding only a mature polypeptide; a coding sequence of a mature polypeptide and various additional coding sequences; a coding sequence of a mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0136] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or may include additional coding and / or non-coding sequences.

[0137] The present invention also relates to polynucleotides that hybridize with the above-mentioned sequences and have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides that can hybridize with the polynucleotides of the present invention under stringent conditions. In the present invention, "stringent conditions" refer to: (1) hybridization and elution at relatively low ionic strength and relatively high temperature, such as 0.2×SSC, 0.1% SDS, 60°C; or (2) addition of denaturing agents during hybridization, such as 50% (v / v) formamide, 0.1% calf serum / 0.1% Ficoll, 42°C, etc.; or (3) hybridization occurs only when the identity between the two sequences is at least 90%, preferably at least 95%. In addition, the polypeptide encoded by the hybridizable polynucleotide has the same biological function and activity as the mature polypeptide.

[0138] The full-length nucleotide sequence of the antibody of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. A feasible method is to synthesize the relevant sequence by artificial synthesis, especially when the fragment length is short. Usually, a fragment with a very long sequence can be obtained by synthesizing multiple small fragments first and then connecting them. In addition, the coding sequence of the heavy chain and the expression tag (such as 6His) can be fused together to form a fusion protein.

[0139] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the proliferated host cells by conventional methods. The biomolecules (nucleic acids, proteins, etc.) involved in the present invention include biomolecules in isolated form.

[0140] At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0141] The present invention also relates to vectors comprising the above-mentioned appropriate DNA sequence and appropriate promoter or control sequence. These vectors can be used to transform appropriate host cells to enable them to express proteins.

[0142] Host cells can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; insect cells of Drosophila S2 or Sf9; animal cells such as CHO, COS7, 293 cells, etc.

[0143] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with CaCl 2 Another method is to use MgCl 2 If necessary, transformation can also be performed by electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0144] The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0145] The recombinant polypeptide in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0146] The antibodies of the invention may be used alone or in combination or conjugated to a detectable marker (for diagnostic purposes), a therapeutic agent, a PK (protein kinase) modifying moiety, or any combination of these.

[0147] Detectable labels for diagnostic purposes include, but are not limited to, fluorescent or luminescent labels, radioactive labels, MRI (magnetic resonance imaging) or CT (computed tomography) contrast agents, or enzymes capable of producing a detectable product.

[0148] Therapeutic agents that can be combined or coupled to the antibodies of the present invention include, but are not limited to: 1. radionuclides; 2. biological toxins; 3. cytokines such as IL-2, etc.; 4. gold nanoparticles / nanorods; 5. viral particles; 6. liposomes; 7. nanomagnetic particles; 8. prodrug activating enzymes (e.g., DT-diaphorase (DTD) or biphenyl hydrolase-like protein (BPHL)); 9. chemotherapeutic agents (e.g., cisplatin) or any form of nanoparticles, etc.

[0149] Fusion protein of the present invention

[0150] As described herein, "the fusion protein of the present invention" refers to a fusion protein having both the anti-4-1BB nanobody described in the first aspect of the present invention and the Fc segment of an immunoglobulin.

[0151] In the present invention, a fusion protein is provided, wherein the nanobody fusion protein has a structure as shown in Formula I from the N-terminus to the C-terminus:

[0152] Z1-L-Z2 (Formula I)

[0153] In the formula,

[0154] Z1 is one or more VHH chains of the anti-4-1BB nanobody as described in the first aspect of the present invention;

[0155] Z2 is the Fc segment of immunoglobulin;

[0156] L is an optional linker sequence.

[0157] Preferably, the immunoglobulin may be IgG1, IgG2, IgG3 or IgG4, etc. (preferably IgG1, IgG2 or IgG4), or may be different mutants of IgG1.

[0158] In one embodiment, the fusion protein is a dimer, and the dimer is formed by disulfide bonds between the Fc segments in Z2.

[0159] In one embodiment, L has an amino acid sequence selected from the group consisting of: GGGGS, (GGGGS) 2 、(GGGGS) 3 、(GGGGS) 4 、(GGGGS) 5 , or a combination thereof.

[0160] In a preferred embodiment, the amino acid sequence of Z2 is as shown in SEQ ID NO:167.

[0161] In another embodiment, the amino acid sequence of Z2 is identical or substantially identical to the amino acid sequence shown in SEQ ID NO:167.

[0162] Preferably, the substantial identity means that there are at most 50 (preferably 1-20, more preferably 1-10, more preferably 1-5, and most preferably 1-3) amino acid differences, wherein the differences include amino acid substitutions, deletions or additions.

[0163] Preferably, the substantial identity is that the amino acid sequence has a sequence identity of at least 70%, at least 75%, at least 80%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% with the corresponding amino acid sequence.

[0164] In a preferred embodiment of the present invention, the amino acid sequence of the fusion protein, from N-terminus to C-terminus, is: a sequence as shown in any one of SEQ ID NOs: 1-40 and a sequence as shown in SEQ ID NO: 167;

[0165] Among them, any one of the above amino acid sequences also includes a derivative sequence that is optionally added, deleted, modified and / or substituted with 1-8 (preferably 1-5, more preferably 1-3) amino acid residues and can retain 4-1BB binding affinity.

[0166] The fusion protein of the present invention has the advantages of high dual-target binding affinity and strong specificity, thereby further enhancing the anti-tumor immune function.

[0167] Pharmaceutical composition

[0168] The present invention also provides a composition. Preferably, the composition is a pharmaceutical composition, which contains the above-mentioned antibody or its active fragment or its fusion protein, and a pharmaceutically acceptable carrier. Generally, these substances can be formulated in a non-toxic, inert and pharmaceutically acceptable aqueous carrier medium, wherein the pH is generally about 5-8, preferably about 6-8, although the pH value may vary depending on the properties of the formulated substance and the condition to be treated. The formulated pharmaceutical composition can be administered by conventional routes, including (but not limited to): intratumoral, intraperitoneal, intravenous, or local administration.

[0169] The pharmaceutical composition of the present invention can be directly used to bind to 4-1BB protein molecules, and thus can be used to treat tumors. In addition, other therapeutic agents can also be used simultaneously.

[0170] The pharmaceutical composition of the present invention contains a safe and effective amount (such as 0.001-99wt%, preferably 0.01-90wt%, more preferably 0.1-80wt%) of the above-mentioned nanoantibody (or its conjugate) of the present invention and a pharmaceutically acceptable carrier or excipient. Such carriers include (but are not limited to): saline, buffer, glucose, water, glycerol, ethanol, and combinations thereof. The pharmaceutical preparation should match the mode of administration. The pharmaceutical composition of the present invention can be prepared in the form of an injection, for example, by conventional methods using physiological saline or an aqueous solution containing glucose and other adjuvants. Pharmaceutical compositions such as injections and solutions are preferably manufactured under sterile conditions. The dosage of the active ingredient is a therapeutically effective amount, for example, about 10 micrograms / kg body weight to about 50 mg / kg body weight per day. In addition, the polypeptide of the present invention can also be used with other therapeutic agents.

[0171] When using a pharmaceutical composition, a safe and effective amount of the immunoconjugate is administered to a mammal, wherein the safe and effective amount is usually at least about 10 micrograms / kg body weight, and in most cases does not exceed about 50 milligrams / kg body weight, preferably the dosage is about 10 micrograms / kg body weight to about 10 milligrams / kg body weight. Of course, the specific dosage should also take into account factors such as the route of administration and the patient's health status, which are all within the skill range of skilled physicians.

[0172] Labeled Nanobodies

[0173] In a preferred embodiment of the present invention, the nanobody carries a detectable marker. More preferably, the marker is selected from the group consisting of an isotope, a colloidal gold marker, a colored marker or a fluorescent marker.

[0174] Colloidal gold labeling can be performed using methods known to those skilled in the art. In a preferred embodiment of the present invention, the anti-4-1BB nanobody is labeled with colloidal gold to obtain a colloidal gold-labeled nanobody.

[0175] The anti-4-1BB nanobody of the present invention has good specificity and high titer.

[0176] Detection Methods

[0177] The present invention also relates to a method for detecting 4-1BB protein. The method comprises the following steps: obtaining a cell and / or tissue sample; dissolving the sample in a medium; and detecting the level of 4-1BB protein in the dissolved sample.

[0178] In the detection method of the present invention, the sample used is not particularly limited, and a representative example is a sample containing cells in a cell storage solution.

[0179] Reagent test kit

[0180] The present invention also provides a kit containing the antibody (or fragment thereof) or fusion protein or detection plate of the present invention. In a preferred embodiment of the present invention, the kit further includes a container, instructions for use, a buffer, etc.

[0181] The present invention also provides a detection kit for detecting 4-1BB levels, which includes an antibody that recognizes 4-1BB protein, a lysis medium for dissolving the sample, and universal reagents and buffers required for detection, such as various buffers, detection markers, detection substrates, etc. The detection kit can be an in vitro diagnostic device.

[0182] application

[0183] As described above, the nanobodies of the present invention have extensive biological and clinical application value, and their applications involve multiple fields such as diagnosis and treatment of diseases related to 4-1BB, basic medical research, and biological research. A preferred application is for clinical diagnosis and targeted therapy of 4-1BB.

[0184] The main advantages of the present invention include:

[0185] 1) The nanoantibody of the present invention has a small molecular weight and can highly specifically bind to human 4-1BB protein while cross-binding to cynomolgus monkey protein.

[0186] 2) The nanoantibody of the present invention requires external cross-linking to exert its activation effect and has excellent activity and safety.

[0187] 3) The Nanobodies of the present invention do not block the binding of the 4-1BB ligand to 4-1BB in the native state.

[0188] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0189] Antibody sequences of the present invention

[0190] In the present invention, the sequences of the 4-1BB antibodies involved are summarized in the following table.

[0191] Table B The corresponding numbers of the sequences of the present invention (SEQ ID NO)

[0192]

[0193]

[0194] Example 1: Construction of Nanobody Library

[0195] 1.1 Animal immunization

[0196] 1 mg of human 4-1BB antigen (purchased from AcroBiosystems) was mixed with an equal volume of Freund's adjuvant to immunize two alpacas (Llama), once a week, for a total of 4 immunizations, to stimulate B cells to express antigen-specific nanoantibodies. After the 4 immunizations, 50 ml of alpaca peripheral blood was extracted and lymphocytes were isolated using lymphocyte separation fluid. Total RNA was extracted using RNA extraction reagent Trizol (purchased from Invitrogen). Total cDNA of the alpaca was obtained by reverse transcription using a cDNA synthesis kit (purchased from Invitrogen).

[0197] 1.2 Nanobody gene amplification

[0198] In the first round of PCR, IgG2 and IgG3 sequences were amplified from cDNA:

[0199] Table 1. Primers for the first round of PCR

[0200] name Sequence (5' to 3') SEQ ID NO: Upstream primer GTCCTGGCTGCTCTTCTACAAGG 161 Downstream primer GGTACGTGCTGTTGAACTGTTCC 162

[0201] The first round of PCR products were subjected to agarose gel electrophoresis, and the fragment at 750 bp was recovered for the second round of VHH sequence amplification. The second round of PCR amplification primers are as follows:

[0202] Table 2. Second round PCR primers

[0203] name Sequence (5' to 3') SEQ ID NO: Upstream primer CTAGTGCGGCCGCcTGGAGACGGTGACCTGGGT 163 Downstream primer CGCGGATCCCAGGTGCAGCTGCAGGAGTCTGGRGGAGG 164

[0204] The second round of PCR product was used as a template for the third round of PCR to add homology arms to the VHH gene. The third round of PCR amplification primers were as follows:

[0205] Table 3. Third round PCR primers

[0206]

[0207] The target fragment was recovered using a PCR purification kit (purchased from QIAGEN).

[0208] 1.3 Library construction

[0209] The linearized yeast display vector and the third round of PCR products were mixed and electroporated into Saccharomyces cerevisiae ( 20828), constructing an anti-4-1BB nanobody library from two animals

[0210] Example 2: Screening of 4-1BB Nanobodies

[0211] 2.1 Biotinylation of human 4-1BB protein

[0212] Take an appropriate volume of double distilled water to dissolve human 4-1BB protein (purchased from AcroBiosystems), and according to the instructions of the biotin labeling kit (purchased from Thermo), dissolve the biotin and mix it with the protein solution, and incubate at 4°C for 2 hours. Use a desalting column (purchased from Thermo) to remove excess biotin, and the desalting column pretreatment and sample collection operations are carried out according to the steps in the product instructions.

[0213] 2.2 MACS enrichment of yeast that specifically binds to 4-1BB

[0214] The VHH library constructed in Example 2 was inoculated in SD-CAA amplification medium (1 L SD-CAA amplification medium containing 6.7 g YNB, 5 g casamino acids, 13.62 g Na 2 HPO 4 12H 2 O, 7.44 g NaH 2 PO 4 and 2% glucose), culture overnight at 30°C and 225rpm. Take an appropriate amount of yeast cells, centrifuge at 3000rpm×5min to remove the culture medium, resuspend the yeast cells with SD-CAA induction medium, and induce overnight. Determine the library concentration after induction, take an appropriate amount of yeast cells, centrifuge to remove the culture medium. Resuspend the yeast cells with 50ml washing buffer (PBS+0.5% BSA+2mM EDTA), centrifuge to remove the supernatant. Resuspend the yeast cells with 10ml washing buffer.

[0215] Add biotin-labeled 4-1BB protein (final concentration 100mM), incubate at room temperature for 30min, collect yeast cells by centrifugation, and wash the yeast 3 times with 50ml washing buffer. Resuspend the yeast cells with 5ml washing buffer, add 200μl SA magnetic beads (purchased from Miltenyi Biotec), and incubate upside down for 10min. Wash the yeast and magnetic bead mixture 3 times with washing buffer, and add the mixture to the LS column (purchased from Miltenyi Biotec). Place the LS column on the magnetic stand and wash with washing buffer to remove non-specifically bound yeast cells. Remove the column from the magnetic stand and add washing buffer to elute the yeast. After centrifugation, the eluted yeast is transferred to 200ml SD-CAA amplification medium for amplification.

[0216] 2.3 Flow cytometry sorting to obtain high-affinity yeast cells

[0217] The yeast cells enriched by MACS were inoculated into SD-CAA amplification medium and cultured overnight at 30°C and 225 rpm. SD-CAA induction medium (1 L SD-CAA induction medium containing 6.7 g YNB, 5 g casamino acids, 13.62 g Na 2 HPO 4 12H 2 O, 7.44 g NaH 2 PO 4 Resuspend yeast cells in 2% galactose, 2% raffinose and 0.1% glucose and induce overnight. Add 1:200 diluted anti-c-Myc mouse antibody (purchased from Thermo) and 100nM biotin-labeled 4-1BB antigen and incubate at room temperature for 10min. Add PBS to wash the yeast 3 times, add 1:500 diluted goat anti-mouse IgG (H+L) AlexaFluor Plus488 (purchased from Invitrogen) and streptavidin APC-coupled fluorescent antibody (purchased from Invitrogen), and incubate at 4℃ in the dark for 15min. Add 2ml PBS to resuspend the cells and use BD FACS AriaI I instrument to sort to obtain yeast with high binding ability to 4-1BB antigen.

[0218] 2.4 Retrieval of 4-1BB Nanobody Candidate Molecular Antibody Gene

[0219] The yeast liquid with high binding ability to 4-1BB antigen obtained by MACS and FACS enrichment was cultured overnight at 30°C and 225rpm in SD-CAA amplification medium, and yeast plasmids were extracted according to the yeast plasmid extraction kit (purchased from Tiangen). The plasmid was transformed into Top10 competent cells (purchased from Tiangen) by electroporation, coated with ampicillin resistant plates, and cultured overnight at 37°C. Single clones were selected for sequencing to obtain the VHH gene sequence.

[0220] Example 3: Construction, expression and purification of heavy chain antibody fusion protein

[0221] 3.1 Antibody gene construction into pCDNA3.1 expression vector

[0222] The VHH gene sequence was linked to the Fc segment of human IgG1 (LALA mutation) and linearized into the pCDNA3.1 vector using homologous recombination enzyme (purchased from Vazyme) and EcoR I / Not I double enzyme digestion. The process was in accordance with the product instructions. The homologous recombination product was transferred into Top10 competent cells, coated with ampicillin-resistant plates, cultured at 37°C overnight, and single clones were picked for sequencing.

[0223] 3.2 Cell transfection

[0224] Using ExpiCHO TMExpression system kit (purchased from Thermo), the plasmid was transferred into Expi-CHO cells, the transfection method was in accordance with the product manual, and the supernatant was collected after 5 days of cell culture and the target protein was purified by protein A magnetic beads (purchased from GenScript) sorting method. The magnetic beads were resuspended in an appropriate volume of binding buffer (PBS + 0.1% Tween 20, pH 7.4) (1-4 times the volume of magnetic beads) and added to the sample to be purified, incubated at room temperature for 1 hour, and gently shaken during the period. The sample was placed on a magnetic stand (purchased from Beaver), the supernatant was discarded, and the magnetic beads were washed 3 times with binding buffer. Elution buffer (0.1M sodium citrate, pH 3.2) was added according to 3-5 times the volume of the magnetic beads, and the beads were shaken at room temperature for 5-10 minutes, and then placed back on the magnetic stand, the elution buffer was collected, and transferred to a collection tube with neutralization buffer (1M Tris, pH 8.54) and mixed.

[0225] Example 4: Affinity determination of 4-1BB antibody fusion protein

[0226] ForteBio affinity determination was performed according to existing methods (Estep, P et al., Solution-based high-throughput antibody-antigen affinity and epitope classification measurements, MAbs, 2013.5 (2): p. 270-8). In brief, the sensor was offline balanced in the analysis buffer for 30 min, then online for 60 s to establish a baseline, and the purified antibody obtained as described above was loaded online onto the AHQ sensor. The sensor was then placed in 100 nM 4-1BB antigen for 5 min, and then the sensor was transferred to PBS for dissociation for 5 min. A 1:1 binding model was used for kinetic analysis.

[0227] Table 4. Affinity of candidate molecules

[0228]

[0229]

[0230] Example 5: Purification of anti-4-1BB antibodies and binding to human 4-1BB CHO-S cells

[0231] CHO cells overexpressing human 4-1BB (CHO-h4-1BB cells) were generated by transfecting the pCHO1.0 vector (purchased from Invitrogen) encoding human 4-1BB cDNA cloned into MCS. The cell density of CHO-h4-1BB cells was adjusted to 2×10 6cells / ml, 100μl / well was added to a 96-well flow plate, centrifuged and set aside. The purified 4-1BB antibody was diluted with PBS, starting from 400nM and diluted 3 times for a total of 12 points. 100μl / well of the diluted sample was added to the 96-well flow plate with cells, incubated at 4°C for 30min, and washed twice with PBS. 100μl / well was added to sheep F(ab')2 anti-human IgG-Fc (PE) (purchased from Abcam) diluted 100 times with PBS, incubated at 4°C for 30min, and washed twice with PBS. 100μl / well was added to PBS to resuspend the cells, and the detection was performed on a CytoFlex (Bechman) flow cytometer and the corresponding MFI was calculated.

[0232] The experimental results are as follows Figure 1 As shown in A and 1B, all the purified samples of the present invention have binding activity with CHO-h4-1BB cells, and the binding activity of some purified samples is similar to that of the control antibody Urelumab (US20090068192).

[0233] Example 6: Purification of anti-4-1BB antibodies binding to cynomolgus monkey 4-1BB protein

[0234] The cynomolgus monkey 4-1BB-his protein (purchased from ACRO) was dissolved according to the instructions, diluted to 1 μg / ml with ELISA coating solution (purchased from Shanghai Biotech), and 100 μl / well was coated on the ELISA plate, overnight at 4°C, washed 3 times with PBST, and blocked with 5% BSA (purchased from Shanghai Biotech) at room temperature for 1 hour. The coating solution was discarded, 100 μl / well was added with 1% BSA gradient dilution of 4-1BB antibody, 200nM 3-fold dilution for a total of 12 points, and incubated at room temperature for 2 hours. Washed 3 times with PBST, 100 μl / well was added with 1% BSA diluted goat anti-human IgG-Fc-HRP (purchased from abcam), and incubated at room temperature for 1 hour. Washed 3 times with PBST, 100 μl / well was added with ELISA colorimetric solution (purchased from Solebol) and reacted at room temperature for 3 minutes, 50 μl / well was added with ELISA stop solution (purchased from Solebol), and the absorbance value at 450nm was read.

[0235] The experimental results are as follows Figure 2 As shown in A and 2B, the purified samples of the present invention have good binding activity with the cynomolgus monkey 4-1BB protein, while the control antibody Urelumab (US20090068192) has weaker binding activity with the cynomolgus monkey 4-1BB protein.

[0236] Example 7: Purification of anti-4-1BB antibodies and primary T cell activation assay

[0237] OKT-3 antibody (purchased from Biolegend) was diluted to 1 μg / ml with sterile PBS (purchased from Hyclone), and 50 μl / well was coated on a 96-well cell culture flat-bottom plate (purchased from Thermo). At the same time, 50 μl / well of anti-4-1BB antibody diluted in PBS was added and incubated at 37°C for two hours. Frozen human PBMC (purchased from Shanghai Saili) was resuscitated, and T cells were isolated using a human T cell isolation and purification kit (purchased from Stemcell). T cells were resuspended in X-VIVO15 medium (purchased from LONZA) and the cell density was adjusted to 0.5×10 6 After the antibody coating is completed, discard the coating solution, wash twice with PBS, discard the PBS, and add 200μl / well of the above T cell suspension. 37℃, 5% CO 2 After 5 days of culture, the supernatant was collected to detect the IFN-γ content.

[0238] The experimental results are as follows Figure 3 As shown in A and 3B, some of the purified samples of the present invention can activate primary human T cells to secrete IFN-γ, and the activity of some antibodies is comparable to that of the control antibody Urelumab (US20090068192).

[0239] Example 8: Construction of humanized 4-1BB antibody

[0240] In order to reduce the immunogenicity of monoclonal antibodies in the human body, L-Yr-13&14-16 and A-Na-19 antibodies were humanized. The humanization method adopted the VHH humanization universal framework transplantation method, and at the same time, according to the method reported in the literature (Vincke, C., et al., Humanized camel single domain antibodies and general strategies for identifying universal humanized nanoantibody scaffolds. J Biol Chem 284 (5): 3273-3284), some amino acids of antibody framework 2 were mutated.

[0241] In this study, IMGT (http: / / www.imgt.org) was used to evaluate the humanization level of the humanized sequences of L-Yr-13&14-16 and A-Na-19 antibodies. The results are shown in Table 5.

[0242] Table 5. Homology of L-Yr-13&14-16 and A-Na-19 sequences and human

[0243] serial number Germline Homology SEQ ID NO: L-Yr-13&14-16 IGHV3-30*01 76.3％ 35 HZ-L-Yr-13&14-16-1 IGHV3-30*01 80.4％ 39 HZ-L-Yr-13&14-16-2 IGHV3-30*01 84.5％ 40 A-Na-19 IGHV3-30*01 80.60％ 3 Hu-A-NA-19-1 IGHV3-15*06 69.4％ 37 Hu-A-NA-19-2 IGHV3-15*06 76.5％ 38

[0244] The protein construction and expression purification methods are the same as those in Example 3. The purified genetically engineered antibodies were tested for binding to human 4-1B BCH-S cells using the same method as in Example 4. Figure 4As shown in A and 4B, the genetically engineered antibody retains binding activity to human 4-1BB CHO-S cells.

[0245] The purified genetically engineered antibody was tested for binding to cynomolgus monkey 4-1BB CHO-S cells. Figure 5 As shown in A and 5B, the genetically engineered HZ-L-Yr-16 antibody maintained its binding activity to cynomolgus monkey 4-1BB CHO-S cells, while the genetically engineered A-Na-19 antibody had a significant decrease in binding activity to cynomolgus monkey 4-1BB CHO-S cells.

[0246] The purified genetically engineered antibodies were subjected to primary T cell activation assay using the same method as in Example 7. Figure 6 A and 6B show that some antibodies after genetic engineering retain primary T cell activation activity.

[0247] Example 9: 4-1BB ligand blocking assay

[0248] The cell density of the expanded CHO-h4-1BB cells was adjusted to 2×10 6 Cells / ml, 100μl / well added to 96-well flow plate, centrifuged for use. The purified 4-1BB antibody was diluted to 400nM with PBS, and 50μl / well of the diluted sample was added to the 96-well flow plate with cells, and incubated at 4°C for 30min. 50μl / well added Biotin-4-1BB ligand protein (purchased from ACRO) diluted to 1μg / ml with PBS, and incubated at 4°C for 30min. Wash twice with PBS, add 100μl / well SAPE (purchased from Thermo) diluted 200 times with PBS, incubate at 4°C for 30min, and wash twice with PBS. 100μl / well added PBS to resuspend the cells, detect on the CytoFlex (Bechman) flow cytometer and calculate the corresponding MFI.

[0249] The results are as follows Figure 7 A shows that the genetically engineered 4-1BB antibody HZ-L-Yr-16-1 has no ligand blocking activity, while the control antibody Utomilumab (US20120237498) has ligand blocking activity.

[0250] Example 10: Antibody and TNFRSF member binding detection

[0251] Human 4-1BB-his, GITR-his, OX40-his, CD40-his proteins (purchased from ACRO) were dissolved according to the instructions, diluted to 1 μg / ml with ELISA coating solution (purchased from Shanghai Biotech), 100 μl / well was coated on the ELISA plate, overnight at 4°C, washed 3 times with PBST, 200 μl / well was added with 5% BSA (purchased from Shanghai Biotech) and blocked at room temperature for 1 hour. The coating solution was discarded, 100 μl / well was added with 4-1BB antibody diluted with 1% BSA, 200 nM 3 replicates, and incubated at room temperature for 2 hours. Washed 3 times with PBST, 100 μl / well was added with goat anti-human IgG-Fc-HRP (purchased from abcam) diluted with 1% BSA, and incubated at room temperature for 1 hour. After washing with PBST for 3 times, 100 μl / well of ELISA colorimetric solution (purchased from Solebol) was added and reacted at room temperature for 3 minutes. 50 μl / well of ELISA stop solution (purchased from Solebol) was added and the absorbance value at 450 nm was read.

[0252] The results are as follows Figure 7 B shows that the HZ-L-Yr-16-1 antibody only binds to the 4-1BB protein and does not bind to other tumor necrosis factor receptor superfamily members.

[0253] Example 11: Crystal structure identification of the complex of 4-1BB and VHH segment

[0254] In order to further explore the binding mode of the 4-1BB nanobody of the present invention and its antigen protein, in this example, L-Yr-13&14-16-1 was selected to perform a crystallization experiment of the antigen complex.

[0255] Among them, in order to promote the formation of crystals, after optimization, the amino acid sequence of the anti-4-1BB antibody in the final crystal complex is a sequence (SEQ ID NO: 169) formed by adding Leu and Gly to the C-terminus of the VHH chain sequence of L-Yr-13&14-16-1 (i.e., SEQ ID NO: 39). It should be noted that the Leu and Gly residues added to the C-terminus are only conventional technical operations to promote crystallization, and do not affect the binding mode of the nanoantibody L-Yr-13&14-16-1 with the human 4-1BB protein.

[0256] In this experiment, X-ray diffraction was used to identify the crystal structure of the complex of 4-1BB and VHH segment. Human 4-1BB protein (SEQID NO: 168) and anti-4-1BB VHH protein (SEQ ID NO: 169) were expressed by HEK293 system. 4-1BB and VHH were mixed in a molar ratio of 1:1 to prepare a complex sample for crystallization. The complex (8.5 mg / mL) was mixed with the crystallization reagent in a ratio of 1:1 and the crystals were cultured at 18°C. After four days, crystals were observed in the culture conditions of the JBK kit, and the crystal morphology was as follows Figure 1 shown.

[0257] Selected single crystals were used for X-ray diffraction experiments at the Shanghai Light Source and the resolution was Diffraction data. Data processing was performed using XDS software. Crystal phase identification was performed using the molecular replacement method using 4-1BB (PDB ID: 6mgp) and VHH (PDB ID: 4xt1) structures as models. Crystal structure refinement was performed using Refmac5. Model detection, manual reconstruction, and structure verification were performed using COOT. The complex crystals belong to the P41212 space group, and their unit cell parameters are: α=90.00°,β=90.00°,γ=90.00°. Specific crystal data statistics are shown in Table 6.

[0258] The crystal structure of the 4-1BB-VHH complex obtained after structural analysis is as follows Fig. 9 As shown. Epitope analysis showed that the main hydrogen bonding between 4-1BB and VHH is concentrated on amino acids such as Asp118, Leu123, Arg130, Val132, Cys134, Gly135 and Ser137 on 4-1BB ( Fig.10 In addition, Leu123, Val124, Val133 and Pro136 on 4-1BB and Val32, Ala33, Tyr37, Leu47, Ile52, Tyr97, Tyr102 and Trp115 on VHH form a hydrophobic interaction interface ( Fig.11 ).

[0259] Table 6 4-1BB-VHH complex crystal data statistics

[0260]

[0261] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Biomis Biotechnology (Zhuhai) Co., Ltd. <120> An antibody targeting 4-1BB and its application <130> P2020-1619 <150> CN202010981835.5 <151> 2020-09-17 <160> 169 <170> SIPOSequenceListing 1.0 <210> 1 <211> 116 <212> PRT <213> Artificial sequence <400> 1 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Pro Pro Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn 20 25 30 Thr Gly Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Arg Asn Thr Val Ser Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ile Tyr Tyr Cys His 85 90 95 Ile Gly Pro Glu Pro Arg Tyr Gly Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 2 <211> 116 <212> PRT <213> artificial sequence <400> 2 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Pro Pro Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn 20 25 30 Thr Gly Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Glu Asn Thr Val Ser Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ile Tyr Tyr Cys His 85 90 95 Ile Gly Pro Glu Pro Arg Tyr Gly Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 3 <211> 116 <212> PRT <213> Artificial sequence <400> 3 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Pro Pro Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn 20 25 30 Thr Gly Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ile Tyr Tyr Cys His 85 90 95 Ile Gly Pro Glu Pro Arg Tyr Gly Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 4 <211> 121 <212> PRT <213> Artificial sequence <400> 4 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Val Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Leu Tyr Thr Gly Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 5 <211> 127 <212> PRT <213> artificial sequence <400> 5 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Leu Asp Tyr Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Glu Thr Thr Tyr Tyr Ser Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Lys Val Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Gly Ala Glu Leu Leu Gly Ser Gly Glu Gly Cys Tyr Val Trp Ser Arg 100 105 110 Asp Gly Ser Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 6 <211> 116 <212> PRT <213> artificial sequence <400> 6 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Pro Pro Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn 20 25 30 Thr Gly Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Ala Lys Asn Thr Val Ser Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Ile Tyr Tyr Cys His 85 90 95 Ile Gly Pro Glu Pro Arg Tyr Gly Tyr Trp Gly Gln Gly Thr Gln Val 100 105 110 Thr Val Ser Ser 115 <210> 7 <211> 121 <212> PRT <213> artificial sequence <400> 7 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Val Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 8 <211> 121 <212> PRT <213> artificial sequence <400> 8 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Glu Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr Trp Gly 100 105 110 Pro Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 9 <211> 121 <212> PRT <213> artificial sequence <400> 9 Glu Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Tyr Tyr Thr Gly Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 10 <211> 122 <212> PRT <213> artificial sequence <400> 10 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Ser Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Arg Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Pro Gln Ser Asp Cys Phe His Tyr Ser Glu Asn Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 11 <211> 121 <212> PRT <213> artificial sequence <400> 11 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 12 <211> 121 <212> PRT <213> artificial sequence <400> 12 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 13 <211> 122 <212> PRT <213> Artificial sequence <400> 13 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Ser Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Arg Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Pro Gln Ser Asp Cys Phe His Tyr Ser Glu Asn Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 14 <211> 122 <212> PRT <213> Artificial sequence <400> 14 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Asp Tyr Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Ser Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Leu Val Tyr 65 70 75 80 Leu Arg Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Thr Ala Pro Arg Ser Asp Cys Phe His Tyr Gly Glu Asn Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 15 <211> 122 <212> PRT <213> artificial sequence <400> 15 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Asp Tyr Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Ser Cys Ile Thr Ala Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Arg Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Pro Arg Ser Asp Cys Phe His Tyr Gly Glu Asn Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 16 <211> 122 <212> PRT <213> artificial sequence <400> 16 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr 20 25 30 Ala Ile Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Ser Cys Ile Glu Lys Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Thr Val Asp 65 70 75 80 Leu Gln Met Asn Arg Leu Ser Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Ala Pro Gln Ser Asp Cys Phe His Tyr Lys Glu Asn Asp Tyr Trp 100 105 110 Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 17 <211> 121 <212> PRT <213> artificial sequence <400> 17 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Val Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Leu 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Leu Tyr Thr Gly Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 18 <211> 121 <212> PRT <213> artificial sequence <400> 18 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Trp Val 35 40 45 Ser Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Val Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 19 <211> 121 <212> PRT <213> artificial sequence <400> 19 Gln Val Gln Leu Gln Glu Ser Gly Gly Ala Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 20 <211> 121 <212> PRT <213> artificial sequence <400> 20 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Val Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Leu Tyr Thr Gly Asp Asp Tyr Trp Gly 100 105 110 Pro Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 21 <211> 121 <212> PRT <213> artificial sequence <400> 21 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Tyr Tyr Thr Ser Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 22 <211> 121 <212> PRT <213> Artificial sequence <400> 22 Gln Val Gln Leu Gln Glu Ser Gly Gly Ala Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr 20 25 30 Ala Ile Gly Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Gly Val 35 40 45 Leu Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr 65 70 75 80 Leu Gln Met Thr Asn Leu Lys Pro Glu Asp Thr Ala Val Tyr Leu Cys 85 90 95 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 23 <211> 114 <212> PRT <213> Artificial sequence <400> 23 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Phe Asn Ala Met Gly 20 25 30 Trp Trp Arg Gln Ala Pro Gly Lys Gln Arg Glu Phe Val Ala Ile Ile 35 40 45 Thr Arg Asp Gly Ser Thr Asn Leu Ala Asp Ser Val Lys Gly Arg Phe 50 55 60 Thr Ile Ser Ser Asp Asn Ala Lys Asn Thr Trp Phe Leu Gln Met Asn 65 70 75 80 Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ser Ala Ser Asp 85 90 95 Tyr Gly Ser Ser Leu Tyr Tyr Trp Gly Gln Gly Thr Gln Val Thr Val 100 105 110 Ser Ser <210> 24 <211> 125 <212> PRT <213> Artificial sequence <400> 24 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Gly Thr Phe Ser Ile Thr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Gln Gln Arg Glu Leu Val 35 40 45 Ala Ala Ile Ala Ser Gly Asp Gly Ala Thr Asn Tyr Ala Asp Phe Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Phe 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Pro Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 25 <211> 115 <212> PRT <213> artificial sequence <400> 25 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Glu 1 5 10 15 Ser Leu Arg Leu Ser Cys Asp Ser Gly Arg Ile Phe Ser Tyr Asn Phe 20 25 30 Methionine Glycine Tryptophan Tyrosine Arginine Glutamine Alanine Proline Glycine Lysine Glutamine Arginine Glutamic Acid Leucine Valine Alanine 35 40 45 Serine Isoleucine Threonine Tryptophan Glycine Glycine Threonine Isoleucine Lysine Tyrosine Alanine Aspartic Acid Serine Valine Lysine Glycine 50 55 60 Arginine Phenylalanine Threonine Isoleucine Serine Arginine Histidine Aspartic Acid Alanine Glutamic Acid Asparagine Threonine Valine Tyrosine Leucine Glutamine 65 70 75 80 Methionine Asparagine Serine Leucine Lysine Serine Glutamic Acid Aspartic Acid Threonine Alanine Valine Tyrosine Tyrosine Cysteine Histidine Alanine 85 90 95 Alanine Threonine Aspartic Acid Threonine Glycine Valine Isoleucine Tyrosine Tryptophan Glycine Glutamine Glycine Threonine Glutamine Valine Threonine 100 105 110 Valine Serine Serine 115 <210> 26 <211> 119 <212> PRT <213> Artificial Sequence <400> 26 Glutamine Valine Glutamine Leucine Glutamine Glutamic Acid Serine Glycine Glycine Glycine Leucine Valine Glutamine Alanine Glycine Glycine 1 5 10 15 Serine Leucine Arginine Leucine Serine Cysteine Alanine Alanine Serine Glycine Arginine Threonine Leucine Serine Glycine Tyrosine 20 25 30 Valine Methionine Glycine Tryptophan Phenylalanine Arginine Glutamine Alanine Serine Glycine Lysine Glutamic Acid Arginine Glutamic Acid Leucine Valine 35 40 45 Ala Ala Ile Ser Ser Gly Gly Ser Thr Tyr Tyr Glu Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys Ala 85 90 95 Ala Asp Pro Arg Arg Leu Thr Gly Leu Tyr Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Gln Val Thr Val Ser Ser 115 <210> 27 <211> 117 <212> PRT <213> artificial sequence <400> 27 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Glu Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn 20 25 30 Val Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Val Ile Thr Ser Asp Tyr Ser Thr Asn Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr His Cys Ala 85 90 95 Ala Thr Gly Tyr Gly Ser Ser Pro Trp Tyr Trp Gly Gln Gly Thr Gln 100 105 110 Val Thr Val Ser Ser 115 <210> 28 <211> 125 <212> PRT <213> artificial sequence <400> 28 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Gly Ile Thr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Pro Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ala Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Leu Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Arg Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 29 <211> 125 <212> PRT <213> artificial sequence <400> 29 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Ser 20 25 30 Ala Met Gly Trp Tyr Arg Gln Pro Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Leu Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Asn Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Leu Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Arg Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 30 <211> 125 <212> PRT <213> artificial sequence <400> 30 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Ser 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ala Ile Val Ile Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 31 <211> 125 <212> PRT <213> artificial sequence <400> 31 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Gln Gln Arg Glu Leu Val 35 40 45 Ala Ala Ile Ala Ser Gly Asp Gly Ala Thr Asn Tyr Ala Asp Phe Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Phe 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Ser Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 32 <211> 125 <212> PRT <213> Artificial sequence <400> 32 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Pro Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ala Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Leu Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Arg Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 33 <211> 125 <212> PRT <213> Artificial sequence <400> 33 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Pro Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ala Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Trp Leu Glu Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 34 <211> 125 <212> PRT <213> Artificial sequence <400> 34 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr 20 25 30 Ala Met Gly Trp Tyr Arg Gln Pro Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 35 <211> 125 <212> PRT <213> artificial sequence <400> 35 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Asp 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Val 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 36 <211> 120 <212> PRT <213> artificial sequence <400> 36 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Arg Ser Ile Phe Ser Ser Tyr 20 25 30 Val Met Ala Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Leu Val 35 40 45 Ala Leu Ile Arg Tyr Gly Gly Ser Thr Asp Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Ile Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala 85 90 95 Ala Ser Lys Ser Ala Tyr Ile Phe Asp Asp Arg Asp Tyr Trp Gly Gln 100 105 110 Gly Thr Gln Val Thr Val Ser Ser 115 120 <210> 37 <211> 116 <212> PRT <213> artificial sequence <400> 37 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn 20 25 30 Thr Gly Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys His 85 90 95 Ile Gly Pro Glu Pro Arg Tyr Gly Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110 Thr Val Ser Ser 115 <210> 38 <211> 116 <212> PRT <213> artificial sequence <400> 38 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn 20 25 30 Thr Gly Ala Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Arg Asp Asp Ser Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Thr Glu Asp Thr Ala Val Tyr Tyr Cys His 85 90 95 Ile Gly Pro Glu Pro Arg Tyr Gly Tyr Trp Gly Gln Gly Thr Leu Val 100 105 110 Thr Val Ser Ser 115 <210> 39 <211> 125 <212> PRT <213> artificial sequence <400> 39 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Val 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 40 <211> 125 <212> PRT <213> artificial sequence <400> 40 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Val 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gly Leu Glu Leu Val 35 40 45 Ala Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 115 120 125 <210> 41 <211> 13 <212> PRT <213> Artificial sequence <400> 41 Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn Thr Gly Ala 1 5 10 <210> 42 <211> 13 <212> PRT <213> Artificial sequence <400> 42 Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn Thr Gly Ala 1 5 10 <210> 43 <211> 13 <212> PRT <213> Artificial sequence <400> 43 Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn Thr Gly Ala 1 5 10 <210> 44 <211> 13 <212> PRT <213> Artificial sequence <400> 44 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 45 <211> 13 <212> PRT <213> Artificial sequence <400> 45 Ala Ala Ser Gly Phe Thr Leu Asp Tyr Tyr Ala Ile Gly 1 5 10 <210> 46 <211> 13 <212> PRT <213> Artificial sequence <400> 46 Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn Thr Gly Ala 1 5 10 <210> 47 <211> 13 <212> PRT <213> Artificial sequence <400> 47 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 48 <211> 13 <212> PRT <213> Artificial sequence <400> 48 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 49 <211> 13 <212> PRT <213> Artificial sequence <400> 49 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 50 <211> 13 <212> PRT <213> Artificial sequence <400> 50 Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr Ala Ile Gly 1 5 10 <210> 51 <211> 13 <212> PRT <213> Artificial sequence <400> 51 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 52 <211> 13 <212> PRT <213> Artificial sequence <400> 52 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 53 <211> 13 <212> PRT <213> Artificial sequence <400> 53 Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr Ala Ile Gly 1 5 10 <210> 54 <211> 13 <212> PRT <213> Artificial sequence <400> 54 Ala Ala Ser Gly Phe Ser Leu Asp Tyr Tyr Ala Ile Gly 1 5 10 <210> 55 <211> 13 <212> PRT <213> Artificial sequence <400> 55 Ala Ala Ser Gly Phe Ser Leu Asp Tyr Tyr Ala Ile Gly 1 5 10 <210> 56 <211> 13 <212> PRT <213> Artificial sequence <400> 56 Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr Ala Ile Ala 1 5 10 <210> 57 <211> 13 <212> PRT <213> Artificial sequence <400> 57 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 58 <211> 13 <212> PRT <213> Artificial sequence <400> 58 Ala Ala Ser Gly Phe Ser Leu Gly Leu Tyr Ala Ile Gly 1 5 10 <210> 59 <211> 13 <212> PRT <213> Artificial sequence <400> 59 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 60 <211> 13 <212> PRT <213> Artificial sequence <400> 60 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 61 <211> 13 <212> PRT <213> Artificial sequence <400> 61 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 62 <211> 13 <212> PRT <213> Artificial sequence <400> 62 Ala Ala Ser Gly Phe Thr Phe Asp Asp Tyr Ala Ile Gly 1 5 10 <210> 63 <211> 10 <212> PRT <213> Artificial sequence <400> 63 Ala Ala Ser Gly Ser Phe Asn Ala Met Gly 1 5 10 <210> 64 <211> 13 <212> PRT <213> Artificial sequence <400> 64 Ala Ala Ser Gly Gly Thr Phe Ser Ile Thr Ala Met Gly 1 5 10 <210> 65 <211> 12 <212> PRT <213> Artificial sequence <400> 65 Asp Ser Gly Arg Ile Phe Ser Tyr Asn Phe Met Gly 1 5 10 <210> 66 <211> 13 <212> PRT <213> Artificial sequence <400> 66 Ala Ala Ser Gly Arg Thr Leu Ser Gly Tyr Val Met Gly 1 5 10 <210> 67 <211> 13 <212> PRT <213> Artificial sequence <400> 67 Ala Ala Ser Gly Ser Ile Phe Ser Ile Asn Val Met Gly 1 5 10 <210> 68 <211> 13 <212> PRT <213> Artificial sequence <400> 68 Ala Ala Ser Gly Ser Thr Phe Gly Ile Thr Ala Met Gly 1 5 10 <210> 69 <211> 13 <212> PRT <213> artificial sequence <400> 69 Ala Ala Ser Gly Ser Thr Phe Ser Ile Ser Ala Met Gly 1 5 10 <210> 70 <211> 13 <212> PRT <213> artificial sequence <400> 70 Ala Ala Ser Gly Ser Thr Phe Ser Ile Ser Ala Met Gly 1 5 10 <210> 71 <211> 13 <212> PRT <213> artificial sequence <400> 71 Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr Ala Met Gly 1 5 10 <210> 72 <211> 13 <212> PRT <213> artificial sequence <400> 72 Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr Ala Met Gly 1 5 10 <210> 73 <211> 13 <212> PRT <213> Artificial sequence <400> 73 Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr Ala Met Gly 1 5 10 <210> 74 <211> 13 <212> PRT <213> Artificial sequence <400> 74 Ala Ala Ser Gly Ser Thr Phe Ser Ile Thr Ala Met Gly 1 5 10 <210> 75 <211> 13 <212> PRT <213> Artificial sequence <400> 75 Ala Ala Ser Gly Ser Thr Phe Ser Ile Val Ala Met Gly 1 5 10 <210> 76 <211> 13 <212> PRT <213> Artificial sequence <400> 76 Ala Ala Ser Arg Ser Ile Phe Ser Ser Tyr Val Met Ala 1 5 10 <210> 77 <211> 13 <212> PRT <213> Artificial sequence <400> 77 Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn Thr Gly Ala 1 5 10 <210> 78 <211> 13 <212> PRT <213> Artificial sequence <400> 78 Ala Ala Ser Gly Ala Ile Phe Arg Ile Asn Thr Gly Ala 1 5 10 <210> 79 <211> 13 <212> PRT <213> Artificial sequence <400> 79 Ala Ala Ser Gly Ser Thr Phe Ser Ile Val Ala Met Gly 1 5 10 <210> 80 <211> 13 <212> PRT <213> Artificial sequence <400> 80 Ala Ala Ser Gly Ser Thr Phe Ser Ile Val Ala Met Gly 1 5 10 <210> 81 <211> 16 <212> PRT <213> Artificial sequence <400> 81 Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys Gly 1 5 10 15 <210> 82 <211> 16 <212> PRT <213> Artificial sequence <400> 82 Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys Gly 1 5 10 15 <210> 83 <211> 16 <212> PRT <213> Artificial sequence <400> 83 Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys Gly 1 5 10 15 <210> 84 <211> 17 <212> PRT <213> Artificial sequence <400> 84 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 85 <211> 17 <212> PRT <213> Artificial sequence <400> 85 Cys Ile Ser Ser Ser Gly Glu Thr Thr Tyr Tyr Ser Asp Ser Val Lys 1 5 10 15 Gly <210> 86 <211> 16 <212> PRT <213> Artificial sequence <400> 86 Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys Gly 1 5 10 15 <210> 87 <211> 17 <212> PRT <213> artificial sequence <400> 87 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 88 <211> 17 <212> PRT <213> artificial sequence <400> 88 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 89 <211> 17 <212> PRT <213> artificial sequence <400> 89 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 90 <211> 17 <212> PRT <213> artificial sequence <400> 90 Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 91 <211> 17 <212> PRT <213> artificial sequence <400> 91 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 92 <211> 17 <212> PRT <213> artificial sequence <400> 92 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 93 <211> 17 <212> PRT <213> artificial sequence <400> 93 Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 94 <211> 17 <212> PRT <213> artificial sequence <400> 94 Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 95 <211> 17 <212> PRT <213> artificial sequence <400> 95 Cys Ile Thr Ala Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 96 <211> 17 <212> PRT <213> artificial sequence <400> 96 Cys Ile Glu Lys Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 97 <211> 17 <212> PRT <213> artificial sequence <400> 97 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Leu Lys 1 5 10 15 Gly <210> 98 <211> 17 <212> PRT <213> artificial sequence <400> 98 Cys Ile Met Ser Ser Asp Ser Ser Ala Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 99 <211> 17 <212> PRT <213> artificial sequence <400> 99 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 100 <211> 17 <212> PRT <213> artificial sequence <400> 100 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 101 <211> 17 <212> PRT <213> artificial sequence <400> 101 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 102 <211> 17 <212> PRT <213> artificial sequence <400> 102 Cys Ile Ser Ser Ser Gly Gly Ser Thr Tyr Tyr Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 103 <211> 16 <212> PRT <213> Artificial sequence <400> 103 Ile Ile Thr Arg Asp Gly Ser Thr Asn Leu Ala Asp Ser Val Lys Gly 1 5 10 15 <210> 104 <211> 17 <212> PRT <213> Artificial sequence <400> 104 Ala Ile Ala Ser Gly Asp Gly Ala Thr Asn Tyr Ala Asp Phe Val Lys 1 5 10 15 Gly <210> 105 <211> 16 <212> PRT <213> Artificial sequence <400> 105 Ser Ile Thr Trp Gly Gly Thr Ile Lys Tyr Ala Asp Ser Val Lys Gly 1 5 10 15 <210> 106 <211> 16 <212> PRT <213> Artificial sequence <400> 106 Ala Ile Ser Ser Gly Gly Ser Thr Tyr Tyr Tyr Glu Asp Ser Val Lys Gly 1 5 10 15 <210> 107 <211> 16 <212> PRT <213> Artificial sequence <400> 107 Val Ile Thr Ser Asp Tyr Ser Thr Asn Tyr Ala Asp Ser Val Lys Gly 1 5 10 15 <210> 108 <211> 17 <212> PRT <213> Artificial sequence <400> 108 Ala Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val Lys 1 5 10 15 Gly <210> 109 <211> 17 <212> PRT <213> Artificial sequence <400> 109 Leu Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val Lys 1 5 10 15 Gly <210> 110 <211> 17 <212> PRT <213> Artificial sequence <400> 110 Ala Ile Val Ile Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 111 <211> 17 <212> PRT <213> Artificial sequence <400> 111 Ala Ile Ala Ser Gly Asp Gly Ala Thr Asn Tyr Ala Asp Phe Val Lys 1 5 10 15 Gly <210> 112 <211> 17 <212> PRT <213> Artificial sequence <400> 112 Ala Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val Lys 1 5 10 15 Gly <210> 113 <211> 17 <212> PRT <213> Artificial sequence <400> 113 Ala Ile Ile Met Ser Asp Gly Asp Thr Asn Tyr Gln Asp Ser Val Lys 1 5 10 15 Gly <210> 114 <211> 17 <212> PRT <213> Artificial sequence <400> 114 Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 115 <211> 17 <212> PRT <213> Artificial sequence <400> 115 Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 116 <211> 16 <212> PRT <213> Artificial sequence <400> 116 Leu Ile Arg Tyr Gly Gly Ser Thr Asp Tyr Ala Asp Ser Val Lys Gly 1 5 10 15 <210> 117 <211> 16 <212> PRT <213> Artificial sequence <400> 117 Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys Gly 1 5 10 15 <210> 118 <211> 16 <212> PRT <213> Artificial sequence <400> 118 Ser Leu Thr Thr Tyr Gly Lys Thr Thr Tyr Ala Asp Phe Val Lys Gly 1 5 10 15 <210> 119 <211> 17 <212> PRT <213> Artificial sequence <400> 119 Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 120 <211> 17 <212> PRT <213> Artificial sequence <400> 120 Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val Lys 1 5 10 15 Gly <210> 121 <211> 10 <212> PRT <213> Artificial sequence <400> 121 His Ile Gly Pro Glu Pro Arg Tyr Gly Tyr 1 5 10 <210> 122 <211> 10 <212> PRT <213> Artificial sequence <400> 122 His Ile Gly Pro Glu Pro Arg Tyr Gly Tyr 1 5 10 <210> 123 <211> 10 <212> PRT <213> Artificial sequence <400> 123 His Ile Gly Pro Glu Pro Arg Tyr Gly Tyr 1 5 10 <210> 124 <211> 14 <212> PRT <213> Artificial sequence <400> 124 Gly Ala Pro Arg Asp Cys Ser Leu Tyr Thr Gly Asp Asp Tyr 1 5 10 <210> 125 <211> 20 <212> PRT <213> Artificial sequence <400> 125 Gly Ala Glu Leu Leu Gly Ser Gly Glu Gly Cys Tyr Val Trp Ser Arg 1 5 10 15 Asp Gly Ser Tyr 20 <210> 126 <211> 10 <212> PRT <213> Artificial sequence <400> 126 His Ile Gly Pro Glu Pro Arg Tyr Gly Tyr 1 5 10 <210> 127 <211> 14 <212> PRT <213> Artificial sequence <400> 127 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr 1 5 10 <210> 128 <211> 14 <212> PRT <213> artificial sequence <400> 128 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr 1 5 10 <210> 129 <211> 14 <212> PRT <213> artificial sequence <400> 129 Gly Ala Pro Arg Asp Cys Ser Tyr Tyr Thr Gly Asp Asp Tyr 1 5 10 <210> 130 <211> 15 <212> PRT <213> artificial sequence <400> 130 Ala Ala Pro Gln Ser Asp Cys Phe His Tyr Ser Glu Asn Asp Tyr 1 5 10 15 <210> 131 <211> 14 <212> PRT <213> artificial sequence <400> 131 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr 1 5 10 <210> 132 <211> 14 <212> PRT <213> Artificial sequence <400> 132 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr 1 5 10 <210> 133 <211> 15 <212> PRT <213> Artificial sequence <400> 133 Ala Ala Pro Gln Ser Asp Cys Phe His Tyr Ser Glu Asn Asp Tyr 1 5 10 15 <210> 134 <211> 15 <212> PRT <213> Artificial sequence <400> 134 Thr Ala Pro Arg Ser Asp Cys Phe His Tyr Gly Glu Asn Asp Tyr 1 5 10 15 <210> 135 <211> 15 <212> PRT <213> Artificial sequence <400> 135 Ala Ala Pro Arg Ser Asp Cys Phe His Tyr Gly Glu Asn Asp Tyr 1 5 10 15 <210> 136 <211> 15 <212> PRT <213> Artificial sequence <400> 136 Ala Ala Pro Gln Ser Asp Cys Phe His Tyr Lys Glu Asn Asp Tyr 1 5 10 15 <210> 137 <211> 14 <212> PRT <213> artificial sequence <400> 137 Gly Ala Pro Arg Asp Cys Ser Leu Tyr Thr Gly Asp Asp Tyr 1 5 10 <210> 138 <211> 14 <212> PRT <213> artificial sequence <400> 138 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr 1 5 10 <210> 139 <211> 14 <212> PRT <213> artificial sequence <400> 139 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr 1 5 10 <210> 140 <211> 14 <212> PRT <213> artificial sequence <400> 140 Gly Ala Pro Arg Asp Cys Ser Leu Tyr Thr Gly Asp Asp Tyr 1 5 10 <210> 141 <211> 14 <212> PRT <213> Artificial sequence <400> 141 Gly Ala Pro Arg Asp Cys Ser Tyr Tyr Thr Ser Asp Asp Tyr 1 5 10 <210> 142 <211> 14 <212> PRT <213> Artificial sequence <400> 142 Gly Ala Pro Arg Asp Cys Ser Arg Tyr Ser Ser Asp Asp Tyr 1 5 10 <210> 143 <211> 11 <212> PRT <213> Artificial sequence <400> 143 Ser Ala Ser Asp Tyr Gly Ser Ser Leu Tyr Tyr 1 5 10 <210> 144 <211> 18 <212> PRT <213> Artificial sequence <400> 144 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Pro Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 145 <211> 10 <212> PRT <213> Artificial sequence <400> 145 His Ala Ala Thr Asp Thr Gly Val Ile Tyr 1 5 10 <210> 146 <211> 13 <212> PRT <213> artificial sequence <400> 146 Ala Ala Asp Pro Arg Arg Leu Thr Gly Leu Tyr Asp Tyr 1 5 10 <210> 147 <211> 11 <212> PRT <213> artificial sequence <400> 147 Ala Ala Thr Gly Tyr Gly Ser Ser Pro Trp Tyr 1 5 10 <210> 148 <211> 18 <212> PRT <213> artificial sequence <400> 148 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Arg Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 149 <211> 18 <212> PRT <213> artificial sequence <400> 149 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Arg Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 150 <211> 18 <212> PRT <213> artificial sequence <400> 150 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 151 <211> 18 <212> PRT <213> artificial sequence <400> 151 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 152 <211> 18 <212> PRT <213> artificial sequence <400> 152 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Arg Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 153 <211> 18 <212> PRT <213> artificial sequence <400> 153 Tyr Ala Arg Thr Gly Tyr Gly Ser Gly Trp Leu Glu Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 154 <211> 18 <212> PRT <213> artificial sequence <400> 154 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 155 <211> 18 <212> PRT <213> artificial sequence <400> 155 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 156 <211> 14 <212> PRT <213> artificial sequence <400> 156 Ala Ala Ser Lys Ser Ala Tyr Ile Phe Asp Asp Arg Asp Tyr 1 5 10 <210> 157 <211> 10 <212> PRT <213> artificial sequence <400> 157 His Ile Gly Pro Glu Pro Arg Tyr Gly Tyr 1 5 10 <210> 158 <211> 10 <212> PRT <213> Artificial sequence <400> 158 His Ile Gly Pro Glu Pro Arg Tyr Gly Tyr 1 5 10 <210> 159 <211> 18 <212> PRT <213> Artificial sequence <400> 159 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 160 <211> 18 <212> PRT <213> Artificial sequence <400> 160 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 1 5 10 15 Asp Tyr <210> 161 <211> twenty three <212> DNA <213> Artificial sequence <400> 161 gtcctggctg ctcttctaca agg 23 <210> 162 <211> twenty three <212> DNA <213> Artificial sequence <400> 162 ggtacgtgct gttgaactgt tcc 23 <210> 163 <211> 33 <212> DNA <213> Artificial sequence <400> 163 ctagtgcggc cgcctggaga cggtgacctg ggt 33 <210> 164 <211> 38 <212> DNA <213> Artificial sequence <400> 164 cgcggatccc aggtgcagct gcaggagtct ggrggagg 38 <210> 165 <211> 89 <212> DNA <213> Artificial sequence <400> 165 atttttactg ctgttttatt cgcagcatcc tccgcattag ctaaaagaga ggctgaagca 60 caggtgcagc tgcaggagtc tggrggagg 89 <210> 166 <211> 81 <212> DNA <213> Artificial sequence <400> 166 agttgtcagt tcctgtgccc cccctcctcc cgcgccacct ccgcccgcac ctccgccacc 60 actggagacg gtgacctggg t 81 <210> 167 <211> 224 <212> PRT <213> Artificial sequence <400> 167 Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Ala Ala Gly Gly Pro 1 5 10 15 Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 20 25 30 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp 35 40 45 Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 50 55 60 Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val 65 70 75 80 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 85 90 95 Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys 100 105 110 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 115 120 125 Leu Pro Pro Ser Arg Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 130 135 140 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 145 150 155 160 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 165 170 175 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys 180 185 190 Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met His Glu 195 200 205 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Pro Gly 210 215 220 <210> 168 <211> 140 <212> PRT <213> artificial sequence <400> 168 Gln Asp Pro Cys Ser Asn Cys Pro Ala Gly Thr Phe Cys Asp Asn Asn 1 5 10 15 Arg Asn Gln Ile Cys Ser Pro Cys Pro Pro Asn Ser Phe Ser Ser Ala 20 25 30 Gly Gly Gln Arg Thr Cys Asp Ile Cys Arg Gln Cys Lys Gly Val Phe 35 40 45 Arg Thr Arg Lys Glu Cys Ser Ser Thr Ser Asn Ala Glu Cys Asp Cys 50 55 60 Thr Pro Gly Phe His Cys Leu Gly Ala Gly Cys Ser Met Cys Glu Gln 65 70 75 80 Asp Cys Lys Gln Gly Gln Glu Leu Thr Lys Lys Gly Cys Lys Asp Cys 85 90 95 Cys Phe Gly Thr Phe Asn Asp Gln Lys Arg Gly Ile Cys Arg Pro Trp 100 105 110 Thr Asn Cys Ser Leu Asp Gly Lys Ser Val Leu Val Asn Gly Thr Lys 115 120 125 Glu Arg Asp Val Val Cys Gly Pro Ser Pro Leu Gly 130 135 140 <210> 169 <211> 127 <212> PRT <213> artificial sequence <400> 169 Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Ser Thr Phe Ser Ile Val 20 25 30 Ala Met Gly Trp Tyr Arg Gln Ala Pro Gly Lys Gln Arg Glu Leu Val 35 40 45 Ala Ser Ile Ile Thr Gly Asp Gly Asp Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Met Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Tyr Ala Arg Thr Gly Tyr Gly Ser Ser Trp Leu Met Gly His Glu Tyr 100 105 110 Asp Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Leu Gly 115 120 125

Claims

1. An anti-4-1BB nanobody, characterized in that The amino acid sequence of the VHH chain of the anti-4-1BB nanobody is shown in any one of SEQ ID NOs: 1-3, 6, 37-38.

2. The anti-4-1BB nanobody according to claim 1, characterized in that The amino acid sequence of the VHH chain of the anti-4-1BB nanobody is shown in any one of SEQ ID NOs: 3, 37, and 38.

3. A fusion protein, characterized in that The structure of the fusion protein from N-terminus to C-terminus is shown in Formula I: Z1-L-Z2 (Formula I) In the formula, Z1 is one or more VHH chains of the anti-4-1BB nanobody as described in claim 1 or 2; Z2 is the Fc segment of immunoglobulin; L is none or a linker sequence.

4. The fusion protein according to claim 3, characterized in that The Z1 is 1-2 VHH chains of the anti-4-1BB nanobody as described in claim 1 or 2.

5. The fusion protein according to claim 3, characterized in that The fusion protein is a dimer, and the dimer is formed by disulfide bonds between Fc segments in Z2.

6. The fusion protein according to claim 3, characterized in that The immunoglobulin is IgG1, IgG2, IgG3 or IgG4.

7. The fusion protein according to claim 3, characterized in that The immunoglobulin is IgG1, or a mutant thereof.

8. The fusion protein according to claim 3, characterized in that The L is an amino acid sequence selected from the group consisting of GGGGS, (GGGGS)2, (GGGGS)3, (GGGGS)4, (GGGGS)5, or a combination thereof.

9. The fusion protein according to claim 3, characterized in that The amino acid sequence of Z2 is shown in SEQ ID NO:

167.

10. The fusion protein according to claim 3, characterized in that In Formula I of the fusion protein, the amino acid sequence of Z1 is shown in any one of SEQ ID NOs: 1-3, 6, 37-38, and L is absent, and the amino acid sequence of Z2 is shown in SEQ ID NO:

167.

11. The fusion protein according to claim 3, characterized in that In Formula I of the fusion protein, the amino acid sequence of Z1 is shown in any one of SEQ ID NOs: 3, 37, and 38, and L is absent, and the amino acid sequence of Z2 is shown in SEQ ID NO:

167.

12. A polynucleotide, characterized in that The polynucleotide encodes the anti-4-1BB nanobody according to claim 1 or 2 or the fusion protein according to any one of claims 3-11.

13. An expression vector, characterized in that: The expression vector contains the polynucleotide according to claim 12.

14. A host cell, characterized in that The host cell contains the expression vector of claim 13, or the polynucleotide of claim 12 is integrated into its genome.

15. A method for producing an anti-4-1BB nanobody or fusion protein, characterized in that: Includes steps: (a) culturing the host cell according to claim 14 under conditions suitable for producing anti-4-1BB nanobody or fusion protein, thereby obtaining a culture containing the anti-4-1BB nanobody or fusion protein; and (b) separating or recovering the anti-4-1BB nanobody or fusion protein from the culture.

16. An immunoconjugate, characterized in that: The immunoconjugate contains: (a) an anti-4-1BB nanobody as described in claim 1 or 2, or a fusion protein as described in any one of claims 3-11; and (b) a conjugation moiety selected from the group consisting of a detectable label, a drug, a toxin or an enzyme.

17. The immunoconjugate according to claim 16, characterized in that The detectable labels include radionuclides.

18. The immunoconjugate according to claim 16, characterized in that The drugs include cytokines.

19. The immunoconjugate according to claim 16, wherein The immunoconjugate contains: a multivalent anti-4-1BB nanobody as described in claim 1 or 2, or a fusion protein as described in any one of claims 3-11; the multivalency means that the amino acid sequence of the immunoconjugate contains multiple repeats of the anti-4-1BB nanobody as described in claim 1 or 2, or the fusion protein as described in any one of claims 3-11.

20. A use of the anti-4-1BB nanobody according to claim 1 or 2 or the fusion protein according to any one of claims 3 to 11, characterized in that: Used to prepare (a) a reagent for detecting 4-1BB molecules; (b) a drug for treating tumors; the tumor is selected from the following group: gastric cancer, liver cancer, kidney tumor, lung cancer, prostate cancer, colorectal cancer, breast cancer, lymphoma, melanoma, head and neck cancer, or a combination thereof.

21. The use according to claim 20, characterized in that The colorectal cancer is small intestine cancer.

22. The use according to claim 20, characterized in that The colorectal cancer is colon cancer.

23. The use according to claim 20, characterized in that The detection includes flow cytometry and cell immunofluorescence detection.

24. A pharmaceutical composition, characterized in that include: (i) an anti-4-1BB nanobody as described in claim 1 or 2, a fusion protein as described in any one of claims 3 to 11, or an immunoconjugate as described in any one of claims 16 to 19; and (ii) a pharmaceutically acceptable carrier.

25. Use of an anti-4-1BB nanobody as claimed in claim 1 or 2 or a fusion protein as claimed in any one of claims 3 to 11 for one or more non-disease treatment purposes and non-disease diagnosis purposes: (i) Used to detect human 4-1BB molecule; (ii) for flow cytometry; (iii) For cell immunofluorescence detection.

26. A recombinant protein, characterized in that The recombinant protein is composed of the following parts: (i) an anti-4-1BB nanobody as described in claim 1 or 2, or a sequence of a fusion protein as described in any one of claims 3 to 11; and (ii) optionally a tag sequence to facilitate expression and / or purification.

27. Use of an anti-4-1BB nanobody according to claim 1 or 2, a fusion protein according to any one of claims 3 to 11, or an immunoconjugate according to any one of claims 16 to 19, characterized in that: Used in the preparation of pharmaceutical agents, reagents, test panels or test kits; Wherein, the reagent, detection plate or kit is used for: detecting 4-1BB protein in a sample; Wherein, the agent is used to treat or prevent solid tumors, and the solid tumors are selected from the following group: gastric cancer, liver cancer, kidney tumor, lung cancer, prostate cancer, colorectal cancer, breast cancer, lymphoma, melanoma, head and neck cancer, or a combination thereof.

28. A method for detecting 4-1BB protein in a sample for non-disease treatment purposes and non-disease diagnosis purposes, comprising the steps of: (1) contacting a sample with the anti-4-1BB nanobody according to claim 1 or 2 or the fusion protein according to any one of claims 3 to 11; (2) Detecting whether an antigen-antibody complex is formed, wherein the formation of the complex indicates the presence of 4-1BB protein in the sample.

Images