A DNA origami-aptamer nanoarray sensor and its preparation method and application

By connecting the binding sites with the fluorescently labeled double-stranded nucleic acid aptamers on triangular DNA origami paper and centrifuged with ultrafiltration tubes, the problem of cumbersome operation and insufficient sensitivity in small molecule detection is solved, and quantitative detection with high specificity and high sensitivity is achieved, and the sensor can be reused.

CN114354909BActive Publication Date: 2025-08-26INST OF ENVIRONMENTAL MEDICINE & OCCUPATIONAL MEDICINE ACAD OF MILITARY MEDICINE ACAD OF MILITARY SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202111491160.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-08
Publication Date
2025-08-26
Estimated Expiration
2041-12-08

AI Technical Summary

Technical Problem

The existing DNA origami sensors are cumbersome, time-consuming and limited in small molecule detection, limiting their application range.

Method used

Triangular DNA origami is used as a template to connect binding sites on some single strands, specifically bind to the double-stranded nucleic acid aptamer of the fluorescently labeled target, and the target-application complex is centrifuged with a 100kDa MWCO ultrafiltration tube to achieve high sensitivity quantitative detection.

Benefits of technology

A small molecule detection with high specificity and high sensitivity is achieved, with a detection range of 0.1 ng/mL to 1000 ng/mL, a detection limit of 0.29 ng/mL, and the sensor can be reused, simplifying the preparation process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114354909B_ABST
    Figure CN114354909B_ABST
Patent Text Reader

Abstract

The present invention provides a DNA origami-aptamer nanoarray sensor and its preparation method and application, which relate to the field of biosensor technology. The present invention proposes a DNA origami-aptamer nanoarray that can achieve high-sensitivity and high-specificity detection of fluorescence spectra. ATP double-stranded nucleic acid aptamers are bound to triangular DNA origami through simple base complementary pairing. Based on the specific binding of the aptamer and the target, as well as the molecular weight difference between the origami and the target-aptamer mixture, the concentration of ATP is quantified by centrifugation using a 100KD ultrafiltration tube. The detection range of ATP is 0.1ng / mL to 1000ng / mL, with a detection limit of 0.29ng / mL. The sensor has good specificity and can be reused.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biosensors, and in particular relates to a DNA origami-aptamer nanoarray sensor and a preparation method and application thereof. Background Art

[0002] Biosensors are analytical tools that convert the biochemical reactions or processes detected during the identification of relevant analytes into other readable output signals, such as optical or electrical signals. With the increasing demand for rapid, on-site, highly sensitive, and highly specific / selective detection in fields such as clinical diagnosis, environmental monitoring, vital physiological function monitoring, and food testing, various biosensors are gaining increasing attention due to their ease of operation, user-friendliness, rapid detection speed, and high sensitivity compared to traditional detection methods. The rapid development of DNA nanotechnology has provided a promising foundation for the development of new biosensors for detection. Its ability to precisely manipulate nanomaterials and the excellent biocompatibility of DNA itself have prompted scientists to continuously explore more possibilities. Among them, scaffolded DNA origami technology is a highly representative DNA structure nanotechnology. It is an effective bottom-up method for the fabrication of complex, arbitrarily shaped, precisely programmable, self-assembled nanostructures ranging in size from tens of nanometers to submicrometers.

[0003] DNA origami is a 2D or 3D structure formed by the orderly folding of a long ssDNA scaffold strand, typically the long DNA strand of the M13 bacteriophage virus, and numerous (usually approximately 200) short stapler strands. These short strands complement the linear end-termini of the scaffold strand, maximizing base pairing with the stapler strands and bringing distal sequences into close proximity, thereby forming the desired shape. The application of DNA origami technology in biosensing has been widely reported. There are numerous reports of DNA origami combined with aptamers or single-stranded nucleotides for sensing in electrochemical, fluorescence, and microscopic imaging assays. For example, Akinori Kuzuya et al. created a DNA origami clamp device that incorporated DNA or RNA strands and aptamers into the DNA origami structure and used atomic force microscopy to visually detect a variety of inorganic and organic targets, ranging from metal ions to proteins, in a single-molecule manner by observing the origami shape transitions. Denis Selnihhin and his colleagues exploited the diversity of DNA origami shapes and their ability to assemble precisely to design and assemble a dynamic DNA origami device containing an array of fluorescent donors and acceptors, allowing single-device analysis using mainstream fluorescence microscopy. However, these devices rely on the design of DNA origami structures, cumbersome and advanced experimental techniques, and time-consuming readouts, significantly limiting their applications. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a DNA origami-aptamer nanoarray sensor and its preparation method and application. The nanoarray sensor has good specificity and can be reused, opening up a new strategy for the application of DNA origami technology in small molecule detection.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a DNA origami-aptamer nanoarray sensor. The nanoarray sensor uses triangular DNA origami as a template, connects binding sites on part of the single strand of the triangular DNA origami, and the binding sites specifically bind to double-stranded nucleic acid aptamers of fluorescently labeled targets.

[0007] Preferably, the binding site comprises PolyA15.

[0008] Preferably, the target comprises ATP;

[0009] When the target is ATP, the double-stranded nucleic acid aptamer includes P1 and P2, wherein the nucleotide sequence of P1 is shown as SEQ ID NO.1, and the nucleotide sequence of P2 is shown as SEQ ID NO.2.

[0010] Preferably, the binding site and the double-stranded nucleic acid aptamer are respectively labeled with different fluorescent markers.

[0011] The present invention also provides a method for preparing the above-mentioned nanoarray sensor, comprising the following steps: mixing an M13 gene chain, a staple chain, and a capture chain in a molar ratio of 1:10:10, cooling from 95°C to 25°C at a rate of 0.1°C / 10s to perform self-assembly, thereby obtaining a triangular DNA origami;

[0012] The nanoarray sensor is obtained by simply extending part of the single strand on the addressable surface of the triangular DNA origami.

[0013] Preferably, after obtaining the triangular DNA origami, the method further comprises filtering to remove excess single strands;

[0014] The filtration involved removal of excess single-stranded DNA using a 100 kDa MWCO.

[0015] The present invention also provides the use of the nanometer array sensor in quantitatively detecting the content of a target substance.

[0016] The present invention also provides a method for quantitatively detecting a target, comprising the following steps: mixing the above-mentioned nanoarray sensor with equal volumes of target substances of different concentrations and incubating for 1 hour, centrifuging using a 100kD ultrafiltration tube, recording the spectrum of the filtrate between 510nm and 700nm, preparing a standard curve, and using the standard curve to calculate the concentration of the target substance.

[0017] Preferably, when the target substance is ATP, the standard curve is y=372.28x+1130.8, R 2 =0.9872, where x is the logarithm of ATP concentration, and y is the difference between the fluorescence value when ATP is 0 ng / mL and the fluorescence values ​​corresponding to different ATP concentrations.

[0018] Preferably, the excitation wavelength of the spectrum is 480 nm, and the slit widths for excitation and emission are both fixed at 10 nm.

[0019] Beneficial effects: The present invention provides a DNA origami-aptamer nanoarray sensor, which uses triangular DNA origami as a template, and extends recognition probes (binding sites) on the origami for binding to double-stranded nucleic acid aptamers labeled with fluorophores. Based on the specific binding reaction between the aptamer and the target, and the molecular weight difference between the origami and the aptamer, the origami array with the aptamer and the target-aptamer complex are cleverly separated by ultrafiltration tube centrifugation, thereby achieving high specificity and high sensitivity quantitative detection of the target using an ordinary fluorescence spectrophotometer. In an embodiment of the present invention, an ATP double-stranded nucleic acid aptamer is bound to the triangular DNA origami through simple base complementary pairing. Based on the specific binding between the aptamer and the target, and the molecular weight difference between the origami and the target-aptamer mixture, the concentration of ATP is quantified by centrifugation in a 100KD ultrafiltration tube. The results show that the detection range of ATP is 0.1ng / mL to 1000ng / mL, and the standard curve equation is y=372.28x+1130.8(R 2 =0.9872), with a detection limit of 0.29 ng / mL. The sensor has good specificity and can be reused, which opens up a new strategy for the application of DNA origami technology in small molecule detection.

[0020] The present invention also provides a method for preparing a DNA origami-aptamer nanoarray sensor and its application in the quantitative detection of target species. The recognition probe is bound to the DNA origami by slow cooling, without the need for a biocoupling step, which greatly saves time and reduces system preparation steps. The detection system is rechargeable, and the detection mechanism is based on the hybridization and displacement of DNA chains. Therefore, after each round of detection, additional double-stranded nucleic acid aptamers can be added to the array solution and re-hybridized to the array for repeated use by the detection system. The spatial distance between adjacent aptamers and the binding process in the solution are precisely controlled to make the binding of the target and the aptamer more efficient. The DNA origami-based detection platform is expected to achieve simultaneous detection of multiple targets by combining different signal aptamers. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of ATP detection based on DNA origami-aptamer nanoarray; a: Synthesis steps of DNA origami after binding complementary strands and aptamers with 24 capture strands; b: Schematic diagram of DNA origami binding of 24 dual ligands; c: AFM image of DNA origami dual aptamer nanoarray; d: ATP detection process using Ultra-0.5ml 100kD centrifugal filter (Millipore);

[0022] Figure 2 Characterization of DNA origami-double-stranded aptamer nanoarrays;

[0023] Figure 3 To verify the detection of ATP based on DNA origami-double-stranded aptamer nanoarray;

[0024] Figure 4 Fluorescence spectra of DNA origami-double-stranded aptamer nanoarrays detecting different concentrations of ATP;

[0025] Figure 5 Rechargeable reuse of DNA origami-based double-stranded aptamer nanoarrays. DETAILED DESCRIPTION

[0026] The present invention provides a DNA origami-aptamer nanoarray sensor. The nanoarray sensor uses triangular DNA origami as a template, connects binding sites on part of the single strand of the triangular DNA origami, and the binding sites specifically bind to double-stranded nucleic acid aptamers of fluorescently labeled targets.

[0027] The triangular DNA origami of the present invention is preferably constructed according to the method of Rothemund (Rothemund, PW, Folding DNA to create nanoscale shapes and patterns. Nature, 2006. 440 (7082): p. 297-302.). Specifically, in an embodiment of the present invention, PolyA15 is extended from the staple chains 51, 39, 06, 18, 52, 40, 07, and 19 of the three sides A, B, and C of the triangular DNA origami to form a capture chain. When constructing the triangular DNA origami of the present invention, the method provided by Rothemund is preferably improved, and more preferably includes: diluting the staple chain and the capture chain (modified chain) to 500 nmol / L respectively; mixing the M13 gene chain (M13mp18, 100 nmol / L) scaffold chain with the staple chain and the capture chain at a molar concentration ratio of 1:10:10 in 1×TAE-Mg 2+ The DNA origami was assembled in a buffer solution (Tris, 40mM; Acetic acid, 20mM; EDTA, 2mM; and Magnesium acetate, 12.5mM; pH 8.0) and slowly cooled from 95°C to 25°C at a rate of 0.1°C / 10s in a PCR instrument. After obtaining the triangular DNA origami, the present invention preferably further comprises filtering to remove excess single strands. The filtration is preferably performed using a 100kDa MWCO ultrafiltration membrane to remove excess short strands, thereby obtaining high-purity DNA origami. In the present invention, the 100kDa MWCO ultrafiltration membrane is preferably an Ultra-0.5ml 100kD ultrafiltration tube (Millipore).

[0028] The M13 gene chain of the present invention has been made public and can be found at http: / / www.neb.com / nebecomm / tech_reference / restriction_enzymes / sequences / m13mp18.txt. The sequences of the staple chain and the capture chain are shown in Table 1.

[0029] Table 1 Single-stranded gene sequences used in the present invention

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039] The binding site of the present invention preferably includes PolyA15. In the present invention, when the target is adenosine triphosphate (ATP), the aptamer binding to ATP is preferably a double-stranded nucleic acid probe P1-P2 designed using the concept of "cooperative stabilization", wherein the nucleotide sequence of P1 is preferably as shown in SEQ ID NO.1: 5'-cactgACCTGGGGGAGTATTGCGGAGGAAGGT-3', and the nucleotide sequence of P2 is preferably as shown in SEQ ID NO.2: 5'-CCCAGGTcagtg-3'. Among them, P1 is a short non-aptamer sequence (containing 5 bases 5'-cactg-3', non-aptamer base sequence represented by lowercase letters) added to the 5' end of the ATP aptamer (the base sequence represented by uppercase letters in P1), and P2 is a 12-base sequence that complementarily pairs with the 5-base non-aptamer short sequence and its adjacent 7-base aptamer short sequence (5'-ACCTGGG-3'). The purpose of this design is to obtain a stable double-stranded nucleic acid structure while minimizing the number of nucleic acid aptamer bases involved in forming the double-stranded nucleic acid structure, thereby maintaining the bulk conformation of the nucleic acid aptamer to the greatest extent and promoting the rapid strand displacement reaction between the double-stranded nucleic acid recognition probe and the target molecule ATP.

[0040] The binding sites and double-stranded nucleic acid aptamers of the present invention are preferably labeled with different fluorescent markers. In an embodiment of the present invention, the four short chains on the triangular DNA origami are labeled with green fluorescent Alexa488, and the ATP aptamer and complementary chain are labeled with Cy5 and Cy3 dyes, respectively, to form an origami array.

[0041] The present invention also provides a method for preparing the above-mentioned nanoarray sensor, comprising the following steps: mixing an M13 gene chain, a staple chain, and a capture chain in a molar ratio of 1:10:10, cooling from 95°C to 25°C at a rate of 0.1°C / 10s to perform self-assembly, thereby obtaining a triangular DNA origami;

[0042] The nanoarray sensor is obtained by simply extending part of the single strand on the addressable surface of the triangular DNA origami.

[0043] The method for constructing the triangular DNA origami of the present invention is preferably the same as described above and will not be described in detail here.

[0044] The present invention simply extends some single strands on the addressable surface, preferably extending PolyA15 from staple strands 51, 39, 06, 18, 52, 40, 07, and 19 on the three sides A, B, and C of the triangular DNA origami, to form recognition probes, as shown in Table 1 (Capture strands for ATP aptamer and Complementary strand loading).

[0045] The present invention also provides the use of the nanometer array sensor in quantitatively detecting the content of a target substance.

[0046] In an embodiment of the present invention, when ATP is the target, the ATP aptamer probe does not participate in the synthesis of the DNA origami. Instead, the origami is functionalized by extending a segment of PolyA15 from a portion of the stapled single strands on the origami. A segment of PolyT15 is then extended from the complementary strand of ATP, enabling it to bind to the DNA origami through base pairing. Simultaneously, the ATP aptamer and the complementary strand combine to form a double-stranded DNA structure. Furthermore, the triangular DNA origami prepared using the preparation method of the present invention is a high-molecular-weight nucleic acid formed by base pairing with 208 short strands and one long single strand. Ultra-0.5ml 100kD ultrafiltration tubes (Millipore) can retain it within the tube. However, the aptamer, with a much smaller molecular weight, cannot be retained by the ultra-0.5ml 100kD ultrafiltration tube and can be removed by centrifugation through the ultrafiltration membrane. When ATP molecules are present in the detection system, due to the strong affinity between ATP and its aptamer, the double-stranded probe opens, the target probe complex is released from the array surface, and the complementary strand remains free above the DNA origami. The released target-probe complex was removed by centrifugation through an ultrafiltration tube (100kDa MWCO, Amicon, Millipore), and the fluorescence value of the DNA origami array decreased. However, when ATP was not present in the detection system, the double-stranded nucleic acid aptamer probe could not be opened, and the fluorescence value of the DNA origami array was high. Based on this mechanism, a fluorescence sensing platform based on DNA origami double-stranded nucleic acid aptamers was proposed to evaluate the ATP content in the detection system ( Figure 1 ).

[0047] The present invention also provides a method for quantitatively detecting a target, comprising the following steps: mixing the above-mentioned nanoarray sensor with equal volumes of target substances of different concentrations and incubating for 1 hour, centrifuging using a 100kD ultrafiltration tube, recording the spectrum of the filtrate between 510nm and 700nm, preparing a standard curve, and using the standard curve to calculate the concentration of the target substance.

[0048] In the present invention, when the method is used to quantitatively determine ATP, as the ATP concentration (0 ng / mL to 1000 ng / mL) increases, the emission peak of the FAM fluorophore at 520 nm gradually weakens. c That is, the relationship between the difference (y) between the fluorescence value when ATP is 0 ng / mL and the fluorescence values ​​corresponding to different concentrations of ATP and the logarithm (x) of the ATP concentration is: y = 372.28x + 1130.8 (R 2 =0.9872), and the limit of detection (LOD) was 0.29 ng / mL. In the present invention, when analyzing the above spectrum, the excitation wavelength is preferably set to 480 nm, and the slit widths for excitation and emission are both fixed to 10 nm.

[0049] The DNA origami-aptamer nanoarray sensor, its preparation method and application provided by the present invention are described in detail below with reference to the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0050] Unless otherwise specified, the reagents, materials and instruments used in the present invention are conventional commercial products in the art.

[0051] 1. Materials

[0052] All nucleotide chains, including staple chains and aptamers, were purchased from Sangon Biotech (Shanghai, China). Origami staple chains were dissolved at 100 μM and stored in tubes. M13mp18 viral DNA was purchased from New England Biolabs (N4040S) at a concentration of 100 nM. Adenosine triphosphate (ATP>99%), uridine triphosphate (UTP>99%), guanosine triphosphate (GTP>99%), and thymidine triphosphate (CTP>99%) were purchased from Aladdin Reagents (Shanghai, China). Magnesium acetate was purchased from Aladdin, EDTA disodium salt and Tris were purchased from Solarbio, and acetic acid was purchased from Jiuding Chemical. All reagents were used without further purification. Ultrapure water for the experiments was prepared using a Millipore ultrapure water purification system (resistivity 18 MΩ·cm).

[0053] 2. Instruments and equipment

[0054] UV-Vis absorption spectra were recorded using a SHIMADZU-1901 spectrometer from Japan. All fluorescence spectra were measured using a F-4500 fluorescence spectrophotometer from Japan. The morphology of the origami was characterized using an atomic force microscope (AFM) from Bruker, Germany, and the synthesis of origami arrays was documented using a laser confocal microscope (Nikon). All origami or origami arrays were synthesized using a PCR annealing method (Bio-Rad T100).

[0055] Example 1

[0056] 1. Self-assembly and purification of DNA origami templates

[0057] According to the Rothemund method, a triangular DNA origami structure was assembled with slight modifications. The specific steps of origami synthesis are as follows: the staple chain (capture chain) that needs to be replaced is removed, and the remaining unmodified short chains (non-capture chains) are mixed in equal volumes and diluted to 500nmol / L for use. The capture chain (modified chain) is mixed in the same way and diluted to 500nmoL / L for use. The M13mp18 (C = 100nmol / L) scaffold chain is mixed with the staple chain and capture chain in a molar concentration ratio of 1:10:10 in 1×TAE-Mg 2+ The buffer solution was slowly cooled from 95°C to 25°C at a rate of 0.1°C / 10s by a PCR instrument for assembly. The specific system was 100 μL: M13mp182.5 μL, staple chain 5 μL, capture chain 5 μL, 10×TAE-Mg 2+ 10μL, ultrapure water 77.5μL.

[0058] The synthesized origami mixture was centrifuged using Ultra-0.5ml 100kD ultrafiltration tubes (Millipore) to remove excess short chains, thereby obtaining highly pure DNA origami. The purified origami solution was collected and characterized by 1% agarose gel electrophoresis and atomic force microscopy.

[0059] 2. Synthesis and Characterization of DNA Origami Arrays Ori-cDNA-Apt (DNA Origami Complementary DNA and Aptamer)

[0060] The purified origami is assembled with the complementary chain of ATP and the aptamer to form an ATP detection component. The specific steps are as follows: The purified origami is quantified by UV-VIS spectrophotometer to calculate the corresponding concentration of the origami, c = 12.6A, A is the UV absorbance value at 260nm. Then Ori: cDNA: Apt is prepared at a molar concentration ratio of 1:3:6 to ensure that the capture chain on the origami and the complementary chain of ATP are fully bound, and at the same time, the complementary chain and the aptamer are completely bound. The three solutions are mixed in equal volumes in 1×TAE-Mg 2+ The buffer solution was placed in a PCR instrument and slowly decreased from 45°C to 25°C at a rate of 5 min / °C for 6 cycles.

[0061] The origami arrays were purified and concentrated by centrifugation through 0.5ml 100kD ultrafiltration tubes. The purified origami nanoarrays were collected and quantified using a UV–VIS spectrophotometer. The nanoarrays were then characterized using 1% agarose gel electrophoresis, atomic force microscopy, and laser confocal microscopy.

[0062] 2.1 Atomic force microscopy characterization

[0063] For DNA origami structures, the origami samples were washed with 1×TAE-Mg 2+ The buffer solution was diluted 5-20 times, and 5 μL was deposited onto a freshly dissociated mica sheet. The mica sheet was adsorbed on the surface for 3 minutes, then rinsed with 100 μL of ultrapure water and dried with nitrogen before imaging. Atomic force microscopy imaging of the DNA origami before and after aptamer loading was performed in gas-phase ScanAsyst mode.

[0064] 2.2 Gel electrophoresis

[0065] DNA origami-aptamer assemblies were separated on 1% agarose gel (stained with Gene Green, electrophoresis buffer: 0.5×TBE-11 mM MgCl2 2+ , electrophoresis was performed at 100 V constant voltage for 40 min in an ice-water bath and imaged under ultraviolet irradiation.

[0066] 2.3 Laser confocal microscopy characterization

[0067] The synthesis of the origami array was studied using laser confocal microscopy imaging. The four short chains on the origami were labeled with green fluorescent Alexa488, and the ATP aptamer and complementary chain were labeled with Cy5 and Cy3 dyes, respectively, to form an origami array. The sample was then dropped onto a glass slide and the parameters were adjusted. Under the excitation of 489nm, 560nm, and 640nm channels, the image was taken at a resolution of 512x512 pixels (unit pixel size 6.21×6.21μm). 2 ) Shoot a frame of 3×3mm 2 image.

[0068] Figure 2 Figures a through f show AFM images and corresponding cross-sectional analyses of bare DNA origami, DNA origami modified with 24 capture strands, and DNA origami bound to double-stranded aptamers. First, the heights of the DNA origami modified with 24 capture strands and the DNA origami bound to double-stranded aptamers reach approximately 3 nm, while the height of the bare DNA origami is approximately 2 nm. Second, the height of the DNA origami bound to double-stranded aptamers exhibits significant fluctuations, likely due to the binding of the double-stranded aptamers. Figure 2 Figure g shows that the combination of 24 molecular probes does not affect the morphology and dispersion of origami. The purified origami array was analyzed by agarose gel electrophoresis ( Figure 2 (i) Under ultraviolet (UV) irradiation, the M13 scaffold chain, triangular DNA origami, origami-complementary chain, and origami-double-stranded arrays exhibit distinct bands. As the number of aptamers bound increases, the band mobility of the assembly decreases, and the fluorescence value of the assembly gradually increases. Laser scanning confocal imaging, under excitation at 489nm, 560nm, and 640nm channels, reveals distinct green and red fluorescence, indicating successful binding of the double-stranded aptamer to the DNA origami. Figure 2 h). Furthermore, fluorescence characterization also demonstrated the successful binding of the double-stranded aptamer. Analysis of the heights of origami without capture chains and origami-aptamer arrays revealed that the latter (2.60±0.22nm) was 0.31nm taller than the former (2.29±0.17nm). Therefore, the origami structure designed and prepared by the present invention with 24 capture chains, with inter-chain distances of 21nm and 6nm, provides ample space for nucleic acid probe binding and prevents fluorescence self-quenching.

[0069] Example 2

[0070] 1. ATP detection

[0071] ATP standard solution (1 mg / mL) was dissolved in 1×TAE-Mg 2+In the buffer solution, first, 50 μL of 5 μM origami array was mixed with equal volumes of target substances at different concentrations, and the mixture was incubated at 37 ° C for 1 hour. Subsequently, Ultra-0.5 ml 100 kD ultrafiltration tubes (Millipore) were used to centrifuge the mixture. The centrifugation conditions were 3000 g for 5 minutes at room temperature. Finally, the origami array solution in the inner tube was collected, and its fluorescence emission spectrum was collected using a Hitachi F-4500 fluorescence spectrophotometer (Japan). The excitation wavelength of FAM fluorescent dye was 480 nm, and the spectrum was recorded between 510 nm and 700 nm. The slit width of excitation and emission was fixed at 10 nm. All measurements were performed in 1×TAE-Mg 2+ The assay was performed in a buffer solution (pH 8.0).

[0072] 2. Specificity Experiment

[0073] ATP structural analogs, such as uridine triphosphate (UTP), cytidine triphosphate (CTP), and guanosine triphosphate (GTP), were selected to evaluate the selectivity of ATP detection. The concentrations of ATP and other compounds were 0.1 ng / mL and 100 ng / mL, respectively, and the analytical conditions were the same as those for ATP detection.

[0074] 3. Reuse of DNA origami

[0075] The detection principle of the present invention is based on the strand hybridization and displacement of double-stranded DNA nucleic acid aptamers. Therefore, the detection system is rechargeable. After each round of detection, a 3-fold excess of ATP aptamer concentration is added to the array solution and re-hybridized to the array in an annealing manner for repeated use by the detection system.

[0076] like Figure 3 As shown in Figure (a), the fluorescence value of the origami array increases after the double-stranded aptamer is added, indicating that the double-stranded aptamer is successfully labeled on the DNA origami. After adding 1 mg / mL ATP and centrifuging the ultrafiltration tube for 5 minutes, the fluorescence value of the collected inner tube solution decreases significantly. This indicates that the stronger affinity between ATP and its aptamer can compete with the FAM-aptamer on the double-stranded probe, thereby detaching the FAM-aptamer from the origami array. Centrifugation removes the fluorescent group it carries, further reducing the fluorescence value on the origami array. Figure 3 Figure b shows that there is no significant difference in the fluorescence values ​​and concentrations of the origami array obtained by centrifugation of four different batches of ultrafiltration tubes, indicating that ultrafiltration tubes can be used for quantitative analysis of ATP. Figure 3 Figure c shows the fluorescence changes of four different batches of origami arrays, indicating that the synthesis of the origami arrays is very stable. Therefore, these experiments show that the DNA origami-based double-stranded aptamer platform combined with ultrafiltration centrifugation can be used for the detection of the target ATP.

[0077] like Figure 4 As shown in Figure a, as the ATP concentration (0 ng / mL to 1000 ng / mL) increases, the emission peak of the FAM fluorophore at 520 nm gradually weakens. c , that is, the relationship between the difference (y) between the fluorescence value when ATP is 0 ng / mL and the fluorescence values ​​corresponding to different concentrations of ATP and the logarithm (x) of the ATP concentration is as follows: Figure 4 As shown in b and c, the linear detection range is 0.1 ng / mL to 1000 ng / mL, and the standard curve equation is y = 372.28x + 1130.8 (R 2 =0.9872), and the limit of detection (LOD) was 0.29 ng / mL.

[0078] The present invention also tested the response of the nanoarray sensor obtained in Example 1 to ATP analogs (GTP, UTP, CTP), and evaluated the selectivity of the sensor in detecting ATP ( Figure 4 d). 0.1 ng / mL ATP and 100 ng / mL GTP, UTP, and CTP were used for testing respectively. It was observed that low concentration of ATP could significantly reduce the fluorescence, resulting in a larger fluorescence difference (about 400), while the fluorescence difference of the three interfering substances with a concentration 1000 times higher than that of ATP (I0-I c ) is half the fluorescence difference of ATP (approximately 200), indicating that ATP can induce a strand displacement reaction in the double-stranded aptamer in the biosensor, causing the FAM-aptamer to move out of the origami array, while its analogs do not cause strand displacement reactions and thus do not affect the fluorescence intensity of the origami array. Therefore, compared with other nucleotide analogs, the ATP-binding aptamer imparts high specificity to the biosensor, making it significantly selective for ATP.

[0079] Because the detection method of the present invention is based on the strand hybridization and displacement of double-stranded DNA aptamers, the detection system is reusable, e.g. Figure 5 As shown in Figure a, after each round of detection, additional nucleic acid aptamers are mixed with the origami array solution and re-hybridized to the origami by annealing for repeated use of the detection system. Figure 5 As shown in middle b, after adding 1 mg / mL ATP to the origami array with the aptamer added again, the fluorescence value decreased significantly.

[0080] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention. Sequence Listing <110> Institute of Environmental Medicine and Occupational Medicine, Academy of Military Medical Sciences, Academy of Military Sciences <120> A DNA origami-aptamer nanoarray sensor and its preparation method and application <160> 218 <170> SIPOSequenceListing 1.0 <210> 1 <211> 32 <212> DNA <213> Artificial Sequence <400> 1 cactgacctg ggggagtatt gcggaggaag gt 32 <210> 2 <211> 12 <212> DNA <213> Artificial Sequence <400> 2 cccaggtcag tg 12 <210> 3 <211> 29 <212> DNA <213> Artificial Sequence <400> 3 tttttttttttttttttccc aggtcagtg 29 <210> 4 <211> 29 <212> DNA <213> Artificial Sequence <400> 4 tttttttttttttttttccc aggtcagtg 29 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <400> 5 cactgacctg ggggagtatt gcggaggaag gt 32 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <400> 6 cactgacctg ggggagtatt gcggaggaag gt 32 <210> 7 <211> 32 <212> DNA <213> Artificial Sequence <400> 7 cggggtttcc tcaagagaag gattttgaat ta 32 <210> 8 <211> 32 <212> DNA <213> Artificial Sequence <400> 8 agcgtcatgt ctctgaattt accgactacc tt 32 <210> 9 <211> 32 <212> DNA <213> Artificial Sequence <400> 9 ttcataatcc ccttattagc gtttttctta cc 32 <210> 10 <211> 32 <212> DNA <213> Artificial Sequence <400> 10 atggtttatg tcacaatcaa tagatattaa ac 32 <210> 11 <211> 40 <212> DNA <213> Artificial Sequence <400> 11 tttgatgatt aagaggctga gacttgctca gtaccaggcg 40 <210> 12 <211> 40 <212> DNA <213> Artificial Sequence <400> 12 gacgggagaa ttaactcgga ataagtttatttccagcgcc 40 <210> 13 <211> 40 <212> DNA <213> Artificial Sequence <400> 13 gataagtgcc gtcgagctga aacatgaaag tatacaggag 40 <210> 14 <211> 32 <212> DNA <213> Artificial Sequence <400> 14 tgtactggaa atcctcatta aagcagagcc ac 32 <210> 15 <211> 32 <212> DNA <213> Artificial Sequence <400> 15 caccggaaag cgcgttttca tcggaagggc ga 32 <210> 16 <211> 40 <212> DNA <213> Artificial Sequence <400> 16 40. cats acgcaaagac acgcaacac cctgaacaaa <210> 17 <211> 40 <212> DNA <213> Artificial Sequence <400> 17 tttaacggtt cggaacctat tattagggtt throw <210> 18 <211> 32 <212> DNA <213> Artificial Sequence <400> 18 ctcagagcat attcacaaac aattaata gt <210> 19 <211> 32 <212> DNA <213> Artificial Sequence <400> 19 ggaggatt tagcgtcaga ctgtccgcct cc <210> 20 <211> 40 <212> DNA <213> Artificial Sequence <400> 20 gtcagagggt aattgatggc aacatataaa agcgattgag <210> 21 <211> 40 <212> DNA <213> Artificial Sequence <400> 21 tagcccgga tagcccgga ccccctgcct atggtcagtg <210> 22 <211> 40 <212> DNA <213> Artificial Sequence <400> twenty two ttgacggaaa tacatacata aagggcgcta atatcagaga 40 <210> twenty three <211> 35 <212> DNA <213> Artificial Sequence <400> twenty three cagagccagg aggttgaggc aggtaacagt gcccg 35 <210> twenty four <211> 32 <212> DNA <213> Artificial Sequence <400> twenty four attaaaggcc gtaatcagta gcgagccacc ct 32 <210> 25 <211> 40 <212> DNA <213> Artificial Sequence <400> 25 gataacccac aagaatgtta gcaaacgtag aaaattattc 40 <210> 26 <211> twenty four <212> DNA <213> Artificial Sequence <400> 26 gccgccagca ttgacaccac cctc 24 <210> 27 <211> 32 <212> DNA <213> Artificial Sequence <400> 27 agagccgcac catcgatagc agcatgaatt at 32 <210> 28 <211> 40 <212> DNA <213> Artificial Sequence <400> 28 caccgtcacc ttattacgca gtattgagtt aagcccaata 40 <210> 29 <211> 35 <212> DNA <213> Artificial Sequence <400> 29 agccatttaa acgtcaccaa tgaacaccag aacca 35 <210> 30 <211> 40 <212> DNA <213> Artificial Sequence <400> 30 ataagagcaa gaaacatggc atgattaaga ctccgacttg 40 <210> 31 <211> twenty four <212> DNA <213> Artificial Sequence <400> 31 ccattagcaa ggccggggga atta 24 <210> 32 <211> 40 <212> DNA <213> Artificial Sequence <400> 32 gagccagcga atacccaaaa gaacatgaaa tagcaatagc 40 <210> 33 <211> 43 <212> DNA <213> Artificial Sequence <400> 33 tatcttaccg aagcccaaac gcaataataa cgaaaatcac cag 43 <210> 34 <211> 43 <212> DNA <213> Artificial Sequence <400> 34 cagaaggaaa ccgaggtttt taagaaaagt aagcagatag ccg 43 <210> 35 <211> 32 <212> DNA <213> Artificial Sequence <400> 35 ccttttttca tttaacaatt tcataggatt ag 32 <210> 36 <211> 32 <212> DNA <213> Artificial Sequence <400> 36 tttaacctat cataggtctg agagttccag ta 32 <210> 37 <211> 32 <212> DNA <213> Artificial Sequence <400> 37 agtataaaat atgcgttata caaagccatc tt 32 <210> 38 <211> 32 <212> DNA <213> Artificial Sequence <400> 38 caagtacctc attccaagaa cgggaaattc at 32 <210> 39 <211> 32 <212> DNA <213> Artificial Sequence <400> 39 agagaataac ataaaaacag ggaagcgcat ta 32 <210> 40 <211> 40 <212> DNA <213> Artificial Sequence <400> 40 aaaacaaaat taattaaatg gaaacagtac attagtgaat 40 <210> 41 <211> 40 <212> DNA <213> Artificial Sequence <400> 41 tttccttagc actcatcgag aacaatagca gcctttacag 40 <210> 42 <211> 40 <212> DNA <213> Artificial Sequence <400> 42 agagtcaaaa atcaatatat gtgatgaaac aaacatcaag 40 <210> 43 <211> 32 <212> DNA <213> Artificial Sequence <400> 43 actagaaata tataactata tgtacgctga ga 32 <210> 44 <211> 32 <212> DNA <213> Artificial Sequence <400> 44 tcaataatag ggcttaattg agaatcataa tt 32 <210> 45 <211> 40 <212> DNA <213> Artificial Sequence <400> 45 aacgtcaaaa atgaaaagca agccgttttt atgaaaccaa 40 <210> 46 <211> 40 <212> DNA <213> Artificial Sequence <400> 46 gagcaaaaga agatgagtga ataaccttgc ttatagctta 40 <210> 47 <211> 32 <212> DNA <213> Artificial Sequence <400> 47 gattaagaaa tgctgatgca aatcagaata aa 32 <210> 48 <211> 32 <212> DNA <213> Artificial Sequence <400> 48 caccggaatc gccatattta acaaaattta cg 32 <210> 49 <211> 40 <212> DNA <213> Artificial Sequence <400> 49 agcatgtatt tcatcgtagg aatcaaacga ttttttgttt 40 <210> 50 <211> 40 <212> DNA <213> Artificial Sequence <400> 50 acatagcgct gtaaatcgtc gctattcatt tcaattacct 40 <210> 51 <211> 40 <212> DNA <213> Artificial Sequence <400> 51 tcccaatcca aataagatta ccgcgcccaa taaataatat 40 <210> 52 <211> 35 <212> DNA <213> Artificial Sequence <400> 52 tcccttagaa taacgcgaga aaacttttac cgacc 35 <210> 53 <211> 32 <212> DNA <213> Artificial Sequence <400> 53 gtgtgataag gcagaggcat tttcagtcctga 32 <210> 54 <211> 40 <212> DNA <213> Artificial Sequence <400> 54 acaagaaagc aagcaaatca gataacagcc atattattta 40 <210> 55 <211> twenty four <212> DNA <213> Artificial Sequence <400> 55 gtttgaaatt caaatatatt ttag 24 <210> 56 <211> 32 <212> DNA <213> Artificial Sequence <400> 56 aatagataga gccagtaata agagatttaa tg 32 <210> 57 <211> 40 <212> DNA <213> Artificial Sequence <400> 57 gccagttaca aaataataga aggctttatcc ggttatcaac 40 <210> 58 <211> 35 <212> DNA <213> Artificial Sequence <400> 58 ttctgaccta aaatataaag taccgactgc agaac 35 <210> 59 <211> 40 <212> DNA <213> Artificial Sequence <400> 59 gcgcctgtta ttctaagaac gcgattccag agcctaattt 40 <210> 60 <211> twenty four <212> DNA <213> Artificial Sequence <400> 60 tcagctaaaa aaggtaaagt aatt 24 <210> 61 <211> 40 <212> DNA <213> Artificial Sequence <400> 61 acgctaacga gcgtctggcg ttttagcgaa cccaacatgt 40 <210> 62 <211> 43 <212> DNA <213> Artificial Sequence <400> 62 acgacaataa atcccgactt gcgggagatc ctgaatctta cca 43 <210> 63 <211> 43 <212> DNA <213> Artificial Sequence <400> 63 tgctattttg cacccagcta caattttgtt ttgaagcctt aaa 43 <210> 64 <211> 32 <212> DNA <213> Artificial Sequence <400> 64 tcatatgtgt aatcgtaaaa ctagtcattt tc 32 <210> 65 <211> 32 <212> DNA <213> Artificial Sequence <400> 65 gtgagaaaat gtgtaggtaa agatacaact tt 32 <210> 66 <211> 32 <212> DNA <213> Artificial Sequence <400> 66 ggcatcaaat ttggggcgcg agctagttaa ag 32 <210> 67 <211> 32 <212> DNA <213> Artificial Sequence <400> 67 ttcgagctaa gacttcaaat atcgggaacg ag 32 <210> 68 <211> 40 <212> DNA <213> Artificial Sequence <400> 68 acagtcaaag agaatcgatg aacgaccccg gttgataatc 40 <210> 69 <211> 40 <212> DNA <213> Artificial Sequence <400> 69 gaataccaca ttcaacttaa gaggaagccc gatcaaagcg 40 <210> 70 <211> 40 <212> DNA <213> Artificial Sequence <400> 70 agaaaagccc caaaaagagt ctggagcaaa caatcaccat 40 <210> 71 <211> 32 <212> DNA <213> Artificial Sequence <400> 71 caatatgacc ctcatatatt ttaaagcatt aa 32 <210> 72 <211> 32 <212> DNA <213> Artificial Sequence <400> 72 catccaataa atggtcaata acctcggaag ca 32 <210> 73 <211> 40 <212> DNA <213> Artificial Sequence <400> 73 aactccaaga ttgcatcaaa aagataatgc agatacataa 40 <210> 74 <211> 40 <212> DNA <213> Artificial Sequence <400> 74 cgttctagtc aggtcattgc ctgacaggaa gattgtataa 40 <210> 75 <211> 32 <212> DNA <213> Artificial Sequence <400> 75 caggcaagat aaaaattttt agaatattca ac 32 <210> 76 <211> 32 <212> DNA <213> Artificial Sequence <400> 76 gattagagat tagatacatt tcgcaaatca ta 32 <210> 77 <211> 40 <212> DNA <213> Artificial Sequence <400> 77 cgccaaaagg aattacagtc agaagcaaag cgcaggtcag 40 <210> 78 <211> 40 <212> DNA <213> Artificial Sequence <400> 78 gcaaatattt aaattgagat ctacaaaggc tactgataaa 40 <210> 79 <211> 40 <212> DNA <213> Artificial Sequence <400> 79 taattgcttt accctgacta ttatgaggca tagtaagagc 40 <210> 80 <211> 35 <212> DNA <213> Artificial Sequence <400> 80 ataaagcctt tgcgggagaa gcctggagag ggtag 35 <210> 81 <211> 32 <212> DNA <213> Artificial Sequence <400> 81 taagaggtca attctgcgaa cgagattaag ca 32 <210> 82 <211> 40 <212> DNA <213> Artificial Sequence <400> 82 aacactatca taacccatca aaaatcaggtctccttttga 40 <210> 83 <211> twenty four <212> DNA <213> Artificial Sequence <400> 83 atgaccctgt aatacttcag agca 24 <210> 84 <211> 32 <212> DNA <213> Artificial Sequence <400> 84 taaagctata taacagttga ttcccatttt tg 32 <210> 85 <211> 40 <212> DNA <213> Artificial Sequence <400> 85 cggatggcac gagaatgacc ataatcgttt accagacgac 40 <210> 86 <211> 35 <212> DNA <213> Artificial Sequence <400> 86 taattgcttg gaagtttcat tccaaatcgg ttgta 35 <210> 87 <211> 40 <212> DNA <213> Artificial Sequence <400> 87 gataaaaacc aaaatattaa acagttcaga aattagagct 40 <210> 88 <211> twenty four <212> DNA <213> Artificial Sequence <400> 88 actaaagtac ggtgtcgaat ataa 24 <210> 89 <211> 40 <212> DNA <213> Artificial Sequence <400> 89 tgctgtagatccccctcaaa tgctgcgaga ggcttttgca 40 <210> 90 <211> 43 <212> DNA <213> Artificial Sequence <400> 90 aaagaagttt tgccagcata aatattcatt gactcaacat gtt 43 <210> 91 <211> 43 <212> DNA <213> Artificial Sequence <400> 91 aatactgcgg aatcgtaggg ggtaatagta aaatgtttag act 43 <210> 92 <211> 32 <212> DNA <213> Artificial Sequence <400> 92 agggatagct cagagccacc accccatgtc aa 32 <210> 93 <211> 32 <212> DNA <213> Artificial Sequence <400> 93 caacagttta tgggattttg ctaatcaaaa gg 32 <210> 94 <211> 32 <212> DNA <213> Artificial Sequence <400> 94 gccgctttgc tgaggcttgc aggggaaaag gt 32 <210> 95 <211> 32 <212> DNA <213> Artificial Sequence <400> 95 gcgcagactc catgttactt agcccgtttt aa 32 <210> 96 <211> 32 <212> DNA <213> Artificial Sequence <400> 96 acaggtagaa agattcatca gttgagattt ag 32 <210> 97 <211> 40 <212> DNA <213> Artificial Sequence <400> 97 cctcagaacc gccacccaag cccaatagga acgtaaatga 40 <210> 98 <211> 40 <212> DNA <213> Artificial Sequence <400> 98 cgacctgcgg tcaatcataa gggaacggaa caacattatt 40 <210> 99 <211> 40 <212> DNA <213> Artificial Sequence <400> 99 agacgttacc atgtaccgta acacccctca gaaccgccac 40 <210> 100 <211> 32 <212> DNA <213> Artificial Sequence <400> 100 cacgcataag aaaggaacaa ctaagtcttt cc 32 <210> 101 <211> 32 <212> DNA <213> Artificial Sequence <400> 101 attgtgtctc agcagcgaaa gacaccatcg cc 32 <210> 102 <211> 40 <212> DNA <213> Artificial Sequence <400> 102 ttaataaaac gaactaaccg aactgaccaa ctcctgataa 40 <210> 103 <211> 40 <212> DNA <213> Artificial Sequence <400> 103 aggtttagta ccgccatgag tttcgtcacc aggatctaaa 40 <210> 104 <211> 32 <212> DNA <213> Artificial Sequence <400> 104 gttttgtcag gaattgcgaa taatccgaca at 32 <210> 105 <211> 32 <212> DNA <213> Artificial Sequence <400> 105 gacaacaagc atcggaacga gggtgagatt tg 32 <210> 106 <211> 40 <212> DNA <213> Artificial Sequence <400> 106 tatcatcgtt gaaagaggac agatggaaga aaaatctacg 40 <210> 107 <211> 40 <212> DNA <213> Artificial Sequence <400> 107 agcgtaacta caaactacaa cgcctatcac cgtactcagg 40 <210> 108 <211> 40 <212> DNA <213> Artificial Sequence <400> 108 accagtcagg acgttggaac ggtgtacaga ccgaaacaaa 40 <210> 109 <211> 35 <212> DNA <213> Artificial Sequence <400> 109 acagacagcc caaatctcca aaaaaaaatt tctta 35 <210> 110 <211> 32 <212> DNA <213> Artificial Sequence <400> 110 aacagcttgc tttgaggact aaagcgatta ta 32 <210> 111 <211> 40 <212> DNA <213> Artificial Sequence <400> 111 ccaagcgcag gcgcataggc tggcagaact ggctcattat 40 <210> 112 <211> twenty four <212> DNA <213> Artificial Sequence <400> 112 cgaggtgagg ctccaaaagg agcc 24 <210> 113 <211> 32 <212> DNA <213> Artificial Sequence <400> 113 acccccagac tttttcatga ggaacttgct tt 32 <210> 114 <211> 40 <212> DNA <213> Artificial Sequence <400> 114 accttatgcg attttatgac cttcatcaag agcatctttg 40 <210> 115 <211> 35 <212> DNA <213> Artificial Sequence <400> 115 cggtttatca ggtttccatt aaacgggaat acact 35 <210> 116 <211> 40 <212> DNA <213> Artificial Sequence <400> 116 aaaacactta atcttgacaa gaacttaatc attgtgaatt 40 <210> 117 <211> twenty four <212> DNA <213> Artificial Sequence <400> 117 ggcaaaagta aaatacgtaa tgcc 24 <210> 118 <211> 40 <212> DNA <213> Artificial Sequence <400> 118 tggtttaatt tcaactcgga tattcattacccacgaaaga 40 <210> 119 <211> 43 <212> DNA <213> Artificial Sequence <400> 119 accaacctaa aaaatcaacg taacaaataa attgggcttg aga 43 <210> 120 <211> 43 <212> DNA <213> Artificial Sequence <400> 120 cctgacgaga aacaccagaa cgagtaggct gctcattcag tga 43 <210> 121 <211> 25 <212> DNA <213> Artificial Sequence <400> 121 ttaattaatt ttttaccata tcaaa 25 <210> 122 <211> twenty four <212> DNA <213> Artificial Sequence <400> 122 ttaatttcat cttagacttt acaa 24 <210> 123 <211> twenty three <212> DNA <213> Artificial Sequence <400> 123 ctgtccagac gtataccgaa cga 23 <210> 124 <211> twenty two <212> DNA <213> Artificial Sequence <400> 124 tcaagattag tgtagcaata ct 22 <210> 125 <211> 25 <212> DNA <213> Artificial Sequence <400> 125 tgtagcattc cttttataaa cagtt 25 <210> 126 <211> twenty four <212> DNA <213> Artificial Sequence <400> 126 tttaattgta tttccaccag agcc 24 <210> 127 <211> twenty three <212> DNA <213> Artificial Sequence <400> 127 actacgaagg cttagcacca tta 23 <210> 128 <211> twenty two <212> DNA <213> Artificial Sequence <400> 128 ataaggcttg caacaaagtt ac 22 <210> 129 <211> 25 <212> DNA <213> Artificial Sequence <400> 129 gtgggaacaa atttctattt ttgag 25 <210> 130 <211> twenty four <212> DNA <213> Artificial Sequence <400> 130 cggtgcgggc cttccaaaaa catt 24 <210> 131 <211> twenty three <212> DNA <213> Artificial Sequence <400> 131 atgagtgagc ttttaaatat gca 23 <210> 132 <211> twenty two <212> DNA <213> Artificial Sequence <400> 132 actattaaag aggatagcgt cc 22 <210> 133 <211> twenty four <212> DNA <213> Artificial Sequence <400> 133 gcgcttaatg cgccgctaca gggc 24 <210> 134 <211> 32 <212> DNA <213> Artificial Sequence <400> 134 tcgggagata tacagtaaca gtacaaataa tt 32 <210> 135 <211> 32 <212> DNA <213> Artificial Sequence <400> 135 cctgattaaa ggagcggaat tatctcggcc tc 32 <210> 136 <211> 32 <212> DNA <213> Artificial Sequence <400> 136 gcaaatcacc tcaatcaata tctgcaggtc ga 32 <210> 137 <211> 32 <212> DNA <213> Artificial Sequence <400> 137 cgaccagtac attggcagat tcacctgatt gc 32 <210> 138 <211> 40 <212> DNA <213> Artificial Sequence <400> 138 tggcaatttt taacgtcaga tgaaaacaat aacggattcg 40 <210> 139 <211> 40 <212> DNA <213> Artificial Sequence <400> 139 ttgacgagca cgtatactga aatggattat ttaataaaag 40 <210> 140 <211> 40 <212> DNA <213> Artificial Sequence <400> 140 cctgattgct ttgaattgcg tagattttca ggcatcaata 40 <210> 141 <211> 32 <212> DNA <213> Artificial Sequence <400> 141 taatcctgat tatcattttg cggagaggaa gg 32 <210> 142 <211> 32 <212> DNA <213> Artificial Sequence <400> 142 ttatctaaag catcaccttg ctgatggcca ac 32 <210> 143 <211> 40 <212> DNA <213> Artificial Sequence <400> 143 agagatagtt tgacgctcaa tcgtacgtgc tttcctcgtt 40 <210> 144 <211> 40 <212> DNA <213> Artificial Sequence <400> 144 gattatacac agaaataaag aaataccaag ttacaaaatc 40 <210> 145 <211> 32 <212> DNA <213> Artificial Sequence <400> 145 taggagcata aaagtttgag taacattgtt tg 32 <210> 146 <211> 32 <212> DNA <213> Artificial Sequence <400> 146 tgacctgaca aatgaaaaat ctaaaatatc tt 32 <210> 147 <211> 40 <212> DNA <213> Artificial Sequence <400> 147 agaatcagag cgggagatgg aaatacctac ataacccttc 40 <210> 148 <211> 40 <212> DNA <213> Artificial Sequence <400> 148 gcgcagaggc gaattaatta tttgcacgta aattctgaat 40 <210> 149 <211> 40 <212> DNA <213> Artificial Sequence <400> 149 gaatacgtaa caggaaaaac gctcctaaac aggaggccga 40 <210> 150 <211> 35 <212> DNA <213> Artificial Sequence <400> 150 tcaatagata ttaaatcctt tgccggttag aacct 35 <210> 151 <211> 32 <212> DNA <213> Artificial Sequence <400> 151 caatatttgc ctgcaacagt gccatagagc cg 32 <210> 152 <211> 40 <212> DNA <213> Artificial Sequence <400> 152 ttaaagggat tttagatacc gccagccatt gcggcacaga 40 <210> 153 <211> twenty four <212> DNA <213> Artificial Sequence <400> 153 acaattcgac aactcgtaat acat 24 <210> 154 <211> 32 <212> DNA <213> Artificial Sequence <400> 154 ttgaggatgg tcagtattaa caccttgaat gg 32 <210> 155 <211> 40 <212> DNA <213> Artificial Sequence <400> 155 cttatagtat atccagaaca atatcaggaa cggtacgcca 40 <210> 156 <211> 35 <212> DNA <213> Artificial Sequence <400> 156 cgcgaactaa aacagaggtg aggcttagaa gtatt 35 <210> 157 <211> 40 <212> DNA <213> Artificial Sequence <400> 157 gaatcctgag aagtgtatcg gccttgctgg tactttaatg 40 <210> 158 <211> twenty four <212> DNA <213> Artificial Sequence <400> 158 accaccagca gaagatgata gccc 24 <210> 159 <211> 40 <212> DNA <213> Artificial Sequence <400> 159 taaaacatta gaagaactca aactttttat aatcagtgag 40 <210> 160 <211> 43 <212> DNA <213> Artificial Sequence <400> 160 gccaccgagt aaaagaacat cacttgcctg agcgccatta aaa 43 <210> 161 <211> 43 <212> DNA <213> Artificial Sequence <400> 161 tctttgatta gtaatagtct gtccatcacg caaattaacc gtt 43 <210> 162 <211> 32 <212> DNA <213> Artificial Sequence <400> 162 cgcgtctgat aggaacgcca tcaactttta ca 32 <210> 163 <211> 32 <212> DNA <213> Artificial Sequence <400> 163 aggaagatgg ggacgacgac agtaatcata tt 32 <210> 164 <211> 32 <212> DNA <213> Artificial Sequence <400> 164 ctctagagca agcttgcatg cctggtcagt tg 32 <210> 165 <211> 32 <212> DNA <213> Artificial Sequence <400> 165 ccttcaccgt gagacgggca acagcagtca ca 32 <210> 166 <211> 32 <212> DNA <213> Artificial Sequence <400> 166 cgagaaagga agggaagcgt actatggttg ct 32 <210> 167 <211> 40 <212> DNA <213> Artificial Sequence <400> 167 gctcattttt taaccagcct tcctgtagcc aggcatctgc 40 <210> 168 <211> 40 <212> DNA <213> Artificial Sequence <400> 168 tttcaccagc ctggccctga gagaaagccg gcgaacgtgg 40 <210> 169 <211> 40 <212> DNA <213> Artificial Sequence <400> 169 gtaaccgtct ttcatcaaca ttaaaatttt tgttaaatca 40 <210> 170 <211> 32 <212> DNA <213> Artificial Sequence <400> 170 acgttgtatt ccggcaccgc ttctggcgca tc 32 <210> 171 <211> 32 <212> DNA <213> Artificial Sequence <400> 171 ccagggtggc tcgaattcgt aatccagtca cg 32 <210> 172 <211> 40 <212> DNA <213> Artificial Sequence <400> 172 tagagcttga cggggagttg cagcaagcgg tcattgggcg 40 <210> 173 <211> 40 <212> DNA <213> Artificial Sequence <400> 173 gttaaaattc gcattaatgt gagcgagtaa cacacgttgg 40 <210> 174 <211> 32 <212> DNA <213> Artificial Sequence <400> 174 tgtagatggg tgccggaaac caggaacgcc ag 32 <210> 175 <211> 32 <212> DNA <213> Artificial Sequence <400> 175 ggttttccat ggtcatagct gtttgagagg cg 32 <210> 176 <211> 40 <212> DNA <213> Artificial Sequence <400> 176 gtttgcgtca cgctggtttg ccccaaggga gcccccgatt 40 <210> 177 <211> 40 <212> DNA <213> Artificial Sequence <400> 177 ggataggtac ccgtcggatt ctcctaaacg ttaatatttt 40 <210> 178 <211> 40 <212> DNA <213> Artificial Sequence <400> 178 ctaaatcgga accctaagca ggcgaaaatc cttcggccaa 40 <210> 179 <211> 35 <212> DNA <213> Artificial Sequence <400> 179 cggcggattg aattcaggct gcgcaacggg ggatg 35 <210> 180 <211> 32 <212> DNA <213> Artificial Sequence <400> 180 tgctgcaaat ccgctcacaa ttcccagctg ca 32 <210> 181 <211> 40 <212> DNA <213> Artificial Sequence <400> 181 ttaatgaagt ttgatggtgg ttccgaggtg ccgtaaagca 40 <210> 182 <211> twenty four <212> DNA <213> Artificial Sequence <400> 182 tggcgaaatg ttgggaaggg cgat 24 <210> 183 <211> 32 <212> DNA <213> Artificial Sequence <400> 183 tgtcgtgcac acaacatacg agccacgcca gc 32 <210> 184 <211> 40 <212> DNA <213> Artificial Sequence <400> 184 caagtttttt ggggtcgaaa tcggcaaaat ccgggaaacc 40 <210> 185 <211> 35 <212> DNA <213> Artificial Sequence <400> 185 tcttcgctat tggaagcata aagtgtatgc ccgct 35 <210> 186 <211> 40 <212> DNA <213> Artificial Sequence <400> 186 ttccagtccttataaatcaaaagagaaccatcacccaaat 40 <210> 187 <211> twenty four <212> DNA <213> Artificial Sequence <400> 187 gcgctcacaa gcctggggtg ccta 24 <210> 188 <211> 40 <212> DNA <213> Artificial Sequence <400> 188 cgatggccca ctacgtatag cccgagatag ggattgcgtt 40 <210> 189 <211> 43 <212> DNA <213> Artificial Sequence <400> 189 aactcacatt attgagtgtt gttccagaaa ccgtctatca ggg 43 <210> 190 <211> 43 <212> DNA <213> Artificial Sequence <400> 190 acgtggactc caacgtcaaa gggcgaattt ggaacaagag tcc 43 <210> 191 <211> 47 <212> DNA <213> Artificial Sequence <400> 191 aaaaaaaaaa aaaaagttaa atacaatcgc aagacaaagc cttgaaa 47 <210> 192 <211> 47 <212> DNA <213> Artificial Sequence <400> 192 aaaaaaaaaa aaaaattatc aaaccggctt aggttgggta agcctgt 47 <210> 193 <211> 47 <212> DNA <213> Artificial Sequence <400> 193 aaaaaaaaaa aaaaaccgga accgaatg gaaagcgcaa catggct 47 <210> 194 <211> 47 <212> DNA <213> Artificial Sequence <400> 194 aaaaaaaaaa aaaaaccttg agtcagacga ttggccttgc gccaccc 47 <210> 195 <211> 47 <212> DNA <213> Artificial Sequence <400> 195 aaaaaaaaaa aaaaacccat cctcgccaac atgtaattta ataaggc 47 <210> 196 <211> 47 <212> DNA <213> Artificial Sequence <400> 196 aaaaaaaaaa aaaaattagt atcgccaacg ctcaacagtc ggctgtc 47 <210> 197 <211> 47 <212> DNA <213> Artificial Sequence <400> 197 aaaaaaaaaa aaaaaaaaga caacattttc ggtcatagcc aaaatca 47 <210> 198 <211> 47 <212> DNA <213> Artificial Sequence <400> 198 aaaaaaaaaa aaaaatcaga acccagaatc aagtttgccg gtaaata 47 <210> 199 <211> 47 <212> DNA <213> Artificial Sequence <400> 199 aaaaaaaaaa aaaaatagtt gcgaattttt tcacgttgat catagtt 47 <210> 200 <211> 47 <212> DNA <213> Artificial Sequence <400> 200 aaaaaaaaaa aaaaaatttt ctgtcagcgg agtgagaata ccgatat 47 <210> 201 <211> 47 <212> DNA <213> Artificial Sequence <400> 201 aaaaaaaaaa aaaaaatagt agtatgcaat gcctgagtag gccggag 47 <210> 202 <211> 47 <212> DNA <213> Artificial Sequence <400> 202 aaaaaaaaaa aaaaattaat gccttatatttc aacgcaaggg caaagaa 47 <210> 203 <211> 47 <212> DNA <213> Artificial Sequence <400> 203 aaaaaaaaaa aaaaagtaca acgagcaacg gctacagagg ataccga 47 <210> 204 <211> 47 <212> DNA <213> Artificial Sequence <400> 204 aaaaaaaaaa aaaaaattcg gtctgcggga tcgtcacccg aaatccg 47 <210> 205 <211> 47 <212> DNA <213> Artificial Sequence <400> 205 aaaaaaaaaa aaaaaaacca gacgtttagc tatattttct tctacta 47 <210> 206 <211> 47 <212> DNA <213> Artificial Sequence <400> 206 aaaaaaaaaa aaaaattagc aaatagattt agtttgacca gtacctt 47 <210> 207 <211> 47 <212> DNA <213> Artificial Sequence <400> 207 aaaaaaaaaa aaaaaagttg ggtcaaagcg ccattcgccc cgtaatg 47 <210> 208 <211> 47 <212> DNA <213> Artificial Sequence <400> 208 aaaaaaaaaa aaaaacagtt tgacgcactc cagccagcta aacgacg 47 <210> 209 <211> 47 <212> DNA <213> Artificial Sequence <400> 209 aaaaaaaaaa aaaaaaagga attacaaaga aaccaccagt cagatga 47 <210> 210 <211> 47 <212> DNA <213> Artificial Sequence <400> 210 aaaaaaaaaa aaaaaaatgg aagcgaacgt tattaatttc taacaac 47 <210> 211 <211> 47 <212> DNA <213> Artificial Sequence <400> 211 aaaaaaaaaa aaaaacgcgc gggcctgtgt gaaattgttg gcgatta 47 <210> 212 <211> 47 <212> DNA <213> Artificial Sequence <400> 212 aaaaaaaaaa aaaaagccag tgcgatcccc gggtaccgag tttttct 47 <210> 213 <211> 47 <212> DNA <213> Artificial Sequence <400> 213 aaaaaaaaaa aaaaaggaca ttcacctcaa atatcaaaca cagttga 47 <210> 214 <211> 47 <212> DNA <213> Artificial Sequence <400> 214 aaaaaaaaaa aaaaataata snow snow snow 47 snow snow <210> 215 <211> 40 <212> DNA <213> Artificial Sequence <400> 215 40. cats acgcaaagac acgcaacac cctgaacaaa <210> 216 <211> 40 <212> DNA <213> Artificial Sequence <400> 216 ttgacggaa tacatacata aagggcgcta atatcagaga <210> 217 <211> 40 <212> DNA <213> Artificial Sequence <400> 217 caccgtcacc ttattacgca gtattgagtt aagcccaata <210> 218 <211> 40 <212> DNA <213> Artificial Sequence <400> 218 gagccagcga atacccaaaa tagcatagc

Claims

1. A method for quantitatively detecting ATP, characterized in that: The following steps are involved: The nanoarray sensor was mixed with equal volumes of target substances of different concentrations and incubated for 1 hour. The mixture was centrifuged using a 100kD ultrafiltration tube, and the spectrum of the filtrate between 510nm and 700nm was recorded to create a standard curve. The concentration of the target substance was then calculated using the standard curve. The standard curve is y=372.28x+1130.8, R 2 =0.9872, where x is the logarithm of ATP concentration, and y is the difference between the fluorescence value when ATP is 0 ng / mL and the fluorescence values ​​corresponding to different ATP concentrations; The nanoarray sensor uses a triangular DNA origami as a template, and connects a binding site to a portion of the single strand of the triangular DNA origami. The binding site specifically binds to a double-stranded nucleic acid aptamer of a fluorescently labeled target; the binding site includes PolyA15; The double-stranded nucleic acid aptamer includes P1 and P2, wherein the nucleotide sequence of P1 is shown in SEQ ID NO.1, and the nucleotide sequence of P2 is shown in SEQ ID NO.2; the binding site and the double-stranded nucleic acid aptamer are respectively labeled with different fluorescence.

2. The method according to claim 1, characterized in that: The excitation wavelength of the spectrum is 480 nm, and the slit widths for excitation and emission are both fixed at 10 nm.

Citation Information

Patent Citations

  • DNA flexagon nano structure-nanogold biosensor based on adapter modification and preparing method and application of DNA flexagon nano structure-nanogold biosensor

    CN104962615A