A non-diagnostic tumor cell detection method based on rolling circle amplification reaction

Abstract

The invention discloses a non-diagnostic tumor cell detection method based on rolling circle amplification reaction, which belongs to the field of biochemical detection and molecular diagnosis. The main points of the technical scheme are as follows: S1, selecting an aptamer S2.2 that specifically binds to MUC1, and designing a nucleic acid chain CDNA that is partially complementary to the aptamer S2.2; S2, making the aptamer S2.2 and the CDNA form a double-stranded I; S3, obtaining an MCF-7 cell sample; S4, adding double-stranded I, a padlock probe, a T4 DNA ligase buffer and T4 DNA ligase to the MCF-7 cell sample, inactivating the enzyme after the reaction is completed, and obtaining a reaction product II; S5, adding Phi 29 DNA polymerase, dNTPs, BSA and Phi 29 DNA polymerase buffer to the reaction product II, and obtaining a tandemly repeated G quadruplex single strand after the reaction is completed; S6, adding fluorescent dye Tb3+ to the product III. The invention is mainly used for converting the number signal of target cells into Tb3+ signals sensitized by a large number of tandemly repeated G quadruplexes amplified by rolling circle amplification reaction, and the method has high sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of biochemical detection and molecular diagnosis, and in particular to a non-diagnostic tumor cell detection method based on rolling circle amplification reaction. Background Art

[0002] In 2020, there were nearly 20 million new cancer cases and nearly 10 million cancer deaths worldwide. With 2.26 million new cases of breast cancer, it surpassed lung cancer to become the "number one cancer." There has been progress in conventional treatment of localized breast cancer, but the treatment of metastatic breast cancer is still difficult, as most deaths occur due to the spread of cancer cells to distant sites. The rare cells that metastasize from tumor tissue into the blood are circulating tumor cells (CTCs). There are only a few to dozens of CTCs per milliliter of blood, and their number is rare in peripheral blood. Existing methods for separating CTCs and blood cell molecular heterogeneity have limitations.

[0003] At present, CTC capture, separation, enrichment and detection technologies mainly include methods developed based on their physical properties or their surface molecular markers, such as the CellSearch system, immunostaining, flow cytometry, molecular analysis (RT-PCR), etc. The CellSearch system is the only CTCs detection method approved by the U.S. Food and Drug Administration (FDA), but the system can only identify CTC subpopulations expressing epithelial markers, but cannot detect another part of cells that undergo epithelial-mesenchymal transition (EMT). It has a limited scope of application and has not been widely promoted in clinical practice. Other detection methods still need to make great improvements in CTC detection applications due to the limitations of method operation and application.

[0004] In order to solve the above problems, a non-diagnostic tumor cell detection method based on rolling circle amplification reaction is provided on the basis of the prior art. Summary of the invention

[0005] The purpose of the present invention is to provide a non-diagnostic tumor cell detection method based on rolling circle amplification reaction. The present invention converts the target cell quantity signal into a Tb3+ signal sensitized by a large number of tandemly repeated G quadruplexes amplified by the rolling circle amplification reaction, and has high sensitivity. It is an effective method for detecting the number of tumor cells.

[0006] The above technical objectives of the present invention are achieved through the following technical solutions:

[0007] A non-diagnostic tumor cell detection method based on rolling circle amplification reaction, the steps are as follows:

[0008] S1, screening out the aptamer S2.2 that specifically binds to MUC1, and designing a nucleic acid chain CDNA that is partially complementary to the aptamer S2.2, wherein the nucleic acid sequence of the aptamer S2.2 is GCAGTTGATCCTTTGGATACCCTGG;

[0009] S2, adding an equal amount of CDNA to the aptamer S2.2 to obtain a mixed solution, then heating the mixed solution to 95°C for 5 minutes and then cooling it down gradually to allow the aptamer S2.2 and CDNA to form a double-stranded I, wherein the nucleic acid sequence of the CDNA is ATCCAAAGGATCAACTGC;

[0010] S3, digesting the cultured MCF-7 cells with an enzyme-free digestion solution, then resuspending the MCF-7 cells with a binding buffer and counting them to obtain an MCF-7 cell sample;

[0011] S4, adding double-stranded I to the MCF-7 cell sample, reacting at 37°C for 1h, and obtaining reaction product I after the reaction is completed; then adding padlock probe and T4 DNA ligase buffer to the reaction product I, and then adding T4 DNA ligase thereto, and reacting at 16°C for 16h. After the reaction is completed, heating to 65°C for 10min to inactivate the enzyme, so that the 5' end and 3' end of the padlock probe are connected to form a circular DNA, and reaction product II is obtained. The nucleic acid sequence of the padlock probe is Phosphorylation-CCTTTGGATTTTTTCTCCCCCTCCCCCCCCCCCTTTTTGCAGTTGAT;

[0012] S5, add Phi 29 DNA polymerase, dNTPs, BSA and Phi 29 DNA polymerase buffer to the reaction product II, and react at 37°C for 1 hour, then raise the temperature to 65°C for 10 minutes to inactivate the enzyme, and after the reaction, obtain product III, i.e., a single-stranded tandemly repeated G quadruplex;

[0013] S6. Add fluorescent dye Tb3+ to the product III, and then use a fluorescence spectrophotometer to detect fluorescence, Ex=290nm, Em=450nm-560nm, and the slit is 5nm.

[0014] Furthermore, the padlock probe described in step S4 includes a 5' end sequence, an intermediate sequence and a 3' end sequence connected in sequence, and a spacer sequence is connected between the 5' end sequence and the 3' end sequence and the intermediate sequence respectively; the 5' end sequence and the 3' end sequence are complementary to the CDNA respectively; the intermediate sequence and the G quadruplex single strand are complementary sequences.

[0015] Through the above technical scheme, the present invention uses aptamer S2.2 and its complementary chain CDNA as recognition probes. Under the induction of target cells, aptamer S2.2 is separated from its complementary chain CDNA, and the complementary chain CDNA is used as a primer to start rolling circle amplification. Through the design of the padlock probe, the product of rolling circle amplification is a tandemly repeated G quadruplex structure, and the G quadruplex sensitizes Tb3+ fluorescence, so that the signal of the target cell is converted into an amplified Tb3+ fluorescence signal. Compared with the prior art, the method of G quadruplex sensitizing Tb3+ luminescence to detect cancer cells has not been reported. The use of aptamers has high detection sensitivity, and the minimum detection limit is 5 cancer cells / ml.

[0016] In summary, the present invention has the following beneficial effects: the present invention converts the target cell quantity signal into a Tb3+ signal sensitized by a large number of tandemly repeated G quadruplexes amplified by a rolling circle amplification reaction, and has high sensitivity, and is an effective method for detecting the number of tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a schematic diagram of a method for detecting MCF-7 cells based on aptamers and rolling circle amplification reactions according to Example 1 of the present invention;

[0018] Figure 2 It is an agarose gel electrophoresis diagram of the aptamer, CDNA, double-strand I and product III (rolling circle amplification product) of Example 1 of the present invention;

[0019] Figure 3 This is a schematic diagram of the structure of the G-quadruplex verified by ultraviolet-visible light spectrum of Example 1 of the present invention;

[0020] Figure 4 This is the fluorescence spectrum of the sensitized Tb3+ ions of Product II and Product III in Example 1 of the present invention. DETAILED DESCRIPTION

[0021] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments:

[0022] Experimental materials and reagents: Tris-HCl buffer (pH 7.4) was purchased from Solarbio, 1M MgCl2 was purchased from Beyotime, terbium chloride hexahydrate (Tbcl.6H2O) and sodium chloride were purchased from Sigma; T4 DNA ligase and its 10X buffer, Phi29 DNA polymerase and its 10X buffer, bovine serum albumin (BSA), and four deoxyribonucleotide mixtures (dNTPS) were purchased from New England BioLabs; MCF-7 cells were from the cell bank of the Chinese Academy of Sciences, and aptamers, CDNA, and padlock probes were synthesized by TaKaRa and purified by HPLC;

[0023] The binding buffer Tris-HCl buffer (pH 7.4) consisted of 10 mM Tris-HCl, 100 mM NaCl, and 5 mM MgCl2; the 100 uM terbium chloride solution was dissolved in 10 mL of water with 373.38 mg of terbium chloride hexahydrate and stored at 4 °C before use.

[0024] Example 1: A non-diagnostic tumor cell detection method based on rolling circle amplification reaction, such as Figure 1 As shown, the steps are as follows:

[0025] S1. Screen out the aptamer S2.2 that specifically binds to MUC1, and design a nucleic acid chain CDNA that is partially complementary to the aptamer S2.2. Put the synthesized aptamer S2.2, CDNA, and padlock probe dry powder into a centrifuge at 5000 rpm for 1 min, add the corresponding volume of binding buffer to prepare a mother solution with a concentration of 10uM, store it at -20°C after aliquoting, and thaw it on ice when using.

[0026] S2. Add the same volume of cDNA to 10uM aptamer S2.2 to obtain a mixed solution, then place the mixed solution in a metal bath at 95°C for 5 minutes and slowly cool to room temperature to allow the aptamer S2.2 and cDNA to form a double-stranded I.

[0027] S3. Rinse the MCF-7 cells in the logarithmic growth phase twice with PBS, add 1 ml of 0.02% EDTA and return to the incubator for 3 minutes. When the cells become round, aspirate the EDTA, add 2 ml of complete culture medium to blow down the cells, centrifuge at 1000 rpm for 5 minutes, discard the supernatant, resuspend the cell pellet with binding buffer, count the cells with an abalone counting plate, and obtain a cell sample of 10 ul of the corresponding cell number after dilution.

[0028] S4. Add the double-stranded protein I formed in step S2 to the MCF-7 cell sample. At this time, the concentration of the aptamer is 50nM. React at 37℃ for 1h. Since the affinity of the aptamer to MUC1 on MCF-7 cells is higher than that of its very complementary chain CDNA, the double-stranded protein is melted, the aptamer binds to the cells, and the CDNA is released, and product I is obtained. At this time, add a padlock probe with a concentration of 50nM and T4 DNA polymerase buffer, and react at 37℃ for 1h. This step is to allow CDNA to hybridize with the padlock probe. Finally, add 1ul of T4 DNA polymerase and react at 16℃ for 16h. Heat at 65℃ for 10min to inactivate the enzyme, so that the padlock probe is connected to circular DNA, i.e., product II.

[0029] S5, add 4ul of 10X Phi 29 DNA polymerase, 5ul of dNTPs, 0.5ul of BSA and 0.5ul of Phi 29 DNA polymerase buffer to the reaction product II, and react at 37°C for 1h, then raise the temperature to 65°C for 10min to inactivate the enzyme, and after the reaction, obtain product III, i.e., the tandemly repeated G quadruplex of the rolling circle amplification product;

[0030] S6. Take 5ul of product III and add 5ul of Tb3+ (100uM), add ultrapure water to make up to 1ml, put it into a quartz fluorescent dish, set the parameters of the fluorescence spectrophotometer to an excitation wavelength of 290nm, an emission wavelength range of 450-560nm, and a slit of 5nm, and obtain the fluorescence spectrum.

[0031] The padlock probe in step S4 includes a 5' end sequence, an intermediate sequence and a 3' end sequence connected in sequence, and a spacer sequence is connected between the 5' end sequence and the 3' end sequence and the intermediate sequence respectively; the 5' end sequence and the 3' end sequence are complementary to the CDNA respectively; the intermediate sequence and the single strand of the G quadruplex are complementary sequences.

[0032] The detection results of the present invention on aptamer, cDNA, double-stranded I, product II and product III are as follows: Figure 2 , Figure 3 and Figure 4 As shown. Among them, Figure 2 The figure is an agarose gel electrophoresis diagram of aptamer, CDNA, double-stranded product Ⅰ and product Ⅲ (rolling circle amplification product); agarose gel electrophoresis verifies the rolling circle amplification product and shows that: lane M is a 20bp DNA Marker, lane 1 is aptamer S2.2, lane 2 is CDNA, lane 3 is a double-stranded product formed by aptamer S2.2 and CDNA, lane 4 is product Ⅱ, and lane 5 is product Ⅲ. Product Ⅲ is a single-stranded G quadruplex with tandem repeats and a large molecular weight. It is retained in the sample loading well during electrophoresis, indicating the formation of a rolling circle amplification reaction.

[0033] Figure 3 The UV-visible spectrum verifies that product III is a G-quadruplex structure; after a single strand of guanine-rich DNA folds to form a G-quadruplex structure, the UV absorbance at a wavelength of 295nm will increase accordingly. On the contrary, the gradual increase in temperature destroys the G-quadruplex structure, and the UV absorbance at a wavelength of 295nm will decrease accordingly. When the temperature rises, an isochromatic point appears at 288nm, and the difference is the largest at 295nm, proving that product III is a G-quadruplex structure.

[0034] Figure 4 This is a schematic diagram of product III sensitizing Tb3+ luminescence; as can be seen from the figure, the fluorescence intensity of pure Tb3+ ions is weak, product II has no G quadruplex single chain and has no effect of sensitizing Tb3+ ions, and product III is a G quadruplex single chain with a very strong effect of promoting Tb3+ ion luminescence.

[0035] Among them, the nucleic acid sequence involved in the present invention is as follows:

[0036] NO 1: The nucleic acid sequence of aptamer S2.2 is: GCAGTTGATCCTTTGGATACCCTGG;

[0037] NO 2: The nucleic acid sequence of cDNA is: ATCCAAAGGATCAACTGC;

[0038] NO 3: The nucleic acid sequence of the padlock probe is:

[0039] Phosphorylation-CCTTTGGATTTTTTCTCCCCCTCCCCCTCCCTTTTTGCAGTTGAT.

[0040] Note: The bold black sequence of the padlock probe is complementary to the cDNA, the italic sequence can form a G quadruplex, and the poly-T sequence is a spacer sequence.

[0041] Through the above technical scheme, the present invention converts the target cell quantity signal into a Tb3+ signal sensitized by a large number of tandemly repeated G quadruplexes amplified by a rolling circle amplification reaction, which has high sensitivity and is an appreciable method for detecting the number of tumor cells.

[0042] This specific embodiment is merely an explanation of the present invention and is not a limitation of the present invention. After reading this specification, those skilled in the art may make non-creative modifications to the present embodiment as needed. However, as long as they are within the scope of the claims of the present invention, they are protected by the patent law. Sequence Listing <110> Chongqing Medical University <120> A method for detecting tumor cells based on rolling circle amplification reaction <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 25 <212> DNA <213> Artificial Sequence <400> 1 gcagttgatc ctttggatac cctgg 25 <210> 2 <211> 18 <212> DNA <213> Artificial Sequence <400> 2 atccaaagga tcaactgc 18 <210> 3 <211> 47 <212> DNA <213> Artificial Sequence <400> 3 cctttggatt ttttctcccc ctccccctcc ccctttttgc agttgat 47

Claims

1. A non-diagnostic tumor cell detection method based on rolling circle amplification reaction, characterized in that the steps as follows: S1, screening out the aptamer S2.2 that specifically binds to MUC1, and designing a nucleic acid chain CDNA that is partially complementary to the aptamer S2.2, wherein the nucleic acid sequence of the aptamer S2.2 is GCAGTTGATCCTTTGGATACCCTGG; S2, adding an equal amount of CDNA to the aptamer S2.2 to obtain a mixed solution, then heating the mixed solution to 95°C for 5 minutes and then cooling it down gradually to allow the aptamer S2.2 and CDNA to form a double-stranded I, wherein the nucleic acid sequence of the CDNA is ATCCAAAGGATCAACTGC; S3, digesting the cultured MCF-7 cells with an enzyme-free digestion solution, then resuspending the MCF-7 cells with a binding buffer and counting them to obtain an MCF-7 cell sample; S4, adding double-stranded I to the MCF-7 cell sample, reacting at 37°C for 1h, and obtaining reaction product I after the reaction is completed; then adding padlock probe and T4 DNA ligase buffer to the reaction product I, and then adding T4 DNA ligase thereto, and reacting at 16°C for 16h. After the reaction is completed, heating to 65°C for 10min to inactivate the enzyme, so that the 5' end and 3' end of the padlock probe are connected to form a circular DNA, and reaction product II is obtained. The nucleic acid sequence of the padlock probe is Phosphorylation-CCTTTGGATTTTTTCTCCCCCTCCCCCCCCCCCTTTTTGCAGTTGAT; S5, add Phi 29 DNA polymerase, dNTPs, BSA and Phi 29 DNA polymerase buffer to the reaction product II, and react at 37°C for 1 hour, then raise the temperature to 65°C for 10 minutes to inactivate the enzyme, and after the reaction, obtain product III, i.e., a single-stranded tandemly repeated G quadruplex; S6. Add fluorescent dye Tb3+ to the product III, and then use a fluorescence spectrophotometer to detect fluorescence, Ex=290nm, Em=450nm-560nm, and the slit is 5nm.

2. A non-diagnostic tumor cell detection method based on rolling circle amplification reaction according to claim 1, characterized in that: The padlock probe described in step S4 includes a 5' end sequence, an intermediate sequence and a 3' end sequence connected in sequence, and a spacer sequence is connected between the 5' end sequence and the 3' end sequence and the intermediate sequence respectively; the 5' end sequence and the 3' end sequence are complementary to the CDNA respectively; the intermediate sequence and the G quadruplex single strand are complementary sequences.

Images