Undifferentiated cell detection method

By measuring the expression levels of LINC00678 and PRDM14 genes in differentiated cells, the problem of difficulty in detecting the residual/mixing of undifferentiated iPS cells in the prior art is solved, and high sensitivity detection of undifferentiated cells in various differentiated cells is achieved, reducing the risk of cancer.

CN114651069BActive Publication Date: 2025-06-17PUBLIC UNIV CORP YOKOHAMA CITY UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202080077961.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2019-11-15
Filing Date
2020-11-12
Publication Date
2025-06-17
Estimated Expiration
2040-11-12

AI Technical Summary

Technical Problem

The prior art is difficult to detect the residual/inclusion of undifferentiated iPS cells in various differentiated cells, especially in differentiated cells other than retinal pigment epithelial cells.

Method used

The expression levels and/or promoter activity of these genes in differentiated cell populations were determined by identifying and applying LINC00678 and PRDM14 as markers to detect the residual/mixing of undifferentiated iPS cells.

Benefits of technology

Residue/inclusion of undifferentiated iPS cells below 0.025% in various differentiated cells, including endoderm, mesoderm and ectoderm, was achieved, reducing the risk of cancer in differentiated cells in regeneration medicine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114651069B_ABST
    Figure CN114651069B_ABST
Patent Text Reader

Abstract

Provided are marker genes capable of detecting the survival / mixing of undifferentiated cells in a population of differentiated cells. By using at least one gene selected from LINC00678 and PRDM14 as an undifferentiated marker, undifferentiated cells present in a population of differentiated cells are detected. Also provided are a method for detecting undifferentiated cells, a method of use as an undifferentiated marker, an undifferentiated cell detection kit, and a method for sorting an undifferentiated cell line.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a method for detecting undifferentiated cells. Background Art

[0002] Detecting and evaluating the survival / mixing of undifferentiated iPS cells in a differentiated cell population used in regenerative medicine is extremely important from the viewpoint of cancer risk. To date, methods for detecting and evaluating the survival / mixing of undifferentiated iPS cells have been reported, such as a method for detecting iPS cell-specific genes by quantitative PCR (qPCR) (Non-Patent Document 1), and a method for reculturing differentiated cells under the culture maintenance conditions of undifferentiated cells (Non-Patent Document 2).

[0003] In the prior art, the reculturing method has the advantage of high accuracy in forming colonies from the mixed undifferentiated iPS cells. On the other hand, since it takes more than one week until detection, the method using quantitative PCR has an advantage in that it can be easily and rapidly implemented.

[0004] However, LIN28 reported to date (Non-Patent Document 1) is present in differentiated cells (retinal pigment epithelial cells) of organs / tissues with low expression, and on the other hand, is not seen in differentiated cells such as hepatocytes and cells differentiated from iPS cells. Therefore, there is a problem that it cannot be used in the detection of the survival / mixing of undifferentiated iPS cells in various differentiated cells.

[0005] Prior Art Documents

[0006] Non-Patent Documents

[0007] Non-Patent Document 1: PLoS One. 2014 27; 9(10): e110496.

[0008] Non-Patent Document 2: PLoS One. 2012; 7(5): e37342. Summary of the Invention

[0010] Problems to be Solved by the Invention

[0011] An object of the present invention is to provide a marker gene that can detect the survival / mixing of undifferentiated cells even in the case of differentiated cells other than retinal pigment epithelial cells.

[0012] Means for Solving the Problems

[0013] The present inventors identified a marker gene that can generally detect the survival / mixing of undifferentiated iPS cells in various differentiated cells.

[0014] As essential requirements for a marker gene, the following alone are insufficient:

[0015] 1. Specifically expressed in undifferentiated iPS cells,

[0016] 2. With extremely low expression in other cell lineages outside undifferentiated iPS cells,

[0017] In addition, the following are also used as benchmarks:

[0018] 3. It is necessary to be highly expressed even in undifferentiated iPS cells, but detectable even with extremely few in differentiated cells.

[0019] Therefore, as genes that meet this benchmark and are highly expressed in undifferentiated iPS cells and have an expression of 0.1% or less in differentiated endoderm cells, LINC00678 and PRDM14 were discovered. By applying these genes, for differentiated cells of organs / tissues, the residual / mixed-in undifferentiated iPS cells can be detected up to 0.025%. Further, since the expression of these marker genes is also 0.1% or less in cells differentiated into mesoderm and ectoderm, they are considered as markers for detecting the residual / mixed-in undifferentiated iPS cells in any differentiated cells of endoderm, mesoderm, and ectoderm.

[0020] The gist of the present invention is as follows.

[0021] (1) A method for detecting undifferentiated cells, which comprises measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 and PRDM14 in a population of differentiated cells.

[0022] (2) The method according to (1), wherein the undifferentiated cells are embryonic carcinoma cells (EC cells), embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), or embryonic germ cells (EG cells), and the population of differentiated cells is a population of cells differentiated from the aforementioned undifferentiated cells.

[0023] (3) The method according to (1) or (2), wherein the population of differentiated cells is a population of differentiated cells of any one of endoderm, mesoderm, or ectoderm.

[0024] (4) The method according to (3), wherein the differentiated cells of endoderm are intrahepatic endoderm cells.

[0025] (5) The method according to any one of (1) to (4), wherein the expression level of the gene is measured as the amount of RNA including mRNA or the amount of protein.

[0026] (6) The method according to any one of (1) to (5), wherein the expression level of the gene is measured by qPCR, digital PCR, isothermal nucleic acid amplification method, immunostaining, in situ hybridization, RNA sequencing, microarray, NanoString, antibody array, flow cytometry, or mass spectrometry.

[0027] (7) Method for selecting undifferentiated cell lines with high sorting safety, which is carried out by measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 and PRDM14 in differentiated cells of any one of endoderm, mesoderm or ectoderm induced from undifferentiated cell lines.

[0028] (8) The method according to (7), wherein the undifferentiated cell line is an embryonic carcinoma cell (EC cell) line, an embryonic stem cell (ES cell) line, an induced pluripotent stem cell (iPS cell or iPSC) line or an embryonic germ cell (EG cell) line.

[0029] (9) The method according to (8), wherein the undifferentiated cell line is an iPS cell line.

[0030] (10) Method for detecting undifferentiated cells, which includes measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 and PRDM14 in tissues formed by transplanting differentiated cells into a model animal.

[0031] (11) Method for using at least one gene selected from LINC00678 and PRDM14 as an undifferentiated marker, which is used for detecting undifferentiated cells present in a population of differentiated cells.

[0032] (12) Kit for detecting undifferentiated cells, which includes a reagent capable of detecting the expression of at least one gene selected from LINC00678 and PRDM14 and / or a reagent capable of measuring the promoter activity of the gene.

[0033] (13) The kit according to (12), wherein the reagent capable of detecting the expression of the gene is a primer, a probe or an antibody.

[0034] (14) The kit according to (12), wherein the reagent capable of measuring the promoter activity of the gene is a gene sequence of a reporter protein linked downstream of the promoter or a vector into which the gene sequence has been introduced.

[0035] Effects of the invention

[0036] According to the present invention, it is possible to detect and evaluate the survival / mixing of undifferentiated cells in a population of differentiated cells, and reduce the canceration risk of differentiated cells applied in regenerative medicine.

[0037] This specification contains the content described in the specification and / or drawings of Japanese Patent Application No. 2019-207002, which is the basis of the priority of this application. Brief Description of the Drawings

[0039] Figure 1 is the LIN28A expression in the microarray data of hepatocytes at the mouse developmental stage. The expression is high up to E13.5 compared to that in the adult (8w).

[0040] Figure 2 is the expression of LIN28A at each differentiation stage of human iPSC differentiated into hepatocytes. LIN28A is also highly expressed in definitive endoderm (DE) and hepatic endoderm (HE).

[0041] Figure 3 is the qPCR of the extracted genes by microarray. The expression was confirmed by qPCR, and genes with low expression especially in hepatocytes were extracted.

[0042] Figure 4 is the study on the detection sensitivity of marker genes by undifferentiated iPSC mixing experiment. For hepatic endoderm cells mixed with undifferentiated iPSCs, the detection sensitivity was studied by qPCR by comparing with the non-mixed group of undifferentiated iPSCs. *p < 0.05.

[0043] Figure 5 is to induce differentiation into respective cells from the three germ layers using STEMdiff Trilineage Differentiation Kit (STEMCELL Technologies), and the differentiability was confirmed by immunostaining and qPCR.

[0044] Figure 6 is to study by qPCR Figure 5 the expression of marker genes in the cells induced to differentiate in

[0045] Figure 7 is to apply the colony immunostaining method to Figure 5 the cells induced to differentiate in

[0046] Figure 8 is the RT-LAMP reaction components

[0047] Figure 9 is the study on the RT-LAMP detection sensitivity of marker genes by undifferentiated iPSC mixing experiment.

[0048] Figure 10 ​​​​​​​​​​is the evaluation of the expression of undifferentiated markers and residual iPSCs in vascular endothelial cells (iPSC-EC) induced from iPS cells. The differentiation into vascular endothelial cells was confirmed by the expression of CD34 and CDH5. The expression of undifferentiated detection marker genes (ESRG, LINC00678, PRDM14) was studied by qPCR.

[0049] Figure 11 is the evaluation of the expression of undifferentiated markers and residual iPSCs in mesenchymal cells (iPSC-STM / MC) induced from iPS cells. The differentiation into mesenchymal cells was confirmed by the expression of FOXF1 and PDGFRB. The expression of undifferentiated detection marker genes (ESRG, LINC00678, PRDM14) was studied by qPCR.

[0050] Figure 12 is the evaluation of the expression of undifferentiated markers and residual iPSCs in ectodermal cells (neural crest cells (NCC)) induced from iPS cells. The differentiation into neural crest cells was confirmed by the expression of SOX1 and PAX6. The expression of undifferentiated detection marker genes (ESRG, LINC00678, PRDM14) was studied by qPCR.

[0051] Mode for carrying out the invention

[0052] The present invention will be described in detail below.

[0053] The present invention provides a method for detecting undifferentiated cells, which comprises measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 (official full name by the HUGO Gene Nomenclature Committee (HGNC): long intergenic non-protein coding RNA 678; NCBI reference sequence: NR_102708.1, etc.) and PRDM14 (official full name by HGNC: PR / SET domain 14; NCBI reference sequence: NM_024504.4, etc.) in a population of differentiated cells.

[0054] The undifferentiated cells to be detected may be pluripotent cells. For example, the undifferentiated cells are embryonic carcinoma cells (EC cells), embryonic stem cells (ES cells), induced pluripotent stem cells (iPS cells), or embryonic germ cells (EG cells).

[0055] ​​The cells constituting the differentiated cell population may be cells other than undifferentiated cells, preferably not pluripotent. For example, cells differentiated from undifferentiated cells to be detected.

[0056] The differentiated cell population may be a population of differentiated cells of any one of the endoderm, mesoderm, and ectoderm.

[0057] Examples of the differentiated cells of the endoderm include, but are not limited to, hepatic endoderm cells.

[0058] In the following examples, iPS cells (undifferentiated cells) mixed in a population of hepatic endoderm cells (differentiated cells) induced to differentiate from iPS cells were detected. The hepatic endoderm cells are hepatic progenitor cells called iPSC-HE (Hepatic Endoderm) (Nature 499: 481-484 (2013); Japanese Patent No. 6124348, "Method for preparing tissues and organs") on the 10th day of the differentiation induction treatment from iPS cells to hepatocytes. According to the measurement by qPCR, LINC00678 and PRDM14 are considered to be effective marker genes for the detection of iPS cells in the hepatic endoderm cell population.

[0059] Examples of the differentiated cells of the mesoderm include, but are not limited to, septum transversum mesenchymal cells, mesenchymal cells, vascular endothelial cells.

[0060] In the following examples, iPS cells (undifferentiated cells) mixed in a population of mesenchymal cells (differentiated cells) induced to differentiate from iPS cells were detected. The mesenchymal cells are mesenchymal stem / precursor cells (cells derived from the mesoderm) called iPSC-STM / MC (iPS cell-derived septum transversum mesenchymal cells / iPS cell-derived mesenchymal cells (septum transversum mesenchyme / mesenchymal cells)) (Cell Rep. 21: 2661-2670. (2017)) that have undergone the differentiation induction treatment from iPS cells to mesenchymal cells, and are CD166 positive and do not express CD31 (PECAM1), which is a marker of vascular endothelium. According to the measurement by qPCR, LINC00678 and PRDM14 are considered to be effective marker genes for the detection of iPS cells in the mesenchymal cell population.

[0061] In addition, in the following examples, iPS cells (undifferentiated cells) mixed in a population of vascular endothelial cells (differentiated cells) induced to differentiate from iPS cells are detected. The vascular endothelial cells are vascular endothelial progenitor cells (cells derived from the mesoderm), called iPSC-EC (iPS cell-derived endothelial cells (endothelial cells)) (Cell Rep. 21: 2661-2670. (2017)), which are subjected to a differentiation induction treatment from iPS cells to vascular endothelial cells. The expression of proteins of CD31 (PECAM1) and CD144, which are markers of vascular endothelium, can be confirmed by immunostaining. In gene expression analysis, high expression of vascular endothelial markers such as PECAM1, CDH5, KDR, and CD34 is observed, and the expression is 10 to 100 times or more higher compared to iPS cells before differentiation induction. According to the measurement by qPCR, LINC00678 and PRDM14 are considered to be marker genes effective in the detection of iPS cells in a population of vascular endothelial cells.

[0062] Examples of differentiated cells of the ectoderm include, but are not limited to, neural stem cells, neural crest cells, and nerve cells.

[0063] In the following examples, iPS cells (undifferentiated cells) mixed in a population of neural crest cells (Menendez L. et al., Proc Natl Acad Sci USA. 108(48): 19240-5. 2011) (cells derived from the ectoderm) induced to differentiate from iPS cells are detected. According to the measurement by qPCR, LINC00678 and PRDM14 are considered to be marker genes effective in the detection of iPS cells in a population of neural crest cells.

[0064] In addition, in the following examples, the STEMdiff Trilineage Differentiation Kit (STEMCELL Technologies) is also used to detect the expression of marker genes in cells induced to differentiate from each of the three germ layers by qPCR.

[0065] In the present invention, differentiated cells and undifferentiated cells can be derived from all animals including humans and non-human animals.

[0066] The expression level of a gene can be measured as the amount of RNA containing mRNA transcribed from the gene or the amount of protein translated from RNA including mRNA. Specifically, the expression level of a gene can be determined by qPCR, digital PCR, isothermal nucleic acid amplification method (such as LAMP method), immunostaining, in situ hybridization, RNA sequencing, microarray, NanoString, antibody array, flow cytometry, mass spectrometry, etc. In addition, the RNA including mRNA may not encode a protein, and further, it may be a partial degradation product of RNA containing the target sequence for nucleic acid amplification, etc.

[0067] In the case of confirming the expression of at least one gene selected from LINC00678 and PRDM14, it can be determined that undifferentiated cells are present in the differentiated cell population (detection of undifferentiated cells).

[0068] In the present specification, "detection" means confirming the presence, but "detection" also includes confirming the absence.

[0069] According to the method of the present invention, undifferentiated cells in a differentiated cell population can be detected with a detection sensitivity of 0.1% or less, for example, 0.025%, 0.01%, and depending on the situation, 0.005%, 0.0025%. The detection sensitivity can be studied by the spike test described in the examples below.

[0070] In differentiated cells of any one of endoderm, mesoderm, or ectoderm induced to differentiate from an undifferentiated cell line, by measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 and PRDM14, undifferentiated cell lines with high safety can be sorted. Therefore, the present invention provides a method for sorting undifferentiated cell lines with high safety in which undifferentiated cells are difficult to remain after differentiation induction by measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 and PRDM14 in differentiated cells of any one of endoderm, mesoderm, or ectoderm induced to differentiate from an undifferentiated cell line.

[0071] The undifferentiated cell line to be sorted can be a pluripotent cell line. For example, the undifferentiated cell line is an embryonic carcinoma cell (EC cell) line, an embryonic stem cell (ES cell) line, an induced pluripotent stem cell (iPS cell) line, or an embryonic germ cell (EG cell) line, preferably an iPS cell line.

[0072] In addition, in the tissue formed by transplanting differentiated cells into a model animal, measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 and PRDMI4 can detect undifferentiated cells in the tissue. Therefore, the present invention also provides a method for detecting undifferentiated cells, which includes measuring the expression level and / or promoter activity of at least one gene selected from LINC00678 and PRDM14 in the tissue formed by transplanting differentiated cells into a model animal. The tissue can be the kind formed by transplanting differentiated cells into a model animal for a long period (for example, 4 to 54 weeks, preferably 8 to 24 weeks).

[0073] Through the present invention, it is obvious that LINC00678 and PRDM14 can be used as marker genes for detecting undifferentiated cells present in a differentiated cell population. Therefore, the present invention provides a method for using at least one gene selected from LINC00678 and PRDM14 as an undifferentiated marker for detecting undifferentiated cells present in a differentiated cell population.

[0074] In addition, the present invention provides a kit for detecting undifferentiated cells, which includes a reagent capable of detecting the expression of at least one gene selected from LINC00678 and PRDM14 and / or a reagent capable of measuring the promoter activity of the gene.

[0075] As reagents for detecting the expression of genes, primers, probes, antibodies, etc. can be cited. For example, a group of oligonucleotide primers that can specifically amplify a transcript (RNA including mRNA) or cDNA of at least one gene selected from LINC00678 and PRDM14, a nucleotide probe that specifically hybridizes with a transcript (RNA including mRNA) or cDNA of at least one gene selected from LINC00678 and PRDM14, and an antibody that specifically binds to a protein (translation product) translated from a transcript (RNA including mRNA) of at least one gene selected from LINC00678 and PRDM14. The group of oligonucleotide primers can be those capable of amplifying a target sequence (usually about 50 to 180 bp) in a nucleotide sequence of a transcript (RNA including mRNA) or cDNA of at least one gene selected from LINC00678 and PRDM14, and can be designed to have sequences complementary to both ends of the target sequence. The length of the oligonucleotide primers can be, for example, 15 to 35 nucleotides, preferably 18 to 27 nucleotides. The nucleotide probe can be one that hybridizes with a transcript (RNA including mRNA) or cDNA of at least one gene selected from LINC00678 and PRDM14 under stringent conditions, and can be designed to have a part or all of the nucleotide sequence of the aforementioned RNA including mRNA or cDNA or a sequence complementary thereto. The stringent conditions can be appropriately determined. The length of the nucleotide probe is usually 1000 nucleotides or less, preferably 100 nucleotides or less, more preferably 50 nucleotides or less, and further more preferably 5 to 30, or 14 to 30 nucleotides. The nucleotide probe can be single-stranded or double-stranded. The antibody can be either a monoclonal antibody or a polyclonal antibody. In this specification, the concept of an antibody includes, in addition to a full-length antibody, low-molecular-weight antibodies such as Fab, F(ab)’2, ScFv, Diabody, V H 、V L 、Sc(Fv)2, bispecific sc(Fv)2, Minibody, ScFv-Fc monomer, ScFv-Fc dimer, etc. The probe or antibody can be immobilized on a solid phase (e.g., a substrate, beads, a membrane, etc.).

[0076] The reagent of the present invention can be labeled. For example, the primer can be labeled with a fluorescent substance, a quenching substance, etc., and the probe and antibody can be labeled with a radioisotope, an enzyme, a luminescent substance, a fluorescent substance, biotin, etc. In addition, in the case of detecting a target molecule (in the present invention, a protein that is an expression product of at least one gene selected from LINC00678 and PRDM14) by reacting a secondary antibody that binds to the primary antibody after the reaction of the primary antibody that specifically binds to the target molecule, the secondary antibody can be labeled (the primary antibody is not labeled).

[0077] As a reagent for measuring the promoter activity of a gene, examples include a gene sequence in which a reporter protein is linked downstream of the promoter or a vector into which the gene sequence has been introduced. As the reporter protein, examples include fluorescent proteins such as luciferase and GFP, and proteins expressed on the cell membrane such as CD antigens. The vector is preferably a plasmid vector.

[0078] The kit of the present invention may further include reagents for detection with primers (DNA polymerase, buffer, magnesium ions, dNTPs, probes, etc.), reagents for detection with probes (buffer, antibody, substrate, etc.), reagents for detection with antibodies (secondary antibody, substrate, buffer, etc.), reagents for measuring the promoter activity of a gene (buffer, luminescent substrate, antibody, etc.), instruments (reaction vessels, pipettes, etc.), instructions for use of the kit, specimens for control, control data for analyzing measurement results, etc. Examples

[0079] Hereinafter, the present invention will be specifically described by way of examples. The scope of the present invention is not limited to the following examples.

[0080] 〔Example 1〕

[0081] Materials and Methods

[0082] ·iPSC

[0083] Those provided by Kyoto University and the University of Tokyo (TkDA3-4, 1231A3, 1383D2, 1383D6, and Ff01) were used.

[0084] ·Undifferentiated cell remnants

[0085] To quantify the undifferentiated cells remaining in the cells differentiated from iPSCs, we applied the method of Tano et al. Briefly, first, the differentiated cells were detached using trypsin, and after inoculating at 1.6x10 5 cells / well in StemFit containing a ROCK inhibitor in a 24-well plate, the medium was exchanged daily with StemFit and cultured at 37°C. After one week, immunostaining was performed and the number of positive colonies was counted.

[0086] ·Colony counting

[0087] The immunostained samples were photographed with a microscope, and the number of colonies was visually counted for the taken photos. One colony of undifferentiated iPSC colonies was regarded as coming from one undifferentiated iPS cell, and was used as the number of remaining undifferentiated iPS cells.

[0088] ·Hepatocyte differentiation

[0089] Undifferentiated iPS cells were seeded at a density of 5 - 10 x 10 4 cells / cm 2 in laminin-coated dishes in the presence of a ROCK inhibitor (Y-27632), and cultured for 6 days in the presence of RPMI + B27 + activin A + Wnt3A. These cells were used as definitive endoderm cells (DE). Further, they were cultured for 4 days in the presence of KO-DMEM + KSR + DMSO + 2-mercaptoethanol as hepatic endoderm cells (HE).

[0090] · Immunostaining

[0091] To detect undifferentiated cells, immunostaining was performed using primary antibodies for pluripotency markers SOX2, TRA-1-60 (Cell Signaling Technologies) and their corresponding secondary antibodies (Thermo Fisher Scientific). Cells were fixed by treatment with 4% paraformaldehyde for 15 minutes. After washing twice with PBS, the cell membrane was permeabilized by treatment with 0.1% Triton X-100 (PBST) in PBS for 10 minutes. Subsequently, blocking treatment was performed with 5% FBS in PBST. After 1 hour, the blocking buffer was removed, and an appropriately diluted primary antibody solution was added and incubated overnight at 4°C. Subsequently, the cells were washed three times with PBS, a diluted secondary antibody solution was added, and the cells were allowed to stand at room temperature for 1 hour in the dark. Finally, the cells were washed three times with PBS, and an Aphathy mounting agent (Wako Pure Chemical Industries) was added for observation.

[0092] · Microscope (Keyence, etc.)

[0093] The entire one well was photographed for bright field, blue fluorescence, green fluorescence, and red fluorescence using a BZ-X710 all-in-one fluorescence microscope with 4x and 10x objectives.

[0094] · qPCR

[0095] RNA extraction including mRNA was performed from cells using the PureLink RNA Mini Kit (Thermo Fisher). cDNA was synthesized by reverse transcription reaction using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher). qPCR was performed using the following primers and the Universal Probe Library (Roche). For PRDM14, primers were designed in a total of 4 regions between the exon junctions of exon 1-2, exon 2-3, exon 4-5, and exon 6-7, respectively. This is because during the process of inducing differentiation from pluripotent stem cells to target differentiated cells, it is considered that due to changes in the transcription start point of RNA including mRNA at different cell differentiation stages, different exon junction structures can be generated by splicing, and partial degradation products of accumulated RNA can be produced. Therefore, it is thought that the primer design position, the detection sensitivity of undifferentiated cells, and its accuracy can vary.

[0096] LINC00678

[0097] Forward: catctcaccaattttaaatcaggac (SEQ ID NO: 1)

[0098] Reverse: ctcccgtcattctgctaacac (SEQ ID NO: 2)

[0099] Probe: #17

[0100] PRDM14 F1-2

[0101] Forward: gctcttggaggtggtgtcg (SEQ ID NO: 3)

[0102] Reverse: gccggaaaggttggaagtc (SEQ ID NO: 4)

[0103] Probe: #64

[0104] PRDM14 E2-3 Forward: tgcaccatgcgatttcag (SEQ ID NO: 5)

[0105] Reverse: tgcatgaggcatagaccttc (SEQ ID NO: 6)

[0106] Probe: #79

[0107] PRDM14 E4-5

[0108] Forward: gacaattctgtgatgtgggag (SEQ ID NO: 7)

[0109] Reverse: tgacactgcacagcaactagg (SEQ ID NO: 8)

[0110] Probe: #68

[0111] PRDM14 E6-7

[0112] Forward: ggcttcggatccacattc (SEQ ID NO: 9)

[0113] Reverse: agtggactcgcatgtgtttg (SEQ ID NO: 10)

[0114] Probe: #11

[0115] · Incorporation experiment

[0116] For cells induced to differentiate, undifferentiated iPS cells maintained in culture were mixed at the ratios described in the figure, and undifferentiated cell survival assays, qPCR, gel electrophoresis of the amplification products after qPCR reaction, etc. were performed.

[0117] · Statistics

[0118] A p-value of 0.05 or less by Student's t-test was considered to have a significant difference. The correlation coefficient was calculated based on the Pearson product-moment correlation coefficient.

[0119] Results

[0120] · In the liver, LIN28 is not an indicator of undifferentiated iPSCs.

[0121] It has been reported that the LIN28 (LIN28A) gene is an indicator of residual undifferentiated iPSCs when differentiating into retinal pigment epithelial cells (RPE) from iPSCs (Kuroda T. et al., PLoS ONE 7(5): e37342. (2012)). When observing the expression of LIN28A in the liver during the mouse developmental stage, it is obvious that the expression is higher at E13.5 compared to the adult (8w) Figure 1 ). Obviously, in iPS cell-derived definitive endoderm cells (DE) and hepatic endoderm cells (HE) which are endoderm cells, there is almost no decrease compared to undifferentiated iPS cells Figure 2 ).

[0122] · Extraction of genes specifically highly expressed in iPS cells

[0123] For the purpose of extracting marker genes that can be used as indicators of residual undifferentiated iPSCs in iPS cell-derived hepatocytes, microarray analysis of the mouse developmental stage, single-cell RNA sequencing of the differentiation induction process of iPS cell-derived hepatocytes, and t-SNE analysis based on RNA sequence data were performed to extract more than 30 genes that are specifically and highly expressed in undifferentiated iPS cells and have low expression in differentiated cells. Regarding the extracted genes, LINC00678 and PRDM14 were extracted as genes with high expression in iPS cells and reduced expression in differentiated cells by qPCR( Figure 3 ). In addition, even for candidate genes that are considered promising by transcriptome analysis, when qPCR is performed, most genes have low expression in iPS cells and high expression in differentiated cells, and are not useful markers.

[0124] · Study on the detection limit of each marker gene (undifferentiated iPSC admixture test)

[0125] For the differentiated iPS cell-derived hepatic progenitor cells (HE), undifferentiated iPS cells maintained in culture were mixed at the recorded ratio, and qPCR was performed( Figure 4 ). As a result, the residual / mixing of undifferentiated iPS cells up to 0.025% could be detected.

[0126] · Residual undifferentiated cell test in differentiated cells prepared by STEMdiffTM Trilineage Differentiation Kit

[0127] Furthermore, in order to show a marker for residual undifferentiated cells in generally iPS cell-derived differentiated induced cells, a commercially available differentiation induction kit (STEMdiff Trilineage Differentiation Kit from Stem Cell Technologies) was used to study the differentiated induced cells( Figure 5 ). As a result, residual undifferentiated cells were observed in the endoderm-derived cells differentiated from iPS cells, and the marker gene expression also increased in correlation with the residual number. Therefore, a correlation between the number of residual undifferentiated cells and marker expression was seen in any cell lineage of endoderm-derived cells, mesoderm-derived cells, and ectoderm-derived cells differentiated from iPS cells( Figure 6 , 7 ).

[0128] Discussion

[0129] Detection and elimination of undifferentiated cell contamination in iPS(ES)-cell-derived differentiated cells beneficial for regenerative medicine applications are important issues in ensuring the safety of all iPS(ES)-cell-derived cell products. To date, rapid evaluation of undifferentiated cell contamination verified by the expression of LIN28A in retinal pigment epithelial cells (RPE) has been reported. However, LIN28A is expressed during mouse development in the liver, and its expression has also been observed in cells induced to differentiate from human iPS cells. Moreover, it is clear that this expression is not correlated with the presence or absence of undifferentiated cells actually remaining in differentiated cells. Therefore, LINC00678 and PRDM14 were extracted as markers for undifferentiated cells remaining in iPS-cell-derived hepatocytes. The detection method for residual undifferentiated iPS cells using multiple marker genes extracted this time is expected to become a simple and rapid tool for ensuring the safety of various iPS(ES)-cell-derived cell products.

[0130] References:

[0131] ·Kuroda T.et al., PLoS ONE 7(5): e37342. (2012)

[0132] ·Tano et al., PLoS One. 201427; 9(10): e110496.

[0133] 〔Example 2〕

[0134] As a method for measuring the expression level of the marker gene of the present invention, research on isothermal nucleic acid amplification methods was conducted. The LAMP method was applied as the isothermal nucleic acid amplification method, and an RT-LAMP method for amplifying and detecting the RNA structure from the LINC00678 gene was designed. The base sequences of the designed RT-LAMP method primer sets and probes are as follows, and fluorescently labeled probes were used. The reaction components of RT-LAMP are shown in Figure 8 .

[0135] F3: gacgggagtgtgagatcc (SEQ ID NO: 11)

[0136] B3: acatcttctcctgaatcctcag (SEQ ID NO: 12)

[0137] FIP: ttggaaatagttctcggttgctctccacatggcgaggcac (SEQ ID NO: 13)

[0138] BIP: tggtcaggtggagtaaaacataaggagacacctccatgctgtc (SEQ ID NO: 14)

[0139] LoopF: caagaagaaaacaggttcctgg (SEQ ID NO: 15)

[0140] LoopB: ggttcaaagcatgaaaaaaattgg (SEQ ID NO: 16)

[0141] Probe: ccttcactttgagccaggcaatggtcag (SEQ ID NO: 17)

[0142] The sample in which iPS cells for undifferentiated maintenance culture of iPS cell-derived hepatic progenitor cells (HE) were gradually mixed as described in Application Example 1 was subjected to RT-LAMP. As a result, it could also be detected in RT-LAMP, and at the same time, it showed higher sensitivity than the qRT-PCR in the experiment ( Figure 9 ).

[0143] [Example 3]

[0144] By introducing a reporter protein gene (a fluorescent protein gene such as a luciferase gene or a GFP gene, or a gene such as a mouse CD4 gene that is expressed on the cell surface and can be specifically detected by an antibody, etc.) under the control of a promoter region related to the expression control of the marker gene of the present invention, it is possible to detect residual undifferentiated cells without directly detecting the expression of the marker gene of the present invention.

[0145] [Example 4]

[0146] By applying a target cell for multiple iPS cell lines and a three-germ layer differentiation induction kit, etc., the expression of the marker gene of the present invention was evaluated for the differentiated cells, and the iPS cell lines with low expression of the marker gene were sorted, so that undifferentiated cell lines with high safety could be sorted.

[0147] [Example 5]

[0148] By transplanting differentiated cells into a model animal for a long time, collecting the transplanted cells, and detecting the expression of the marker gene of the present invention by qPCR, isothermal amplification method (such as LAMP method), etc. or by the method described in [Example 3], undifferentiated cells in the formed tissue were detected.

[0149] [Example 6]

[0150] Using the same method as in Example 1, as mesoderm-derived cells, the residual test of undifferentiated iPS cells and qPCR were applied to diaphragm interstitial cells (iPSC-STM / MC) (Cell Rep. 21: 2661-2670. (2017)) and vascular endothelial cells (iPSC-EC) (Cell Rep. 21: 2661-2670. (2017)) induced to differentiate from iPS cells, and the expression of marker genes was studied. In either iPSC-STM / MC or iPSC-EC, ESRG, LINC00678, and PRDM14 were reduced in differentiated cells without residual undifferentiated cells, and it was considered that they could be used as residual undifferentiated markers ( Figure 10 , 11 ).

[0151] In addition, as ectoderm-derived cells, in the measurement by qPCR of neural crest cells (NCC) (Menendez L. et al., Proc Natl Acad Sci U S A. 108(48): 19240-5. 2011) induced to differentiate from iPS cells, the same results were obtained ( Figure 12 ).

[0152] All publications, patents, and patent applications cited in this specification are incorporated herein by reference in their entirety.

[0153] Industrial Applicability

[0154] The present invention can be applied to the detection and evaluation of undifferentiated cells remaining / mixed in differentiated cells applicable in regenerative medicine.

[0155] Sequence Listing Free Text

[0156] <Sequence No. 1 to 16>

[0157] Showing the DNA sequences of primers.

[0158] <Sequence No. 17>

[0159] Showing the DNA sequences of probes.

Claims

1. A method for detecting undifferentiated cells, which comprises determining the expression level of at least one gene selected from LINC00678 and PRDM14 in a population of differentiated cells of the mesoderm, differentiated cells of the ectoderm, or hepatendoderm cells; wherein, The undifferentiated cells are induced pluripotent stem cells (iPS cells), and the population of differentiated cells of the mesoderm, differentiated cells of the ectoderm, or hepatendoderm cells is a population of cells differentiated from the undifferentiated cells.

2. The method according to claim 1, wherein, The undifferentiated cells are detected with a detection sensitivity of 0.1% or less.

3. The method according to claim 1 or 2, wherein, The expression level of a gene is measured as the amount of RNA including mRNA or the amount of protein.

4. The method according to claim 1 or 2, wherein, The expression level of a gene is measured by qPCR, digital PCR, isothermal nucleic acid amplification method, immunostaining, in situ hybridization, RNA sequencing, microarray, NanoString, antibody array, flow cytometry, or mass spectrometry.

5. A method for sorting undifferentiated cell lines with high safety, which is carried out by determining the expression level of at least one gene selected from LINC00678 and PRDM14 in differentiated cells of the mesoderm, differentiated cells of the ectoderm, or hepatendoderm cells induced to differentiate from undifferentiated cell lines; wherein, The undifferentiated cell line is an induced pluripotent stem cell (iPS cell) line.

6. The method according to claim 5, wherein, The undifferentiated cell line is detected with a detection sensitivity of 0.1% or less.

7. Use of a reagent for determining the expression level of at least one gene selected from LINC00678 and PRDM14 in the preparation of a kit for detecting undifferentiated cells in a tissue formed by transplanting differentiated cells of the mesoderm, differentiated cells of the ectoderm, or hepatendoderm cells into a model animal; wherein, The undifferentiated cells are induced pluripotent stem cells (iPS cells), and the differentiated cells of the mesoderm, differentiated cells of the ectoderm, or hepatendoderm cells are cells differentiated from the undifferentiated cells.

8. The use according to claim 7, wherein, The undifferentiated cells are detected with a detection sensitivity of 0.1% or less.

9. Use of a reagent capable of detecting the expression of at least one gene selected from LINC00678 and PRDM14 in differentiated cells of the mesoderm, differentiated cells of the ectoderm, or hepatendoderm cells in the preparation of a kit for detecting undifferentiated cells present in differentiated cells of the mesoderm, differentiated cells of the ectoderm, or hepatendoderm cells, wherein, The undifferentiated cells are induced pluripotent stem cells (iPS cells).

10. The use according to claim 9, wherein, The undifferentiated cells are detected with a detection sensitivity of 0.1% or less.

11. The use according to claim 9 or 10, wherein, The reagent capable of detecting the expression of a gene is a primer, a probe, or an antibody.

Citation Information

Patent Citations

  • Remote supervisory and controlling equipment

    JP1986024348A

  • Pipe joint

    JP2019207002A