Fungal strains comprising an enhanced protein productivity phenotype and methods thereof

Abstract

The present disclosure generally relates to modified filamentous fungal strains (cells) comprising an increased protein productivity phenotype, wherein such modified strains are particularly suitable for growth in submerged culture (e.g., large-scale production of proteins for industrial / commercial applications). Therefore, certain embodiments of the present disclosure relate to such variant (modified) strains of filamentous fungi derived (obtained) from a parent strain comprising a gene encoding a native GEF1 protein, wherein the variant strain comprises a genetic modification that disrupts or deletes a gene encoding a native GEF1 protein, wherein when grown / cultured / fermented under the same conditions, the variant strain comprises an increased protein productivity phenotype (i.e., relative to the parent strain).

Description

Technical Field

[0001] This disclosure generally relates to the fields of biology, molecular biology, filamentous fungi, yeast, fermentation, genetics, and industrial protein production. More specifically, the strains and methods disclosed herein relate to genetic modifications in filamentous fungi that produce phenotypic variants (modified) strains, wherein such modified strains are particularly suitable for growth in submerged cultures (e.g., large-scale production of proteins for industrial / commercial applications).

[0002] Cross-references to related applications

[0003] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 932,525, filed November 8, 2019, which is incorporated herein by reference in its entirety.

[0004] References to sequence lists

[0005] The electronic submission of the text file sequence list named “NB41383-WO-PCT_SequenceListing.txt” was created on October 27, 2020, and is 55KB in size. It is hereby incorporated in its entirety by reference. Background Technology

[0006] Filamentous fungi (e.g., species of *Aspergillus*, *Penicillium*, *Talaromyces*, *Fusarium*, *Myceliophthora*, *Neurospora*, *Candida*, *Trichoderma*, etc.) can express high levels of native and heterologous proteins, making them highly suitable for large-scale production of proteins (e.g., enzymes, antibodies, peptides, etc.) and / or metabolites for industrial and / or commercial applications such as pharmaceuticals, animal health, food, beverages, laundry and textiles. Filamentous fungi typically grow in deep mycelial cultures in bioreactors (fermenters) regulated to introduce and distribute oxygen and nutrients into the culture medium (i.e., culture broth). For example, the filamentous fungus *Trichoderma reesei* (T. reesei, an asexual form of the fungus *Hypocreajecorina*) is known to be an efficient producer of cellulase.

[0007] Therefore, filamentous fungi are utilized for their ability to produce proteins (e.g., enzymes), which are valuable in the production of commodities such as cellulosic (derived) ethanol, textile products, grain products, detergents, fiber / pulp / paper, food additives, feed additives, etc. For example, recombinant gene expression in such fungal host strains is a common method for protein production (i.e., for industrial and commercial purposes), and thus, improvements in protein productivity in fungal host strains are a significant economic factor in protein production costs. Therefore, as those skilled in the art will understand, such novel compositions and methods for improving protein production in filamentous fungal strains have important commercial significance. Summary of the Invention

[0008] This disclosure generally relates to modified filamentous fungal strains (cells) that exhibit an enhanced protein productivity phenotype, wherein such modified strains are particularly suitable for growth in submerged cultures (e.g., for large-scale production of proteins for industrial / commercial applications). Therefore, certain embodiments of this disclosure relate to such variant (modified) strains of filamentous fungi derived (obtained) from a parental strain containing a gene encoding a native GEF1 protein, wherein the variant strain contains a genetic modification that disrupts or omits the gene encoding the native GEF1 protein, and wherein, when grown / cultured / fermented under the same conditions, the variant strain exhibits an enhanced protein productivity phenotype (i.e., relative to the parental strain).

[0009] Biological Sequence Summary

[0010] SEQ ID NO:1 is a Trichoderma reesei polynucleotide sequence that encodes the natural GEF1 protein containing SEQ ID NO:2.

[0011] SEQ ID NO:2 is the amino acid sequence of the natural full-length GEF1 protein encoded by the polynucleotide of SEQ ID NO:1.

[0012] SEQ ID NO:3 is the open reading frame (ORF) encoding the natural full-length GEF1 protein of SEQ ID NO:2.

[0013] SEQ ID NO:4 is a C-terminal truncated GEF1 variant protein containing amino acid positions 1-1,244 of SEQ ID NO:2.

[0014] SEQ ID NO:5 is the amino acid sequence of the GEF1 domain present in SEQ ID NO:2.

[0015] SEQ ID NO:6 is the amino acid sequence of the BAR domain present in SEQ ID NO:2.

[0016] SEQ ID NO:7 is the amino acid sequence of the conserved unknown domain present in SEQ ID NO:2.

[0017] SEQ ID NO:8 is the RNA sequence of target site 3 (TS3) in the Trichoderma reesei GEF1 gene.

[0018] SEQ ID NO:9 is the nucleic acid sequence of primer AL950.

[0019] SEQ ID NO:10 is the nucleic acid sequence of primer AL952.

[0020] SEQ ID NO:11 is the nucleic acid sequence of primer RhoF1.

[0021] SEQ ID NO:12 is the nucleic acid sequence of primer RhoR1.

[0022] SEQ ID NO:13 is the RNA sequence of target site 4 (TS4) in the Trichoderma reesei GEF1 gene.

[0023] SEQ ID NO:14 is the nucleic acid sequence of the hygromycin phosphotransferase marker gene.

[0024] SEQ ID NO:15 is the PCR1 promoter nucleic acid sequence of Neurospora crassa.

[0025] SEQ ID NO:16 is the nucleic acid sequence of the trpC terminator of Aspergillus nidulans.

[0026] SEQ ID NO:17 is the nucleic acid sequence of primer HygF1.

[0027] SEQ ID NO:18 is the nucleic acid sequence of primer HygR1.

[0028] SEQ ID NO:19 is the nucleic acid sequence of the pyr2 marker gene. Attached Figure Description

[0029] Figure 1 shows the polynucleotide sequence (SEQ ID NO:1) encoding the amino acid sequence of a natural Trichoderma species GEF1 protein homolog containing SEQ ID NO:2; Figures 1A-1B ).like Figure 1A and Figure 1B As shown, the DNA sequence encoding the GEF1 protein (SEQ ID NO: 2) contains two (2) introns represented by lowercase (nucleotide) letters and three (3) exons represented by uppercase (nucleotide) letters, wherein the Cas9 target site 3 (TS3) nucleotide is represented by lowercase (nucleotide) letters. Double underscoreThe uppercase letters indicate that the Cas9 target site 4 (TS4) nucleotide is... single underscore Uppercase letters are used to indicate that the codon GAG of the wild-type sequence (SEQ ID NO:1) is represented in bold uppercase, and this codon was mutated prematurely in the mutant strain. T The AG) stop codon encodes the C-terminated GEF1 protein (GEF1 protein). Figure 1B ).

[0030] Figure 2 shows the open reading frame (ORF) sequence (SEQ ID NO:3) of the native GEF1 protein encoding SEQ ID NO:2; Figures 2A-2B ).

[0031] Figure 3 shows the native GEF1 protein (SEQ ID NO:2); Figure 3A ) and variant (C-terminally truncated) GEF1 protein (SEQ ID NO:4; Figure 3B The amino acid sequence of SEQ ID NO:2. Furthermore, Figure 3 shows the GEF1 domain of the natural GEF1 protein (SEQ ID NO:2). Figure 3C ;SEQ ID NO:5), BAR structural domain ( Figure 3D ;SEQ ID NO:6) and unknown structural domains ( Figure 3E (SEQ ID NO:7). For example, the natural GEF1 protein (SEQ ID NO:2; Figure 3A The amino acid sequence of ) contains the GEF1 domain predicted by Pfam ( Figure 3A Pale gray amino acid shadow; PF00621) and BAR domain ( Figure 3A (Bold amino acids; PF03114). For example... Figure 3B As shown, the variant GEF1 protein (SEQ ID NO:4) is truncated at the C-terminus, with the truncation occurring near the N-terminus of the GEF1 domain (e.g., residue "VI"). K ”). Detailed Implementation

[0032] As set forth and described herein, this disclosure generally relates to genetically modified filamentous fungal strains (cells) and their use in the production of industrial proteins. More specifically, the strains and methods of this disclosure relate to genetic modifications in filamentous fungi that produce phenotypic variant strains, wherein such variant strains are particularly suitable for growth in submerged cultures (e.g., for large-scale production of proteins for industrial / commercial applications). Thus, as described herein, certain embodiments of this disclosure relate to genetically modified filamentous fungal strains and methods thereof, wherein such modified strains contain protein productivity-enhancing phenotypes, such as improved volumetric efficiency, higher specific productivity, improved carbon source yield, reduced bioreactor (fermenter) operating costs, etc.

[0033] I. Definition

[0034] Before describing the strains and methods of the present invention in detail, the following terms are defined for clarity. Undefined terms shall conform to their conventional meaning as used in the relevant art. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the compositions and methods of the present invention pertain.

[0035] All disclosures and patents referenced in this specification are incorporated herein by reference.

[0036] When a range of values ​​is provided, it should be understood that each intermediate value is one-tenth of the lower limit (unless the context clearly indicates otherwise), and the range between the upper and lower limits, as well as any other stated or intermediate values ​​within that range, are encompassed within the compositions and methods of the invention. The upper and lower limits of these smaller ranges may be independently included within said smaller range and are also encompassed within the compositions and methods of the invention, subject to any specifically excluded limits in the stated range. Where a stated range includes one or both limits, the range excluding any one or both of those included limits is also included in the compositions and methods of the invention.

[0037] This document provides certain ranges in which numerical values ​​are preceded by the term "approximately". The term "approximately" is used in this document to provide textual support for the exact number that follows it, as well as numbers that are close to or approximate to the number following the term. In determining whether a number is close to or approximate to a specifically stated number, an unlisted number that is close to or approximates can be a number that is substantially equivalent to the number given the specific statement in the context in which it is presented. For example, with respect to numerical values, the term "approximately" refers to a numerical value of... - 10% to + A range of 10%, unless the term is specifically defined otherwise in the context. In another instance, the phrase "approximately 6 pH" refers to a pH range of 5.4 to 6.6, unless pH is specifically defined otherwise.

[0038] The headings provided herein are not intended to limit the various aspects or embodiments of the compositions and methods of the invention, which can be derived by referring to the specification as a whole. Therefore, when the specification is referred to as a whole, the terms to be defined below are defined more fully.

[0039] Based on this detailed description, the following abbreviations and definitions apply. It should be noted that the singular forms “a / an” and “the” include a plural number of indicators unless the context clearly indicates otherwise. Thus, for example, reference to “enzyme” includes multiple such enzymes, and reference to “dosage” includes reference to a single or multiple doses known to those skilled in the art and their equivalents, etc.

[0040] It should also be noted that the claims may be drafted to exclude any optional elements. Therefore, this statement is intended as a basis for the use of exclusive terms such as “solely,” “only,” “excluding,” “not including,” etc., or the use of “negative” limitations in relation to the description of the elements of the claims.

[0041] It should also be noted that, as used herein, the term “comprising” means “including, but not limited to” one or more components following the term “comprising”. Components following the term “comprising” are essential or mandatory, but compositions comprising one or more components may also include other non-mandatory or optional components.

[0042] It should also be noted that, as used herein, the term "composed of" means including but not limited to the term "composed of one or more components". Therefore, the one or more components following the term "composed of" are necessary or mandatory, and one or more other components are not present in the composition.

[0043] As will be apparent to those skilled in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features that can be readily separated from or combined with features of any of the other several embodiments without departing from the scope or spirit of the inventive compositions and methods described herein. Any method of narration may be performed in the order of the events described or in any other logically feasible order.

[0044] The filamentous fungal cells used in the operations, constructions, and uses described herein are typically derived from the phylum Pezizomycotina, particularly fungi in a vegetative hyphal state. These organisms include filamentous fungal cells used to produce commercially important industrial and pharmaceutical proteins, including but not limited to species of the genera *Trichoderma*, *Aspergillus*, *Fusarium*, *Penicillium*, *Chrysosporium*, *Cephalosporium*, *Basilaria*, *Geosmithia*, *Neurospora*, and *Desmodium*.

[0045] For example, in some embodiments, filamentous fungal cells and their strains include, but are not limited to, *Trichoderma longibrachiatum* (previously classified as *Trichoderma longibrachiatum* and *Trichoderma rubiginosa*), *Aspergillus niger*, *Aspergillus fumigatus*, *Aspergillus itaconicus*, *Aspergillus oryzae*, *Aspergillus niger*, *Aspergillus terreus*, *Aspergillus sojae*, *Aspergillus japonicus*, *Neurospora crassa*, *Penicillium funiculosum*, *Penicillium chrysogenum*, *Talaromyces (Geosmithia) emersonii*, *Fusarium venenatum*, and *Myceliophthora*. Thermophila, Chrysosporium lucknowense (C1), etc.

[0046] As used herein, for ease of description, terms and phrases such as “one or more filamentous fungal strains”, “one or more fungal strains”, “one or more filamentous fungal cells”, “one or more filamentous fungal cells”, “one or more fungal cells”, etc., may be used interchangeably and are not intended to limit the scope of this disclosure.

[0047] As used herein, “yeast” and / or “yeast strain” includes, but is not limited to, species of the genus *Saccharomyces* (e.g., *Saccharomyces cerevisiae*, *Saccharomyces pastorianus*, *Saccharomyces carlsbergensis*), species of the genus *Schizosaccharomyces* (e.g., *Schizosaccharomyces pombe*), and species of the genus *Yarrowia* (e.g., *Yarrowia lipolytica*).

[0048] As used herein, the term “gene” is synonymous with the term “allele” and refers to a nucleic acid (polynucleotide) that encodes and directs the expression of a protein or RNA. The vegetative form of filamentous fungi is typically haploid, therefore a single copy of a designated gene (i.e., a single allele) is sufficient to confer a specific phenotype.

[0049] As used herein, phrases such as “parental cell,” “parental fungal cell,” “parental strain,” “parental fungal strain,” “parental strain of filamentous fungal cell,” and “reference strain” are used interchangeably and refer to “unmodified” parental filamentous fungal cells. For example, “parental strain of filamentous fungal cell” refers to any cell or strain of filamentous fungi in which the genome of the “parental” cell is modified (e.g., by introducing genetic modifications into the parental cell) to produce a variant (daughter) strain of filamentous fungal cell, such that the “parental” and “daughter” cells are different.

[0050] As used herein, phrases such as “variant cell,” “daughter cell,” “variant strain,” “daughter strain,” “variant or daughter fungal strain,” “variant or daughter strain of filamentous fungal cells,” etc., are used interchangeably and refer to modified strains of filamentous fungal cells derived from (i.e., obtained from or available from) a parent (or reference) strain of filamentous fungal cells, wherein the variant strain contains genetic modifications not present in the parent strain, and thus, by comparison, phenotypic differences between the “parent” and “variant” strains can be attributed to these genetic modifications. In other words, the parent and variant strains are otherwise homogeneous, except for the introduction of one or more genetic modifications into the variant strain.

[0051] Therefore, parental and variant "strains" can be described as having certain characteristics, such as genetic modifications, expression phenotypes, morphological phenotypes, etc.; however, those skilled in the art will understand that, technically, it is the "cells" of the parental or variant strain that have such characteristics, and the term "strain" is used for convenience.

[0052] As used herein, the terms “wild-type” and “natural” are used interchangeably and refer to naturally found genes, proteins, protein mixtures or strains.

[0053] As used herein, “endogenous filamentous fungal genes” encoding the target protein include, but are not limited to, endogenous genes encoding glycoside hydrolases (GH) family enzymes (e.g., EC No. 3.2.1.1-3.2.1.206), endogenous genes encoding proteases, endogenous genes encoding esterases, endogenous genes encoding lipases, etc., as are known and understood by those skilled in the art.

[0054] As used herein, the phrases “lignocellulose-degrading enzyme,” “cellulase enzyme,” and “cellulase” are used interchangeably and include glycosidic hydrolases (GH) such as cellobiase, xylanase, endoglucanase, and β-glucosidase, which hydrolyze the β-(1,4)-linked glycosidic bonds of cellulose (hemicellulose) to produce glucose.

[0055] In some embodiments, cellobiase includes enzymes classified under Enzyme Committee number (EC 3.2.1.91), endoglucanase includes enzymes classified under EC 3.2.1.4, endo-β-1,4-xylanase includes enzymes classified under EC 3.2.1.8, β-xylosidase includes enzymes classified under EC 3.2.1.37, and β-glucosidase includes enzymes classified under EC 3.2.1.21.

[0056] As used herein, "endoglucanase" protein can be abbreviated as "EG", "cellobiase" protein as "CBH", "β-glucosidase" protein as "BG", and "xylanase" protein as "XYL". Therefore, as used herein, the gene (or ORF) encoding the EG protein can be abbreviated as "eg", the gene (or ORF) encoding the CBH protein can be abbreviated as "cbh", the gene (or ORF) encoding the BG protein can be abbreviated as "bg", and the gene (or ORF) encoding the XYL protein can be abbreviated as "xyl".

[0057] In some embodiments, the filamentous fungal cells used for operation, construction, and use as described herein are typically derived from the Discomycetes, particularly fungi in a vegetative hyphal state that contain the GEF1 gene or its homologs.

[0058] As used herein, the “gene or polynucleotide encoding the native GEF1 protein” has sequence homology with SEQ ID NO:1. In some embodiments, the gene or polynucleotide encoding the native GEF1 protein has approximately 70% to 100% sequence identity with SEQ ID NO:1 or SEQ ID NO:3. In some other embodiments, the gene or polynucleotide encoding the native GEF1 protein has approximately 70% to 100% sequence identity with SEQ ID NO:1 or SEQ ID NO:3 and encodes a GEF1 domain having at least 90% sequence identity with SEQ ID NO:5. In some other embodiments, the gene or polynucleotide encoding the native GEF1 protein hybridizes with the nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:3 under moderate to stringent hybridization conditions.

[0059] In some embodiments, the upstream (5′) cellulase gene promoter sequence includes, but is not limited to, the cellobiase (CBH) gene promoter sequence, the endoglucanase (EG) gene promoter sequence, the β-glucosidase (BG) gene promoter sequence, and the xylanase (XYL) gene promoter sequence.

[0060] As used herein, the “read frame (ORF) nucleic acid sequence encoding the native Trichoderma species GEF1 protein” is sequence homologous to the ORF nucleic acid sequence of SEQ ID NO:3. In some other embodiments, the ORF nucleic acid sequence encodes the native Trichoderma species GEF1 protein having approximately 70% to 100% sequence identity with SEQ ID NO:2. In other embodiments, the ORF nucleic acid sequence encodes the native Trichoderma species GEF1 protein having approximately 70% to 100% sequence identity with SEQ ID NO:2 and includes a GEF1 domain having at least 90% sequence identity with SEQ ID NO:5. In some other embodiments, the ORF encoding the native GEF1 protein hybridizes with the nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:3 under moderate to stringent hybridization conditions.

[0061] As used herein, the amino acid residues in a given amino acid sequence are numbered using the amino acid residue numbers (positions) of the GEF1 protein from the native Trichoderma species SEQ ID NO:2. For example, Figure 3A The amino acid sequence (SEQ ID NO:2) of the native Trichoderma species GEF1 protein is presented. Therefore, phrases such as "containing a glutamic acid (E; Glu) residue at sequence position 1,244 corresponding to SEQ ID NO:2" or "containing a GEF1 domain at sequence positions 1,242-1,454 corresponding to SEQ ID NO:2" are used as reference (parental) protein sequences for the native (Trichoderma species) GEF1 protein. For example, as... Figure 3A As shown, the given amino acid sequence described herein can be aligned with the amino acid sequence (SEQ ID NO:2) of the natural Trichoderma species GEF1 protein using the alignment algorithm described herein (and / or alignment algorithms known to those skilled in the art). The amino acid residues in the given amino acid sequence that are aligned with the amino acid residues in the natural sequence (preferably the best alignment) can be conveniently numbered by referring to the corresponding amino acid residues in the GEF1 sequence.

[0062] Similarly, to establish sequence homology or identity with the primary (1°) sequence of the GEF1 protein (SEQ ID NO:2) of a Trichoderma species, those skilled in the art can readily compare the primary sequence of SEQ ID NO:2 with one or more candidate GEF1 protein homolog / ortholog sequences using sequence alignment algorithms, software, and methods known to them. Therefore, after aligning conserved residues, allowing necessary insertions and deletions to maintain alignment (i.e., avoiding the elimination of conserved residues through arbitrary deletions and insertions), residues equivalent to specific amino acids in the primary sequence of the candidate filamentous fungal GEF1 protein are defined. The alignment of conserved residues should preferably retain 100% of such residues. However, alignments of greater than 98%, 95%, 90%, 85%, 80%, 75%, 70%, 50%, or at least 45% of conserved residues are also sufficient to define equivalent residues.

[0063] As used in this paper, a Trichoderma strain named "T4" was continuously propagated under selective conditions to identify and isolate a mutant strain capable of high-temperature protein production without adversely affecting specific productivity (Qp).

[0064] As used in this paper, a mutant Trichoderma strain named “T4-E1” (i.e., derived from the parental 'T4' strain) was identified and isolated at selective temperatures, in which the T4-E1 mutant strain had a similar Qp at 28°C to the specific productivity (Qp) of the T4 strain at 25°C.

[0065] As used in this article, the variant Trichoderma strain named “T4-ΔRho#22D” is derived from the T4 parent strain. The variant T4-ΔRho#22D contains a pyr2 marker gene introduced at the Cas9 cleavage site (TS3), thereby disrupting the GEF1 coding sequence.

[0066] As used in this article, the Trichoderma strain named “t-ATV84” contains three copies of the gene encoding the DXST endoglucanase S. coccosporum, and contains the deletion (or disruption) of the native cellulase genes encoding CBHI, CBHII, EGI, and EGII proteins.

[0067] As used in this article, the Trichoderma strain named "t-AWC88" is derived from the t-ATV84 strain and also contains the introduced GEF1 gene disruption.

[0068] As used herein, the Staphylotrichum coccosporum endoglucanase “STCE1” is described in U.S. Patent No. 7,595,182 (which is incorporated herein by reference in its entirety).

[0069] As used herein, “Cyclospora STCE1 endoglucanase” can also be referred to as “Cyclospora DXST endoglucanase”; therefore, the terms STCE1 and DXST are interchangeable. In some embodiments, the polynucleotide sequence encoding the DXST protein is placed under the control of a promoter such as cbhI.

[0070] As used herein, the phrase "elevated fermentation (culture) temperature" refers to a fermentation temperature greater than 25°C. In some embodiments, the elevated fermentation temperature is at least about 25.5°C to about 28°C. In some embodiments, the elevated fermentation temperature is at least about 25.1°C to 25.9°C.

[0071] As used herein, the terms “peptide” and “protein” (and / or their respective plural forms) are used interchangeably to refer to polymers of any length containing amino acid residues linked by peptide bonds. Conventional one-letter or three-letter codes for amino acid residues are used herein. Polymers may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acid components. These terms also include naturally modified or intervened amino acid polymers; for example, by disulfide bond formation, glycosylation, esterification, acetylation, phosphorylation, or any other operation or modification, such as conjugation with a labeled component. This definition also includes, for example, peptides containing one or more amino acid analogs (including, for example, non-natural amino acids) and other modifications known in the art.

[0072] As used herein, the term "derived polypeptide / protein" refers to a protein derived or potentially derived by: adding one or both of one or more N-terminal and C-terminal amino acids; substituting one or more amino acids at one or more different sites in the amino acid sequence; deleting one or more amino acids at one or both ends of the protein or at one or more sites in the amino acid sequence; and / or inserting one or more amino acids at one or more sites in the amino acid sequence. The preparation of protein derivatives can be achieved by modifying the DNA sequence encoding the native protein, converting that DNA sequence into a suitable host, and expressing the modified DNA sequence to form the derived protein.

[0073] Related (and derived) proteins include “variant proteins.” Variant proteins differ from reference / parental proteins (e.g., wild-type proteins) through substitutions, deletions, and / or insertions at a small number of amino acid residues. The number of different amino acid residues between the variant and the parent protein can be one or more, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, or more amino acid residues. Variant proteins may share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or more, amino acid sequence identity with the reference protein. Variant proteins may also differ from the reference protein in selected motifs, domains, epitopes, conserved regions, etc.

[0074] As used herein, the term "similar sequence" refers to a sequence within a protein that provides similar function, tertiary structure, and / or conserved residues to a target protein (i.e., typically the original target protein). For example, in epitope regions containing α-helical or β-sheet structures, substituted amino acids in a similar sequence preferably maintain the same specific structure. The term also refers to nucleotide sequences as well as amino acid sequences. In some embodiments, similar sequences are developed such that amino acid substitutions produce variant enzymes exhibiting similar or improved functions. In some embodiments, the tertiary structure and / or conserved residues of amino acids in the target protein are located at or near the target segment or fragment. Therefore, when the target segment or fragment contains, for example, α-helical or β-sheet structures, substituted amino acids preferably maintain said specific structure.

[0075] As used herein, the term "homological protein" refers to a protein that has similar activity and / or structure to a reference protein. This is not intended to imply that homologs are necessarily evolutionarily related. Rather, it is intended to indicate that the term covers one or more proteins that are identical, similar, or corresponding (i.e., in terms of structure and function) from different organisms. In some embodiments, it is desirable to identify homologs that have similar quaternary, tertiary, and / or primary structures to a reference protein.

[0076] The degree of homology between sequences can be determined using any suitable method known in the art (see, for example, Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; programs in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI), such as GAP, BESTFIT, FASTA, and TFASTA; and Devereux et al., 1984).

[0077] For example, PILEUP is a useful procedure for determining the level of sequence homology. PILEUP creates multiple sequence alignments from a set of related sequences using progressive, pairwise alignments. It can also draw a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle (1987). This method is similar to that described by Higgins and Sharp (1989). Useful PILEUP parameters include a default gap weight of 3.00, a default gap length weight of 0.10, and a weighted terminal gap. Another example of a useful algorithm is the BLAST algorithm described by Altschul et al., 1990 and Karlin et al., 1993. A particularly useful BLAST procedure is the WU-BLAST-2 procedure (see, for example, Altschul et al., 1996). The parameters “W”, “T”, and “X” determine the sensitivity and speed of the alignment. The BLAST procedure uses word length (W) 11, BLOSUM 62 score matrix (see, for example, Henikoff and Henikoff, 1989), alignment (B) 50, expected value (E) 10, M′ 5, N′ - 4, and comparison of two chains as default values.

[0078] As used herein, in the case of at least two nucleic acids or polypeptides, the phrases “substantially similar” and “substantially identical” typically mean that the polynucleotide or polypeptide contains a sequence with at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or even at least about 99%, or higher, identity compared to a reference (i.e., wild-type) sequence. Sequence identity can be determined using standard parameters using known procedures such as BLAST, ALIGN, and CLUSTAL. (See, for example, Altschul et al., 1990; Henikoff et al., 1989; Karlin et al., 1993; and Higgins et al., 1988). Software used to perform BLAST analysis is publicly available from the National Center for Biotechnology Information (NCBI). Additionally, the FASTA database can be searched (Pearson et al., 1988). One indication that two peptides are essentially identical is that the first and second peptides are immunoreactive. Typically, peptides differing only in conserved amino acid substitutions are immunoreactive. Therefore, the peptides are essentially identical, for example, where the two peptides differ only in conserved substitutions. Another indication that two nucleic acid sequences are essentially identical is that the two molecules hybridize to each other under stringent conditions (e.g., in the range of moderate to high stringency).

[0079] As used in this article, “nucleic acid” refers to a sequence of nucleotides or polynucleotides and their fragments or portions, as well as DNA, cDNA, and RNA, which are genomes or origins of synthesis and may be double-stranded or single-stranded, whether representing sense or antisense strands.

[0080] As used herein, the term "expression" refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from the nucleic acid molecules of this disclosure. Expression can also refer to the translation of mRNA into a polypeptide. Therefore, the term "expression" includes any steps involved in polypeptide production, including but not limited to transcription, post-transcriptional modification, translation, post-translational modification, secretion, etc.

[0081] As used herein, the combined term “expression / production”, as in phrases such as “a variant strain of filamentous fungal cells expresses / produces an ‘increased’ amount of the target protein (POI)” (i.e., relative to the parent cell), is intended to include any steps involved in expressing and producing the protein in such variant filamentous fungal strains of this disclosure.

[0082] In some embodiments, a gene, polynucleotide, or nucleic acid sequence encoding a naturally occurring GEF1 protein with “sequence homology” refers to a DNA or RNA (nucleic acid) sequence that has minor sequence variations from the corresponding nucleic acid sequence and retains substantially the same biological function as the corresponding nucleic acid sequence. For example, in some embodiments, a nucleic acid sequence having substantial sequence homology to the gene, polynucleotide, or nucleic acid encoding a naturally occurring GEF1 protein is assessed by identifying the encoded gene product (natural GEF1 protein) as described herein.

[0083] In some other embodiments, nucleic acid hybridization methods are used to identify / distinguish gene, polynucleotide, or nucleic acid sequences that have sequence homology with the gene, polynucleotide, or nucleic acid encoding the native GEF1 protein. For example, in some embodiments, DNA / RNA sequences that have substantial sequence homology with the gene encoding the native GEF1 protein (e.g., SEQ ID NO:2) are identified by their ability to hybridize with specified nucleic acid sequences of this disclosure under stringent conditions.

[0084] As used herein, “hybridization under stringent conditions” is intended to describe conditions for hybridization and washing under which nucleotide sequences that are significantly identical or homologous to each other remain hybridized. Such stringent conditions are well known to those skilled in the art (see, for example, Ausubel et al., 1995; Sambrook et al., 1989). For example, in some embodiments, non-limiting examples of stringent hybridization conditions include hybridization in 4× sodium chloride / sodium citrate (SSC) at about 65°C–70°C (or hybridization in 4×SSC plus 50% formamide at about 42°C–50°C), followed by washing once or more with 1×SSC at about 65°C–70°C. Similarly, non-limiting examples of highly stringent hybridization conditions include hybridization in 1×SSC at about 65°C–70°C (or hybridization in 4×SSC plus 50% formamide at about 42°C–50°C), followed by washing once or more with 0.3×SSC at about 65°C–70°C. Therefore, highly stringent hybridization conditions include hybridization in 4×SSC at approximately 50°C–60°C (or alternatively, hybridization in 6×SSC with 50% formamide at approximately 40°C–45°C), followed by washing once or more with 2×SSC at approximately 50°C–60°C. This disclosure is also intended to cover ranges between the above values, such as at 65°C–70°C or 42°C–50°C. In some embodiments, SSPE (1×SSPE of 0.15M NaCl, 10mM NaH2PO4, and 1.25mM EDTA, pH 7.4) can be used instead of SSC (1×SSPE of 0.15M NaCl and 15mM sodium citrate) in the hybridization and washing buffer; after hybridization, each wash is performed for 15 minutes. The hybridization temperature for hybrids less than 50 base pairs in length is expected to be 5°C–10°C lower than the melting temperature (Tm) of the hybrid, where Tm is determined according to the following equation. For hybrids shorter than 18 base pairs, Tm(°C) = 2(number of A+T bases) + 4(number of G+C bases). For hybrids between 18 and 49 base pairs, Tm(°C) = 81.5 + 16.6(log10[Na+]) + 0.41(%G+C) - (600 / N), where N is the number of bases in the hybrid and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+] = 0.165M for 1×SSC). Those skilled in the art will also recognize that other reagents can be added to the hybridization and / or washing buffers to reduce non-specific hybridization of nucleic acid molecules with membranes such as nitrocellulose or nylon membranes. These other reagents include, but are not limited to, blocking agents (e.g., BSA or salmon or herring sperm carrier DNA), detergents (e.g., SDS), chelating agents (e.g., EDTA), Ficoll, PVP, etc.In particular, another non-limiting example of stringent hybridization conditions when using nylon membranes is hybridization at about 65°C in 0.25–0.5 M NaH₂PO₄, 7% SDS, followed by washing once or more at 65°C in 0.02 M NaH₂PO₄, 1% SDS, or alternatively in 0.2 × SSC, 1% SDS (see, for example, Church and Gilbert, 1984).

[0085] Therefore, as generally described above, certain embodiments of this disclosure relate to variant strains of filamentous fungal cells containing genetic modifications to genes encoding the native GEF1 protein. As used herein, the terms “modification” and “genetic modification” are used interchangeably and include, but are not limited to: (a) the introduction, substitution, or removal of one or more nucleotides in a gene, or the introduction, substitution, or removal of one or more nucleotides in a regulatory element required for gene transcription or translation; (b) gene disruption; (c) gene transformation; (d) gene deletion; (e) downregulation of genes (e.g., antisense RNA, siRNA, miRNA, etc.); (f) specific mutagenesis (including, but not limited to, CRISPR / Cas9-based mutagenesis) and / or (g) random mutagenesis of any one or more genes disclosed herein.

[0086] As used herein, genetically modified filamentous fungal variants include, but are not limited to, genetic modifications of the gene encoding the naturally occurring GEF1 protein disclosed herein. Therefore, as described in further detail below, various molecular biological methods are well known to those skilled in the art and can be used to generate / construct such variants of filamentous fungal cells.

[0087] As used in this article, “the introduction, substitution or removal of one or more nucleotides in a gene that encodes a protein” is a genetic modification that includes gene coding sequences (i.e., exons) and non-coding intercalation (intron) sequences.

[0088] As used herein, “gene disruption,” “gene inactivation,” and “gene destruction” are used interchangeably and broadly refer to any genetic modification that substantially disrupts / inactivates a target gene. Exemplary methods of gene disruption include, but are not limited to, the complete or partial deletion or mutagenesis of any part of a gene (including a polypeptide coding sequence (CDS), promoter, enhancer, or other regulatory element), wherein mutagenesis encompasses substitution, insertion, deletion, inversion, and any combination and variation thereof, which disrupts / inactivates one or more target genes and substantially reduces or prevents the expression / production of a functional gene product. In some embodiments of this disclosure, such gene disruption prevents host cells from expressing / producing a product encoding a LOC gene.

[0089] In some embodiments, established gene editing techniques, such as CRISPR / Cas9 gene editing, zinc finger nuclease (ZFN) gene editing, transcription activator-like effector nuclease editing (TALEN), and homing (large) nuclease editing, are used to genetically modify genes, polynucleotide, or nucleic acid sequences encoding the natural GEF1 protein.

[0090] In other embodiments, variant strains of filamentous fungi are constructed (i.e., genetically modified) by gene conversion methods (e.g., see Iglesias and Trautner, 1983).

[0091] In other embodiments, the target protein (e.g., endogenous POI or heterologous POI) expressed / produced by the fungal cells of this disclosure is detected, identified, measured, and determined by the following methods: protein quantification methods, gene transcription methods, mRNA translation methods, etc., including but not limited to protein migration / mobility rate (SDS-PAGE), mass spectrometry, HPLC, size exclusion, ultracentrifugation sedimentation rate analysis, transcriptomics, proteomics, fluorescent tags, epitope tags, fluorescent protein (GFP, RFP, etc.) chimeras / hybrids, etc.

[0092] As used herein, functionally and / or structurally similar proteins are considered “related proteins.” Such related proteins can be derived from organisms of different genera and / or species, or even different classes (e.g., bacteria and fungi). Related proteins also encompass homologs and / or orthologs identified by primary sequence analysis, secondary or tertiary structure analysis, or immune cross-reactivity.

[0093] As used herein, the term "promoter" refers to a nucleic acid sequence that controls the expression of a coding sequence or functional RNA. Typically, the coding sequence is located 3' (downstream) of the promoter sequence. Promoters can be entirely derived from natural genes, or consist of different elements derived from different promoters found in nature, or even contain synthetic nucleic acid segments. Those skilled in the art will understand that different promoters can direct gene expression in different cell types, at different developmental stages, or in response to different environmental or physiological conditions. Promoters that induce gene expression in most cell types are generally referred to as "constitutive promoters." It is also recognized that DNA fragments of different lengths can possess the same promoter activity because the exact boundaries of the regulatory sequence cannot be fully determined in most cases.

[0094] As used herein, the term "operably linked" refers to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one nucleic acid fragment is influenced by the other. For example, a promoter is operably linked to a coding sequence (e.g., an ORF) when expression of that coding sequence is possible (i.e., the coding sequence is transcribed under the control of a promoter). A coding sequence can be operably linked to a regulatory sequence in either the sense or antisense direction. A nucleic acid is "operably linked" to another nucleic acid sequence when it is placed in a functional relationship with that sequence. For example, if DNA encoding a secretory precursor (i.e., a signal peptide) is expressed as a preprotein involved in polypeptide secretion, then the DNA encoding the secretory precursor is operably linked to the DNA of the polypeptide; if a promoter or enhancer affects the transcription of a coding sequence, then that promoter or enhancer is operably linked to that sequence; or if a ribosome binding site is localized to facilitate translation, then that ribosome binding site is operably linked to the coding sequence. Generally, "operably linked" means that the linked DNA sequences are contiguous, and in the case of a secretory precursor, contiguous and in the reading phase. However, enhancers do not have to be continuous. Ligation is achieved by connecting at a convenient restriction site. If such a site is not available, synthetic oligonucleotide adaptors or linkers are used as per conventional practice.

[0095] As defined herein, a “suitable regulatory sequence” is a nucleotide sequence located upstream (5′ non-coding sequence), inside, or downstream (3′ non-coding sequence) of a coding sequence that affects the transcription, RNA processing, or stability or translation of the relevant coding sequence. Regulatory sequences may include promoters, translation leader sequences, RNA processing sites, effector binding sites, and stem-loop structures.

[0096] As defined herein, the term "introduction" as used in phrases such as "introducing into fungal cells" at least one polynucleotide open reading frame (ORF) or its gene or vector includes methods known in the art for introducing polynucleotides into cells, including but not limited to protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection, etc.

[0097] As used herein, “transformed” or “transformation” refers to cells transformed using recombinant DNA technology. Transformation typically occurs by inserting one or more nucleotide sequences (e.g., polynucleotides, ORFs, or genes) into a cell. The inserted nucleotide sequence can be a heterologous nucleotide sequence (i.e., a sequence that is not naturally present in the cell to be transformed).

[0098] As used herein, “transformation” refers to the introduction of exogenous DNA into a host cell, such that the DNA remains an integrative chromosome or a self-replicating extrachromosomal vector. As used herein, “transformed DNA,” “transformed sequence,” and “DNA construct” refer to DNA used to introduce the sequence into a host cell. The DNA can be generated in vitro by PCR or any other suitable technique. In some embodiments, the transforming DNA comprises an input sequence, while in other embodiments it also comprises an input sequence flanking a homology cassette. In yet another embodiment, the transforming DNA comprises other non-homologous sequences added to the ends (i.e., filler sequences or flanking sequences). The ends may be closed, thus causing the transforming DNA to form a closed loop, such as, inserted into a vector.

[0099] As used herein, “input sequence” refers to a DNA sequence introduced into the chromosome of a fungal cell. In some embodiments, the input sequence is part of a DNA construct. In other embodiments, the input sequence encodes one or more target proteins. In some embodiments, the input sequence comprises a sequence that may or may not be present in the genome of the cell to be transformed (i.e., it may be a homologous or heterologous sequence). In some embodiments, the input sequence encodes one or more target proteins, genes, and / or mutated or modified genes. In alternative embodiments, the input sequence encodes a functional wild-type gene or operon, a functional mutant gene or operon, or a non-functional gene or operon. In some embodiments, the input sequence is a non-functional sequence inserted into a gene to disrupt gene function. In another embodiment, the input sequence includes a selection marker. In yet another embodiment, the input sequence includes two homology boxes.

[0100] As used herein, a "homology cassette" refers to a nucleic acid sequence homologous to a sequence in a fungal cell chromosome. More specifically, according to the invention, a homology cassette is an upstream or downstream region having approximately 80% to 100%, approximately 90% to 100%, or approximately 95% to 100% sequence identity with a directly flanking coding region of a gene or part of a gene that has been deleted, disrupted, inactivated, downregulated, etc. These sequences guide the integration site of the DNA construct in the fungal cell chromosome and guide which part of the fungal cell chromosome is replaced by the input sequence. Although not intended to limit the disclosure, a homology cassette may comprise from about 1 base pair (bp) to 200 kilobases (kb). Preferably, a homology cassette comprises between about 1 bp and 10.0 kb; between 1 bp and 5.0 kb; between 1 bp and 2.5 kb; between 1 bp and 1.0 kb; and between 0.25 kb and 2.5 kb. The homology cassette may also include approximately 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb, and 0.1 kb. In some embodiments, selectively labeled 5' and 3' ends are flanked by the homology cassette, wherein the homology cassette contains a nucleic acid sequence located closely flanking the coding region of a gene.

[0101] As used herein, the term "nucleotide sequence encoding a selectively labeled nucleotide sequence" refers to a nucleotide sequence that can be expressed in a host cell and wherein selectively labeled expression confers the ability of a cell containing the expressed gene to grow in the absence of a corresponding selective reagent or in the absence of essential nutrients.

[0102] As used herein, the terms "selective marker" and "selective marker" refer to nucleic acids (e.g., genes) that can be expressed in host cells, allowing for easy selection of those hosts containing the vector. Examples of such selective markers include, but are not limited to, antimicrobial agents. Thus, the term "selective marker" refers to a gene that provides an indication that a host cell has taken up imported target DNA or that some other response has occurred. Typically, a selective marker is a gene that confers antimicrobial resistance or metabolic advantage to host cells, allowing for differentiation during transformation of cells containing foreign DNA from cells that have not received any foreign sequence.

[0103] As defined in this article, the host cell “genome,” the fungal cell “genome,” or the filamentous fungal cell “genome” includes chromosomal genes and extrachromosomal genes.

[0104] As used herein, the terms “plasmid,” “vector,” and “box” refer to extrachromosomal elements that typically carry genes that are not part of the cell’s central metabolism and are usually in the form of circular double-stranded DNA molecules. Such elements can be linear or circular autonomously replicating sequences, genome-integrated sequences, bacteriophages, or nucleotide sequences derived from any source of single-stranded or double-stranded DNA or RNA, many of which have been linked or recombined into a single structure capable of introducing a promoter fragment and DNA sequence targeting a selected gene product, along with an appropriate 3′ untranslated sequence, into the cell.

[0105] As used herein, the term "vector" refers to any nucleic acid that can replicate (spread) within a cell and carry new genes or DNA fragments (e.g., "input sequences") into the cell. Therefore, the term refers to nucleic acid constructs designed for transfer between different host cells. Vectors include viruses, bacteriophages, proviruses, plasmids, phage particles, transposons, and artificial chromosomes such as YAC (yeast artificial chromosome), BAC (bacterial artificial chromosome), PLAC (plant artificial chromosome), etc., which are "attachments" (i.e., autonomously replicating) or can integrate into the chromosome of a host cell.

[0106] As used in this article, a “transformation cassette” refers to a specific vector that contains a gene (or its ORF) and has elements other than the gene that promotes the transformation of a particular host cell.

[0107] As used herein, "expression vector" refers to a vector capable of incorporating and expressing heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commercially available and are known to those skilled in the art. The selection of an appropriate expression vector is within the knowledge of those skilled in the art.

[0108] As used herein, the terms "expression cassette" and "expression vector" refer to a nucleic acid construct that is recombinantly or synthetically generated and has a specific set of nucleic acid elements (i.e., vectors or vector elements, as described above) that allow a specific nucleic acid to be transcribed in a target cell. Recombinant expression cassettes may be incorporated into plasmids, chromosomes, mitochondrial DNA, plasmid DNA, viruses, or nucleic acid fragments. Typically, the recombinant expression cassette portion of an expression vector includes (among other sequences) the nucleic acid sequence to be transcribed and a promoter. In some embodiments, the DNA construct further includes a specific set of nucleic acid elements that allow a specific nucleic acid to be transcribed in a target cell. In some embodiments, the DNA constructs of this disclosure contain selective markers and inactivated chromosomal or gene or DNA segments as defined herein.

[0109] As used herein, a “targeting vector” is a vector comprising a polynucleotide sequence homologous to a region in the chromosome of a host cell into which the targeting vector is transformed, and the vector is capable of driving homologous recombination at that region. For example, a targeting vector can be used to introduce genetic modifications into the chromosome of a host cell via homologous recombination. In some embodiments, the targeting vector contains other non-homologous sequences, such as additional non-homologous sequences added to the ends (i.e., filler sequences or flanking sequences). The ends may be closed, such that the targeting vector forms a closed loop, as in an insert vector.

[0110] As used herein, variant cells (or strains) containing an "enhanced protein productivity phenotype" include, but are not limited to, variant cells (or strains) containing increased / increased volumetric productivity, variant cells (or strains) containing increased / increased carbon conversion efficiency, variant cells (or strains) containing increased / increased protein yield, and variant cells (or strains) containing increased / increased specific protein productivity. For example, in some embodiments, variant cells or strains containing an enhanced protein productivity phenotype express / produce at least 0.1% or more of total protein (g) per gram of supplied sugar (relative to the parent strain), wherein the supplied sugar can be a mass representation of sugar added to the fermenter during the production phase (i.e., after the start of supply).

[0111] As defined in this article, the phrases “protein productivity enhancement phenotype” and “protein productivity increase phenotype” are used interchangeably.

[0112] As used herein, when describing “increased protein productivity / enhanced phenotype” in unmodified (parental) cells relative to modified (variant / daughter) cells, it should be understood that “parental” and “variant” cells are grown / cultured / fermented under the same conditions (e.g., the same conditions such as culture medium, temperature, pH, etc.). Similarly, when describing “expression / production” of a target protein (POI) in unmodified (parental) cells relative to “expression / production” of the same POI in modified (variant / daughter) cells, it should be understood that “parental” and “variant” cells are grown / cultured / fermented under substantially the same conditions (e.g., the same conditions such as culture medium, temperature, pH, etc.).

[0113] As used in this article, "aerobic fermentation" refers to growth in the presence of oxygen.

[0114] As used herein, the terms “broth,” “cell broth,” “fermented broth,” and / or “culture broth” are used interchangeably and generally refer to (i) fermented (culture) medium and (ii) cells in liquid (deep) culture.

[0115] As used herein, the term "cell cluster" refers to the cellular component (including intact and lysed cells) present in a liquid (deep) culture. Cell clusters can be expressed as stem cell weight (DCW) or wet cell weight (WCW).

[0116] II. Fungal strains exhibiting enhanced protein production phenotypes at elevated culture temperatures.

[0117] As generally described and illustrated in the following examples section, the applicant, under selective conditions, continuously propagated a Trichoderma reesei whole cellulase strain named T4 to identify and isolate its ability to perform high-temperature protein production (i.e., without adversely affecting specific productivity (Q)). p (See, for example, the mutant strain in Example 1). More specifically, a mutant *Trichoderma reesei* strain named “T4-E1” was identified and isolated under such selective conditions (Example 2), wherein the mutant T4-E1 strain exhibited a similar specific productivity at 28°C compared to the parental T4 strain at 25°C (Table 1). The applicant identified the mutant gene in the T4-E1 strain, wherein the inferred amino acid sequence of the encoded protein (SEQ ID NO:2; PID:120482) includes a sequence region homologous to the GEF1 protein domain (SEQ ID NO:5). As detailed in Example 2, the mutation in the T4-E1 strain replaced the glutamate codon (Glu; amino acid position 1,245) with an early stop codon, thereby truncating the (GEF1) protein near the start of the “GEF1 domain” (see, for example, Example 2). Figure 3A Natural sequence and Figure 3B (a sequence with C-terminus truncated).

[0118] As described in Example 3 of this disclosure, the applicant also constructed a variant (modified) Trichoderma strain (named "T4-ΔRho#22D") derived from the T4 parent strain, wherein the T4-ΔRho#22D strain contains a pyr2 marker gene introduced at the Cas9 cleavage site (TS3), thereby disrupting the GEF1 coding sequence. For example, the fermenter (culture) performance of the wild-type (parental) T4 strain, the mutant T4-E1 strain, and the constructed variant T4-ΔRho#22D strain is presented in Table 1, wherein the mutant T4-E1 strain and the constructed variant T4-ΔRho#22D strain exhibited an increased total protein production rate at 28°C relative to the total protein production rate of the parental T4 strain at 25°C.

[0119] As further described in Example 4, the applicant constructed a Trichoderma species production strain transformed with a copy of the gene encoding the DXST (STCE1) endoglucanase of *Trichoderma*. More specifically, the parental *Trichoderma* DXST production strain named "t-ATV84" was transformed with a copy of the gene encoding the DXST endoglucanase of *Trichoderma*, and also included the deletion of the native cellulase genes encoding the proteins CBHI, CBHII, EGI, and EGII. Similarly, the variant (modified) *Trichoderma* DXST production strain named "t-AWC88" was derived from the t-ATV84 strain and also included the disruption of the introduced GEF1 gene. For example, as shown in Table 2, the Trichoderma variant containing the disrupted GEF1 gene (t-AWC88) exhibited higher amounts of DXST endoglucanase at 25°C compared to the amount produced by the parental strain (t-ATV84) containing the natural GEF1 gene at 25°C.

[0120] III. Molecular Biology

[0121] As generally described above, certain embodiments of this disclosure relate to modified filamentous fungal strains comprising a protein-enhancing phenotype. In certain preferred embodiments, the modified (variant) filamentous fungal strains comprise a protein-enhancing phenotype at elevated fermentation (culture) temperatures. In another embodiment, this disclosure relates to modified yeast strains comprising an ethanol-enhancing phenotype. In certain preferred embodiments, the modified (variant) yeast strains comprise an ethanol-enhancing phenotype at elevated fermentation (culture) temperatures.

[0122] Therefore, certain other embodiments of this disclosure relate to molecular biology, genetic modification, polynucleotides, genes, ORFs, vectors, expression cassettes, etc. In some embodiments, this disclosure relates to recombinant nucleic acids (polynucleotides) comprising a gene or ORF encoding a target protein (POI). In some embodiments, the recombinant nucleic acid (polynucleotide) comprises a polynucleotide expression cassette encoding the POI.

[0123] In some embodiments, the polynucleotides of this disclosure comprise one or more selectable markers. Selectable markers for use in filamentous fungi include, but are not limited to, alsl, amdS, hygR, pyr2, pyr4, pyrG, sucA, bleomycin resistance markers, blastomycin resistance markers, pyrithione resistance markers, chlorimuron-methyl resistance markers, neomycin resistance markers, adenine pathway genes, tryptophan pathway genes, thymidine kinase markers, etc. In a particular embodiment, the selectable marker is pyr2, the composition of which and its method of use are generally described in PCT Publication No. WO2011 / 153449.

[0124] The fungal host cells of this disclosure are transformed using standard techniques for transforming filamentous fungi and culturing fungi (these standard techniques are well known to those skilled in the art). Thus, the introduction of DNA constructs or vectors into fungal host cells includes techniques such as transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipid-mediated transfection and DEAE-dextrin-mediated transfection), incubation with calcium phosphate DNA precipitation, high-speed bombardment with DNA-coated microparticles, gene gun or bio-projectile transformation, protoplast fusion, etc. General transformation techniques are known in the art (see, for example, Ausubel et al., 1987; Sambrook et al., 2001 and 2012; and Campbell et al., 1989). Expression of heterologous proteins in *Trichoderma* is described, for example, in U.S. Patent No. 6,022,725; U.S. Patent No. 6,268,328; Harkki et al., 1991; and Harkki et al., 1989. Transformation of *Aspergillus* strains is also referenced to Cao et al., (2000).

[0125] Typically, protoplasts or cells that have undergone permeation treatment are used to transform Trichoderma species, typically at a ratio of 10... 5 Up to 10 7 / mL, especially 2×10 6 The process is carried out at a density of / mL. 100 μL of these protoplasts or cells in a suitable solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) is mixed with the desired DNA. Typically, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride, etc., may also be added to the uptake solution to promote transformation. Similar procedures can be used for other fungal host cells (e.g., see U.S. Patent Nos. 6,022,725 and 6,268,328, both of which are incorporated herein by reference).

[0126] Therefore, the methods and compositions disclosed herein generally rely on conventional techniques in the field of recombinant genetics. For example, in some embodiments, a heterologous gene or ORF encoding a target protein is introduced into a filamentous fungal (host) cell. In some embodiments, the heterologous gene or ORF is typically cloned into an intermediate vector and then transformed into a filamentous fungal (host) cell for replication and / or expression. These intermediate vectors may be prokaryotic vectors, such as plasmids or shuttle vectors. In some embodiments, the expression of the heterologous gene or ORF is under the control of its natural promoter. In other embodiments, the expression of the heterologous gene or ORF is under the control of a heterologous promoter, which may be a heterologous constitutive promoter or a heterologous inducible promoter.

[0127] Those skilled in the art will understand that natural promoters can be modified by replacing, substituting, adding, or eliminating one or more nucleotides without altering the promoter's function. The practice of this invention encompasses, but is not limited to, these modifications to the promoter.

[0128] Expression vectors typically contain a transcription unit or expression cassette that includes all the additional elements required to express a heterologous sequence. For example, a typical expression cassette contains a 5′ promoter operatively linked to a heterologous nucleic acid sequence encoding the target protein, and may also contain sequence signals required for effective polyadenylation of the transcript, ribosome binding sites, and translation termination sequences. Additional elements of the cassette may include enhancers, and if genomic DNA is used as the structural gene, introns with functional splicing donor and acceptor sites may be included.

[0129] In addition to the promoter sequence, the expression cassette may also contain a transcriptional terminator of a structural gene for efficient termination. This terminator may be derived from a gene with the same promoter sequence or from a different gene. While any fungal terminator may function in this invention, preferred terminators include: a terminator from the *Trichoderma* cbhI gene, a terminator from the *Aspergillus nidus* trpC gene (Yelton et al., 1984; Mullaney et al., 1985), and a glucosyl amylase gene from *Aspergillus awamori* or *Aspergillus niger* (Nunberg et al., 1984; Boel et al., 1984).

[0130] The specific expression vector used to deliver genetic information into cells is not particularly critical. Any of the conventional vectors used for expression in eukaryotic or prokaryotic cells can be used. Standard bacterial expression vectors include bacteriophage λ and M13, as well as plasmids such as pBR322-based plasmids, pSKF, pET23D, and fusion expression systems such as MBP, GST, and LacZ. Epitope tags such as c-myc can also be added to recombinant proteins to provide convenient isolation methods.

[0131] Elements that may be included in the expression vector may also be replicons encoding genes that allow selection of antibiotic resistance in bacteria carrying the recombinant plasmid, or unique restriction sites in non-essential regions of the plasmid that allow insertion of heterologous sequences. The specific antibiotic resistance gene selected is not decisive, as any of the many resistance genes known in the art may be suitable. Prokaryotic sequences are preferably selected such that they do not interfere with DNA replication or integration in *Trichoderma reesei*.

[0132] The transformation methods of the present invention can result in the stable integration of all or part of the transformation vector into the genome of a filamentous fungus. However, transformation resulting in extrachromosomal transformation vectors that maintain autonomous replication is also considered. A variety of standard transfection methods can be used to generate *Trichoderma reesei* cell lines expressing large amounts of heterologous proteins; therefore, any known procedure for introducing exogenous nucleotide sequences into fungal host cells can be used. These include transfection using calcium phosphate, polyglobulin, protoplast fusion, electroporation, gene gun methods, liposomes, microinjection, protoplast vectors, viral vectors, and any other known method for introducing cloned genomic DNA, cDNA, synthetic DNA, or other exogenous genetic material into host cells. *Agrobacterium*-mediated transfection methods, such as those described in U.S. Patent No. 6,255,115, are also used.

[0133] After the expression vector is introduced into the cells, the transformed cells are cultured under conditions favorable for gene expression. Large numbers of transformed cells can be cultured as described herein. Finally, the protein product is recovered from the culture using standard techniques. Therefore, this disclosure provides for the expression and enhanced production of desired proteins, particularly at the elevated fermentation (culture) temperatures described herein.

[0134] In some other embodiments, this disclosure relates to genetically modified filamentous fungal strains (cells) that contain a protein-enhancing phenotype. In specific embodiments, the modified fungal strains of this disclosure contain a protein-enhancing phenotype at elevated fermentation temperatures. For example, in some embodiments, variant strains of filamentous fungi contain genetic modifications to the gene encoding the GEF1 protein, wherein such genetic modifications include, but are not limited to: (a) introducing, substituting, or removing one or more nucleotides in the GEF1 gene (or its ORF), or introducing, substituting, or removing one or more nucleotides in regulatory elements required for transcription or translation of the GEF1 gene (or its ORF), (b) gene disruption, (c) gene transformation, (d) gene deletion, (e) gene downregulation, (f) specific mutagenesis, and / or (g) random mutagenesis of the gene encoding the GEF1 protein having sequence identity with SEQ ID NO:2.

[0135] Therefore, in some embodiments, genetically modified filamentous fungal variants are constructed by eliminating the expression / production of the GEF1 protein through gene deletion.

[0136] In other embodiments, genetically modified filamentous fungal variants are constructed by partially deleting or disrupting genes to eliminate the expression / production of the native GEF1 protein. For example, as described in Example 3 (… Figure 3BAs described in [the paper], by introducing a premature stop codon (i.e., a premature stop codon that truncates the GEF1 protein at the C-terminus; SEQ ID NO:4) to inactivate the native GEF1 gene in a parental filamentous fungal strain, a variant (daughter) strain exhibiting an increased protein productivity phenotype relative to the parental cells during fermentation at 25°C was obtained. More specifically, when the parental (T4) and daughter (T4-ΔRho#22D) strains were fermented at an elevated fermentation temperature (28°C), the variant (daughter) strain exhibited an increased protein productivity phenotype relative to the parental strain (Table 1, protein production rate).

[0137] Therefore, in some embodiments, the modified filamentous fungal strain contains a partial deletion of the GEF1 gene, wherein the partial deletion includes a partial deletion of any portion of the GEF1 gene coding sequence, and such variant strains contain a protein-enhancing phenotype. Therefore, in some other embodiments, such variant strains do not express / produce the GEF1 protein, or such variant strains express / produce a reduced amount of the GEF1 protein relative to the parent strain.

[0138] Therefore, as set forth herein and described above in general, those skilled in the art can readily perform one or more genetic modifications and construct variant filamentous fungal strains by referring to one or more nucleic acid sequences and / or protein sequences disclosed herein.

[0139] For example, gene deletion techniques can partially or completely remove a gene, thereby eliminating or reducing the expression / production of a protein, and / or thus eliminating or reducing the expression / production of the encoded protein (e.g., GEF1). In such methods, gene deletion can be accomplished by homologous recombination using an integrative plasmid / vector constructed with consecutive 5′ and 3′ regions flanking the gene. These consecutive 5′ and 3′ regions can be introduced into filamentous fungal cells, for example, on the integrative plasmid / vector in conjunction with a selectable marker, to allow plasmid integration into the cell.

[0140] In other embodiments, variant strains of filamentous fungi contain genetic modifications that disrupt or inactivate the gene encoding the protein (e.g., GEF1). Exemplary methods of gene disruption / inactivation include disrupting any portion of the gene (e.g., see Figures 1-3), including polypeptide-coding sequences (CDS), promoters, enhancers, or other regulatory elements, said disruption including substitution, insertion, deletion, inversion, and combinations thereof and variants thereof. Non-limiting examples of gene disruption techniques include inserting (integrating) an integration plasmid containing nucleic acid fragments homologous to said (e.g., GEF1) gene into one or more genes of this disclosure, which will produce repetitions of homologous regions and incorporate (inserting) vector DNA between the repetitive regions. In some other non-limiting examples, gene disruption techniques involve inserting an integration plasmid containing a nucleic acid fragment homologous to a gene (e.g., a gene encoding the GEF1 protein) into the gene. This produces repetitions of the homologous regions, and vector DNA is incorporated (inserted) between the repetitive regions. The inserted vector DNA distinguishes, for example, the promoter of the GEF1 gene from the coding sequence of the GEF1 protein, or interrupts (disrupts) the coding or non-coding sequence of the GEF1 gene, thereby resulting in an increased protein productivity phenotype. Therefore, the disruptive construct can be a selectable marker gene (e.g., pyr2) with 5′ and 3′ regions homologous to the GEF1 gene. The selectable marker enables the identification of transformants containing the disrupted gene. Thus, in some embodiments, gene disruption includes modifications to gene control elements such as promoters, ribosome binding sites (RBS), untranslated regions (UTRs), codon alterations, etc.

[0141] In other embodiments, variant strains of filamentous fungi are constructed (i.e., genetically modified) by introducing, substituting, or removing one or more nucleotides from a gene or its regulatory elements required for transcription or translation. For example, nucleotides may be inserted or removed to introduce a premature stop codon, remove a start codon, or shift the open reading frame (ORF). Such modifications can be accomplished by site-directed mutagenesis or PCR-induced mutagenesis according to methods known in the art (e.g., see Botstein and Shortle, 1985; Lo et al., 1985; Higuchi et al., 1988; Shimada, 1996; Ho et al., 1989; Horton et al., 1989; and Sarkar and Sommer, 1990).

[0142] In another embodiment, variant strains of filamentous fungi are constructed via gene transformation (e.g., see Iglesias and Trautner, 1983). For example, in gene transformation, a nucleic acid sequence corresponding to a target gene is mutagenized in vitro to produce a defective nucleic acid sequence, which is then transformed into parental cells to produce variant cells containing the defective gene. Through homologous recombination, the defective nucleic acid sequence replaces the endogenous gene. It may be desirable that the defective gene or gene fragment also encodes a marker that can be used to select transformants containing the defective gene. For example, the defective gene can be associated with a selectable marker and introduced onto a non-replicating or temperature-sensitive plasmid. Selection of plasmid integration is achieved by selecting the marker under conditions that disallow plasmid replication. Selection of a second recombination event leading to gene substitution is achieved by examining colony loss of the selectable marker and obtaining the mutant gene (Perego, 1993).

[0143] In other embodiments, variant strains of filamentous fungi are constructed using an antisense (gene silencing) technique, employing a nucleotide sequence complementary to the nucleic acid sequence of the GEF1 gene (Parish and Stoker, 1997). More specifically, gene expression in filamentous fungal strains can be reduced (downregulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of a gene that is transcribed in the cell and capable of hybridizing with mRNA produced in the cell. Under conditions that allow the complementary antisense nucleotide sequence to hybridize with the mRNA, the amount of translated protein is thereby reduced or eliminated. Such antisense methods include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, etc., all of which are well known to those skilled in the art.

[0144] In other embodiments, variant strains of filamentous fungi are constructed by random or specific mutagenesis using methods well known in the art (including, but not limited to, chemical mutagenesis and transposition (see, for example, Youngman et al., 1983)). Gene modification can be performed by mutagenesis of parental cells and screening for mutant cells in which the expression of the GEF1 gene has been reduced or eliminated. Mutagenesis can be specific or random and can be performed, for example, by using suitable physical or chemical mutagens, by using suitable oligonucleotides, or by mutagenesis produced by subjecting the DNA sequence to PCR. Furthermore, mutagenesis can be performed by any combination of these mutagenesis methods. Examples of physical or chemical mutagens suitable for the purposes of this invention include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), o-methylhydroxylamine, nitrous acid, ethyl methanesulfonic acid (EMS), sodium bisulfite, formic acid, and nucleotide analogs. When using these reagents, mutagenesis is typically carried out by incubating the parental cells to be mutated under suitable conditions in the presence of the selected mutagen, and selecting mutant cells that exhibit reduced or no gene expression.

[0145] In some other embodiments, variant strains of filamentous fungi are constructed using site-specific gene editing techniques. For example, in some embodiments, variant strains of filamentous fungi are constructed (i.e., genetically modified) by using transcriptional activators such as TALENs, zinc finger endonucleases (ZFNs), homing (large) endonucleases, etc. More specifically, genetic modifications are made to the portions of the gene to be modified (e.g., coding regions, non-coding regions, leader sequences, propeptide sequences, signal sequences, transcription terminators, transcriptional activators, or other regulatory elements desired for the expression of the coding region) using ZFN gene editing, TALEN gene editing, homing (large) endonucleases, etc., methods well known and usable by those skilled in the art.

[0146] In some other embodiments, variant strains of filamentous fungi are constructed using CRISPR / Cas9 editing (e.g., see examples herein). More specifically, compositions and methods for fungal genome modification using the CRISPR / Cas9 system are described and well known in the art (e.g., see PCT Publications: WO 2016 / 100571, WO 2016 / 100568, WO 2016 / 100272, WO 2016 / 100562, etc.). Thus, the gene encoding the GEF1 protein can be genetically modified by means of a nucleic acid-directed endonuclease that disrupts, deletes, mutates, or otherwise alters the gene by binding to a guide RNA (e.g., Cas9) or guide DNA (e.g., NgAgo) to find its target DNA, which recruits the endonuclease to a target sequence on the DNA, whereby the endonuclease can produce single-strand or double-strand breaks in the DNA. This targeted DNA break becomes a substrate for DNA repair and can be recombinated with a provided editing template to disrupt or delete the gene. For example, a gene encoding a nucleic acid-directed endonuclease (e.g., Cas9 from *S. pyogenes* or a codon-optimized gene encoding the Cas9 nuclease) can be operatively linked to an active promoter and an active terminator in filamentous fungal cells to produce a filamentous fungal Cas9 expression cassette. Similarly, those skilled in the art can readily identify one or more target sites specific to the target gene.

[0147] For example, to construct a DNA construct encoding gRNA targeting a specific site within a target gene, a variable targeting domain (VT) is incorporated into a nucleotide at the target site, which is a 5′ tangent motif (TGG) adjacent to a pre-interstitial (PAM) sequence, fused with DNA encoding the Cas9 endonuclease recognition domain (CER) of Streptococcus pyogenes Cas9. Combining the DNA encoding the VT domain and the DNA encoding the CER domain yields DNA encoding gRNA. Thus, a filamentous fungal expression cassette of gRNA is generated by operatively linking the gRNA-encoding DNA to an active promoter and an active terminator in filamentous fungal cells.

[0148] In some embodiments, DNA breaks induced by nucleases are repaired / replaced with an input sequence. For example, to precisely repair DNA breaks generated by the aforementioned Cas9 expression cassette and gRNA expression cassette, a nucleotide editing template is provided, allowing the cell's DNA repair mechanisms to utilize the editing template. For instance, approximately 500 bp 5′ of the target gene can be fused with approximately 500 bp 3′ of the target gene to generate an editing template, which is used by the filamentous fungal host's mechanisms to repair DNA breaks generated by RGEN (RNA-directed endonuclease).

[0149] Many different methods (e.g., protoplast fusion, electroporation, naturally competent cells, or induced competent cells) can be used to co-deliver the Cas9 expression cassette, gRNA expression cassette, and editing template into filamentous fungal cells. Transformed cells are screened by PCR using forward and reverse primers to amplify the target loci. These primers can amplify wild-type loci or modified loci that have already been edited by RGEN. These fragments are then sequenced using sequencing primers to identify the edited colonies.

[0150] Another way to genetically modify the gene encoding the GEF1 protein disclosed herein is by altering the expression level of the target gene. For example, nuclease-deficient variants of such nucleotide-directed endonucleases (e.g., Cas9D10A, N863A, or Cas9 D10A, H840A) can be used to regulate gene expression levels by enhancing or antagonizing the transcription of the target gene. These Cas9 variants are inactive against all nuclease domains present in the protein sequence but retain RNA-directed DNA-binding activity (i.e., these Cas9 variants cannot cleave either strand of DNA when bound to a homologous target site). Therefore, nuclease-deficient proteins (i.e., Cas9 variants) can be expressed as filamentous fungal expression cassettes when combined with filamentous fungal gRNA expression cassettes, making the Cas9 variant protein target a specific intracellular target sequence. The binding of the Cas9 (variant) protein to a specific gene target site can block the binding or movement of transcription mechanisms on cellular DNA, thereby reducing the amount of gene product produced. Therefore, using this method, any gene disclosed herein can be targeted to a reduced gene expression. Gene silencing can be monitored in cells containing nuclease-deficient Cas9 expression cassettes and one or more gRNA expression cassettes by using methods such as RNAseq.

[0151] V. Target protein

[0152] As briefly stated in the foregoing sections, the strains and methods of the present invention can be used to produce commercially important proteins in deep cultures of filamentous fungi. The target protein (POI) of this disclosure can be any endogenous or heterologous protein, and it can be a variant of such a POI. The protein may contain one or more disulfide bridges, or it may be a protein in a monomeric or polymeric form, i.e., the protein has a quaternary structure and is composed of multiple identical (homologous) or dissimilar (heterologous) subunits, wherein the POI or its variants are preferably POIs with the desired properties.

[0153] In some embodiments, the variant strain of filamentous fungi exhibits an increased protein titer relative to the (unmodified) parental strain, where protein titer is defined as the amount of protein per volume (g / L). The titer can be measured, for example, by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS, etc.). Thus, in some embodiments, the variant strain of filamentous fungi contains at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more of increased protein titer compared to the unmodified (parental) cells.

[0154] In some embodiments, variant strains of filamentous fungi exhibit increased volumetric productivity relative to (unmodified) parental strains, where volumetric productivity is defined as the amount (g) of protein produced per nominal volume (L) of bioreactor per total fermentation time during fermentation. Volumetric productivity can be determined, for example, by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS, etc.). Thus, in some embodiments, variant strains of filamentous fungi contain at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more of increased volumetric productivity compared to unmodified (parental) cells.

[0155] In some other embodiments, variant strains of filamentous fungi exhibit increased total protein yield, where total protein yield is defined as the amount of protein (g) produced per gram of carbohydrate supply relative to the (unmodified) parent strain. Therefore, as used herein, total protein yield (g / g) can be calculated using the following equation:

[0156] Y f =T p / T c

[0157] Among them, “Y” f "T" refers to the total protein yield (g / g). p "T" refers to the total protein (g) produced during fermentation, and "T" refers to the total protein produced during fermentation. c " is the total carbohydrates (g) supplied during fermentation (bioreactor) operation. In some embodiments, the increase in total protein yield of the modified strain (i.e., relative to the parent strain) is at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to unmodified (parental) cells.

[0158] Total protein yield can also be described as carbon conversion efficiency / carbon yield, for example, as a percentage (%) of the supplied carbon incorporated into the total protein. Therefore, in some embodiments, the variant strains of filamentous fungi contain an increased carbon conversion efficiency relative to the (unmodified) parent strain (e.g., an increase in the percentage (%) of supplied carbon incorporated into the total protein). In some embodiments, the increase in carbon conversion efficiency of the modified strain (i.e., relative to the parent strain) is at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parental) cells.

[0159] In some embodiments, variant strains of filamentous fungi exhibit increased specific productivity (Qp) of POI relative to their (unmodified) parental strains. For example, the detection of specific productivity (Qp) is a suitable method for evaluating protein production rates. Specific productivity (Qp) can be determined using the following equation:

[0160] "Qp = gP / gDCW·hr"

[0161] Wherein, “gP” is the number of grams of protein produced in the tank; “gDCW” is the number of grams of stem cell weight (DCW) in the tank; and “hr” is the fermentation time in hours from the inoculation time, including both production and growth time. Therefore, in some embodiments, the variant strain of filamentous fungi contains at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more of a specific productivity (Qp) increase compared to unmodified (parental) cells.

[0162] In some embodiments, the POI or its variants are selected from the group consisting of: acetylesterase, aminopeptidase, amylase, arabinogalactanase, arabinofuranase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, rennet, keratinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endoglucanase, glucosylamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glycosylation Enzymes, hemicellulase, hexose oxidase, hydrolases, invertases, isomerases, laccases, ligases, lipases, lyases, mannanases, mannosidases, oxidases, oxidoreductases, pectin acid lyases, pectin acetylesterases, pectin depolymerases, pectin methylesterases, pectin hydrolysates, perhydrolases, polyol oxidases, peroxidases, phenol oxidases, phytases, polygalacturonases, proteases, peptidases, rhamnose-galacturonases, ribonucleases, transferases, transport proteins, transglutaminases, xylanases, hexose oxidases, and combinations thereof.

[0163] In some embodiments, the POI or a variant thereof is selected from the group consisting of the enzyme committee (EC) numbers, which are selected from EC 1, EC 2, EC 3, EC 4, EC 5 or EC 6.

[0164] For example, in some embodiments, the POI is an oxidoreductase, including but not limited to EC1 (oxidoreductase) enzymes selected from: EC 1.10.3.2 (e.g., laccase), EC 1.10.3.3 (e.g., L-ascorbic acid oxidase), EC 1.1.1.1 (e.g., alcohol dehydrogenase), EC 1.11.1.10 (e.g., chloride peroxidase), EC 1.11.1.17 (e.g., peroxidase), EC 1.1.1.27 (e.g., L-lactate dehydrogenase), EC 1.1.1.47 (e.g., glucose 1-dehydrogenase), EC 1.1.3.X (e.g., glucose oxidase), EC 1.1.3.10 (e.g., pyranose oxidase), EC 1.13.11.X (e.g., dioxygenase), EC 1.13.11.12 (e.g., linoleic acid 13S-lipoxygenase). 13S-lipozygenase), EC 1.1.3.13 (e.g., alcohol oxidase), EC 1.14.14.1 (e.g., monooxygenase), EC 1.14.18.1 (e.g., monophenol monooxigenase), EC 1.15.1.1 (e.g., superoxide dismutase), EC 1.1.5.9 (formerly EC 1.1.99.10, e.g., glucose dehydrogenase), EC 1.1.99.18 (e.g., cellobiose dehydrogenase), EC 1.1.99.29 (e.g., pyranose dehydrogenase), EC 1.2.1.X (e.g., fatty acid reductase), EC 1.2.1.10 (e.g., acetaldehyde dehydrogenase), EC 1.5.3.X (e.g., fructosylamine reductase), EC 1.8.1.X (e.g., disulfide reductase) and EC 1.8.3.2 (e.g., thiol oxidase).

[0165] In some embodiments, the POI is a transferase, including but not limited to EC 2 (transferase) enzymes selected from: EC 2.3.2.13 (e.g., transglutaminase), EC 2.4.1.X (e.g., hexosyltransferase), EC 2.4.1.40 (e.g., alternasucrase), EC 2.4.1.18 (e.g., 1,4α-glucan branching enzyme), EC 2.4.1.19 (e.g., cyclomaltodextrin glucan transferase), EC 2.4.1.2 (e.g., dextrin glucanase), EC 2.4.1.20 (e.g., cellobiose phosphorylase), EC 2.4.1.25 (e.g., 4-α-glucan transferase), EC 2.4.1.333 (e.g., 1,2-β-oligoglucose phosphotransfer ... 2.4.1.4 (e.g., amylose sucrase), EC2.4.1.5 (e.g., glucan sucrase), EC2.4.1.69 (e.g., galactoside 2-α-L-fucosyltransferase), EC2.4.1.9 (e.g., inulosucrase), EC2.7.1.17 (e.g., xylulose kinase), EC2.7.7.89 (formerly EC 3.1.4.15, e.g., [glutamyl synthase]-adenosine-L-tyrosine phosphorylase), EC2.7.9.4 (e.g., α-glucan kinase), and EC2.7.9.5 (e.g., phosphoglucan kinase).

[0166] In other embodiments, POI is a hydrolase, including but not limited to enzymes selected from the following EC 3 (hydrolase) groups: EC 3.1.XX (e.g., esterase), EC 3.1.1.1 (e.g., pectinase), EC 3.1.1.14 (e.g., chlorophyllase), EC 3.1.1.20 (e.g., tannic acidase), EC 3.1.1.23 (e.g., glyceryl acyl hydrolase), EC 3.1.1.26 (e.g., galactosidase), EC 3.1.1.32 (e.g., phospholipase A1), EC 3.1.1.4 (e.g., phospholipase A2), EC 3.1.1.6 (e.g., acetylesterase), EC 3.1.1.72 (e.g., acetylxylan esterase), EC 3.1.1.73 (e.g., ferulic acid esterase), EC 3.1.1.74 (e.g., keratinase), EC EC 3.1.1.86 (e.g., rhamnogalacturonate acetylesterase), EC 3.1.1.87 (e.g., fumonisin B1 esterase), EC 3.1.26.5 (e.g., ribonuclease P), EC 3.1.3.X (e.g., phosphomonyl ester hydrolase), EC 3.1.30.1 (e.g., Aspergillus nuclease S1), EC 3.1.30.2 (e.g., Serratia marcescens nuclease), EC 3.1.3.1 (e.g., alkaline phosphatase), EC 3.1.3.2 (e.g., acid phosphatase), EC 3.1.3.8 (e.g., 3-phytase), EC 3.1.4.1 (e.g., phosphodiesterase I), EC 3.1.4.11 (e.g., phosphatidylinositol phospholipase C), EC 3.1.4.3 (e.g., phospholipase C), EC 3.1.4.4 (e.g., phospholipase D), EC 3.1.6.1 (e.g., arylsulfatase), EC 3.1.8.2 (e.g., diisopropyl-fluorophosphatase), EC 3.2.1.10 (e.g., oligo-1,6-glucosidase), EC 3.2.1.101 (e.g., mannan endono-1,6-α-mannosidase), EC 3.2.1.11 (e.g., α-1,6-glucan-6-glucan hydrolase), EC 3.2.1.131 (e.g., xylan α-1,2-glucuronosidase), EC 3.2.1.132 (e.g., chitosan N-acetylglucosamine hydrolase), EC 3.2.1.139 (e.g., α-glucuronidase), EC 3.2.1.14 (e.g., chitinase), EC 3.2.1.151 (e.g., xylogan-specific endo-β-1,4-glucanase), EC 3.2.1.155 (e.g., xylogan-specific exo-β-1,4-glucanase), EC 3.2.1.EC 164 (e.g., galactan endopeptidase-1,6-β-galactosidase), EC 3.2.1.17 (e.g., lysozyme), EC 3.2.1.171 (e.g., rhamnogalacturonomannan hydrolase), EC 3.2.1.174 (e.g., rhamnogalacturonomannan rhamnosyl hydrolase), EC 3.2.1.2 (e.g., β-amylase), EC 3.2.1.20 (e.g., α-glucosidase), EC 3.2.1.22 (e.g., α-galactosidase), EC 3.2.1.25 (e.g., β-mannosidase), EC 3.2.1.26 (e.g., β-fructofuranosidase), EC 3.2.1.37 (e.g., xylan 1,4-β-xylosidase), EC EC 3.2.1.39 (e.g., endoglucanase-1,3-β-D-glucosidase), EC 3.2.1.40 (e.g., α-L-rhamnosidase), EC 3.2.1.51 (e.g., α-L-fucosidase), EC 3.2.1.52 (e.g., β-N-acetylglucosaminease), EC 3.2.1.55 (e.g., α-N-arabinofuranylase), EC 3.2.1.58 (e.g., dextran-1,3-β-glucosidase), EC 3.2.1.59 (e.g., endoglucanase-1,3-α-glucosidase), EC 3.2.1.67 (e.g., galactan-1,4-α-galacturonase), EC 3.2.1.68 (e.g., isoamylase), EC 3.2.1.7 (e.g., 1-β-D-fructan sugar hydrolase), EC 3.2.1.74 (e.g., dextran 1,4-β-glucosidase), EC 3.2.1.75 (e.g., dextran endoglucan-1,6-β-glucosidase), EC 3.2.1.77 (e.g., mannan 1,2-(1,3)-α-mannosidase), EC 3.2.1.80 (e.g., fructan β-fructosidase), EC 3.2.1.82 (e.g., exoglucan-poly-α-galacturonidase), EC 3.2.1.83 (e.g., κ-carrageenanase), EC 3.2.1.89 (e.g., arabinogalactan endopeptidase-1,4-β-galactosidase), EC 3.2.1.91 (e.g., cellulose 1,4-β-cellobiosidase), EC 3.2.1.96 (e.g., mannosyl-glycoprotein endopeptidase-β-N-acetylglucosidase), EC 3.2.1.99 (e.g., arabinogalactan endopeptidase-1,5-α-L-arabinosidase), EC 3.4.XX (e.g., peptidases), EC 3.4.11.X (e.g., aminopeptidases), EC 3.4.11.1 (e.g., leucine aminopeptidases), EC 3.4.11.18 (e.g., methionine aminopeptidases), EC 3.4.13.9 (e.g., Xaa-Pro dipeptidase), EC 3.4.14.5 (e.g., dipeptidyl peptidase IV), EC 3.4.16.X (e.g., serine carboxypeptidase), EC 3.4.16.5 (e.g., carboxypeptidase C), EC 3.4.19.3 (e.g., pyroglutamyl peptidase I), EC 3.4.21.X (e.g., serine endopeptidase), EC 3.4.21.1 (e.g., chymotrypsin), EC 3.4.21.19 (e.g., gamma-glutamyl endopeptidase), EC 3.4.21.26 (e.g., prolyl oligopeptidase), EC 3.4.21.4 (e.g., trypsin), EC 3.4.21.5 (e.g., thrombin), EC 3.4.21.63 (e.g., aspergillus honey), EC 3.4.21.65 (e.g., thermomycin), EC 3.4.21.80 (e.g., streptomycin A), EC EC 3.4.22.X (e.g., cysteine ​​endopeptidase), EC 3.4.22.14 (e.g., actin), EC 3.4.22.2 (e.g., papain), EC 3.4.22.3 (e.g., fig protease), EC 3.4.22.32 (e.g., stem bromelain), EC 3.4.22.33 (e.g., fruit bromelain), EC 3.4.22.6 (e.g., papain), EC 3.4.23.1 (e.g., pepsin A), EC 3.4.23.2 (e.g., pepsin B), EC 3.4.23.22 (e.g., *Phytophthora chinensis* pepsin), EC 3.4.23.23 (e.g., *Mucor* pepsin), EC 3.4.23.3 (e.g., pepsin), EC 3.4.24.X (e.g., metalloendopeptidase), EC EC 3.4.24.39 (e.g., deuterolysin), EC 3.4.24.40 (e.g., Serratia marcescens enzyme), EC 3.5.1.1 (e.g., asparaginase), EC 3.5.1.11 (e.g., penicillin amidase), EC 3.5.1.14 (e.g., N-acyl-aliphatic-L-amino acid amidase), EC 3.5.1.2 (e.g., L-glutamine amidase), EC 3.5.1.28 (e.g., N-acetylmurayl-L-alanine amidase), EC 3.5.1.4 (e.g., amidase), EC 3.5.1.44 (e.g., proteo-L-glutamine amidase), EC 3.5.1.5 (e.g., urease), EC EC 3.5.1.52 (e.g., peptide-N(4)-(N-acetyl-β-glucosamine)asparaginase), EC 3.5.1.81 (e.g., N-acyl-D-amino acid deacylase), EC 3.5.4.6 (e.g., AMP deaminase), and EC 3.5.5.1 (e.g., nitrile hydrolase).

[0167] In other embodiments, the POI is a lyase, including but not limited to EC 4 (lyase) enzymes selected from: EC 4.1.2.10 (e.g., mandelinnisone lyase), EC 4.1.3.3 (e.g., N-acetylneuraminic acid lyase), EC 4.2.1.1 (e.g., carbonic acid dehydratase), EC 4.2.2.10 (e.g., rhamnogalacturonopolysaccharide lyase), EC 4.2.2.22 (e.g., pectin lyase), EC 4.2.2.23 (e.g., rhamnogalacturonopolysaccharide endoglucan lyase), and EC 4.2.2.3 (e.g., mannuron-specific alginate lyase).

[0168] In some other embodiments, the POI is an isomerase, including but not limited to EC 5 (isomerase) enzymes selected from the following: EC 5.1.3.3 (e.g., aldose 1-epimerase), EC 5.1.3.30 (e.g., D-allulose 3-epimerase), EC 5.4.99.11 (e.g., isomaltulose synthase) and EC 5.4.99.15 (e.g., (1→4)-α-D-glucan 1-α-D-glucosyltransmutase).

[0169] In yet another embodiment, POI is a ligase, including but not limited to EC 6 (ligase) enzymes selected from: EC 6.2.1.12 (e.g., 4-coumaric acid:coenzyme A ligase) and EC 6.3.2.28 (e.g., L-amino acid α-ligase).

[0170] These and other aspects of the strains and methods of the present invention, as well as the embodiments, will be apparent to those skilled in the art from this specification and the following examples.

[0171] VII. Fermentation

[0172] In some embodiments, this disclosure provides methods for producing a target protein, which include fermenting filamentous fungal cells that secrete the target protein. In other embodiments, this disclosure provides methods for producing an increased amount of ethanol in a yeast strain. Typically, fungal cells are fermented using fermentation methods well known in the art. In some embodiments, the fungal cells are grown under batch or continuous fermentation conditions. Classical batch fermentation is a closed system in which the composition of the culture medium is set at the start of fermentation and remains unchanged during fermentation. At the start of fermentation, the culture medium is inoculated with one or more desired organisms. In this method, fermentation occurs without adding any components to the system. Typically, batch fermentation meets the criteria of “batch” with respect to the addition of a carbon source and often involves experimentation with control factors such as pH and oxygen concentration. The metabolite and biomass composition of a batch system changes continuously until fermentation stops. In batch culture, cells progress through a static stasis phase to a high logarithmic growth phase, and finally to a stationary phase where the growth rate decreases or stops. Cells in the stationary phase eventually die if left untreated. Typically, cells in the logarithmic phase are responsible for the mass production of the product.

[0173] A suitable variant of the standard batch system is the fed-batch fermentation system. In this variant of the typical batch system, the substrate is added incrementally as fermentation progresses. Fed-batch systems are useful when catabolite repression might inhibit cellular metabolism and when a limited amount of substrate is desired in the culture medium. Measuring the actual substrate concentration in a fed-batch system is difficult and is therefore estimated based on changes in measurable factors such as pH, dissolved oxygen, and the partial pressure of exhaust gases (e.g., CO2). Batch and fed-batch fermentation are commonly used and well-known in the art.

[0174] Continuous fermentation is an open system in which a defined fermentation medium is continuously added to a bioreactor while an equal volume of conditioned medium is removed for further processing. Continuous fermentation typically maintains the culture at a constant high density, with cells primarily in the logarithmic growth phase. Continuous fermentation allows for the regulation of one or more factors affecting cell growth and / or product concentration. For example, in one embodiment, a limiting nutrient (such as a carbon or nitrogen source) is maintained at a fixed rate, and all other parameters are allowed to be modulated. In other systems, many factors affecting growth can change continuously while cell concentration, as measured by the turbidity of the medium, remains constant. Continuous systems strive to maintain steady-state growth conditions. Therefore, cell loss due to medium transfer should be balanced against the cell growth rate during fermentation. Methods for regulating nutrients and growth factors used in continuous fermentation processes, as well as techniques for maximizing product formation rates, are well known in the field of industrial microbiology.

[0175] Some embodiments of this disclosure relate to fermentation procedures for culturing fungi. Fermentation procedures for producing cellulase are known in the art. For example, cellulase can be produced by solid-state culture or submerged culture (including batch, fed-batch, and continuous processes). Cultivation is typically carried out in a growth medium containing an aqueous mineral salt medium, organic growth factors, carbon and energy sources, molecular oxygen, and, of course, the starting inoculum of the filamentous fungal host to be used.

[0176] In addition to carbon and energy sources, oxygen, assimilable nitrogen, and microbial inoculum, it is also necessary to supply appropriate amounts of mineral nutrients in the right proportions to ensure proper microbial growth, maximize the assimilation of carbon and energy sources by cells during microbial transformation, and obtain the maximum cell yield and maximum cell density in the fermentation medium.

[0177] The composition of aqueous mineral culture media can vary widely, depending in part on the microorganisms and substrates used, as is known in the art. In addition to nitrogen, the mineral culture medium should also include suitable amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium in suitable soluble and assimilable ionic and compound forms, and preferably should also contain certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, all as known in the art, also in suitable soluble and assimilable forms.

[0178] The fermentation reaction is an aerobic process in which the required molecular oxygen is supplied by a molecular oxygen-containing gas such as air, oxygen-enriched air, or even essentially pure molecular oxygen, as long as the contents of the fermentation vessel are maintained at a suitable oxygen partial pressure that can effectively help the microbial species grow vigorously.

[0179] Microorganisms also require assimilable nitrogen sources. These sources can be any nitrogen-containing compound or nitrogen that releases nitrogen in a form suitable for microbial metabolism. While various organic nitrogen sources, such as protein hydrolysates, can be used, inexpensive nitrogen-containing compounds such as ammonia, ammonium hydroxide, urea, and various ammonium salts (such as ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride, or various other ammonia compounds) are commonly available. Ammonia itself is convenient for large-scale operations and can be used in appropriate quantities by bubbling through the aqueous fermentation medium. It can also be used to aid in pH control.

[0180] The pH range of the aqueous microbial ferment (fermentation mixture) should be within the exemplary range of about 2.0 to 8.0. In the case of filamentous fungi, the pH is typically in the range of about 2.5 to 8.0; in the case of Trichoderma reesei, the pH is typically in the range of about 3.0 to 7.0. The preferred pH range of the microorganisms depends to some extent on the culture medium used and the specific microorganisms, and thus varies slightly with changes in the culture medium, as can be readily determined by those skilled in the art.

[0181] Preferably, fermentation is carried out in a manner that allows carbon-containing substrates to be controlled as a limiting factor, thereby providing cells with good conversion of carbon-containing substrates and preventing these cells from being contaminated by a basic amount of unconverted substrates. The latter is not a problem for water-soluble substrates, as any remaining trace amounts can be easily washed away. However, this can be problematic with insoluble substrates and requires additional product processing steps such as suitable washing steps.

[0182] As mentioned above, the time required to reach this level is not critical and can vary depending on the specific microorganism and the fermentation process being performed. However, it is well known in the art how to determine the carbon source concentration in the fermentation medium and whether the desired carbon source level has been reached.

[0183] Fermentation can be carried out in batches or continuously. For ease of control, to produce a uniform amount of product, and to use all equipment most economically, batch feeding is preferred.

[0184] If necessary, some or all of the carbon source and energy material and / or a portion of the assimilable nitrogen source (such as ammonia) may be added to the aqueous mineral medium before feeding it into the fermenter.

[0185] Preferably, each feed stream introduced into the reactor is controlled at a predetermined rate, or in response to needs determined by monitoring factors such as the concentration of carbon and energy substrates, pH, dissolved oxygen, oxygen or carbon dioxide in the exhaust gas from the fermenter, cell density measurable by stem cell weight, light transmittance, etc. The feed rates of various materials can be varied to achieve the fastest possible cell growth rate consistent with the efficient utilization of carbon and energy sources, thereby obtaining the highest possible microbial cell yield relative to substrate variations.

[0186] In batch or preferred fed-batch operations, all equipment, reactors or fermentation units, vessels or containers, piping, and associated circulation or cooling equipment are initially sterilized, typically by steam, such as at approximately 121°C for at least 15 minutes. Then, in the presence of all necessary nutrients, including oxygen and carbonaceous substrate, the sterilized reactor is inoculated with a culture of the selected microorganism. The type of fermenter used is not critical.

[0187] Protein collection and purification from fermented broth can also be performed using procedures known in the art. Fermented broth will typically contain cell debris, including cells, various suspended solids and other biomass contaminants (which are preferably removed from the fermented broth by means known in the art), and desired cellulase products.

[0188] Suitable methods for this removal include conventional solid-liquid separation techniques, such as centrifugation, filtration, dialysis, microfiltration, rotary vacuum filtration, or other known methods, to produce a cell-free filtrate. Techniques such as ultrafiltration, evaporation, or precipitation can preferably be used to further concentrate the fermented broth or cell-free filtrate prior to crystallization.

[0189] The protein components of the precipitate supernatant or filtrate can be obtained by means of a salt (e.g., ammonium sulfate) and then purified by various chromatographic procedures (e.g., ion exchange chromatography, affinity chromatography, or similar procedures recognized in the art).

[0190] VIII. Exemplary Embodiments

[0191] Non-limiting embodiments of this disclosure include, but are not limited to:

[0192] 1. A filamentous fungal variant (or modified) strain derived from a parental filamentous fungal strain containing a gene encoding a natural GEF1 protein, wherein the variant strain contains a genetic modification that disrupts or omits the gene encoding the natural GEF1 protein, wherein, when cultured under the same conditions, the variant strain contains a protein productivity-enhancing phenotype relative to the parental strain.

[0193] 2. The variant strain as described in Example 1, wherein the protein productivity enhancement phenotype is selected from the group consisting of: increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity.

[0194] 3. The variant strain as described in Example 1, wherein the filamentous fungus is Pezizomycotina.

[0195] 4. The variant strain as described in Example 1, wherein the filamentous fungi are selected from the group consisting of: Trichoderma species, Aspergillus species, Fusarium species, Penicillium species, Candida species, Chrysosporium species, Cephalosporium species, Talaromyces species, Neurospora species, and Myceliophthora species, etc.

[0196] 5. The variant strain as described in Example 1, when fermented under the same conditions at 25°C with the parent strain, exhibits a protein productivity phenotype relative to the parent strain.

[0197] 6. The variant strain as described in Example 1, when fermented under the same conditions at 26°C with the parent strain, exhibits a protein productivity phenotype relative to the parent strain.

[0198] 7. The variant strain as described in Example 1, when fermented under the same conditions at 27°C with the parent strain, exhibits a protein productivity phenotype relative to the parent strain.

[0199] 8. The variant strain as described in Example 1, when fermented under the same conditions at 28°C with the parent strain, exhibits a protein productivity phenotype relative to the parent strain.

[0200] 9. The variant strain as described in Example 1, wherein the variant strain contains a gene encoding an endogenous target protein (POI).

[0201] 10. The variant strain as described in Example 9, wherein the endogenous POI is a lignocellulose-degrading enzyme.

[0202] 11. The variant strain as described in Example 1, wherein the variant strain comprises an expression construct encoding a heterologous target protein (POI).

[0203] 12. The variant strain as described in Example 11, wherein the heterologous POI is selected from enzymes, antibodies or fragments thereof, receptor proteins and peptides.

[0204] 13. The variant strain as described in Example 12, wherein the heterologous POI is an enzyme selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases.

[0205] 14. The variant strain as described in Example 12, wherein the heterologous POI is an enzyme selected from the group consisting of: acetylesterase, aminopeptidase, amylase, arabinogalactanase, arabinofuranase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, rennet, keratinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endoglucanase, glucosylamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucose Aldolatilase, glycosyl hydrolase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, laccase, ligase, lipase, lyase, mannanase, mannosidase, oxidase, oxidoreductase, pectin acid lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin hydrolysate, perhydrolase, polyol oxidase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, peptidase, rhamnose-galacturonase, ribonuclease, transferase, transport protein, transglutaminase, xylanase, and hexose oxidase.

[0206] 15. A target protein, said target protein being produced by a variant strain as described in Example 1.

[0207] 16. The variant strain as described in Example 1, wherein the encoded GEF1 protein has at least 70% sequence identity with SEQ ID NO:2.

[0208] 17. The variant strain as described in Example 1, wherein the encoded GEF1 protein has at least 90% sequence identity with the GEF1 domain of SEQ ID NO:5.

[0209] 18. The variant strain as described in Example 1, wherein the gene encoding the GEF1 protein has at least 70% sequence identity with the GEF1 polynucleotide sequence of SEQ ID NO:1.

[0210] 19. The variant strain as described in Example 1, wherein the gene encoding the GEF1 protein has at least 70% sequence identity with the open frame (ORF) sequence of SEQ ID NO:3.

[0211] 20. The variant strain as described in Example 1, wherein the gene encoding the GEF1 protein is hybridized with the GEF1 gene of SEQ ID NO:1 or the GEF1 ORF of SEQ ID NO:3 under moderate to stringent hybridization conditions.

[0212] 21. The variant strain as described in Example 1, wherein the genetic modification truncates at least the first 20 amino acid residues of the N-terminus of GEF1 or at least the last 20 amino acid residues of the C-terminus of GEF1.

[0213] 22. The variant strain as described in Example 1, wherein the genetic modification truncates at least the first 200 amino acid residues of the N-terminus of GEF1, or truncates at least the last 200 amino acid residues of the C-terminus of GEF1.

[0214] 23. The variant strain as described in Example 1, wherein the genetic modification truncates at least the first 500 amino acid residues of the N-terminus of GEF1 or at least the last 500 amino acid residues of the C-terminus of GEF1.

[0215] 24. The variant strain as described in Example 1, wherein the genetic modification truncates at least 700 to 750 amino acid residues at the C-terminus of the GEF1.

[0216] 25. The variant strain as described in Example 1, wherein the gene encoding the GEF1 protein is deleted.

[0217] 26. A method for producing an increased amount of an endogenous target protein (POI) in a modified filamentous fungal strain, the method comprising (a) genetically modifying the filamentous fungal strain by disrupting or deleting the natural GEF1 gene, and (b) fermenting the modified strain under conditions suitable for producing the POI, wherein when cultured at 25°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0218] 27. The method as described in Example 26, wherein the filamentous fungus is a phylum Discomycetes.

[0219] 28. The method as described in Example 26, wherein the filamentous fungi are selected from the group consisting of: Trichoderma species strains, Aspergillus species strains, Fusarium species strains, Penicillium species strains, Candida species strains, Aureosyl species strains, Cephalosporium species strains, Basilaria species strains, Neurospora species strains, and Trichoderma species strains, etc.

[0220] 29. The method as described in Example 26, wherein when cultured at 26°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0221] 30. The method as described in Example 26, wherein when cultured at 27°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0222] 31. The method as described in Example 26, wherein when cultured at 28°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0223] 32. The method as described in Example 26, wherein the endogenous POI is a lignocellulose-degrading enzyme.

[0224] 33. The method as described in Example 26, wherein the modified strain further comprises an expression construct encoding a heterologous POI.

[0225] 34. The method as described in Example 26, wherein the encoded GEF1 protein has at least 70% sequence identity with SEQ ID NO:2.

[0226] 35. The method as described in Example 26, wherein the encoded GEF1 protein has at least 90% sequence identity with the GEF1 domain of SEQ ID NO:5.

[0227] 36. The method as described in Example 26, wherein the gene encoding the GEF1 protein has at least 70% sequence identity with the GEF1 polynucleotide sequence of SEQ ID NO:1.

[0228] 37. The method as described in Example 26, wherein the gene encoding the GEF1 protein has at least 70% sequence identity with the open frame (ORF) sequence of SEQ ID NO:3.

[0229] 38. The method as described in Example 26, wherein the gene encoding the GEF1 protein is hybridized with the GEF1 gene of SEQ ID NO:1 or the GEF1 ORF of SEQ ID NO:3 under moderate to stringent hybridization conditions.

[0230] 39. The method as described in Example 26, wherein the genetic modification truncates at least the first 20 amino acid residues of the GEF1 N-terminus or at least the last 20 amino acid residues of the GEF1 C-terminus.

[0231] 40. The method as described in Example 26, wherein the genetic modification truncates at least the first 200 amino acid residues of the N-terminus of GEF1, or truncates at least the last 200 amino acid residues of the C-terminus of GEF1.

[0232] 41. The method as described in Example 26, wherein the genetic modification truncates at least the first 500 amino acid residues of the GEF1 N-terminus or at least the last 500 amino acid residues of the GEF1 C-terminus.

[0233] 42. The method as described in Example 26, wherein the genetic modification truncates at least 700 to 750 amino acid residues at the C-terminus of the GEF1.

[0234] 43. The method as described in Example 26, wherein the gene encoding the GEF1 protein is deleted.

[0235] 44. A method for producing an increased amount of a heterologous target protein (POI) in a modified filamentous fungal strain, the method comprising (a) genetically modifying the filamentous fungal strain by disrupting or deleting the natural GEF1 gene and by introducing an expression cassette encoding the heterologous POI, and (b) fermenting the modified strain under conditions suitable for producing the heterologous POI, wherein when cultured at 25°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0236] 45. The method as described in Example 44, wherein the filamentous fungus is a phylum Discomycetes.

[0237] 46. ​​The method as described in Example 44, wherein the filamentous fungi are selected from the group consisting of: Trichoderma species strains, Aspergillus species strains, Fusarium species strains, Penicillium species strains, Candida species strains, Aureosyl species strains, Cephalosporium species strains, Basilaria species strains, Neurospora species strains, and Trichoderma species strains, etc.

[0238] 47. The method as described in Example 44, wherein when cultured at 26°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0239] 48. The method as described in Example 44, wherein when cultured at 27°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0240] 49. The method as described in Example 44, wherein when cultured at 28°C under the same conditions, the modified strain produces an increased amount of the POI relative to the parent strain.

[0241] 50. The method as described in Example 44, wherein the heterologous POI is selected from enzymes, antibodies or fragments thereof, receptor proteins and peptides.

[0242] 51. The method as described in Example 44, wherein the heterologous POI is an enzyme selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases.

[0243] 52. The method as described in Example 44, wherein the heterologous POI is an enzyme selected from the group consisting of: acetylesterase, aminopeptidase, amylase, arabinogalactanase, arabinofuranase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, rennet, keratinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endoglucanase, glucosylamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase. Acidase, glycosyl hydrolase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, laccase, ligase, lipase, lyase, mannanase, mannosidase, oxidase, oxidoreductase, pectin acid lyase, pectin acetylesterase, pectin depolymerase, pectin methylesterase, pectin hydrolysate, perhydrolase, polyol oxidase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, peptidase, rhamnose-galacturonase, ribonuclease, transferase, transport protein, transglutaminase, xylanase, and hexose oxidase.

[0244] 53. A target protein, said target protein being produced by the method described in Example 26 or Example 44.

[0245] 54. A method for producing an increased amount of ethanol in a yeast fermentation process, the method comprising (a) genetically modifying a yeast strain by deleting or disrupting the natural GEF1 gene, and (b) fermenting the modified strain under conditions suitable for ethanol production, wherein, when cultured under the same conditions, the modified strain produces an increased amount of ethanol at EOF relative to the amount of ethanol produced by the parent strain at the end of fermentation (EOF).

[0246] 55. A variant yeast strain derived from a parent strain containing a gene encoding a GEF1 protein homolog, wherein the variant strain contains a genetic modification that deletes or disrupts the gene encoding the GEF1 protein homolog, wherein, when cultured under the same conditions, the variant strain exhibits an increased ethanol production phenotype relative to the parent strain.

[0247] Example

[0248] Certain aspects of this disclosure can be further understood from the following examples, which should not be construed as limiting. Modifications to the materials and methods will be apparent to those skilled in the art.

[0249] Example 1

[0250] Identification of mutant Trichoderma strains exhibiting an enhanced protein production phenotype at elevated culture temperatures.

[0251] Trichoderma reesei holocellulase (T4) strains were continuously propagated under selective conditions to isolate mutants capable of high-temperature protein production without adversely affecting specific productivity. A mutant Trichoderma reesei strain named “T4-E1” was identified and isolated, exhibiting a similar specific productivity (Qp) at 28°C compared to the parental T4 strain at 25°C. For example, the T4 parental strain was spore-producing on BIRD agar, and 1 × 10⁻⁶ spores were collected from the agar plate. 7 1 spore / mL, suspended in water, and treated at room temperature with 0.15 mg / mL 1-methyl-3-nitro-1-nitrosoguanidine (Sigma 112, 994-1) for two (2) hours until only 1% of the spores remained viable. The spores were inoculated into evolutionary medium containing 0.5% microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethyl cellulose (CMC; Sigma-Aldrich C5678, St. Louis, Michigan) or acid-swollen cellulose (e.g., for preparation, see Wood, 1988) as the sole carbon source. In addition, the medium contained ammonium sulfate (4 g), sodium dihydrogen phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g), and 2.5 mL of 400X trace element solution per liter.

[0252] More specifically, in the first method, approximately one (1) million chemically mutated spores are inoculated into a 250 (250) ml concave-bottom flask containing the aforementioned evolutionary medium, which has As the sole carbon source, the flasks were incubated at 180 rpm and 31°C for five (5) days. At this point, 10% volume / volume was transferred to a second flask of the same type and incubated in the same manner. Subcultures were repeated eleven (11) times consecutively as follows: P1 = five (5) days, P2 = five (5) days, P3 = four (4) days, P4 = four (4) days, P5 = four (4) days, P6 = four (4) days, P7 = four (4) days, P8 = four (4) days, P9 = three (3) days, P10 = three (3) days, and P11 = two (2) days. The P11 broth from the P11 shaker was centrifuged at 4,000 rpm for ten (10) minutes. The supernatant was discarded, and the cells were resuspended in water and spread on BIRD medium.

[0253] Total protein BCA (product number 23228, Thermo Scientific, Rockford, IL) per colony-forming unit was evaluated after incubation for four (4) days in slow-release lactose microtiter plates (srMTP; e.g., see PCT Publication No. WO 2014 / 047520) at 31°C, 200 rpm, and 80% humidity. Thus, high-temperature protein production by a mutant strain that produced an equivalent amount of total protein at 31°C relative to the parent strain at 25°C was further evaluated in a fermenter.

[0254] In the second method, mutant spores of the parental strain of *Trichoderma reesei* T4 were encapsulated in droplets of an aqueous and oil emulsion using the method described in Bachmann et al. (2013). The droplets contained evolutionary media with 0.5% microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethyl cellulose (Sigma-Aldrich C5678, St. Louis, Michigan, MO), or acid-swellable cellulose (Wood, 1988) as the sole carbon source. Additionally, the media contained ammonium sulfate (4 g), sodium dihydrogen phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g), and 2.5 ml of 400X trace element solution per liter. The droplets were incubated in tubes at 31°C for three (3) days, during which time the emulsion was disrupted using the method described in Bachmann et al. (2013). Cells were recovered, spores were generated on agar plates, encapsulated, and incubated at 31°C for three (3) days. This process was repeated 10 times. After final transfer, cells were suspended in water and plated on BIRD medium. Total BCA protein per colony-forming unit (product number 23228, Thermo Scientific, Rockford, IL) was evaluated after four (4) days of incubation at 31°C, 200 rpm, and 80% humidity in srMTP lactose plates (PCT Publication No. WO 2014 / 047520). High-temperature protein production of mutant strains at 31°C was further evaluated in fermenters, yielding the same amount of total protein as the parent strain at 25°C. Therefore, as generally stated above and presented below, the mutant Trichoderma reesei strain named "T4-E1" was identified as a high-temperature mutant capable of optimal protein production at 28°C, compared to the optimal protein production of the parental T4 strain at 25°C.

[0255] Example 2

[0256] Characteristics of mutant Trichoderma strains containing the mutated GEF1 gene

[0257] The mutated gene in the *Trichoderma* variant (mutant) strain described in Example 1 above is located at scaffold position 3:1532639-1538781 in the wild-type *Trichoderma reesei* QM6a v2.0 genome sequence assembly, information available at the Joint Genome Institute (JGI) website (genome.jgi.doe.gov). For example, the deduced amino acid sequence (PID: 120482, SEQ ID NO: 2) includes a sequence region homologous to the Rho / Rac / Cdc42-like guanine nucleotide exchange factor domain (GEF1 domain; PfamPF00621, also known as Dbl homology or DH domain) (e.g., SEQ ID NO: 4). This homologous region is located at amino acid residues 1,242-1,454 in the deduced amino acid sequence (i.e., PID: 120482; SEQ ID NO: 2). Rho family GTPases regulate many different cellular processes, among which these GTPases are activated by releasing bound GDP and subsequently binding GTP, a binding catalyzed by guanine exchange factors from the GEF1 family. A mutation in the variant T4-E1 strain replaced the glutamate codon (Glu(E); amino acid position 1,245) with an early stop codon, thereby truncating the protein near the start of the GEF1 domain (e.g., see...). Figures 3A-3C ).

[0258] Similarly, the deduced amino acid sequence (PID: 120482; SEQ ID NO: 2) also shows homology at residues 1,576-1,677 of SEQ ID NO: 2 with the BAR or AH / BAR domain (e.g., SEQ ID NO: 5; Pfam PF03114). The AH / BAR domain is present in a range of proteins. In some cases, this domain has been shown to interact with membranes, dimerize, or bind to Arf and Rho family GTPases, including ARF1, a small GTPase involved in vesicle budding of the Golgi complex. The AH / BAR domain was not observed in four other (4) Trichoderma reesei GEF1 domain proteins (SEQ ID NO: 5).

[0259] Unlike some other GEF1 domain proteins, the Plekstrin homologous domain (PH domain, Pfam PF00169) was not found in SEQ ID NO:2 (PID: 120482). The PH domain can bind to phosphatidylinositol and heterotrimeric G proteins or the β / γ subunits of protein kinase C in the membrane, thus being associated with signal transduction pathways. Four other deduced protein sequences containing GEF1 domains were found in the Trichoderma reesei QM6a genome, two of which also contain the PH domain.

[0260] Furthermore, the deduced amino acid sequence (PID: 120482; SEQ ID NO: 2) includes a highly conserved C-terminal sequence (e.g., SEQ ID NO: 6) at residues 1,918-1,990 of SEQ ID NO: 2, which is found in several other filamentous fungi, including *Fusarium fujikuroi*, *Fusarium graminearum*, *Thielavia terrestris*, *Podospora anserina*, *Penicillium rubens*, and *Aspergillus niger*. However, this C-terminal domain (SEQ ID NO: 6) is not found in the other four (4) GEF1 domain proteins identified in the *Trichoderma reesei* genome.

[0261] Example 3

[0262] The GEF1 gene in Trichoderma strains was inactivated by inserting the pyr2 gene.

[0263] The GEF1 gene (JGI Trichoderma reesei v2.0 scaffold 3:1532639-1538781) encoding the GEF1 protein of SEQ ID NO:2 (PID: 120482) was inactivated in Trichoderma reesei strains using a Cas9-based method. More specifically, purified Cas9 protein and modified EZtracrRNA were purchased from Synthego (Redwood City, CA), and the modified crRNA was synthesized by Synthego with the following sequence (TS3; SEQ ID NO:7) at its 5′ end, which is specific to the target site (TS3) within the Trichoderma reesei GEF1 gene.

[0264] TS3:CAUUCAUCCAAGAAUCCGAG(SEQ ID NO:7)

[0265] The Cas9 target site (TS) in the GEF1 gene, identified by the aforementioned RNA sequence (SEQ ID NO:7), is located at nucleotides 3,659-3,678 in the coding sequence. This Cas9 target site is close to the mutation at nucleotide 3,733 observed in the T4-E1 mutant strain (Example 2). Following the manufacturer's instructions, tracrRNA and crRNA were annealed to form guide RNA (gRNA), which was then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Before use, Cas9:RNP was mixed with Lipofectamine CRISPR-MAX, purchased from Thermo Fisher Scientific, Inc. (Waltham, MA).

[0266] A linear DNA fragment containing the *Trichoderma reesei* pyr2 gene was amplified by PCR using primers AL950 (SEQ ID NO:8) and AL952 (SEQ ID NO:9). This *Trichoderma reesei* pyr2 gene possesses a natural promoter and terminator sequence, and is flanked by a 492 bp *Trichoderma reesei* repeat sequence (SEQ ID NO:18). The PCR product was purified using a Qiagen QIAquick PCR purification kit.

[0267] AL950:CCTAACTAACGTCTGACATCG(SEQ ID NO:8)

[0268] AL952:CGTACCATTTGACTGATACGATG(SEQ ID NO:9)

[0269] Transformation of *Trichoderma reesei* parental strains with pyr2 PCR product plus Cas9:RNP was performed. Urate auxotrophs in the transformants were selected. Transformants with desired pyr2 insertion into the GEF1 gene were screened by PCR using forward and reverse primer pairs RhoF1 (SEQ ID NO:10) and RhoR1 (SEQ ID NO:11), which amplified GEF1 Cas9.

[0270] RhoF1: GAGCTAGACACGGGCGAAG (SEQ ID NO:10)

[0271] RhoR1:AGGAACCCTTCGTGAGCAAG(SEQ ID NO:11)

[0272] Insertion of pyr2 increased the size of the PCR product from 755 bp to approximately 2.8 kb. The DNA sequence of the 2.8 kb PCR product from the transformant named “ΔRho#22D” was determined by Sanger sequencing using RhoF1 and RhoR1 primers, thus verifying the insertion of pyr2 at the Cas9 cleavage site and the disruption of the GEF1 coding sequence.

[0273] As presented in Table 1, the fermenter performance of the ΔRho#22D transformant was compared with that of the parental T4 strain and the mutant strain named T4-E1 described in Example 1. For example, the final specific productivity (Qp) rates of the T4, T4-E1, and T4-ΔRho#22D strains at 28°C are shown in Table 1 as a percentage (%) relative to the final Qp rate of the control strain T4 at 25°C.

[0274] Table 1 shows the final Qp rate (g / gDCW / hr) as a percentage of the control (T4 25℃).

[0275]

[0276] Example 4

[0277] The GEF1 gene in Trichoderma strains containing heterologous cellulase expression constructs is inactivated through partial deletion.

[0278] As described in this example, the Trichoderma strain named “T4-DXST” is derived from / constructed from the parental Trichoderma reesei strain T4, in which the natural cellulase genes encoding CBHI, CBHII, EGI, and EGII proteins are inactivated by deletion or disruption (i.e., using conventional molecular biology techniques known to those skilled in the art), and transformed with a copy of the gene encoding cyclosporine endoglucanase 1 (STCE1) under the control of a highly efficient cbhI promoter.

[0279] Methods for transforming *Trichoderma reesei* with exogenously added plasmid DNA have been disclosed (Penttila et al., 1986; Gruber et al., 1990; Smith et al., 1991). Stable transformants are generated by integrating the plasmid DNA into the host chromosome. Integration can occur at sites homologous to regions of the plasmid DNA in the genome or at non-homologous sites.

[0280] The gene encoding GEF1 in a parental *Trichoderma reesei* strain containing the introduced STCE1 cellulase construct was inactivated using a Cas9-based method (see, for example, U.S. Patent No. 7,595,182). More specifically, purified Cas9-2NLS protein and modified EZtracrRNA were purchased from Synthego (Redwood City, CA). The modified crRNA was synthesized by Synthego, having the following RNA sequences at its 5′ end that are specific for target sites 3 and 4 (TS3 / TS4) within the *Trichoderma reesei* GEF1 gene.

[0281] TS3:CAUUCAUCCAAGAAUCCGAG(SEQ ID NO:7)

[0282] TS4:AUUGUGGAGGAAAUCUACAA(SEQ ID NO:12)

[0283] The Cas9 target sites (TS3 / TS4) in the GEF1 gene, identified by the aforementioned RNA sequence, are located at nucleotides 3,659-3,678 and 3,775-3794 in the coding sequence. These Cas9 target sites are close to the mutation at nucleotide 3,733 observed in the T4-E1 mutant strain. Following the manufacturer's instructions, tracrRNA and crRNA are annealed to form guide RNA (gRNA), which is then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Before use, Cas9:RNP is mixed with Lipofectamine CRISPR-MAX, purchased from Thermo Fisher Scientific, Inc. (Waltham, MA).

[0284] A linear DNA fragment containing a bacterial hygromycin phosphotransferase gene (SEQ ID NO:13) operatively linked to the *Neurospora crassa* cpc1 promoter (SEQ ID NO:14) and the *Aspergillus nidulans* trpC terminator (SEQ ID NO:15) was amplified by PCR using primers HygF1 (SEQ ID NO:16) and HygR1 (SEQ ID NO:17).

[0285] HygF1: TGGCTTTCCGTCTCCATTG (SEQ ID NO:16)

[0286] HygR1:AGTGTACCTGTGCATTCTGGG (SEQ ID NO:17)

[0287] Protoplasts of the parental *Trichoderma reesei* strain were transformed with a linear DNA fragment and a mixture of two Cas9:RNPs (containing two crRNAs). Hygromycin-resistant transformants were selected on appropriate agar media. However, only smaller and slower-growing transformed colonies were picked from selective agar plates and transferred to agar plates with non-selective media. After growth on the non-selective media, transformants were picked and spotted onto media containing hygromycin. Transformants that did not grow in the presence of hygromycin were selected for further investigation. It was assumed that these transformants briefly exhibited hygromycin resistance and subsequently lost the hygromycin resistance DNA marker fragment not integrated into the *Trichoderma reesei* genome. PCR was performed using primers RhoF1 (SEQ ID NO:10) and RhoR1 (SEQ ID NO:11) to screen for hygromycin-sensitive transformants.

[0288] As expected when a deletion occurs between the Cas9 target sites TS3 and TS4, a transformant producing a PCR product of approximately 630 bp was identified. In wild-type cells, this PCR product is 756 bp in size. The PCR product was sequenced from each end using primers RhoF1 (SEQ ID NO: 10) and RhoR1 (SEQ ID NO: 11). Transformant #89 (t-AWC88) had a 125 bp deletion between TS3 and TS4 (i.e., nucleotides 3,668–3,791 in the coding sequence), with no insertion. Subsequently, Trichoderma transformant #89 (t-AWC88) was fermented and compared with the STCE / DXST protein production of the parent strain (t-AVT84) at 25°C and 28°C (as shown in Table 2).

[0289] Table 2

[0290] Final protein yield during production, expressed as a percentage of control strain t-AVT84 at 25°C.

[0291]

[0292] More specifically, as shown in Table 2 above, the T4-DXST progeny strain (t-AWC88) has an optimal protein production temperature that is at least 2-3°C higher than that of the parent strain (t-AVT84).

[0293] References

[0294] PCT application serial number: PCT / US 2019 / 27590

[0295] PCT Publication No. WO 2011 / 153449

[0296] PCT Publication No. WO 2011 / 153449

[0297] PCT Publication Number WO 2012 / 145584

[0298] PCT Publication Number WO 2012 / 145595

[0299] PCT Publication No. WO 2016 / 100272

[0300] PCT Publication No. WO 2016 / 100562

[0301] PCT Publication No. WO 2016 / 100568

[0302] US Patent No. 6,022,725

[0303] U.S. Patent No. 6,255,115.

[0304] US Patent No. 6,268,328

[0305] US Patent No. 7,595,182

[0306] U.S. Provisional Application Serial No. 62 / 711,846, filed on July 30, 2018.

[0307] Altschul et al., J. Mol. Biol. 215:403-10, 1990.

[0308] Altschul et al., Meth. Enzymol. 266:460-80, 1996.

[0309] Ausubel et al., "Current Protocols in Molecular Biology", GreenPublishing Associates / Wiley Interscience, New York, 1994.

[0310] Bachmann et al., "Availability of public goods shapes the evolution ofcompeting metabolic strategies", PNAS, 110(35):14302-14307, 2013.

[0311] Boel et al.,EMBO J.3:1581-1585,1984.

[0312] Science 229:4719,1985.

[0313] Campbell et al.,Curr.Genet.,16:53-56,1989.

[0314] Cao et al.,Science,9:991-1001,2000.

[0315] Devereux et al.,Nucleic Acids Res.12:387-395,1984.

[0316] Gruber et al.,1990

[0317] Hakkinen et al.,“Screening of candidate regulators for cellulase andhemicellulase production in Trichoderma reesei and identification of a factoressential for cellulase production”,Biotechnol Biofuels 7,14,2014.

[0318] Harkki et al.,BioTechnol.,7:596-603,1989.

[0319] Harkki et al.,Enzyme Microb.Technol.,13:227-233,1991.

[0320] Henikoff and Henikoff,Proc.Natl.Acad.Sci.USA 89:10915,1989.

[0321] Higgins and Sharp,CABIOS 5:151-53,1989.

[0322] Higuchi et al.,Nucleic Acids Research 16:7351,1988.

[0323] Ho et al., Gene 77:61,1989.

[0324] Horton et al.,Gene 77:61,1989.

[0325] Iglesias and Trautner,Molecular General Genetics 189:73-76,1983.

[0326] Joint Genomes Institute(JGI)website(www.genome.jgi.doe.gov).

[0327] Karlin et al.,Proc.Natl.Acad.Sci.USA 90:5873-87,1993.

[0328] Lo et al.,Proceedings of the National Academy of Sciences USA 81:2285,1985.

[0329] Mullaney et al.,MGG 199:37-45,1985.

[0330] Needleman and Wunsch,J.Mol.Biol.,48:443,1970.

[0331] Nunberg et al.,Mol.Cell Biol.4:2306,1984.

[0332] Parish and Stoker,FEMS Microbiology Letters 154:151-157,1997.Pearsonand Lipman,1988

[0333] Penttila et al.,“A versatile transformation system for thecellulolytic filamentous fungus Trichoderma reesei”,Gene 61,155-164,1987.

[0334] Perego,1993,In A.L.Sonneshein,J.A.Hoch,and R.Losick,editors,Bacillussubtilis and Other Gram-Positive Bacteria,Chapter 42,American Society ofMicrobiology,Washington,D.C.

[0335] Sambrook et al.,“Molecular Cloning,A Laboratory Manual”,4th Edition,Cold Spring Harbor Laboratory Press,Cold Spring,New York,2012.

[0336] Sarkar and Sommer,BioTechniques 8:404,1990.

[0337] Shimada,Meth.Mol.Biol.57:157;1996.

[0338] Smith and Waterman,Adv.Appl.Math.2:482,1981.

[0339] Wood,“Preparation of crystalline,amorphous,and dyed cellulasesubstrates”,Methods in Enzymology,Vol.160,pages 19-25,1988.

[0340] Yelton et al.,PNAS USA 81:1470-1474,1984.

[0341] Youngman et al.,1983

Claims

1. A variant filamentous fungal cell derived from a parent cell comprising a gene encoding a GEF1 protein, wherein the variant cell comprises a genetic modification that disrupts or deletes the gene encoding the GEF1 protein, wherein when fermented under the same conditions, the variant cell comprises an increased protein productivity phenotype relative to the parent cell, wherein the filamentous fungal cell is a Trichoderma, and wherein the increased protein productivity phenotype is selected from increased total protein productivity, wherein the GEF1 protein consists of the amino acid sequence of SEQ ID NO:

2.

2. The variant cell of claim 1, comprising an increased protein productivity phenotype relative to the parent cell when the variant and parent cell are fermented under the same conditions at 26°C.

3. The variant cell of claim 1, comprising a gene encoding an endogenous protein of interest (POI) and / or an expression cassette encoding a heterologous POI.

4. The variant cell of claim 3, wherein the endogenous POI is a lignocellulose degrading enzyme.

5. The variant cell of claim 4, wherein the lignocellulose degrading enzyme is selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases.

6. The variant cell of claim 3, wherein the expression cassette encodes a heterologous POI selected from the group consisting of an enzyme, an antibody, a receptor and a peptide.

7. The variant cell of claim 6, wherein the enzyme is selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases.

8. A method for producing increased amounts of an endogenous protein of interest (POI) in a modified filamentous fungal cell, the method comprising: (a) genetically modifying a parental filamentous fungal cell by disrupting or deleting the native GEF1 gene, and (b) fermenting the modified cells under conditions suitable for producing the POI, wherein said modified cell produces an increased amount of said POI relative to said parent strain when fermented under the same conditions at 25°C, The filamentous fungal cell is of the genus Trichoderma, and the GEF1 protein consists of the amino acid sequence of SEQ ID NO:

2.

9. The method of claim 8, wherein the endogenous POI is a lignocellulose degrading enzyme.

10. The method of claim 9, wherein the lignocellulose degrading enzyme is selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases and beta-glucosidases.

11. The method of claim 8, wherein the modified strain further comprises an expression construct encoding a heterologous POI.

12. A method for producing increased amounts of a heterologous protein of interest (POI) in a modified filamentous fungal cell, the method comprising: (a) genetically modifying a parental filamentous fungal cell by disrupting or deleting the native GEF1 gene and by introducing an expression cassette encoding a heterologous POI, and (b) fermenting the modified cell under conditions suitable for production of the heterologous POI, wherein the modified cell produces an increased amount of the POI relative to the parent strain when fermented under the same conditions at 25°C, wherein the filamentous fungal cell is of the genus Trichoderma, The GEF1 protein consists of the amino acid sequence of SEQ ID NO:

2.

13. The method of claim 12, wherein the heterologous POI is selected from the group consisting of an enzyme, an antibody or fragment thereof, a receptor protein, and a peptide.

14. The method of claim 12, wherein the heterologous POI is an enzyme selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases, and ligases.

Images