Application of MOGAT2 in the preparation of products for diagnosing and predicting the prognosis of hepatocellular carcinoma

Abstract

The present invention discloses the application of MOGAT2 in the preparation of products for the diagnosis and prognosis judgment of hepatocellular carcinoma, belonging to the field of molecular markers. It also discloses the application of a reagent for detecting the expression level of MOGAT2 in the preparation of a kit for predicting the prognosis of patients with hepatocellular carcinoma. The present invention verifies through experiments that MOGAT2 is lowly expressed in hepatocellular carcinoma tissues and highly expressed in adjacent normal liver tissues. By detecting the expression level of the molecular marker MOGAT2 for the diagnosis and / or prognosis judgment of hepatocellular carcinoma, it can supplement and improve the deficiencies of the current screening strategies for liver cancer diagnosis and prognosis.

Description

Technical Field

[0001] The present invention relates to the field of molecular markers, and particularly to the application of MOGAT2 (monoacylglycerol acyltransferase 2) in the preparation of products for diagnosing and predicting the prognosis of hepatocellular carcinoma. Background Art

[0002] According to relevant reports, liver cancer is the sixth most common human malignancy globally (841,80 cases / year) and the fourth leading cause of cancer-related deaths (781,631 cases / year). Hepatocellular carcinoma (HCC) originates from hepatocytes and accounts for the vast majority (about 75 - 85%). Despite recent progress in early detection and management, the mortality rate of hepatocellular carcinoma remains high due to the low early diagnosis rate. Abnormal lipid metabolism is closely related to hepatocellular carcinoma, which is different from normal liver tissue and other tumors in terms of lipid metabolism. Currently, there are few models based on metabolism-related genes to predict the diagnosis of hepatocellular carcinoma and the prognosis of liver cancer patients. Therefore, there is an urgent need to establish a new metabolism-related biomarker and therapeutic target that can reliably predict the prognosis of hepatocellular carcinoma to supplement and improve the current screening strategies for the diagnosis and prognosis of hepatocellular carcinoma.

[0003] MOGAT2 is a member of the MOGAT gene family and belongs to the membrane-bound acyltransferase of the diacylglycerol acyltransferase (DGAT) gene family. It plays an important role in the monoacylglycerol pathway of triacylglycerol synthesis and is highly expressed in the small intestine and liver of humans. Recent studies have shown that MOGAT2 is an attractive target for the treatment of obesity, diabetes, and non-alcoholic steatohepatitis. However, the specific expression of MOGAT2 in hepatocellular carcinoma and its diagnostic and prognostic value have not been studied yet. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of MOGAT2 in the preparation of products for diagnosing and predicting the prognosis of hepatocellular carcinoma, so as to solve the problems existing in the above-mentioned prior art, quickly diagnose hepatocellular carcinoma and judge the prognosis of hepatocellular carcinoma patients, and supplement and improve the deficiencies of the current screening strategies for the diagnosis and prognosis of hepatocellular carcinoma.

[0005] To achieve the above purpose, the present invention provides the following solutions:

[0006] The present invention provides the application of MOGAT2 lipid metabolism-related biomarker in the preparation of products for diagnosing and / or predicting the prognosis of hepatocellular carcinoma.

[0007] Preferably, the product includes reagents and / or kits for detecting the expression level of MOGAT2.

[0008] The present invention also provides an application of a reagent for detecting the expression level of MOGAT2 in the preparation of a kit for predicting the prognosis of patients with hepatocellular carcinoma.

[0009] Preferably, the kit includes primers for amplifying MOGAT2 and primers for amplifying the internal reference β-actin gene.

[0010] Preferably, the primers for amplifying MOGAT2 are:

[0011] Forward primer: 5′-TCTCTTCGATCTTCCCCGGTA-3′,

[0012] Reverse primer: 5′-GATGCCCAGCAAGTTTCCG-3′;

[0013] The primers for amplifying the internal reference β-actin gene are:

[0014] Forward primer: 5′-CAGCAAGGACTGGTCTTTCTAT-3′,

[0015] Reverse primer: 5′-GCGGCATCTTCAAACCTC-3′.

[0016] The present invention discloses the following technical effects:

[0017] The present invention screens a new molecular marker MOGAT2 for assisting in predicting the prognosis of hepatocellular carcinoma. The experimental verification results show that MOGAT2 is lowly expressed in hepatocellular carcinoma tissues and highly expressed in adjacent normal liver tissues. By detecting the expression level of MOGAT2 in the patient's tissues, the diagnosis can be quickly made and the prognosis of patients with hepatocellular carcinoma can be predicted. Therefore, the molecular marker MOGAT2 provided by the present invention can supplement and improve the deficiencies of the current screening strategies for the diagnosis and prognosis of hepatocellular carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0019] Figure 1 It is a diagram for analyzing the mRNA expression level of MOGAT2 in hepatocellular carcinoma tissues by GEPIA and UALCAN databases; in the figure, LIHC represents hepatocellular carcinoma, Normal represents normal liver tissue, and Primary tumor represents primary tumor;

[0020] Figure 2To analyze the correlation between the expression of MOGAT2 and the postoperative survival of patients with hepatocellular carcinoma and other tumor patients in the UALCAN and GEPIA databases; in the figure, LIHC represents hepatocellular carcinoma, BLCA represents bladder urothelial carcinoma, HNSC represents head and neck squamous cell carcinoma, and READ represents rectal adenocarcinoma;

[0021] Figure 3 To analyze the correlation between the expression of MOGAT2 in hepatocellular carcinoma tissues and some hepatocellular carcinoma-related genes (AFP, GPC3, HSPA4, and TP53) in the GEPIA database;

[0022] Figure 4 To analyze the correlation between the expression of MOGAT2 in hepatocellular carcinoma tissues and proliferation-related factors (MKI67, MYC) in the GEPIA database;

[0023] Figure 5 Results graph for comparing the expression levels of MOGAT2 mRNA in 40 pairs of fresh hepatocellular carcinoma and adjacent tissues; A is the detection of the mRNA level of MOGAT2 in hepatocellular carcinoma and its adjacent tissues by qRT-PCR method, with β-actin as the internal reference, and B is the ROC curve graph of A; in the figure, Adjacent normal tissue represents adjacent tissues, and HCC represents hepatocellular carcinoma tissues;

[0024] Figure 6 Results graph for comparing the protein expression levels of MOGAT2 in 40 pairs of fresh hepatocellular carcinoma and adjacent tissues; A is the detection of the protein level of MOGAT2 in hepatocellular carcinoma and its adjacent tissues by Western blot method, with GAPDH as the internal reference, and B is the quantitative bar graph of A; in the figure, Adjacent normal tissue and AN represent adjacent tissues, and HCC and H represent hepatocellular carcinoma tissues;

[0025] Figure 7 Results graph for observing the expression of MOGAT2 in 363 pairs of paraffin-embedded hepatocellular carcinoma and adjacent tissues by tissue microarray combined with IHC; A is the immunohistochemical result graph, where brown indicates strong positive (+++), light brown indicates positive (++), yellow indicates weak positive (+), and blue indicates negative (-), magnification: left ×40 (bar = 500μm), right ×400 (bar = 50μm); B is the ROC curve graph of A; in the figure, Adjacent normal represents adjacent tissues, and HCC represents hepatocellular carcinoma tissues;

[0026] Figure 8 Kaplan-Meier plotter graph of the five-year survival rate of patients with hepatocellular carcinoma with MOGAT2 expression, (P < 0.05, the difference is statistically significant). Detailed Embodiments

[0027] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be construed as a limitation on the present invention, but rather as a more detailed description of certain aspects, features, and implementation schemes of the present invention.

[0028] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0029] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0030] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of this application are merely exemplary.

[0031] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0032] The present invention will be further described below in conjunction with specific embodiments.

[0033] The main reagents used in the following examples are:

[0034] (1) qRT-PCR reagents; Trizol: Invitrogen; qRT-PCR primers: Guangzhou Ribobio Co., Ltd., GAPDH primers: Shanghai Sangon Biotech Co., Ltd.; reverse transcription kit: Thermo Fisher Scientific, SYBR Green Ⅰ mix: Beijing Bioteke Corporation; genomic DNA (gDNA) extraction kit: Beijing Tiangen Biochemical Technology Co., Ltd.; DNA Marker: Shanghai Sangon Biotech Co., Ltd.

[0035] (2) Western blot reagents: 1×TBST: Weigh 2.42 g of Tris, 8.0 g of NaCl, and 0.5 mL of Tween-20, dissolve them by mixing, make up the volume to 1 L, and store at room temperature. 1× Transfer membrane Buffer: Weigh 14.4 g of glycine and 3.03 g of Tris, stir and dissolve them in an appropriate amount of double-distilled water, then add 200 mL of absolute methanol, make up the volume to 1 L, and mix well (prepare before use). 100 mL of blocking solution: Weigh 5 g of skim milk powder, add it to 100 mL of 1×TBST, and dissolve by mixing (prepare when needed). BCA protein assay kit: Biosharp; Polyclonal antibody against MOGAT2 (for Western blot assay): Invitrogen; Goat anti-rabbit secondary antibody conjugated with horseradish peroxidase (for Western blot assay): CST, USA; ECL chemiluminescence kit: Thermofisher, USA.

[0036] (3) Two-step immunohistochemical detection kit: Polyclonal antibody against human MOGAT2 (for immunohistochemical assay): Invitrogen; Goat anti-rabbit secondary antibody conjugated with horseradish peroxidase (for immunohistochemical assay): CST, USA; 0.01 mol / L citrate buffer (pH 6.0): Beijing Zhongshan Biotechnology Co., Ltd.; DAB staining solution kit: Fuzhou Maixin Biotechnology Co., Ltd., China; Xylene, neutral gum, etc. are provided by the pathology department.

[0037] The main instruments used in the following examples are as follows:

[0038] Molecular hybridization oven: UVP, USA; Ultra-micro spectrophotometer: Thermo, USA; Ordinary PCR amplifier: BIO-RAD, USA; Light Cycler cobas Z480 PCR instrument: Roche, USA; Tissue microarray maker: Beecher Instruments, USA; Automatic immunohistochemical stainer (2D): LABVISION, USA; Gel imaging system: BIO-RAD, USA; Multifunctional microplate reader: Thermo, USA; Full-automatic pathological imaging system: PerkinElmer Vectra, USA; Electrophoresis apparatus: Bio-Rad, model miniprotean 3cell; Electrotransfer instrument: Dalian Jingmai Technology Co., Ltd., model PS-9; Integrated chemiluminescence imager: ChemiScope 5300Pro; Inverted phase contrast microscope: leica, Germany; Optical microscope: XDS-1A.

[0039] Example 1

[0040] 1. Through the data analysis of the GEPIA and UALCAN databases, the mRNA expression level map of MOGAT2 in hepatocellular carcinoma was obtained. As Figure 1 shown, MOGAT2 was lowly expressed in hepatocellular carcinoma tissues.

[0041] 2. Through the data analysis of the GEPIA and UALCAN databases, the correlation between the expression of MOGAT2 and the postoperative survival of patients with hepatocellular carcinoma and other tumor patients was obtained. As Figure 2 shown, the expression of MOGAT2 was positively correlated with the postoperative survival of patients with hepatocellular carcinoma and other tumors such as bladder urothelial carcinoma, head and neck squamous cell carcinoma, and rectal adenocarcinoma.

[0042] 3. Through the gene correlation data analysis of the GEPIA database, it was found that the expression of MOGAT2 in hepatocellular carcinoma tissues was negatively correlated with the expression of some hepatocellular carcinoma-related genes AFP (R=-0.16; P=0.0017), GPC3 (R=-0.28; P=5.8e-08), TP53 (R=-0.24; P=4.5e-06), and HSPA4 (R=-0.3; P=5.3e-09).

[0043] 4. Through the gene correlation data analysis of the GEPIA database, it was found that the expression of MOGAT2 in hepatocellular carcinoma tissues was negatively correlated with the expression of proliferation-related genes MKI67 (R=-0.22; P=1.4e-05) and MYC (R=-0.19; P=0.00018).

[0044] 5. Detection of samples by qRT-PCR method

[0045] Fresh specimens of cancer tissues and adjacent normal tissues from 40 groups of fresh hepatocellular carcinoma surgery patients were provided by the Affiliated Hospital of Nantong University. After the above tissues were excised during the operation, necrotic tissues were removed, blood stains were rinsed with normal saline, and they were cryopreserved with liquid nitrogen within 30 minutes, and then stored in a -80°C refrigerator for standby. The specific operations are as follows:

[0046] (1) RNA extraction and cDNA synthesis: RNA was extracted using the Trizol kit according to the conventional method. Then, cDNA was synthesized using the reverse transcriptase kit, both according to the conventional method.

[0047] (2) Primer design: Primers were designed from the NCBI gene sequences. The upstream primer for MOGAT2: 5′-TCTCTTCGATCTTCCCCGGTA-3′, the downstream primer: 5′-GATGCCCAGCAAGTTTCCG-3′, and the length of the amplified target fragment is 167 bp; the upstream primer for the reference gene β-actin: 5′-CAGCAAGGACTGGTCTTTCTAT-3′, the downstream primer: 5′-GCGGCATCTTCAAACCTC-3′, and the length of the amplified target fragment is 162 bp.

[0048] (3) Fluorescent quantitative PCR detection

[0049] 1) Fluorescent quantitative PCR reaction system

[0050] Table 1 Fluorescent quantitative PCR reaction system (20.0 μl)

[0051]

[0052]

[0053] 2) Reaction conditions

[0054] Pre-denaturation at 93℃ for 2 min, then 94℃ for 5 s, 61℃ for 30 s, 82℃ for 1 s, for 40 cycles. After the reaction, the computer automatically fits and plots according to the cycle threshold (crossing point, Cp) and the corresponding logarithm values of different quantitative template copy numbers, and draws the standard curves of the target gene and GAPDH.

[0055] 3) Specificity of the method

[0056] To verify the specificity of the SYBR Green Ⅰ dye method, the melting curve of the PCR amplification product was measured and the product was analyzed by 2% agarose gel electrophoresis.

[0057] 4) Repeatability test

[0058] Five different dilutions of the standard product (5.0×10 9 ~5.0×10 5 copies / ml) were detected in 5 batches at different times to calculate the between-batch coefficient of variation; the above standard product was detected in 5 replicates per batch to calculate the within-batch coefficient of variation.

[0059] 5) Detection of the expression levels of the human target gene and the reference gene GAPDH in the specimens

[0060] The cDNA templates of different specimens and standards with different dilutions were respectively added to 17 μl of PCR reaction solution. According to the standard curve, the copy numbers of the target gene and GAPDH and the corresponding Cp values in different samples were obtained. To eliminate the differences in samples, reverse transcription, and PCR reactions, the logarithmic ratio of the target gene mRNA and GAPDH concentrations was used as an index to evaluate the expression level of the target gene.

[0061] 6) Data processing

[0062] The detection results were calculated for the mean ± standard deviation, coefficient of variation (CV), and P value using the SPSS 22.0 statistical analysis software. The significance level α was set at 0.05.

[0063] The mRNA expression levels of MOGAT2 in 40 pairs of hepatocellular carcinoma and adjacent tissues were detected by qRT-PCR. As Figure 5 shown, it was found that the expression of MOGAT2 mRNA in hepatocellular carcinoma tissues was significantly lower than that in the corresponding adjacent tissues. The results of the ROC curve showed that the expression of MOGAT2 mRNA could distinguish hepatocellular carcinoma from adjacent normal liver tissues. The area under the curve (AUC) was 0.9247 (95% CI, 0.8644 - 0.9849), the cut-off value was 0.75, and the sensitivity and specificity were 92.5% and 82.5%, respectively.

[0064] 6. Specimens for Western blotting

[0065] (1) Extracting tissue proteins

[0066] 1) Take out the 40 pairs of fresh tissues reserved from the -80 °C refrigerator and place them on crushed ice. Weigh 100 mg of each tissue and cut it into pieces with scissors and put them into a 10 ml EP tube (inserted into crushed ice);

[0067] 2) Take 8 ml of lysis buffer and add 80 μl of PMSF and mix well (add 1 ml of the mixed lysis buffer per 100 mg of tissue);

[0068] 3) Add 1 ml of the lysis buffer containing PMSF to each tube and homogenize on an electric homogenizer;

[0069] 4) After homogenization, pour it into a 2 ml EP tube and centrifuge at 12000 rpm at low temperature (4 °C) for 15 min;

[0070] 5) Take the supernatant and aliquot (1 ml EP tube), 40 μl per tube (or aliquot according to the required amount);

[0071] 6) Place it in a -20 °C refrigerator (seal with Parafilm). You can either add the loading buffer and boil for 15 min first, or boil it again before electrophoresis.

[0072] (2) Determination of Protein Concentration (BCA Kit)

[0073] 1) According to the number of samples, prepare an appropriate amount of BCA working solution by mixing 50 volumes of BCA reagent A with 1 volume of BCA reagent B (50:1), and mix well;

[0074] 2) Completely dissolve the protein standard, take 10 μl and dilute it to 100 μl to make the final concentration 0.5 mg / ml, and dilute the standard with PBS;

[0075] 3) Add the standard to the standard wells of the 96-well plate at 0, 1, 2, 4, 8, 12, 16, 20 μl, and add the solution used to dilute the standard to make up to 20 μl;

[0076] 4) Add an appropriate volume of the sample to the sample wells of the 96-well plate, and add the solution used to dilute the standard to 20 μl;

[0077] 5) Add 200 μl of BCA working solution to each well, and incubate at 37 °C for 30 minutes;

[0078] 6) Measure A 562 , and calculate the protein concentration according to the standard curve.

[0079] (3) Prepare the Gel

[0080] 1) Select the concentration and volume of the gel required (10 ml of separating gel and 4 ml of stacking gel are needed to prepare 2 gels);

[0081] 2) Preparation of 12% separating gel

[0082] Distilled water: 2.0 ml; 30% Acr - Bis (29:1): 4.0 ml; 1 mol / l Tris - HCl pH 8.8: 3.8 ml; 10% SDS: 0.1 ml; 10% AP: 0.1 ml; TEMED: 0.004 ml.

[0083] 3) Preparation of 5% stacking gel

[0084] Distilled water: 2.7 ml; 30% Acr - Bis (29:1): 0.67 ml; 1 mol / l Tris - HCl pH 6.8: 0.5 ml; 10% SDS: 0.04 ml; 10% AP: 0.04 ml; TEMED: 0.004 ml.

[0085] 4) Wash and dry the glass slides for preparing the gel, then assemble them together (clamp tightly to prevent leakage of the gel), and first add the separating gel until it is 1.5 cm from the upper end. After standing for 20 min, add the stacking gel to the top, insert the comb (constantly replenish the gel to prevent voids during concentration), and let it stand at room temperature for 2 h or overnight in a 4 °C refrigerator.

[0086] (4) Loading and Electrophoresis

[0087] 1) Mix 50 μg of total protein with 5× loading buffer (protein: 5× Loading buffer = 4:1), seal the 1 ml EP tube with parafilm, and boil for 3 - 5 min;

[0088] 2) Take out the pre - prepared gel from the refrigerator and place it on the support in the electrophoresis tank (if two gels are electrophoresed simultaneously, the position is: both thin glass plates face inwards; if only one gel is run, the other is replaced with a plastic plate, with the side with words facing inwards). When clamping the glass slides, press down firmly and rotate the clamp at the same time;

[0089] 3) Place the clamped rack into the electrophoresis tank, fill the inside with electrophoresis buffer, and add 1 / 3 to 1 / 2 volume outside;

[0090] 4) Load the sample, the pipette tip should be close to the glass slide, and 1× loading buffer can be added to the holes on the other two sides without sample loading for balance;

[0091] 5) Connect the power supply, first at 80 V for about 20 min and then switch to 100 V for about 90 min;

[0092] 6) When electrophoresis is completed (the bromophenol blue runs to the bottom of the gel, the Marker is separated and the bands are clear), remove the gel and the glass slide simultaneously, and cut off the excess part (according to the position of the Marker);

[0093] (5) Transfer

[0094] 1) Place the cotton pads and filter papers in 1× transfer buffer in advance to equilibrate for 20 min. Cut a PVDF membrane of appropriate size, polarize it with formaldehyde for 3 s, and then place it in ddH2O for 2 min;

[0095] 2) Assemble the transfer sandwich: cathode (black) - cotton pad - filter paper - gel - PVDF membrane - filter paper - cotton pad - anode (red). The membrane should not be dried and no bubbles should be generated (note the front and back of the membrane, the black side of the transfer plate is at the bottom, and the white side with holes is on the top);

[0096] 3) Place the sandwich into the transfer tank, pay attention to the positive and negative poles (black - black, red - red); place it in an ice box and add 1× transfer buffer until full;

[0097] 4) Place the electro - transfer instrument in crushed ice, cover it with an ice bag on top, and connect the power supply (300 mA, 2 h, the transfer time is shorter for smaller molecular weights);

[0098] 5) Turn off the power supply and take out the transfer membrane.

[0099] (6) Staining the Membrane with Ponceau S (to check if the protein has been transferred to the membrane)

[0100] 1) Take out the membrane and directly put it into the Ponceau red dye solution (freshly prepared) for 1 minute;

[0101] 2) Take out and wash in ddH2O for 2 min;

[0102] 3) Wash with 1×TBS-T (without skimmed milk powder) for 5 min × 3 times. If the staining is not obvious, it can be re-stained.

[0103] (7) Blocking, adding primary and secondary antibodies for incubation

[0104] 1) Place the PVDF membrane in blocking solution (1×TBS-T containing 5% skim milk powder), shake at 4°C overnight or at room temperature for 2 hours, and wash the membrane for 5 minutes × 3 times;

[0105] 2) Place the washed membrane on a plate, add primary antibodies diluted in 1×TBS-T containing 5% skim milk powder (MOGAT2 primary antibody diluted 1000 times, internal reference GAPDH diluted 1000 times, 1 ml of each diluted antibody is placed in an EP tube), with the front side of the membrane facing up, and evenly drip on the membrane;

[0106] 3) Incubate at room temperature for about 1 hour, then place at 4°C overnight, or place directly at 4°C (the time can be longer);

[0107] 4) Take out the membrane and wash it with 1×TBS-T solution for 10 min×3 times;

[0108] 5) Prepare secondary antibody diluted in 1×TBS-T containing 5% skim milk powder (dilute the secondary antibody 2000 times, dilute 1 ml and place in EP tube);

[0109] (6) Evenly add the diluted secondary antibody onto the membrane and place at room temperature or 4°C for 2 hours (the ratio of the secondary antibody can be determined according to the instructions) for no more than 3 hours;

[0110] (7) Wash with 1×TBS-T (without skimmed milk powder) for 5 min × 3 times;

[0111] (8) Use absorbent paper to absorb excess liquid on the membrane and develop it;

[0112] (9) Use Image J image processing software to perform grayscale statistical analysis on the images.

[0113] Western blot was used to detect the protein expression level of MOGAT2 in 40 groups of fresh hepatocellular carcinoma and its adjacent tissues. Figure 6 As shown, the results showed that the expression of MOGAT2 protein in hepatocellular carcinoma tissue was significantly lower than that in the corresponding adjacent normal tissue.

[0114] 7. Tissue microarray combined with immunohistochemistry specimens:

[0115] (1) Tissue specimens

[0116] Paraffin specimens of cancer tissues and adjacent tissues from 363 patients with hepatocellular carcinoma in the Department of Pathology, Affiliated Hospital of Nantong University from January 2004 to December 2012 were selected. The clinical and pathological data of all patients were completely collected and could be followed up by telephone or other means without loss to follow-up (the follow-up cut-off date was December 31, 2017). The patients or their families were informed and all signed the informed consent form. The acquisition and use of tissue specimens were approved by the Ethics Committee of Affiliated Hospital of Nantong University. The TNM staging was based on the eighth edition of TNM classification recommended by the Union for International Cancer Control (UICC) and the American Joint Committee on Cancer (AJCC). In addition, 128 hepatitis specimens, 100 hepatic cavernous hemangioma specimens, 70 liver cirrhosis specimens, and 42 focal nodular hyperplasia specimens were selected during the same period. All selected cases were histologically determined by two experienced pathologists, and the patients had not received anti-tumor treatments such as immunotherapy, chemotherapy, or radiotherapy before surgery.

[0117] (2) Preparation of tissue microarray

[0118] All specimens were fixed with 10% formaldehyde, embedded in paraffin, and the paraffin blocks were screened without obvious defects. Tissue microarrays were made. The main procedures were as follows:

[0119] 1) According to the microscopic examination results of HE-stained sections, representative lesion areas were marked on the paraffin blocks;

[0120] 2) Paraffin and beeswax were mixed at a volume ratio of 1:1 to make blank recipient paraffin blocks: a 10×7 hole tissue array was designed on the paraffin blocks, and then a TMA blank paraffin block was made with a tissue microarray instrument;

[0121] 3) The most representative lesion areas were selected at the marked points on the donor paraffin blocks, and tissue blocks with a diameter of 2 mm were taken, one core was taken from each case; the taken tissue cores were transferred to the holes of the recipient paraffin blocks;

[0122] 4) The tissue array blocks were heated and fused in a constant temperature oven at 55°C for 10 min, and cooled to room temperature before melting quickly to integrate the recipient paraffin blocks with the donor tissues; the tissue microarrays were frozen at 4°C for about 4 h, and then the tissue array blocks were corrected with a fully automatic tissue slicer at a speed of 20 mm / revolution until all tissue cores were completely exposed;

[0123] 5) The tissue array blocks were sliced with a slicer, and the consecutive sections were floated in cold water to unfold naturally, and then the sections were transferred to warm water at 45°C for about 2 min to unfold, and after unfolding, they were pasted on the glass slides treated with anti - detachment agent and dried;

[0124] 6) Bake the sections at 60 °C for 3 min and continue baking at 58 °C for 16 h;

[0125] 7) Store the prepared tissue microarray in a section box and keep it in the refrigerator at 4 °C for standby.

[0126] (3) Immunohistochemical staining (EnVision two-step method)

[0127] 1) Conventional dewaxing and hydration: Before dewaxing, place the tissue microarray in an incubator at 60 °C and bake for about 20 min. Xylene for 15 min × 3 times (60 °C) → absolute ethanol for 10 min × 2 times → 95% ethanol for 5 min × 2 times → 80% ethanol for 5 min → 70% ethanol for 5 min; Xylene is used for dewaxing, based on the principle of similar compatibility; generally, place it in each reagent for 10 min. In hot weather, you can put it for a few minutes less. On the contrary, in cold weather, the dewaxing time can be extended to 12 - 15 min;

[0128] 2) Antigen retrieval: After dewaxing, rinse with water for a period of time, perform microwave antigen retrieval, and rinse with running water. Incubate with 3% H2O2 at room temperature for 10 min to remove endogenous peroxidase, and rinse with 0.01 mol / L PBS for 3 min × 3 times;

[0129] 3) Add primary antibody and secondary antibody: Drop the primary antibody, dilute it 1:150 with antibody diluent respectively, incubate overnight at 4 °C, drop the biotin-labeled secondary antibody and incubate at room temperature for 30 min, and incubate with SP solution at room temperature for 30 min. Wash with PBS between each step; Use PBS buffer instead of the primary antibody as a negative control;

[0130] 4) Color development and counterstaining: Take the slides out of the incubator, rinse with 0.01 mol / l PBS for 3 min × 3 times, immerse the sections in the DAB working solution for 5 min, and observe and control the color development degree under the microscope at the same time. When a positive reaction appears, rinse with running water in time to terminate the reaction; Counterstaining: Counterstain with hematoxylin for 30 s - 2 min, rinse with running water, differentiate with 0.1% hydrochloric acid, rinse with running water, and blue;

[0131] 5) Dehydration: 70% ethanol for 3 min → 80% ethanol for 3 min → 95% ethanol for 5 min → absolute ethanol for 5 min → xylene for 8 min × 2 times, dry at 60 °C;

[0132] 6) Sealing: Drop neutral balsam beside the tissue, and then cover it with a cover slip. First, place one side flat, and then gently put down the other side to avoid generating bubbles. After sealing the slides, place them in a fume hood to dry.

[0133] (4) Result interpretation:

[0134] All immunohistochemical staining sections were evaluated and scored by two independent experienced pathologists (double-blind) according to the proportion of positively stained tumor cells and the intensity of staining. At a magnification of 400x, representative areas of each section were observed, and 5 fields of view were randomly selected. 500 - 1000 cells were counted, and the positive rate of cells was calculated. The percentage of the number of positively stained tumor cells was counted as 0 - 100%. The intensity of stained cells was divided into the following four grades: 0 (no staining, -), 1 (weak staining; yellow, +), 2 (moderate staining; light brown, ++), 3 (strong staining; brown, +++). The staining proportion score was from 0 to 100 points. The final score was the product of the proportion of positive cells and the staining rate. The ROC curve was plotted based on the scores. Additionally, the cut-off point set by the X-tile software (Rimm Lab, Yale University; http: / / www.tissuearray.org / rimmlab) was 120. Among them, 0 to 119 was low expression or none (-), and 120 - 300 was high expression (+). Using SPSS 22.0 statistical software, χ 2 test or Fisher's exact probability method was used for statistical analysis to determine the relationship between the expression of the target gene and each pathological index. The Kaplan-Meier method was used to plot the survival curve, the log-rank test was used for comparison between groups, and Cox proportional hazards regression was used for prognostic analysis. Finally, the asymptotic Sig. two-sided P < 0.05 was used as the standard for statistical significance of differences.

[0135] The results of immunohistochemical staining were as Figure 7 shown. The MOGAT2 protein was mainly localized in the cytoplasm of adjacent normal liver tissues, showing brown. While it was low or not expressed in hepatocellular carcinoma tissues. The positive rate of MOGAT2 protein expression in hepatocellular carcinoma tissues (36.9%, 134 / 363) was significantly lower than that in adjacent normal liver tissues (63.1%, 229 / 363). And the expression of MOGAT2 protein could distinguish hepatocellular carcinoma from adjacent normal liver tissues. The area under the curve was 0.9150 (95% CI, 0.8955 - 0.9345), and the cut-off value was 0.7217. The sensitivity and specificity were 93.11% and 79.06% respectively.

[0136] In non-cancerous tissues, the positive rate of MOGAT2 in hepatitis tissues was 82.8% (106 / 128), in cavernous hemangioma was 82.0% (82 / 100), in liver cirrhosis was 75.7% (53 / 50), and in focal nodular hyperplasia was 70.7% (29 / 41). Compared with hepatocellular carcinoma tissues, the differences were statistically significant (χ2 = 199.460, P < 0.0001) (Table 2).

[0137] Using Person χ2 analysis and Student's t-test, the expression level of MOGAT2 was closely related to serum AFP value, T stage, lymph node metastasis (N), TNM stage, liver cirrhosis, and vascular invasion, and the differences were statistically significant (Table 3). The Cox regression results showed that both MOGAT2 expression and T stage were independent prognostic factors for patients with hepatocellular carcinoma (Table 4). The Kaplan-Meier survival curve showed that the overall survival rate of the high MOGAT2 expression group was higher than that of the low or no-expression group, as shown in Figure 8 .

[0138] Table 2 Expression of MOGAT2 protein in liver benign tissues, hepatocellular carcinoma tissues, and adjacent normal liver tissues

[0139]

[0140] Table 3 Effects of MOGAT2 protein expression on clinicopathological features of patients with hepatocellular carcinoma

[0141]

[0142]

[0143]

[0144] Table 4 Results of COX regression analysis of MOGAT2 and prognosis of patients with hepatocellular carcinoma

[0145]

[0146]

[0147] The above results indicate that MOGAT2 can be used as a molecular marker for assisting in the diagnosis of the prognosis of hepatocellular carcinoma. By using the primers of this molecular marker to prepare a kit for the diagnosis and / or prognosis of hepatocellular carcinoma and detecting the expression level of the molecular marker MOGAT2 for auxiliary diagnosis in hepatocellular carcinoma, the operation will be made more convenient and feasible.

[0148] The above-described embodiments are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention. Sequence Listing <110> Affiliated Hospital of Nantong University <120> Application of MOGAT2 in the Preparation of Products for the Diagnosis and Prognosis Judgment of Hepatocellular Carcinoma <160> 4 <170> SIPO Sequence Listing 1.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <400> 1 tctcttcgat cttccccggt a 21 <210> 2 <211> 19 <212> DNA <213> Artificial Sequence <400> 2 gatgcccagc aagtttccg 19 <210> 3 <211> 22 <212> DNA <213> Artificial Sequence <400> 3 cagcaaggac tggtctttct at 22 <210> 4 <211> 18 <212> DNA <213> Artificial Sequence <400> 4 gcggcatctt caaacctc 18

Claims

1. Use of a reagent for detecting the expression level of MOGAT2 in the preparation of a kit for predicting the prognosis of patients with hepatocellular carcinoma; The kit includes primers for amplifying MOGAT2 and primers for amplifying the internal reference β-actin gene; The primers for amplifying MOGAT2 are: Forward primer: 5′- TCTCTTCGATCTTCCCCGGTA -3′, Reverse primer: 5′- GATGCCCAGCAAGTTTCCG -3′; The primers for amplifying the internal reference β-actin gene are: Forward primer: 5′-CAGCAAGGACTGGTCTTTCTAT-3′, Reverse primer: 5′-GCGGCATCTTCAAACCTC-3′; The patients with hepatocellular carcinoma are patients with T-stage hepatocellular carcinoma; Patients with high MOGAT2 expression have a higher overall survival rate than those with low or no expression.

Images