A nucleic acid composition for a hepatocellular carcinoma early diagnosis kit and application thereof

Abstract

This invention belongs to the technical field of biomarkers and identification of hepatocellular carcinoma (HCC), specifically relating to an early diagnostic kit, identification method, and application for HCC. It provides a diagnostic kit for molecular markers in blood, used for diagnosing HCC and monitoring its progression. The kit contains multiple nucleic acid molecules, where one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, which is an indicator of the presence of HCC. This invention also uses corresponding methods to identify the expression levels of one or more nucleic acid molecules in plasma exosomes. By identifying multiple nucleic acid molecules in the blood, each encoding a microRNA sequence, and comparing with healthy controls, it can detect and / or monitor the occurrence and progression of HCC, or evaluate the treatment effect after liver cancer surgery.

Description

Technical Field

[0001] This invention belongs to the technical field of biomarkers and identification techniques for hepatocellular carcinoma, specifically relating to a nucleic acid composition for an early diagnostic kit for hepatocellular carcinoma and its application. Background Technology

[0002] Hepatocellular carcinoma (HCC) accounts for the majority of cases, and the ideal treatment is early resection. Unfortunately, many HCC patients miss the opportunity to have their tumors removed due to a lack of early diagnosis. Therefore, finding reliable and effective biomarkers is crucial for improving the prognosis of HCC.

[0003] MicroRNAs (miRNAs) are short RNA molecules, comprising 18-25 nucleotides, and are members of the non-coding RNA family. These miRNAs play important roles in cell proliferation, differentiation, and development by binding to hundreds of complementary target mRNAs. Numerous studies have shown that miRNAs are highly expressed in a variety of diseases, including cancer. Since then, miRNAs have been used as excellent candidate biomarkers and therapeutic targets for various cancers.

[0004] Exosomal miRNAs in biological fluids have been shown to be potential biomarkers for diagnosing diseases, including cancers such as exosomal miRNAs in urine for bladder cancer, exosomal miRNAs in plasma for ovarian cancer, and pancreatic juice for diagnosing pancreatic ductal adenocarcinoma.

[0005] However, the presence of ribonucleases in body fluids raises questions about the stability of miRNAs as biomarkers. Exosomes are extracellular carriers with diameters between 50 and 150 nm. After being released from cells into body fluids, exosomes are considered carriers of biological information (proteins, lipids, and RNA) regulating target cellular functions. Due to the presence of the exosome membrane, in vivo miRNAs can be protected from degradation by ribonucleases and are highly stable in body fluids. Therefore, some have considered exosomal miRNAs to be potential cancer biomarkers for cancer diagnosis.

[0006] Most of the nucleic acids in exosomes derived from HCC are miRNAs. Numerous studies have reported that exosomal miRNAs mediate the growth, metastasis, and immune escape of liver cancer. Many miRNAs in the blood exosomes of hepatocellular carcinoma patients differ from those in normal controls, suggesting that exosomal miRNAs are suitable as biomarkers for HCC. For example, the exosomal miRNA group (miR-10b-5p, miR-221-3p, miR-223-3p, miR-21-5p) can distinguish between HCC and non-HCC (AUC = 0.80, sensitivity = 58%, specificity = 95%). However, due to insufficient sensitivity, single or existing exosomal miRNA groups are not suitable as accurate diagnostic biomarkers for clinical application.

[0007] Therefore, it remains necessary to identify a group of exosomal diagnostic miRNA markers in the plasma of hepatocellular carcinoma patients. Furthermore, there is a persistent clinical need for an early detection and / or monitoring method in high-risk individuals (i.e., early liver cancer screening, and recurrence after liver cancer surgery). Summary of the Invention

[0008] The purpose of this invention is to provide a nucleic acid composition for an early diagnostic kit for hepatocellular carcinoma, addressing the shortcomings of existing technologies and solving the technical problems described in the background.

[0009] To achieve the above objectives, the present invention adopts the following technical solution: a nucleic acid composition for an early diagnostic kit for hepatocellular carcinoma, the nucleic acid composition comprising a variety of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, the nucleic acid expression biomarker being an indicator of the presence of hepatocellular carcinoma, wherein the nucleic acid expression biomarker includes any one or more nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, and hsa-miR-1250-5p, as well as an internal reference labeling small nuclear RNA sequence U6.

[0010] Furthermore, the nucleic acid expression biomarker comprises at least five nucleic acid molecules and / or at least five combinations of nucleic acid molecules.

[0011] Furthermore, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence, the expression of which is downregulated in one or more target plasmas compared with one or more healthy controls.

[0012] Furthermore, compared with one or more healthy controls, in one or more target plasma exosome samples, the expression of any one or more nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, and hsa-miR-1250-5p was downregulated, while the expression of small nuclear RNA U6 remained unchanged.

[0013] Furthermore, the nucleic acid expression biomarkers also include those encoding hsa-miR-212-5p-U6, hsa-miR-519b-3p-U6, hsa-miR-1248-U6, hsa-miR-1250-5p-U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 / U6, hsa-miR-1250-5p / U6, and hsa-miR-212-5p / U6. Any one or more combinations of nucleic acid molecules, including hsa-miR-519b-3p, hsa-miR-212-5p / hsa-miR-1248, hsa-miR-212-5p / hsa-miR-1250-5p, hsa-miR-519b-3p / hsa-miR-1248, hsa-miR-519b-3p / hsa-miR-1250-5p, and hsa-miR-1248 / hsa-miR-1250-5p.

[0014] Furthermore, compared with one or more healthy controls, the expression of any one or more combinations of nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, hsa-miR-1250-5p, hsa-miR-212-5p-U6, hsa-miR-519b-3p-U6, hsa-miR-1248-U6, and hsa-miR-1250-5p-U6 was downregulated in one or more target plasma exosome samples.

[0015] The present invention also provides a method for identifying one or more target plasma exosomes exhibiting hepatocellular carcinoma, the method comprising:

[0016] (a) Determine the expression levels of multiple nucleic acid molecules in one or more target plasma exosomes, each nucleic acid molecule encoding a microRNA sequence;

[0017] (b) Determine the expression levels of the various nucleic acid molecules in one or more healthy control plasmas;

[0018] (c) By comparing the respective expression levels obtained in steps (a) and (b), one or more nucleic acid molecules differentially expressed in the target plasma and control plasma are identified from the plurality of nucleic acid molecules, wherein the differentially expressed one or more nucleic acid molecules together represent nucleic acid expression biomarkers as defined above, which are indicators of the presence of hepatocellular carcinoma.

[0019] This invention also provides the application of an early diagnostic kit for hepatocellular carcinoma in the diagnosis of liver cancer.

[0020] The beneficial effects of this invention are as follows:

[0021] (1) The present invention provides a diagnostic kit for molecular markers in blood, which is used to diagnose hepatocellular carcinoma and monitor the progression of hepatocellular carcinoma. The nucleic acid composition of the kit contains a variety of nucleic acid molecules, each of which encodes a microRNA sequence. One or more of the nucleic acid molecules in plasma exosomes are differentially expressed in patients and healthy controls, and one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker. The nucleic acid expression biomarker is an indicator of the presence of hepatocellular carcinoma.

[0022] (2) The present invention also provides a method for efficiently identifying one or more target plasma exosomes that represent hepatocellular carcinoma by means of corresponding methods to identify the expression level of one or more nucleic acid molecules in plasma exosomes.

[0023] (3) The purpose of this invention is to use validated exosomal miRNA biomarkers for early screening and detection of HCC, early detection of tumor recurrence after liver cancer surgery, and monitoring of changes in the patient's condition after surgical treatment. Specifically, by identifying multiple nucleic acid molecules in the blood, each encoding a microRNA sequence, and comparing them with healthy controls, multiple nucleic acid molecules are differentially expressed in the plasma exosomes of hepatocellular carcinoma patients. Using a combination of one or more differentially expressed nucleic acid molecules as biomarkers, the occurrence and / or progression of hepatocellular carcinoma can be detected and / or monitored, or the treatment effect after liver cancer surgery can be evaluated. Attached Figure Description

[0024] The features, advantages, and technical effects of exemplary embodiments of the present invention will now be described with reference to the accompanying drawings.

[0025] Figure 1 This is a flowchart illustrating the workflow of the present invention for identifying one or more target plasma exosomes in hepatocellular carcinoma;

[0026] Figure 2 Heatmap of differentially expressed miRNAs from exosomal miRNA samples;

[0027] Figure 3 The ROC curve is plotted based on the expression levels in the training group samples.

[0028] Figure 4 This is a graph of the ROC curves for all participants in the study in Example 4. Detailed Implementation

[0029] This invention is based on the discovery that hepatocellular carcinoma (HCC) can be reliably identified with high accuracy and sensitivity using specific miRNA expression biomarkers in plasma exosomes, wherein these expression biomarkers typically include multiple downregulated human miRNAs as defined herein. In particular, these miRNA expression biomarkers—by analyzing the overall miRNA expression pattern and / or the individual expression levels of each miRNA in plasma exosomes—can screen individuals at high risk for HCC for early detection and diagnosis.

[0030] The invention illustrated below can be suitably practiced without any one or more elements or one or more limitations not specifically disclosed herein.

[0031] The present invention will be described with reference to specific embodiments and the accompanying drawings, but the invention is not limited thereto, but only by the claims. The described drawings are illustrative only and are considered non-limiting.

[0032] When the term "comprising" is used in the specification and claims of this invention, it does not exclude other elements or steps. For the purposes of this invention, the term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this is also understood to disclose a group preferably consisting only of these embodiments.

[0033] When an indefinite or definite article such as "a" or "a kind of," or "the," is used to refer to a singular noun, the plural form of that noun is included, unless otherwise specified.

[0034] The term "approximately" in this invention refers to an accurate range that, as understood by those skilled in the art, still guarantees the technical effect of the intended feature. This term typically indicates a deviation from the indicated value of ±10%, preferably ±5%.

[0035] The following terms or definitions are provided for the purpose of understanding the invention only, and should not be considered to have a scope less than that understood by those skilled in the art.

[0036] The purpose of this invention is to detect hepatocellular carcinoma in high-risk individuals using validated miRNA biomarkers, wherein multiple nucleic acid molecules in the blood are identified, each encoding a microRNA (miRNA) sequence, wherein one or more different nucleic acid molecules are differentially expressed in the plasma of hepatocellular carcinoma patients compared to healthy controls, wherein one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker that is an indicator of the presence of hepatocellular carcinoma and the effectiveness of treatment.

[0037] The term "liver" in this article refers to the human organ, the liver.

[0038] The term "cancer" (also known as carcinoma) in this article generally refers to any type of malignant neoplasm, that is, any morphological and / or physiological alterations (based on genetic re-programming) of target cells that show or have a predisposition to developing cancer characteristics compared to unaffected (healthy) wild-type control cells. Examples of such alterations may involve cell size and shape (increase or decrease), cell proliferation (increase in cell number), cell differentiation (change in physiological state), apoptosis (programmed cell death), or cell survival.

[0039] The term "hepatocellular carcinoma" in this article refers to the cancerous growth of liver cells. Liver cancer is divided into primary liver cancer and metastatic liver cancer. The pathological types of primary liver cancer include hepatocellular carcinoma (HCC), cholangiocarcinoma, and mixed cell carcinoma, among which hepatocellular carcinoma accounts for more than 95% of primary liver cancers.

[0040] The term "plasma" in this article refers to the yellowish liquid component of blood, in which whole blood cells are typically suspended. It comprises approximately 55% of the total blood volume. It is predominantly water (90% by volume) and contains dissolved proteins, glucose, agglutinating factors, mineral ions, hormones, and carbon dioxide (plasma is the primary medium for transporting secretory products). Plasma is prepared by centrifuging fresh blood in a centrifuge until the blood cells settle to the bottom of the centrifuge tube. The plasma is then purified and transferred. The density of plasma is approximately 1.025 kg / L, or 1025 kg / m³. 3 Current research indicates that exosomal miRNAs are stable in plasma. The term "plasma sample" refers to plasma obtained from the individual being tested or a healthy control.

[0041] The term "exosome" in this article refers to a flattened, spherical endosomal vesicle released from the cell into the extracellular environment, originating from the nuclear endosome system. Exosomes isolated using ultracentrifugation exhibit a cup-shaped morphology under electron microscopy, typically with a diameter of 50–150 nm. Recent studies have revealed that exosomes represent a novel mode of intercellular communication, facilitating cell-to-cell exchange through informational substances such as proteins and nucleic acids contained within the vesicles.

[0042] As used in this article, "patient" refers to a person who should at least be considered to have hepatocellular carcinoma; "target plasma" refers to plasma obtained from a patient; and "healthy individual" or "healthy control" specifically refers to a healthy individual without any cancer manifestations. Furthermore, "control plasma" here refers to plasma obtained from these healthy individuals. However, in some applications, such as when comparing different types of cancer where these individuals have other types of cancer, the plasma obtained from these individuals is also specifically referred to as "control."

[0043] Typically, the plasma samples used are derived from biological samples of research subjects diagnosed with hepatocellular carcinoma. Additionally, to more definitively obtain data from "control samples," samples can be collected from research subjects with known disease states. Biological samples may include body tissues and fluids, such as liver tissue, serum, blood cells, sputum, and urine. Furthermore, biological samples can be obtained from cases exhibiting hepatocellular carcinoma characteristics or suspected cases. Furthermore, if necessary, samples can be purified from the obtained body tissues and fluids to obtain biological samples. In this invention, the biological samples are derived from plasma samples of hepatocellular carcinoma patients and control plasma samples. According to this invention, the expression levels of nucleic acid molecular markers are determined using biological samples derived from research subjects.

[0044] The samples used for detection in the in vitro method of the present invention should generally be collected in a clinically acceptable manner, preferably in a manner that protects nucleic acids (especially RNA) or proteins.

[0045] The terms “microRNA” or “miRNA” as used in this article have their common meaning in this field (Bartel, DP (2004) Cel1 23, 281-292; He, L. and Hannon, GJ (2004) Nat. Rev. Genet. 5, 522-531). Therefore, “microRNA” refers to an RNA molecule derived from a genomic locus, processed from transcripts that can form local RNA precursor miRNA structures. Mature miRNAs are typically 20, 21, 22, 23, 24, or 25 nucleotides in length, but other numbers, such as 18, 19, 26, or 27 nucleotides, may also be present.

[0046] miRNA coding sequences have the potential to pair with flanking genomic sequences, allowing mature miRNAs to be placed within partially paired RNA duplexes (also referred to herein as stem-loop or hairpin structures or pre-miRNAs), which serve as intermediates in miRNA processing from longer precursor transcripts. This processing typically occurs through the sequential action of two specific endonucleases, Drosha and Dicer, respectively. Drosha generates a miRNA precursor (also referred to herein as a hairpin or stem-loop structure) from the primary transcript (also referred to herein as “pri-miRNA”). From this miRNA precursor, the miRNA duplex is cleaved by Dicer, which contains the mature miRNA in one arm of the hairpin or stem-loop structure and a similarly sized segment (often referred to herein as miRNA*) in the other arm. The miRNA is then directed to its target mRNA to perform its function, while the miRNA* is degraded. Furthermore, miRNAs are typically derived from genomic segments different from the predicted protein-coding regions.

[0047] As used herein, the term "premiRNA precursor" ("premiRNA" or "pre-miRNA") refers to a portion of the primary transcript of the miRNA from which it is processed into a mature miRNA. Typically, pre-miRNA folds into a stable hairpin (i.e., double-stranded) or stem-loop structure. Hairpin structures are typically 50-80 nucleotides in length, preferably 60-70 nucleotides (counting miRNA residues, residues that pair with the miRNA, and any intercalation segments, but excluding more distal sequences).

[0048] As used herein, the term "nucleic acid molecule encoding a microRNA sequence" refers to any nucleic acid molecule that encodes a microRNA (miRNA). Therefore, this term refers not only to mature miRNAs but also to the corresponding precursor miRNAs and primary miRNA transcripts as described above. Furthermore, this invention is not limited to RNA molecules but also includes corresponding DNA molecules encoding microRNAs, such as DNA molecules produced by reverse transcription of miRNA sequences. Nucleic acid molecules encoding the microRNA sequences of this invention typically encode a single miRNA sequence (i.e., an individual miRNA). However, it is also possible for such nucleic acid molecules to encode two or more miRNA sequences (i.e., two or more miRNAs), for example, a transcription unit may contain two or more miRNA sequences controlled by commonly used regulatory sequences such as promoters or transcription terminators.

[0049] The term "nucleic acid molecule encoding a microRNA sequence" as used herein is also understood to include both "sense nucleic acid molecules" (i.e., molecules whose nucleic acid sequence (5'→3') matches or corresponds to the encoded miRNA (5'→3') sequence) and "antisense nucleic acid molecules" (i.e., molecules whose nucleic acid sequence is complementary to the encoded miRNA (5'→3') sequence, or in other words, molecules whose nucleic acid sequence matches the reverse complementary sequence (3'→5') of the encoded miRNA sequence). The term "complementary" as used herein refers to the ability of an "antisense" nucleic acid molecule sequence to form base pairs with a corresponding "sense" nucleic acid molecule sequence (a sequence complementary to the antisense sequence), preferably Watson-Crick base pairs.

[0050] Within the scope of this invention, two nucleic acid molecules (i.e., “sense” and “antisense” molecules) can be perfectly complementary, meaning they do not contain any base mismatches and / or extra or missing nucleotides. Alternatively, the two molecules may contain one or more base mismatches or differ in their total number of nucleotides (due to additions or deletions). Preferably, the “complementary” nucleic acid molecule comprises at least 10 consecutive nucleotides that are perfectly complementary to the sequence contained in the corresponding “sense” nucleic acid molecule.

[0051] Therefore, the various nucleic acid molecules encoding miRNA sequences included in the diagnostic kits of the present invention may include one or more “sense nucleic acid molecules” and / or one or more “antisense nucleic acid molecules.” Sometimes, the diagnostic kit includes one or more “sense nucleic acid molecules” (i.e., the miRNA sequence itself) that are considered to constitute the whole or at least a subset of differentially expressed miRNAs (i.e., molecular markers), which are indicators of the presence or occurrence of a specific disease predisposition, in this case, hepatocellular carcinoma. On the other hand, when the diagnostic kit includes one or more “antisense nucleic acid molecules” (i.e., sequences complementary to the miRNA sequence), the molecules may contain probe molecules (for hybridization assays) and / or oligonucleotide primers (e.g., for reverse transcription or PCR applications) suitable for detecting and / or quantifying one or more specific (complementary) miRNA sequences in a given sample.

[0052] The various nucleic acid molecules defined in this invention may include at least 2, at least 10, at least 50, at least 100, at least 200, at least 500, at least 1000, at least 10000, or at least 100000 nucleic acid molecules, each of which encodes a miRNA sequence.

[0053] The term "differential expression" as used in this article refers to a change in the expression level of a specific miRNA in target plasma exosomes compared to that in healthy control plasma exosomes. This change can be upregulated (i.e., an increase in miRNA concentration in the target plasma) or downregulated (i.e., a decrease in miRNA concentration or its disappearance in the target plasma). In other words, nucleic acid molecules are activated to higher or lower levels in the target plasma than in the control plasma.

[0054] Within the scope of this invention, nucleic acid molecules are considered to be differentially expressed if the corresponding expression levels of the nucleic acid molecule in target cells and control cells typically differ by at least 5% or at least 10%, preferably at least 20% or at least 25%, and most preferably at least 30% or at least 50%. Thus, the latter value corresponds to an upregulation of the expression level of a given nucleic acid molecule in target cells by at least 1.3-fold or at least 1.5-fold compared to wild-type control cells, or conversely, a downregulation of the expression level in target cells by at least 0.7-fold or at least 0.5-fold.

[0055] The term “expression level” as used in this article refers to the degree to which a specific miRNA sequence is transcribed from its genomic locus, i.e., the concentration of miRNA in one or more analyzed plasmas.

[0056] As mentioned above, the term "control plasma" typically refers to (healthy) plasma that does not exhibit the phenotype of hepatocellular carcinoma. However, in some applications, such as when comparing plasmas showing different cancerous or precancerous states, plasma with less severe disease characteristics is typically considered "control plasma."

[0057] In specific implementations, standardized values ​​of expression levels obtained from several independent measurements (e.g., two, three, five, or ten measurements) and / or from several measurements within a group of target or control plasma samples are used for analysis. Standardized values ​​can be obtained using any method known in the art. For example, a range of mean ± 2 SD (standard deviation) or mean ± 3 SD can be used as standardized values.

[0058] Differences in exosomal miRNA expression levels between obtained disease or control plasmas can be normalized to the expression levels of further control nucleic acids, such as housekeeping genes, whose expression levels are known to vary regardless of the disease state of the individual from whom the sample was obtained. Examples of housekeeping genes include β-actin, glyceraldehyde-3-phosphate dehydrogenase, and ribosomal protein P1. In a preferred embodiment of this patent, the control nucleic acid is a small nuclear miRNA—U6—known to be stably expressed in different non-cancerous and pre-cancerous states of the collected samples.

[0059] However, instead of measuring expression levels in plasma samples in any experiment, one or more cutoff values ​​can be defined based on experimental evidence and / or existing technical data for a specific disease phenotype (i.e., disease state). In this case, the individual expression levels of plasma samples can be determined using a stable control miRNA for normalization. If the calculated "normalized" expression level is higher than the corresponding defined cutoff value, this finding is an indication of upregulated gene expression. Conversely, if the calculated "normalized" expression level is lower than the corresponding defined cutoff value, this finding is an indication of downregulated gene expression.

[0060] In the context of this invention, the term "identification of hepatocellular carcinoma" also includes prediction and probability analysis (in the "diagnostic" sense). The compositions and methods disclosed herein are intended for clinical application to determine the form of treatment, including therapeutic interventions, diagnostic criteria such as disease stage, and disease monitoring and surveillance. According to the invention, intermediate results can be provided regarding the condition of a subject. These intermediate results can be combined with additional information to assist physicians, nurses, or other practitioners in diagnosing that the subject has the disease. Alternatively, the invention can be used to detect cancer cells in tissues derived from a subject and provide useful information to physicians for diagnosis.

[0061] In this invention, one or more differentially expressed nucleic acid molecules identified together represent a nucleic acid expression biomarker, which is an indicator of the presence of hepatocellular carcinoma through plasma samples. As used herein, the term "expression biomarker" refers to a group of nucleic acid molecules (e.g., miRNAs) whose expression levels differ between hepatocellular carcinoma plasma exosome samples and healthy control samples. In this invention, nucleic acid expression biomarker also refers to a group of markers representing a minimum number of (different) nucleic acid molecules, each encoding a miRNA sequence that identifies an individual's phenotypic state.

[0062] In a first aspect, the present invention relates to a diagnostic kit for identifying molecular markers in exosomes of target plasma exhibiting hepatocellular carcinoma, the kit comprising a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, wherein one or more of the plurality of nucleic acid molecules are differentially expressed in the target plasma and in one or more control plasmas, wherein the one or more differentially expressed nucleic acid molecules together represent a nucleic acid expression biomarker, the nucleic acid expression biomarker being an indication of the presence of hepatocellular carcinoma.

[0063] The nucleic acid expression biomarkers defined in this article may include at least five nucleic acid molecules and a group of nucleic acid molecules composed of the above nucleic acid molecules.

[0064] In an implementation scheme, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence, the expression of which is downregulated in one or more target plasmas compared with one or more healthy controls.

[0065] Typically, the nucleic acid molecules included in nucleic acid expression biomarkers are human sequences (hereafter referred to as "has" (Homo sapiens)).

[0066] In the implementation scheme, the nucleic acid expression biomarker includes any one or more nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, and hsa-miR-1250-5p, as well as the internal reference labeling small nuclear RNA sequence U6.

[0067] To normalize the expression levels obtained from nucleic acid expression biomarkers encoding microRNA sequences, nucleic acid expression molecules of the small nuclear RNA sequence U6 can be used, which are relatively stable in hepatocellular carcinoma plasma exosomes.

[0068] Table 1: Nucleic acid sequence listing of the above miRNAs

[0069]

[0070] All miRNA and U6snRNA sequences disclosed in this article have been stored in the miRBase database (http: / / microrna.sanger.ac.uk / ) and the NCBI GenBank database (https: / / www.ncbi.nlm.nih.gov / nuccore).

[0071] Particularly preferably, compared with one or more healthy controls, in one or more target plasmas, the expression of any one or more nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248 and hsa-miR-1250-5p is downregulated, while the expression of the small nuclear RNA sequence U6 is relatively stable.

[0072] As used herein, the terms “one or more of the plurality of nucleic acid molecules” and “any one or more human target cell-derived nucleic acid molecules” may refer to any subgroup of the plurality of nucleic acid molecules, such as any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, etc., each of which encodes a microRNA sequence contained within the nucleic acid expression characteristics.

[0073] In a more preferred embodiment, the nucleic acid expression biomarker includes encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, hsa-miR-1250-5p, (hsa-miR-212-5p-U6), (hsa-miR-519b-3p-U6), (hsa-miR-1248-U6), (hsa-miR-1250-5p-U6), hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 / U6, hsa-miR-1250-5p / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 ...50-5p / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p Any one or more nucleic acid combinations of U6, hsa-miR-1250-5p / U6, hsa-miR-212-5p / hsa-miR-519b-3p, hsa-miR-212-5p / hsa-miR-1248, hsa-miR-212-5p / hsa-miR-1250-5p, hsa-miR-519b-3p / hsa-miR-1248, hsa-miR-519b-3p / hsa-miR-1250-5p, and hsa-miR-1248 / hsa-miR-1250-5p.

[0074] The term "nucleic acid combination" as used in this article refers to the overall application of at least two nucleic acid expression levels. Preferably, the overall combination can be achieved using a formula to utilize relative changes or calculation results.

[0075] In a second aspect, the present invention relates to a diagnostic kit for molecular markers used to distinguish individuals from healthy individuals in monitoring early recurrence after liver cancer surgery, the kit comprising a plurality of nucleic acid molecules, each encoding a microRNA sequence.

[0076] The nucleic acid expression biomarkers defined in this article may include at least five nucleic acid molecules and a group of nucleic acid molecules composed of the above nucleic acid molecules.

[0077] In an implementation scheme, the nucleic acid expression biomarker comprises at least one nucleic acid molecule encoding a microRNA sequence, the expression of which is downregulated in one or more target plasmas compared with one or more healthy controls.

[0078] In the implementation scheme, the nucleic acid expression biomarker includes any one or more nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, and hsa-miR-1250-5p, as well as the internal reference labeling small nuclear RNA sequence U6.

[0079] Table 2: Nucleic acid sequence listing of the above miRNAs

[0080]

[0081] All miRNA and U6snRNA sequences disclosed in this article have been stored in the miRBase database (http: / / microrna.sanger.ac.uk / ) and the NCBI GenBank database (https: / / www.ncbi.nlm.nih.gov / nuccore).

[0082] As used herein, the terms “one or more of the plurality of nucleic acid molecules” and “any one or more human target cell-derived nucleic acid molecules” may refer to any subgroup of the plurality of nucleic acid molecules, such as any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, etc., each of which encodes a microRNA sequence contained within the nucleic acid expression characteristics.

[0083] In a more preferred embodiment, the nucleic acid expression biomarker includes encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, hsa-miR-1250-5p, (hsa-miR-212-5p-U6), (hsa-miR-519b-3p-U6), (hsa-miR-1248-U6), (hsa-miR-1250-5p-U6), hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 / U6, hsa-miR-1250-5p / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p / U6, hsa-miR-1248 ...50-5p / U6, hsa-miR-212-5p / U6, hsa-miR-519b-3p Any one or more nucleic acid combinations of U6, hsa-miR-1250-5p / U6, hsa-miR-212-5p / hsa-miR-519b-3p, hsa-miR-212-5p / hsa-miR-1248, hsa-miR-212-5p / hsa-miR-1250-5p, hsa-miR-519b-3p / hsa-miR-1248, hsa-miR-519b-3p / hsa-miR-1250-5p, and hsa-miR-1248 / hsa-miR-1250-5p.

[0084] Example

[0085] Example 1: Patient Materials

[0086] In the sequencing study, blood samples were collected from three HCC patients and three healthy individuals in 2019. All patients provided informed consent for participation in the scientific research. Tissue sample collection was conducted in accordance with protocols, with all samples obtained prior to surgical procedures and approved by the hospital association's review committee.

[0087] In the training study, blood samples were collected from 40 HCC patients and 15 healthy individuals between 2018 and 2019. All patients provided informed consent for participation in the scientific study. Tissue sample collection was conducted in accordance with protocols approved by the hospital association's review committee, and all samples were obtained prior to surgical procedures.

[0088] In the validation study, blood samples were collected from 60 HCC patients and 19 healthy individuals between 2019 and 2021. All patients provided informed consent for participation in the scientific study. Tissue samples were collected in accordance with protocols approved by the hospital association's review committee, and all samples were obtained prior to surgical procedures.

[0089] The basic characteristics of blood samples used in sequencing, training, and validation studies are detailed in Table 3.

[0090] Table 3: Basic Features Discovered and Validated

[0091] Blood exosome samples sequencing train verify HCC 3 40 60 age 45.33±7.37 56.10±12.06 51.22±10.86 Gender (Female: Male) 0:3 9:31 5:55 healthy individuals 3 15 19 age 42.33±14.15 59.13±11.36 50.47±13.69 Gender (Female: Male) 1:2 8:7 9:10

[0092] Patient data (age, sex, etc.) are obtained from the hospital database. Tumor pathology is performed independently by three pathologists according to the World Health Organization's tumor classification system. Pathological follow-up (e.g., histological analysis via hematoxylin and eosin (H&E) staining) definitively determines the disease state of a given sample (i.e., healthy control, adenoma, adenocarcinoma, or intermediate state) and ensures consistency in sample classification.

[0093] Example 2: Sample collection, exosome isolation, and exosome RNA extraction, see [link to example]. Figure 1 The flowchart illustrates the steps of the present invention for determining expressed biomarkers, which are used for early screening and detection of HCC, early detection of tumor recurrence after liver cancer surgery, and monitoring changes in the patient's condition after surgical treatment.

[0094] All blood samples were collected in anticoagulant tubes, and plasma was collected within 3 hours of isolation. Blood samples were centrifuged at 3000×g for 10 minutes at 4°C, and plasma was stored in liquid nitrogen for exosome separation. Plasma exosome extraction was completed within 24 hours. Plasma samples were diluted with phosphate-buffered saline (PBS), filtered through a 0.22 μm filter, and centrifuged at 150000×g for 2 hours at 4°C. The precipitate was resuspended in cold PBS and centrifuged at 150000×g for 2 hours at 4°C. The precipitate was collected and resuspended in 150 μL PBS for exosome identification, and the remaining sample was then used for RNA extraction. RNA was extracted using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. RNA was quantified using a Nano-Drop spectrophotometer (Thermo Fisher Scientific).

[0095] Example 3: Hepatocellular carcinoma-associated plasma exosome sequencing

[0096] High-throughput sequencing of exosomal miRNAs was performed by Aksomics. In short, total RNA samples were run on agarose gels, and miRNA bands were excised for cDNA library construction. The cDNA libraries were then sequenced using an Illumina NextSeq 500 sequencer. After quality control of the raw sequencing data, the final data were compared with a reference genome, followed by miRNA expression quantification and differential expression screening. Sequencing results are shown below. Figure 2 , Figure 2 A heatmap of differentially expressed miRNAs from exosomal miRNA samples was generated, and a total of 1030 differentially expressed miRNAs were screened for further selection. Based on the sequencing results, further screening was conducted, resulting in candidate exosomal miRNAs (Table 4).

[0097] Table 4: Expression levels of candidate exosomal miRNAs

[0098]

[0099]

[0100] Example 4: Secondary screening of exosomal miRNAs

[0101] The expression of candidate exosomal miRNAs in the training group samples was further screened using qRT-PCR. Significant differences were found in the expression levels of hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, and hsa-miR-1250-5p (Table 5). ROC curves were plotted based on the expression levels in the training group samples; see [link to ROC curves] for details. Figure 3 , Figure 3 The figure illustrates human miRNAs included in preferred miRNA biomarkers obtained on a microarray according to the first aspect of the invention, for the identification of single plasma exosomal miRNAs in hepatocellular carcinoma. The data are normalized against the internal stable control small nuclear RNA sequence U6. The figure also shows the AUC of these miRNAs from hepatocellular carcinoma patients compared to healthy controls, demonstrating that the data reliably distinguish hepatocellular carcinoma patients from healthy individuals in blood samples.

[0102] Table 5: Differential expression and diagnostic efficacy of exosomal miRNAs after secondary screening

[0103]

[0104]

[0105] Example 5: Validation of the diagnostic efficacy of exosomal miRNA combinations

[0106] Using SPSS (25.0, IBM) software and the exosomal miRNA expression data from the training group samples in Example 4, a logistic regression equation was established to construct a diagnostic model. The formula is as follows, and its diagnostic ROC curve is shown in the figure. Figure 4 ,Depend on Figure 4 The model showed an area under the ROC curve of 0.8343 for all participants in the study, a 95% confidence interval of 0.7618–0.9067, a sensitivity of 67%, and a specificity of 88.24%, indicating high diagnostic efficacy.

[0107] logit(p=HCC)=0.116×ΔCt(miR-212-5p)+0.297×ΔCt(miR-519b-3p)+0.114×ΔCt(miR-1248)+0.341×ΔCt(miR-1250-5p)-8.023

[0108] The expression levels of hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, hsa-miR-1250-5p, and small nuclear RNA U6 in the validation group samples were detected by qRT-PCR, and the relative expression levels were calculated. The validation group consisted of 79 samples (60 HCC samples and 19 healthy controls). The prediction results are shown in Table 6, with a true positive rate of 75% and a true negative rate of 73.68%. The diagnostic efficacy of the diagnostic model was analyzed using plasma exosomal miRNA data from all participants in the study, and corresponding ROC curves were plotted. Figure 4 The model had an area under the ROC curve of 0.8343 for all participants in the study, a 95% confidence interval of 0.7618–0.9067, a sensitivity of 67%, and a specificity of 88.24%, which can be considered as having high diagnostic efficacy.

[0109] Table 6: Validation Results of the Diagnostic Model

[0110]

[0111] Example 6: A method for quantifying exosomal miRNA biomarkers

[0112] For qualitative determination, the following nucleic acid expression biomarkers were selected: hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248, and hsa-miR-1250-5p, as well as the internal reference labeling small nuclear RNA sequence U6.

[0113] To normalize the expression levels of nucleic acid molecules (i.e., nucleic acid molecules encoding microRNA sequences contained in nucleic acid expression biomarkers) in plasma, an internal reference can be used to label the small nuclear RNA sequence U6, which is relatively stable in the plasma exosomes of hepatocellular carcinoma.

[0114] The purity and integrity of the extracted exosome total RNA were determined using a Nanodrop spectrophotometer. An absorbance of 2.0 (260nm / 280nm) was optimal, indicating relatively pure RNA. However, high purity does not necessarily mean good RNA integrity. A reaction mixture of 2 μL 6x Loading buffer, 4 μL total RNA, and 6 μL ddH2O was prepared for agarose gel electrophoresis. The electrophoretic pattern of intact, undegraded RNA should clearly show three bands: 18S rRNA, 28S rRNA, and 5S rRNA, with the 28S rRNA band being twice as bright as the 18S rRNA band.

[0115] This patent specifies the use of a particular method to reverse transcribe the aforementioned miRNA and small nuclear RNA sequence U6. In this study, the qPCR reaction system for preparing exosomal miRNAs was prepared using the miDETECT ATrack™ miRMA qPCR kit from Ribobio.

[0116] The first step is to tail the miRNA: Prepare the reaction system according to the configuration ratio in Table 7 on ice. After the configuration is complete, mix the above reaction system and react at 37°C for 1 hour. After the reaction is complete, place the Poly(A)Tailing product on ice for later use, or store it in an ultra-low temperature freezer at -80°C for later use.

[0117] Table 7: Poly(A) tailing reaction system (prepared on ice)

[0118]

[0119] Note: The reaction system can be scaled up as needed, but a 20 μL reaction system should not exceed 5 μg of total RNA.

[0120] The second step involves reverse transcription of the miRNA tailing product: The reverse transcription reaction system was prepared on ice, with the proportions shown in Table 8. After mixing, the system was incubated at 42°C for 1 hour, followed by incubation at 72°C for 10 minutes. The resulting product was cDNA, which can be stored on ice or at -20°C.

[0121] Table 8: Reverse transcription reaction system for tailed products (prepared on ice)

[0122]

[0123] The third step is to prepare the qRT-PCR reaction system. Prepare the reaction system as shown in Table 9 on ice. Add the solution from this reaction system to a 384-well plate and mix well. The qPCR reaction is performed using a suitable PCR instrument. The reaction system is as follows: 95℃ for 10 min, 95℃ for 2 s, 60℃ for 20 s, 70℃ for 10 s, for a total of 40 cycles.

[0124] Table 9: qRT-PCR reaction system (prepared on ice)

[0125]

[0126] Typically, at least three independent experiments were performed for each measurement, and the determined miRNA expression levels represent the average of the individually obtained data. The average expression levels of the four selected miRNAs were normalized against the stably expressed control small nuclear RNA sequence U6 using the following formula:

[0127] Log2([miRNA expression level]-[U6 expression level]).

[0128] The identification of miRNA expression biomarkers in this invention provides a unique molecular marker that enables the screening, detection, and diagnosis of hepatocellular carcinoma via plasma exosomes. Furthermore, this expression biomarker may be used to monitor treatment response in hepatocellular carcinoma patients and guide treatment decisions.

[0129] The invention described herein by example can be suitably carried out without any of the elements or limitations specifically disclosed herein. Therefore, terms such as “comprising,” “including,” and “containing” should be used broadly and without limitation. Furthermore, the terms and expressions used herein are intended to describe the invention without limitation, and their use does not exclude any equivalents of the features and descriptions shown or any part thereof, but it should be appreciated that various modifications can be made within the scope of the claimed invention. Therefore, it should be understood that despite the specific disclosure of the invention by way of embodiments and optional features, modifications and changes can be made to the invention by those skilled in the art, and such modifications and changes are considered to be within the scope of the invention.

[0130] This invention is described broadly and generally. Each narrower subordinate concept and sub-superordinate set falling within the scope of the superordinate description also forms part of this invention. This includes superordinate descriptions of the invention that are conditional or negatively restrictive of any subject matter removed from the superordinate, regardless of whether the removed subject matter is specifically cited herein.

[0131] Other embodiments are within the scope of the following claims. Furthermore, when features or aspects of the invention are described in a Markush manner, those skilled in the art will recognize that the invention is also described in any of the various members or subgroups of the Markush group.

[0132] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style of the specification is merely for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

[0133] Based on the disclosure and teachings of the foregoing specification, those skilled in the art can make changes and modifications to the above embodiments. Therefore, the present invention is not limited to the specific embodiments described above, and any obvious improvements, substitutions, or modifications made by those skilled in the art based on the present invention are within the scope of protection of the present invention. Furthermore, although some specific terms are used in this specification, these terms are only for convenience of explanation and do not constitute any limitation on the present invention.

Claims

1. A nucleic acid composition for a hepatocellular carcinoma early diagnosis kit, characterized by: The nucleic acid composition comprises a plurality of nucleic acid molecules, each nucleic acid molecule encoding a microRNA sequence, the plurality of differentially expressed nucleic acid molecules together representing a nucleic acid expression biomarker, the nucleic acid expression biomarker consisting of the plurality of differentially expressed nucleic acid molecules, the nucleic acid expression biomarker being indicative of the presence of hepatocellular carcinoma, wherein the nucleic acid expression biomarker comprises nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248 and hsa-miR-1250-5p and the internal reference marker small nuclear RNA sequence U6, the nucleotide sequence of hsa-miR-212-5p being ACCUUGGCUCUAGACUGCUUACU, the nucleotide sequence of hsa-miR-519b-3p being AAAGUGCAUCCUUUUAGAGGUU, the nucleotide sequence of hsa-miR-1248 being ACCUUCUUGUAUAAGCACUGUGCUAAA, the nucleotide sequence of hsa-miR-1250-5p being ACGGUGCUGGAUGUGGCCUUU, the nucleotide sequence of small nuclear RNA sequence U6 being GTGCTCGCTTCGGCAGCACATATACTAAAATGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT.

2. The nucleic acid composition for use in a kit for early diagnosis of hepatocellular carcinoma according to claim 1, characterized in that: The nucleic acid expression biomarker comprises at least 5 nucleic acid molecules and / or at least 5 combinations of nucleic acid molecules.

3. The nucleic acid composition for use in a kit for early diagnosis of hepatocellular carcinoma according to claim 1, wherein: The nucleic acid expression biomarker comprises nucleic acid molecules encoding microRNA sequences, the expression of which is down-regulated in the target plasma compared to the healthy control. ​ 4. The nucleic acid composition for use in a kit for the early diagnosis of hepatocellular carcinoma according to any one of claims 1 to 3, characterized in that: The expression of nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248 and hsa-miR-1250-5p is down-regulated in the target plasma exosome sample compared to the healthy control, while the expression of small nuclear RNA U6 is unchanged. The nucleic acid expression biomarker comprises at least 5 nucleic acid molecules and / or at least 5 combinations of nucleic acid molecules. The nucleic acid expression biomarker comprises nucleic acid molecules encoding microRNA sequences, the expression of which is down-regulated in the target plasma compared to the healthy control. The expression of nucleic acid molecules encoding hsa-miR-212-5p, hsa-miR-519b-3p, hsa-miR-1248 and hsa-miR-1250-5p is down-regulated in the target plasma exosome sample compared to the healthy control, while the expression of small nuclear RNA U6 is unchanged.

Images