A molecular marker related to Parkinson's disease, its detection kit and application

Abstract

The present invention belongs to the field of biomedical detection technology, and discloses a mutation site associated with Parkinson's disease (PD), a detection kit and an application thereof. The present invention screens out a molecular marker associated with Parkinson's disease, and the base sequence of the molecular marker is shown in SEQ ID NO: 2, which is a missense mutation from A to G in exon 11 of the USP8 gene. The molecular marker of the present invention can cause abnormal accumulation of α-Syn in dopamine neurons (DAn), which causes functional damage to DAn cells and leads to the occurrence of PD. The present invention provides new targets and pathways for the prediction and treatment of PD, and has good clinical application value for the prevention and treatment of PD.

Description

Technical Field

[0001] The present invention relates to the field of biomedical detection technology, and in particular to a molecular marker associated with Parkinson's disease, a detection kit thereof and an application thereof. Background Art

[0002] Parkinson's disease (PD) is a disease caused by abnormal damage to dopaminergic neurons (DAn) in the substantia nigra of the midbrain, which manifests as involuntary tremors and movement disorders. In severe cases, patients cannot take care of themselves. PD is the second most common neurodegenerative disease, second only to Alzheimer's disease, and its occurrence and development seriously endanger people's health and life.

[0003] When PD patients develop behavioral disorders, some DAn cells in the substantia nigra have already died and the condition continues to worsen and worsen. Therefore, early diagnosis and prevention of PD are very important. However, there are currently no good targets for predicting the occurrence of PD, which makes it difficult to prevent and treat PD in advance clinically.

[0004] The abnormal accumulation of α-synuclein (α-Syn) in the substantia nigra of the midbrain is a pathological feature of PD. This conclusion has been widely confirmed in autopsies of PD patients and in vitro basic research experiments. Reducing its α-Syn accumulation can rescue the pathological phenotype of PD DAn cells (PD-DAn) and play a therapeutic effect on PD. The mechanisms of α-Syn accumulation reported so far include: mutation of the α-Syn regulatory gene SNCA, abnormal lysosomal autophagy and degradation pathways, abnormal activation of glial cells, influence of intestinal flora metabolites, and abnormal α-Syn phosphorylation modification. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a molecular marker related to Parkinson's disease, a detection kit and application thereof.

[0006] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0007] In the first aspect, the present invention screens out a molecular marker associated with Parkinson's disease, the base sequence of the molecular marker is shown in SEQ ID NO: 2, which is a missense mutation from A to G in exon 11 of the USP8 gene. The SNP sequence is CCTCAGAGTGGAAAAGTTATTCCTG[A / G]TCGTTCCACCAAGCCAGTAGTTTTT, the sequences in hg19 and hg38 are consistent, the codon GAT mutates to GGT, and aspartic acid (D) becomes glycine (G).

[0008] Point mutation USP8 of the present invention D442G It is closely related to the abnormal accumulation of α-Syn and provides new targets and pathways for the prediction and treatment of PD.

[0009] In a second aspect, the present invention provides a primer for detecting the molecular marker, wherein the base sequence of the primer is shown in SEQ ID NO: 3, SEQ ID NO: 4; or SEQ ID NO: 5, SEQ ID NO: 6.

[0010] In a third aspect, the present invention provides a kit for detecting susceptibility to Parkinson's disease, comprising the primers described above.

[0011] In a fourth aspect, the present invention provides a drug for treating Parkinson's disease, wherein the drug is an inhibitor that inhibits the missense mutation.

[0012] In a fifth aspect, the present invention uses the molecular markers, the primers, and the kit in the preparation of a drug for evaluating human susceptibility to Parkinson's disease.

[0013] As a preferred implementation of the application of the present invention, the determination is made by detecting whether the missense mutation exists.

[0014] Furthermore, if the missense mutation exists, the patient is susceptible to Parkinson's disease; if the missense mutation does not exist, the patient is not susceptible to Parkinson's disease.

[0015] In a sixth aspect, the present invention uses the molecular marker, the primer, and the kit in the preparation of a drug for preventing or treating Parkinson's disease.

[0016] In a seventh aspect, the present invention uses the drug in the preparation of a medicament for preventing or treating Parkinson's disease.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] The molecular marker of the present invention, namely USP8 D442G Point mutations can lead to abnormal accumulation of α-Syn in DAn, which eventually causes functional damage to DAn cells and leads to the occurrence of PD. D442G Point mutations in USP8 can predict human susceptibility to PD; detection of USP8 in PD patients D442G The mutation of USP8 can provide a theoretical basis for the pathogenesis and clinical treatment of PD in this patient. D442G Correcting the mutation through mutated expression or gene modification can prevent and treat PD.

[0019] The present invention provides new targets and pathways for the prediction and treatment of PD, and has great clinical application value for the prevention and treatment of PD. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The sequence of wild-type and mutant USP8 (A) and the D442G mutation of USP8 (i.e., USP8 MT ) Mutation rate statistics in normal subjects (B) and PD patients (C);

[0021] Figure 2 To overexpress USP8 WT / MT The successful construction of NSC cell lines was verified, and the results showed that the overexpression cell lines expressed higher mRNA and protein of USP8 than the cells before overexpression;

[0022] Figure 3 To overexpress USP8 WT / MT Detection of α-Syn protein expression in DAn cells differentiated from NSCs at day 40 (n=3, *P<0.05);

[0023] Figure 4 To overexpress USP8 WT / MT Detection of α-Syn protein expression in DAn cells differentiated from NSCs at 60 days (n=3, *P<0.05, **P<0.01). DETAILED DESCRIPTION

[0024] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0025] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0026] Statistical analysis of the following examples: All experiments were repeated at least 3 times independently, and the results were expressed as mean values ​​and standard deviations, and analyzed using one-way analysis of variance and T-test. All statistical analyses used P<0.05 as the test standard for significant statistical differences, and the analysis software was SPSS 16.0 and GraphPad Prism 5.

[0027] Embodiment 1:

[0028] The present invention discovered a mutation site D442G (rs3743044) in the USP8 gene. Figure 1 As shown in A.

[0029] The skin cells of PD and their normal siblings (non-PD) were sequenced for whole genome. Six early-onset PD patients and two healthy people (siblings of PD3 and PD4) were selected for whole genome sequencing. Statistical analysis was performed based on the 1000 Genome Database, 90 Han Chinese Genome Database, 10,000 Genome Database and sequencing data of two healthy people to find gene mutation points with high mutation rates in the six PD patients and low mutation rates in healthy people. Nearly 50 gene mutation points (SNPs) were screened, and then the mutation rates in PD and healthy people were detected by expanding the samples. Blood was obtained from 55 PD patients and 50 healthy people, DNA was extracted, and PCR-Sanger sequencing was performed by designing primers that can amplify the target SNP fragments. The PCR primers are shown in Table 1.

[0030] Sequencing results showed that USP8 D442G The incidence in PD patients is about 23.6%, and the incidence in healthy people is only 10.9%. Fathmm-XF, SIFT and PolyPhen-2 software were further used to predict the harmfulness of the rs3743044 (chr15:50773787:A / G) mutation. All three software predicted it to be a harmful mutation.

[0031] USP8 of 55 PD patients D442G The incidence rate was statistically analyzed in combination with the age of the patient. The results showed that 13 of the 55 PD patients had USP8. D442G The incidence rate was 23.6%, of which 10 people were aged 40-50 years old, and 4 of them had USP8 D442G mutation (40%); 14 patients aged 50-60 years, 5 of whom had USP8 D442G Mutation (36%); 19 patients aged 60-70 years, 3 of whom had USP8 D442G Mutation (16%); 12 patients aged 70-80 years had USP8 mutation D442G Mutation (8%). Detailed information is shown in Table 2 below.

[0032] Table 1 USP8 PCR amplification sequencing primers

[0033] Gene Forward(5' to 3') Reverse(5' to 3') USP8 AGTTCCAGTGATGTTTGA TCTTTCTGTTCCTCTTGC

[0034] Table 2 Different age of illness and USP8 D442G Occurrence statistics

[0035] Age of illness (years) Number of people <![CDATA[USP8 WT Number of people]]> <![CDATA[USP8 D442G Number of people]]> <![CDATA[USP8 D442G Incidence (%)]]> 40-50 10 6 4 40％ 50-60 14 9 5 36％ 60-70 19 16 3 16％ 70-80 12 11 1 8％

[0036] The USP8 gene is a 130kDa (1118AA) protein molecule with 83707bp bases and 20 exons. rs3743044 is a missense mutation in exon 11, and its SNP sequence is CCTCAGAGTGGAAAAGTTATTCCTG[A / G]TCGTTCCACCAAGCCAGTAGTT TTT. The sequences in hg19 and hg38 are consistent, and the codon GAT mutates to GGT, from aspartic acid (D) to glycine (G). The wild-type sequence is shown in SEQ ID NO: 1, and the missense mutation sequence is shown in SEQ ID NO: 2.

[0037] The structural information of USP8-encoded protein P40818 was queried in the PDB database. The region where the mutation point was located was not a known motif and was predicted to be a disordered region. The Predict Protein software was used to predict the structure and function of protein P40818. Four different methods predicted that the mutation position was a disordered region. The effect of amino acid substitution on function was predicted. The harmful score of amino acid substitution from D to G in this region was the largest among the 20 amino acids, suggesting that it may affect function. The variability of disordered proteins or disordered regions has become an essential element of some biochemical reactions because they provide a wider range of structural selectivity. The lack of a specific structure allows them to bind to more proteins with different structures, and disordered proteins or disordered regions are often associated with diseases.

[0038] like Figure 1 As shown in B and C. The results show that USP8 of 50 normal people D442G (i.e. USP8 MT ) mutation rate was 10.9%, and USP8 in 56 PD patients D442G (i.e. USP8 MT ) mutation rate is 23.6%. The mutation rate of this mutation site in PD patients is significantly higher than that in normal healthy people. The mutation rate in PD patients is about twice that of normal healthy people. The mutation rate of different age groups was statistically analyzed and it was found that USP8 D442G The mutation rate is higher in early-onset and familial PD.

[0039] Embodiment 2:

[0040] Plasmid pLenti (purchased from addgene, pLenti-CMV-GFP-Puro, addgene-17448) was selected to construct a recombinant expression vector to express USP8 WT and USP8 D442G (USP8 MT ).

[0041] By designing primers (sequences are shown in Table 3), the mRNA fragment of USP8 was amplified by PCR using the DNA of healthy human PD4C and PD patient PD4 as templates, namely, the gene cloning experiment. The pLenti vector was double-digested with XbaI and SalI, and the PCR product (gel recovery) was double-digested with XbaI and SalI. The two digestion products were connected by T4. The connected products were transformed into DH5α competent state, and the transformation products were evenly spread on LB-agarose culture plates with ampicillin. The clones were selected for colony PCR. PCR was performed with the primers in Table 3. The PCR products were subjected to DNA agarose electrophoresis experiment. If a band of 3354 bp was obtained, it was possible that the clones were successfully connected. These clones were sequenced by Sanger sequencing with the universal primer CMV forward primer. Five reactions were measured, and each reaction measured 800bp-1000bp, that is, the sequence of about 4000bp after CMV was measured. These sequences were compared with the sequence of USP8 mRNA to obtain the overexpression plasmid with the correct sequence. The plasmid derived from PC4C is USP8. WT , the plasmid from PD4 is USP8 D442G (Carrying rs3743044 mutation). The successfully constructed plasmid was stored at -80°C for the subsequent construction of a stable overexpression neural stem cell line.

[0042] According to the method in the literature (Li W, Proc Natl Acad Sci, 2011), iPSCs were differentiated into NSCs to obtain PD4C-NSCs and PD4-NSCs. In PD4C-NSCs and PD4-NSCs, USP8 was transfected into them by lentiviral transfection. WT 、USP8 MT The three plasmids, pLenti (empty vector, EV), were transfected into the cells respectively. 48 hours after transfection, puromycin (Puro) was added to the culture medium for screening. The initial concentration of Puro added was 0.5 μg / mL. After 3 days, most of the NSC cells would die. At this time, the Puro concentration was reduced to 0.3 μg / mL, and the surviving NSCs would continue to grow and proliferate under the conditions of Puro.

[0043] By designing primers to detect USP8 mRNA expression, we tested the expression of USP8 in NSC cells after overexpression. We designed three primers, namely, primers to detect USP8 mRNA expression (across the mutation point) (USP8 total ), primers for detecting wild-type USP8 mRNA expression (USP8 WT ) and for USP8 D442G Mutation primer (USP8 MT), the primer sequences are shown in Table 4. The experimental results showed that the constructed NSC cell lines highly expressed the target USP8 gene (such as Figure 2 A). The expression of USP8 total protein was further detected by Western Blot. The experimental results are shown in Figure 2 As shown in B, the results showed that the overexpression cell lines all highly expressed USP8, proving that the cell lines were successfully constructed.

[0044] Table 3 USP8 gene cloning PCR amplification sequencing primers

[0045]

[0046] Table 4 USP8 overexpression detection primers

[0047] Gene Forward(5' to 3') Reverse(5' to 3') GAPDH CGGAGTCAACGGATTTGGTC GACAAGCTTCCCGTTCTCAG <![CDATA[USP8 total ]]> GTCCAGGAGTCACTGCTAGTT AGGAGCCAGTTTTCATAGCCT USP8WT CAGTTGAACCAGTTGCTGCT CTGGCTTGGTGGAACGAT USP8MT CAGTTGAACCAGTTGCTGCT CTGGCTTGGTGGAACGAC

[0048] Overexpression of empty pLenti and USP8 in neural stem cells (NSCs) of normal subjects (Ctrl) and PD patients (PD) WT or USP8 D442G (USP8 MT), further differentiated into DAn cells, differentiation method: refer to the literature (Li W, Proc Natl Acad Sci, 2011; Woodard CM, Cell Rep, 2014), iPSCs in good cell state were subcultured into 6-well plates, and 1×N2 (invitrogen, 17502-048), 1×B27 (invitrogen, 17504-044), 1% Glutmax (gibco, 100X), and 10 ng / mL hLIF (miltenyi) were added to the neural culture medium Advanced DMEM / F12:Neural Basal (1:1) containing 3μM CHIR99021 and 2μM SB431542. After 7 days of culture, the cells were subcultured at a regular ratio of 1:10. After 14 days of culture, CD133 (CD133-APC, BD Pharmingen-566596) and CD56 (CD56-PE, BD Pharmingen-563238) flow cytometry was used to sort and purify NSC cells. The cell culture medium after sorting was replaced with: DMEM / F12:Neural Basal (1:1), 1×N2 (invitrogen, 17502-048), 1×B27 (invitrogen, 17504-044), 300 ng / mL cAMP (sigma, A9505-1g), 0.2mM Ascorbic acid (Sigma, A4403-100mg), 100ng / mL SHH (miltenyi, 99-130-095-730) and 100ng / mL fgf8b (miltenyi, 99-130-095-741) were added and cultured for 10 days. Then, 10ng / mL BDNF (miltenyi, 99-130-096-286), 10ng / mL GDNF (miltenyi, 99-130-098-449), 10ng / mL IGF (miltenyi, 130-093-886) and 1ng / mL TGF-beta (miltenyi, 130-094-008) were added and differentiation culture was continued for 10 days. CD15 (CD15-APC, BD Pharmingen-551376) / CD184 (CD184-PE-Cy5, BD Pharmingen-555975) double negative and CD24 (CD24-PE, BD Pharmingen-560991) / CD56 (CD56-PE-Cy7, BD Pharmingen-557747) double positive cell population, after sorting and purification, more than 70% of the cells co-express TH / TUJ1 double positive, and have the unique electrophysiological phenomenon of human dopaminergic neuron cells, that is, dopaminergic neuron cells. .

[0049] After sorting, the cells were cultured continuously. After one week of culture, i.e., when DAn cells were differentiated for 40 days, Figure 3 As shown, the expression of α-Syn protein in cells of each experimental group was detected by Westren Blot technology ( Figure 3 The experimental method is the conventional method of Westren Blot total protein detection; and the gray value of the protein band is statistically analyzed using ImageJ software ( Figure 3 (As shown in B), (the experimental method is the conventional method of ImageJ grayscale value analysis, with GAPDH as the internal reference protein), the results show that overexpression of USP8 D442G It can significantly increase the protein accumulation of α-Syn, with statistically significant differences (n=3, *P<0.05).

[0050] Overexpression of empty pLenti, USP8 in neural stem cells of normal subjects (Ctrl) and PD patients (PD) WT or USP8 D442G (USP8 MT ), further differentiated into DAn cells, when DAn cells were differentiated for 60 days, Figure 4As shown, the expression of α-Syn protein in cells of each experimental group was detected by WestrenBlot technology ( Figure 4 The grayscale values ​​of the protein bands were statistically analyzed using ImageJ software ( Figure 4 The results showed that overexpression of USP8 D442G The protein accumulation of α-Syn was significantly increased compared with that at 40 days after overexpression of USP8. D442G The accumulation of α-Syn protein was more serious in DAn cells (n=3, *P<0.05, **P<0.01).

[0051] The above results show that USP8 is a key target of dopaminergic neurons. D442G Dopaminergic neuron cells with point mutations have a higher degree of abnormal accumulation of α-Syn and are damaged. MT Expression of USP8 can reduce the accumulation of α-Syn. MT inhibitors, thereby playing a role in the treatment of PD.

[0052] Abnormal accumulation of α-Syn is one of the pathological phenotypes of dopaminergic neurons in PD. D442G Point mutations may increase the risk of developing PD. D442G Point mutations may increase the risk of PD, USP8 D442G People with point mutations are susceptible to PD and it is hereditary.

[0053] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention. SEQUENCE LISTING <110> Suzhou Jia'an Huayu Biotechnology Co., Ltd. <120> A molecular marker related to Parkinson's disease, its detection kit and application <130> 2022 <160> 14 <170> PatentIn version 3.5 <210> 1 <211> 51 <212> DNA <213> human <400> 1 cctcagagtg gaaaagttat tcctgatcgt tccaccaagc cagtagtttt t 51 <210> 2 <211> 51 <212> DNA <213> HUAMN <400> 2 cctcagagtg gaaaagttat tcctggtcgt tccaccaagc cagtagtttt t 51 <210> 3 <211> 18 <212> DNA <213> synthetic <400> 3 agttccagtg atgtttga 18 <210> 4 <211> 18 <212> DNA <213> synthetic <400> 4 tctttctgtt cctcttgc 18 <210> 5 <211> 28 <212> DNA <213> synthetic <400> 5 gagctctaga atgcctgctg tggcttca 28 <210> 6 <211> 34 <212> DNA <213> synthetic <400> 6 acgcgtcgac ttatgtggct acatcagtta ctcg 34 <210> 7 <211> 20 <212> DNA <213> SYNTHETIC <400> 7 cggagtcaac ggatttggtc 20 <210> 8 <211> 20 <212> DNA <213> SYNTHETIC <400> 8 gacaagcttc ccgttctcag 20 <210> 9 <211> 21 <212> DNA <213> synthetic <400> 9 gtccaggagt cactgctagt t 21 <210> 10 <211> 21 <212> DNA <213> synthetic <400> 10 aggagccagt tttcatagcc t 21 <210> 11 <211> 20 <212> DNA <213> synthetic <400> 11 cagttgaacc agttgctgct 20 <210> 12 <211> 18 <212> DNA <213> synthetic <400> 12 ctggcttggt ggaacgat 18 <210> 13 <211> 20 <212> DNA <213> synthetic <400> 13 cagttgaacc agttgctgct 20 <210> 14 <211> 18 <212> DNA <213> synthetic <400> 14 ctggcttggt ggaacgac 18

Claims

1. Use of a molecular marker associated with Parkinson's disease in the preparation of a drug for evaluating a person's susceptibility to Parkinson's disease, characterized in that: The base sequence of the molecular marker is shown in SEQ ID NO: 2, which is a missense mutation from A to G in the 11th exon of the USP8 gene.

2. Use of a primer in the preparation of a drug for evaluating a person's susceptibility to Parkinson's disease, characterized in that: The base sequences of the primers are shown in SEQ ID NO:3, SEQ ID NO:4; or SEQ ID NO:5, SEQ ID NO:

6.

3. Use of a kit for detecting susceptibility to Parkinson's disease in the preparation of a drug for evaluating a person's susceptibility to Parkinson's disease, characterized in that: The kit includes primers; the base sequences of the primers are shown in SEQ ID NO: 3, SEQ ID NO: 4; or SEQ ID NO: 5, SEQ ID NO:

6.

4. The use according to any one of claims 1 to 3, characterized in that: The determination is made by detecting whether there is a missense mutation; the missense mutation is a missense mutation from A to G in exon 11 of the USP8 gene.

5. The use according to claim 4, characterized in that If the missense mutation is present, the patient is susceptible to Parkinson's disease; if the missense mutation is absent, the patient is not susceptible to Parkinson's disease.

Images