A method for constructing a library of t cell receptors targeting specific tumor cells

Abstract

The application provides a T cell receptor library construction method for targeting specific tumor cells, mainly based on a humanized mouse model established by specific individual steady-state peripheral blood mononuclear cell expansion cells, the humanized mouse has human dendritic cells, monocytes and various T cell subgroups, and then specific tumor cells are added. The application has the immunological characteristics of a specific individual and the specificity of targeting tumor cells, can be used as a treatment and research platform, and provides a TCR-T library capable of recognizing NALM6 and breast cancer tumor cell strain MDA DB antigens, the platform can be used for screening and treatment of patient tumor, especially refractory tumor TCR library, and provides a technical platform for designing specific targeting sequences of chimeric antigen receptor T cells, and is suitable for biomedical research of immunology, basic biological research, design of chimeric antigen receptor immune cells including T cell structure and immunotherapy.

Description

Technical Field

[0001] This invention belongs to the biomedical field and involves cell biology, mouse models, tumor-specific antigen T cells, and the construction of TCR-T libraries targeting tumor antigen diversity, especially a method for constructing a T cell receptor (TCR-T) library targeting specific tumor cells. Background Technology

[0002] Cancer poses a significant threat to human health and life due to its poor prognosis, low cure rate, high metastasis rate, and high mortality rate. Currently, surgical resection, radiotherapy, and chemotherapy are the basic methods for treating cancer. While these methods have improved patient survival rates to some extent, poor quality of life and high recurrence rates of malignant tumors remain key bottlenecks in cancer treatment. Over the past decade, engineered T-cell immunotherapy, represented by chimeric antigen receptor T (CAR-T) cells, has emerged as one of the most promising treatment options in the field of cancer treatment due to its low toxicity, good therapeutic effects, and ability to enhance the patient's immune system.

[0003] However, despite the encouraging effects of CAR-T cells in treating hematologic malignancies, their efficacy against non-hematologic cancers, including metastatic breast cancer which poses a significant threat to human health and life, is very limited. CAR-T cells achieve precise recognition and killing of target tumor cells through their antigenic peptide chains that guide tumor cells, as well as cytotoxic signaling pathways linked to these peptides. Therefore, designing single-chain variable fragments (scFvs) that specifically recognize cancer cells and transfecting them onto T cells is crucial for CAR-T design and killing. However, designing effective binding sequences that recognize specific tumor antigens for scFvs remains a significant challenge. A key issue is that the molecular sequences used to guide the recognition of cancer antigen determinants are still unclear and difficult to determine, requiring consideration of parameters such as affinity, epitope relationships, spatial structure, accessibility, and the cytotoxic function of engineered T cells. Therefore, designing single-chain variable fragments that target tumor antigens is an extremely time-consuming and labor-intensive task, which limits the widespread clinical application of engineered T cells, including CAR-T cells, and also limits their tumor-killing effects.

[0004] As is well known, the third complementarity-determining region (CDR3) of the TCR B chain (TRB) is the region with the greatest variation and selectivity in antigen recognition and binding sites. This region is a crucial structure that directly interacts with heterologous peptides presented on the cell membrane surface by the major histocompatibility complex (MHC) on the surface of antigen-presenting cells, forming the molecular basis for T cells to recognize cancer cells and specific antigens of foreign substances. Therefore, effective sequence and functional screening of tumor-targeting TRB CDR3 gene libraries will help in the establishment of TCR libraries with rearranged sequences targeting specific cancers, and will also help in the discovery of specific T cell libraries targeting specific tumor cells.

[0005] Humanized mouse models, also known as humanized hematopoietic system mouse models, are among the most commonly used animal models that closely resemble the human immune system. These mice are established by directly transplanting CD34-derived bone marrow or umbilical cord blood. + Hematopoietic stem and progenitor cells (HSPCs) or human peripheral blood mononuclear cells (PBMNCs). CD34 + HSPCs and PBMNCs have become the most widely used and routine modeling methods for humanized mice with artificial blood systems, serving as a good paradigm for research on many major diseases, including immuno-oncology and infectious diseases. In these humanized models, although CD34... + Humanized mice that undergo hematopoietic stem cell transplantation have advantages such as a lifespan of up to 12 months, T cell maturation, and strong graft-versus-host disease. However, due to the low number of hematopoietic stem cells, the need for donors to receive mobilization agents, the potential side effects or adverse reactions following such treatment, and the 5-46% mobilization failure rate among donors, the use of human CD34... + The use of hematopoietic stem and progenitor cells to establish humanized mice has significant limitations. Direct transplantation of human peripheral blood mononuclear cells (PBMNCs) to establish a humanized mouse model is suitable for T cell regeneration studies, but the chimerism time is short and it cannot be used to study the interactions between different immune cells in vivo.

[0006] Building upon our previous work, we developed a three-dimensional system (3D) using the self-assembling peptide RGD (L-arginine, glycine, and L-aspartic acid) to effectively capture and expand homeostatic peripheral blood mononuclear cells (PBMNCs) without the need for mobilization agents. In our previous work, the expanded cells in the 3D system demonstrated the ability to reconstruct human T cells, B cells, and granulocytes. However, it remains to be seen whether this cell reconstruction mouse model can obtain monocytes, myeloid dendritic cells (mDCs), plasmacytoid dendritic cells (pDCs), and various functional T cell subsets, including naïve T cells. T cells (Tn), effector T cells (Te), central memory T cells (Tcm), effector memory T cells (Tem), human CD45 + CD3 + HLA-DR + Whether activated T cells can generate anti-tumor T cells under the influence of specific tumors, and the characteristics of TRB CDR3 in mouse models with specific individual characteristics are also unclear. Summary of the Invention

[0007] One objective of this invention is to provide a method for constructing a T-cell receptor library targeting specific tumor cells using a humanized mouse model with individualized characteristics. Specifically, this method involves constructing a T-cell receptor TCR-T library targeting specific tumor cells. The model incorporates various components of the human immune system, including monocytes, myeloid dendritic cells, plasmacytoid dendritic cells, and functional T-cell subsets such as Tn, Te, Tcm, Tem, and HLA-DR. + A method for constructing a human T-cell receptor TCR-T library targeting these two tumor cell lines by continuously infusing inactivated tumor cells, such as NALM6 (acute lymphoblastic leukemia B-type) and MDA-MB-231 (breast cancer cell line), with activated T cells. The above invention is achieved through the following technical solution:

[0008] 1. Preparation of hematopoietic stem and progenitor cells using peripheral blood mononuclear cells

[0009] Peripheral blood from specific donors was centrifuged using a gradient centrifugation solution at 400×g for 25 minutes to obtain mononuclear cells (PBMNCs) from the white membrane layer. These cells were then processed using a calcium-free solution. 2+ and Mg 2+ The PBMNCs were washed 2-3 times with phosphate-buffered saline (PBS) and cultured with a self-assembled polypeptide hydrogel composed of L-arginine, glycine and L-aspartic acid, RGD.

[0010] The specific steps can be followed according to the manufacturer's instructions. In short, the self-assembled peptide RGD culture involves diluting with 20% sucrose and sonicating. PBMNCs are encapsulated in the RGD peptide and cultured in hematopoietic cell culture medium SFEM II (StemSpan, STEMCELL, Canada) for 15-30 minutes to form a three-dimensional structure. The supernatant is then removed, and the culture is further inoculated with a medium supplemented with 100 ng / ml stem cell growth factor (SCF), 100 ng / ml FMS-like tyrosine kinase 3 ligand (FLT3L), 20 ng / ml thrombopoietin (TPO), 2 ng / ml vascular endothelial growth factor (VEGF), 20 ng / ml interleukin-3 (IL3), 20 ng / ml interleukin-6 (IL6), 1 μM aryl hydrocarbon receptor (AhR) antagonist StemRegenin 1 (SR1), and 25 μg / ml vitamin C (Vc). The medium is changed every 2-3 days for 10-15 days. Cells expanded using this method contain hematopoietic stem and progenitor cells. This method is also known as a three-dimensional culture system.

[0011] 2. Establishment of humanized mice

[0012] Step (1) After culturing cells in a three-dimensional culture system for self-assembled peptide RGD culture for 10-15 days, the expanded cells were treated with trypsin (0.25%)-EDTA (0.02%), filtered through a 40μm filter, washed 2-3 times with PBS, and 7-8 week old NOD-Prkdc cells were collected. em26Cd52 Il2rg em26Cd22 / Nju (NCG) mice were irradiated with 1.8 g of gray, and 4 hours later, the treated cells were divided into groups of approximately 7-8 x 10⁻⁶ cells. 5 The cells were injected into mice via tibial injection. Three weeks post-transplantation, the chimerism and type of human immune cells were analyzed by flow cytometry. Chimerism of human hematopoietic cells, including human leukocyte antigen CD45, dendritic cells, monocytes, and T cells, was detected in these mice, which was considered a successful humanization model and will be used in subsequent experiments to construct a TCR-T library targeting tumor cells.

[0013] Antibodies analyzed by flow cytometry were previously labeled with h or m to indicate their target human or mouse cell types. For the detection of human dendritic cells (DCs) and monocytes, hCD45-based antibodies were used. + Cells, first circle hCD3 - CD19 - The group, and based on this, obtained hCD14. + The proportion of monocytes, and at the same time, in hCD45 + CD3 - CD19 - CD14- hHLA-DR isolated from cells + CD11c + Myeloid DCs and hHLA-DR + CD123 + plasma cell-like DCs

[0014] To detect different subsets of human T cells, we first started with hCD45. + circle hCD3 in the cell population + Cells, and then, further, hCD4 was obtained. + CD8 - and hCD4 - CD8 + Cell subsets, simultaneously, in hCD3 + Based on the population, hCD62L was obtained. + CD45RA + Immature T cells, hCD62L + CD45RA - Central memory T cells, hCD62L - CD45RA + Effector T cells, hCD62L - CD45RA - The proportion of effector memory T cells;

[0015] 3. Humanized mice were inoculated with mitomycin C-inactivated tumor cells NALM 6 and MDA-MB-231.

[0016] In this study, to fully mimic the interactions of the humanized mouse immune system, investigate the inhibitory effect of immunization on the growth of late-injected xenograft tumors, and explore the potential TRB correlation between pre-immunization and late-stage protective mechanisms, we used two tumor cell lines: NALM 6, a B-cell precursor leukemia cell line whose specific target antigen CD19 has been successfully introduced into CD19-targeted CAR-T cells in clinical practice; and MDA-MB-231, a triple-negative breast cancer (TNBC) cell line that exhibited cancer refractory and high mortality in experiments. NALM 6 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS), while MDA-MB-231 breast cancer cells were cultured in Dulbecco modified Eagle medium (DMEM) containing 10% FBS. Both cell lines carried green fluorescent protein (EGFP). After entering the logarithmic phase, DNA synthesis and mitosis were inhibited for 2-3 hours with 10 mg / mL mitomycin C, and then cells were collected, with each tumor cell counted at 1 × 10⁻⁶. 6 One cell was injected into a humanized mouse via the tail vein. A booster treatment was administered once on day 7.

[0017] 4. Construction of a T cell receptor B chain (TRB) complementarity-determining region (CDR3) sequence library

[0018] Isolation of human T cells and RNA extraction. Human T cells were collected from humanized mice and purified using the EasySep Human CD3 Positive Selection Kit II. Total RNA was extracted using Trizol reagent, and 28S- and 18S-RNA transcription bands were detected by 1.2% agarose gel electrophoresis to assess RNA integrity.

[0019] High-throughput sequencing and library construction of the T-cell receptor B chain were performed using ImmuHub TCR technology. The first reaction system employed an unbiased 5' amplification protocol, introducing unique molecular barcodes (UMBs) into the PCR reaction system for cDNA synthesis. For the TRB V fragment (TRBV), two reaction systems were used for amplification. The first system used primers (ImmuQuad Biotech, Hangzhou, China) with the complementary determinant region (CDR3) V and V regions added to the TRBV amplification, followed by cycles of 95°C for 15 min, 94°C for 30 s (15 cycles), 60°C for 40 min, 72°C for 30 s, 94°C for 30 s (10 cycles), 72°C for 10 min, and storage at 4°C. The second reaction system used the first-round PCR product as a template, continuing amplification using the same primers and reaction conditions. PE150 was used... The system performed PCR product sequencing. Based on the UMB adapter, repetitive and low-quality sequences in the original database were removed. Fragments of the V, D, J, and C genes were mapped to reference sequences in the International Immunogenetic Information Database to obtain a nucleotide and amino acid expression sequence library of TRBCDR3. After further removing the stop codon, a database of TRB CDR3 nucleotide and corresponding amino acid sequences was obtained.

[0020] 5. Clonal Characterization Analysis of the TRB CDR3 Library

[0021] The FASTA sequence dataset was submitted to IMGT / highV QUEST for gene interpretation to construct a cancer-targeting TRB CDR3 gene library. Information for each clone was obtained, including clone number, clone frequency, CDR3 gene sequence, CDR3 amino acid sequence, and V, D, J, and C segments. The similarity and differences of the TRB CDR3 libraries across groups were analyzed, including clone type, number diversity, and clonal proliferation. The total number of each clonal type was calculated by comparing the identical AA sequences of CDR3 across groups. Further analysis was conducted on the increased TRB clonal types and their frequency changes within the clone sharing among groups. To calculate novel products under immunostimulation conditions, the characteristics, number, and frequency of new clonal types were further calculated.

[0022] 6. Establishment of a tumor-bearing mouse model

[0023] NALM 6 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS), and MDA-MB-231 breast cancer cells were cultured in Dulbecco modified Eagle medium (DMEM) containing 10% FBS. 1×10⁻⁶ cells were diluted with 300 μL of PBS. 6 NAML6-EGFP and 1×10 6 MDA-MB-231-EGFP cell suspension was injected into NCGs mice via the tail vein. Tumor growth was measured by flow cytometry 20 days after transplantation; mouse survival was assessed.

[0024] This invention provides a method for developing a TCR-T cell library that targets specific tumor cells, offering an important technical platform for clinical treatment of specific tumors, as well as enabling the design of TCR sequences targeting specific tumor antigens and the acquisition of a T cell library capable of killing specific tumors. Compared with existing technologies, this invention has the following advantages:

[0025] (1) Establishment of mouse models. Currently, mouse models mainly utilize CD34 in peripheral blood after mobilization. + Hematopoietic stem and progenitor cells or peripheral blood mononuclear cells can be used. CD34 levels in peripheral blood after mobilization... + While hematopoietic stem and progenitor cells can establish human cells over a long period, donors must undergo mobilization treatment, which carries numerous risks, including splenomegaly, nausea, vomiting, cardiopulmonary dysfunction, and fatigue. Furthermore, a ten-year follow-up study found that donors receiving hematopoietic stem cell mobilization agents had a 15% higher chance of developing leukemia later in life compared to healthy individuals. Additionally, the number of hematopoietic stem cells in bone marrow is extremely low, and the content in umbilical cord blood is even lower. Mouse models established using normal peripheral blood mononuclear cells only allow for T cell regeneration, and the process is short, typically around one month, and often involves severe graft-versus-host disease (GvHD). Our mouse model, however, offers many advantages. First, the source is widely available; everyone has their own peripheral blood, making it more convenient than bone marrow or umbilical cord blood. Second, donors do not need to undergo any mobilization agents or other drug treatments. Third, collection is convenient, requiring only a few milliliters of blood drawn from a vein. Fourth, donors possess individual immune characteristics, with little or no GvHD. Fifth, our system allows for the long-term reconstruction of mouse hematopoietic and immune system potential using human cells. Sixth, our mouse model includes not only human CD3... + T-cell implantation also includes myeloid dendritic cells (mDCs), plasmacytoid dendritic cells (pDCs), and CD14. +Monocytes and functional T cells at different differentiation stages include naive T cells (Tn), central memory T cells (Tcm), memory effector T cells (Tem), effector T cells (Te), and activated T cells.

[0026] (2) Humanized mouse models showed significant reactivity of human immune cells after receiving immunoinfusions of inactivated hematologic malignancies NAML6 and triple-negative breast cancer cells MDA-MB-231. Based on the changes in myeloid dendritic cells, plasmacytoid dendritic cells, monocytes, and T cells at different differentiation stages, including Tn, Tcm, Te, and Tem, before and after tumor inactivation, our mouse model demonstrated a rapid and effective response to these immune stimuli. T-cell receptor TCR-T sequencing revealed significant changes in the frequency of gene usage and gene rearrangements in the V, D, and J segments of the B-chain complementarity-determining region 3 (CDR3) of the TCR-T, as well as the emergence of new clones. Currently, no similar studies have been reported. Attached Figure Description

[0027] Figure 1 This describes the specific implementation steps of a method for constructing a T-cell receptor (TCR-T) library that targets tumor cells.

[0028] Figure 2 It is a dynamic detection of human leukocyte antigen expression in humanized mice.

[0029] Figure 3 It refers to the dynamic changes of cytokines from different species.

[0030] Figure 4 It is a flow cytometry dynamic detection of humanized mouse dendritic cells and monocytes.

[0031] Figure 5 It is a dynamic statistical analysis of dendritic cells and monocytes from humanized mice.

[0032] Figure 6 It is a flow cytometry dynamic detection of various subsets of human lymphocyte T cells from humanized mice, including T cells at different differentiation stages.

[0033] Figure 7 Dynamic detection and statistical analysis of various subsets of human lymphocyte T cells in humanized mice.

[0034] Figure 8 Quality control and diversity analysis of the TRB CDR3 sequencing database.

[0035] Figure 9 Preferred usage, frequency of use, and characteristics of TRBV, TRBJ, and their combinations.

[0036] Figure 10Rearrangement kinetics analysis of TRBV-Js.

[0037] Figure 11 TRB CDR3 shared clone analysis.

[0038] Figure 12 Dynamic changes in the top 20 clones by percentage of shared clones.

[0039] Figure 13 The Berger-Parker index was used to calculate the amplification of dominant shared clones.

[0040] Figure 14 Cloning origins can be analyzed using cloning tracing techniques.

[0041] Figure 15 Tumor cell immune infusion induces specific TRB CDR3 clonal expansion.

[0042] Figure 16 Tumor immunotherapy inhibits the growth of late-stage xenografted tumor cells in vivo.

[0043] Figure 17 Tumor immunotherapy significantly improves the survival rate of mice xenografted with tumor cells. Detailed Implementation

[0044] The present invention will be further described in conjunction with the accompanying drawings and embodiments. Unless otherwise specified, the materials, reagents, etc. used in the following embodiments are commercially available.

[0045] Example 1: Establishment of an Individual-Specific Humanized Mouse Model

[0046] This invention provides a method for establishing an individual-specific humanized mouse model, and on this basis, for establishing a TCR-T library targeting specific tumor cells.

[0047] 1. Establish an individual-specific humanized mouse model with various humanized immune cells, including myeloid dendritic cells, plasmacytoid dendritic cells, CD14+ monocytes, and various T cells such as naive T cells, central memory T cells, effector T cells, memory effector T cells, helper T cells, cytotoxic T cells, and activated T cells. Based on this, inactivated tumor cells are continuously infused. To stimulate the immune system response, this invention uses two tumor cell lines: NALM6 (acute lymphoblastic leukemia B) and MDA-MB-231 (triple-negative breast cancer cell line). For mice treated with tumor immunotherapy, humanized T cells are purified and used to create a T cell receptor T cell bank targeting tumor cells. Specific protocols are as follows... Figure 1As shown. The main steps include the collection and culture of peripheral blood mononuclear cells from specific individuals, the establishment and detection of humanized mice, the immunoinfusion of inactivated tumor cells, the sequencing and analysis of T cell receptor B chain (TRB), and the detection of tumor burden and survival in mice after xenograft inoculation.

[0048] 2. Obtain individual-specific homeostatic peripheral blood mononuclear cells

[0049] Individuals can become cell donors for constructing individual-specific humanized mice, based on their own needs. A certain amount of peripheral blood (1-50 ml) is aseptically drawn, with the upper limit being the normal blood donation volume.

[0050] The lymphocyte separation medium was used to isolate mononuclear cells from blood products. Lymphocyte separation medium and unmobilized peripheral blood were added to centrifuge tubes at a ratio of 1:2. The centrifuge was incubated at 2500 rpm for 25 minutes at 4 degrees Celsius. The middle white membrane layer was aspirated and washed 2-3 times with phosphate-buffered saline (PFS) free of calcium and magnesium ions. The obtained mononuclear cells were then used for the next step of three-dimensional system preparation and culture.

[0051] 3. Preparation and culture of three-dimensional cell systems

[0052] Using self-assembled protein peptide RGD, the material was first diluted and processed according to the manufacturer's instructions. Then, individual mononuclear cells were coated onto the material. The cells were equilibrated in hematopoietic stem cell expansion medium SFEM (STEMCELLTECHNOLOGY) for 15-30 minutes. The supernatant was then removed, and the cells were cultured in SFEM containing 100 ng / ml SCF, 100 ng / ml FLT3L, 20 ng / ml IL-3, 20 ng / ml IL-6, 20 ng / ml TPO, 2 ng / ml VEGF, and 25 μg / ml vitamin C. The medium was changed every two days. After approximately 10-15 days of culture, the cells were ready for in vivo transplantation experiments in mice.

[0053] 4. Establishment of humanized mouse model

[0054] Once the cells cultured in three dimensions have grown to a certain size, the three-dimensional system is broken up in preparation for in vivo transplantation experiments in mice.

[0055] Specifically, the following steps are taken: Once the cells in the 3D culture have grown to a certain size, the 3D system is broken up, and the cells are collected. Digestion is performed using 0.25% trypsin / EDTA for 10 minutes. Digestion is stopped with culture medium containing fetal bovine serum. The cells are gently pipetted through a 70µm cell filter at 1000 rpm for 5 minutes, and then collected. The cells are washed 2-3 times with phosphate-buffered saline (PBS) free of calcium and magnesium ions, and then collected again. The cell density is adjusted to 1.5 × 10⁻⁶ cells / year. 4 Cells per microliter, keep on ice.

[0056] Immunodeficient female mice aged 6-8 weeks were irradiated with 1.8 g of Gray. Four hours later, the mice were anesthetized with approximately 300 μL of an anesthetic for tibial bone cavity transplantation of three-dimensionally cultured cells. Each mouse produced approximately 7 × 10⁸ cells. 5 cell.

[0057] 5. Flow cytometry detection of humanized cells, specifically human leukocyte antigen CD45.

[0058] Three weeks after cell transplantation in mice, the positive expression of human leukocyte antigen molecule CD45 was detected. 20-30 μL of blood was collected from the tail vein of mice. 40 μL of heparin sodium anticoagulant was added to the tube beforehand. The blood from the mouse tail vein was thoroughly mixed with the heparin sodium and incubated with a flow cytometry antibody containing human CD45 fluorescein for 30 minutes. 200 μL of solution A (0.6 mL formic acid + 500 mL purified water) was added while shaking, followed immediately by solution B. Solution B consisted of sodium bicarbonate (Na₂CO₃) (3 g), sodium chloride (NaCl) (7.25 g), sodium sulfate (Na₂SO₄) (15.65 g), and water (H₂O) (500 mL). The effect of solution A was then terminated. This method effectively removed red blood cells. Human CD45 expression was detected using flow cytometry. Mice with human CD45 expression greater than 0.1% in monocytes were defined as having successfully established a humanized mouse model. The CD45 detection mentioned above was also performed on the second day after tumor immunotherapy infusion to detect dynamic changes in CD45 levels. Specifically, as follows... Figure 2 Description: Dynamic detection of human leukocyte antigen (HLA) expression in humanized mice. Dynamic detection of HLA CD45 molecules before tumor inactivation infusion and after the first and second infusions. Results showed that HLA CD45 molecules chimericly integrated well, showing an upward trend after the second infusion, but without significant change.

[0059] 6. Detection of dynamic changes in human and mouse cytokines before and after immunoinfusion of tumor cells.

[0060] The secretion of corresponding cytokines was detected using the Luminex liquid chromatography suspension chip Bio-Plex Pro Human Cytokine 27-plex Assay (#M500KCAF0Y) and the Bio-Plex Pro Mouse Cytokine Grp I Panel 23-plex (#M60009RDPD) kit. The specific procedures were performed according to the manufacturer's instructions, and the simplified steps are as follows: diluted serum was incubated with the chip for 30 minutes, and the antibody incubation time was 30 minutes. Colorimetric analysis: Discard the detection antibody and wash three times with a plate washer; dilute Streptavidin-PE with Assay Buffer according to the instructions; add 50 μL of diluted Streptavidin-PE to each well, seal with film, and incubate on a plate at 850 rpm for 10 min in the dark at room temperature; wash three times with a plate washer; resuspend in 125 μL of Assay Buffer to each well, seal with film, and incubate on a plate at 850 rpm for 30 seconds in the dark at room temperature; read the values ​​using a calibrated Bio-Plex instrument. Data results: After detection by the Bio-Plex instrument, the results were automatically calculated and optimized by the software to form a data table. Graphs were plotted using GraphPadPrism9. The results are shown below. Figure 3 The following describes the dynamic changes of cytokines from different species. A: Dynamic detection of human cytokine secretion in humanized mice before tumor inactivation infusion and after the first and second infusions. Results showed that granulocyte colony-stimulating factor (G-CSF) was significantly downregulated after immunoinfusion, while basic fibroblast growth factor (basic-FGF) and interleukin-9 (IL-9) were significantly upregulated. Other cytokines, including tumor necrosis factor-α (TNF-α) and interleukin-2 (IL-2), showed no significant changes in expression. B: Dynamic detection of mouse cytokine secretion in humanized mice before tumor inactivation infusion and after the first and second infusions. Results showed that granulocyte colony-stimulating factor (G-CSF) was significantly upregulated after immunoinfusion, the opposite of human G-CSF expression. Eosinophil chemokine (Eotaxin) was also significantly upregulated. Other mouse cytokines also showed some degree of dynamic changes.

[0061] 7. Detection of dendritic cells and monocytes in humanized immune cells

[0062] Three weeks after mouse cell transplantation, the positive expression of human dendritic cells and monocytes was detected. The specific method was the same as the main steps of the flow cytometry detection of human leukocyte antigen CD45 in step 5 above. Antibodies used included CD45-APC-H7, mouse CD45-PECF594, CD3-Percpcy5.5, CD19-Percpcy5.5, CD14-FITC, HLA-DR-BV605, CD123-APC, and CD11c-PECY7. Flow cytometry dynamics of human dendritic cells and monocytes in humanized mice before tumor inactivation infusion and after the first and second infusions are shown. We first circled the cells positive for human leukocyte antigen CD45 expression; within this cell population, we then circled the cell population of human CD3-negative and CD19-negative cells. + CD3 - CD19 - In cells, CD14 is obtained + Monocytes; then on CD45 + CD3 - CD19 - CD14 - HLA-DR was obtained from cells. + CD11c + Myeloid dendritic cells and HLA-DR + CD123 + Plasma cell-like dendritic cells. Specifically, as... Figure 4 and 5 The results show that CD45 + CD3 - CD19 - CD14 - HLA-DR + CD11c + Myeloid dendritic cells and CD45 + CD3 - CD19 - CD14 - HLA-DR + CD123 + Plasma cell-like dendritic cells decreased significantly after the first immunization infusion, but their expression levels rebounded after the second infusion, returning to pre-infusion levels. CD14... + Monocytes were significantly upregulated after both the first and second infusions, with the upregulation being more pronounced after the first infusion. These results indicate that tumor immunotherapy has a significant regulatory effect on myeloid dendritic cells, plasmacytoid dendritic cells, and monocytes.

[0063] 8. Detection of T cells in humanized immune cells

[0064] Three weeks after mouse cell transplantation, the dynamic changes in human T cell subsets were examined. The specific method was the same as the main steps of step 5 above, namely the flow cytometry detection of human leukocyte antigen CD45 in humanized cells. Antibodies used included CD45-APC-H7, mouse CD45-PECF594, CD3-Percpcy5.5, CD4-FITC, CD8-BV510, HLA-DR-BV605, CD62L-PE, and CD45RA-APC. We first identified CD45-positive cells and then examined the changes in the proportion of human CD3-positive cells within this cell population. + CD3 + Cells, analysis of CD3 + CD4 + CD8 - T helper cells (Th) and CD3 + CD4 - CD8 + T cytotoxic cells (Tc); simultaneously at CD45 + CD3 + In cells, analysis of naive T cells ( T cells (Tn), effector T cells (Te), central memory T cells (Tcm), effector memory T cells (Tem), HLA-DR + Activation of T cells, etc. Specifically, such as... Figure 6 and 7 The results show that CD3 + Cell expression levels decreased after the first immunization infusion, while at the second infusion, cell expression levels were comparable to pre-infusion levels, but without significant difference. CD4 + CD8 - T helper cells (Th cells) were significantly upregulated after both the first and second infusions, while CD4 cells were upregulated in contrast. - CD8 + Tc, the cytotoxic T cell cytokine, was significantly downregulated after both the first and second infusions. Tn, Tcm, and Tem were all upregulated after the first infusion, with Tcm and Tem showing significant changes. After the second infusion, Tn and Tcm showed a decreasing trend, but without significant change. Tem increased significantly again after the second infusion. Te decreased significantly after both the first and second infusions, with a more pronounced decreasing trend after the first infusion. HLA-DR + CD8 +A significant change was also observed in activated T cells. This may be due to the stimulating effect of our humanized cells on mice, and it may also be related to the timing of our sample testing, as we performed the immune cell detection 24 hours after the immunization infusion.

[0065] Example 2: A method for constructing a T-cell receptor (TCR-T) library targeting specific tumor cells

[0066] 1. Collecting human T cells from humanized mice

[0067] After two consecutive infusions of inactivated tumor cells, they were purified using EasySep. TM Human CD3 Positive Selection Kit II (STEMCELL Technologies Inc., Canada). Total RNA was extracted using Trizol reagent (Invitrogen) according to the manufacturer's instructions. RNA integrity was detected using 28S- and 18S-RNA transcript bands on a 1.2% agarose gel.

[0068] 2. Construction of a library of the complementarity-determining region (CDR3) sequence of the T cell receptor B chain (TRB).

[0069] Here, we used the ImmuHub TCR analysis system (ImmuQuad Biotech, Hangzhou, China) for high-throughput sequencing of TRB. In short, a 5' unbiased amplification protocol was employed, introducing unique molecular barcode adapters (UMBs) into the PCR reaction system for cDNA synthesis. For the TRB V fragment (TRBV), two reaction systems were used for amplification. The first system used primers with the complementarity-determining region (CDR3) V and V region added (ImmuQuad Biotech, Hangzhou, China), followed by cycles of 95°C for 15 min, 94°C for 30 s (15 cycles), 60°C for 40 min, 72°C for 30 s, 94°C for 30 s (10 cycles), 72°C for 10 min, and storage at 4°C. The second reaction system used the first-round PCR product as a template, continuing amplification using the same primers and reaction conditions.

[0070] Using PE150 (Illumina) The system performed PCR product sequencing. Repetitive and low-quality sequences were removed from the original database based on UMB adapter pointers. Fragments of the V, D, J, and C genes were mapped to reference sequences in the International Immunogenetic Information Database (http: / / www.imgt.org). The nucleotide sequences and corresponding amino acid sequences obtained after removing the stop codon constituted the database of the TRBV complementarity-determining region (CDR3).

[0071] 3. Clonal Characterization Analysis of the TRB CDR3 Library

[0072] The FASTA sequence dataset was submitted to IMGT / highV QUEST for gene annotation to construct a TRB CDR3 gene library targeting specific tumor cells. Information for each clone was obtained, including clone number, clone frequency, CDR3 gene sequence, CDR3 amino acid (AA) sequence, and V, D, J, and C segments. The similarity and differences of the TRB CDR3 libraries across groups were analyzed. The diversity of clone types and numbers, and clone proliferation were analyzed separately. The total number of each clone type was calculated by comparing the identical AA sequences of CDR3 across groups. We also analyzed the changes in TRB clone frequency among shared clones across groups. To detect new clones generated under tumor immunization infusion conditions, we also calculated the newly generated clones and their characteristics, including number and frequency.

[0073] The Invsimpson Diversity Index (Invsimpson Index) was used as a clonal index to quantitatively analyze the diversity of TRB clones. The Invsimpson Diversity Index is the reciprocal of the Simpson Index; a higher Invsimpson Index indicates greater clonal diversity. Specifically... Figure 8 The following describes the quality control and diversity analysis of the TRB CDR3 sequencing database. After high-throughput sequencing and quality control of TRB CDR3, we obtained an average total number of clones of 8440 in the untreated group and an average number of 1619 in the treated group. Figure 8 A). The counts for each sample were: 7002 humanized mice 1 (untreated), 9878 humanized mice 2 (untreated), 1916 humanized mice 1 (treated), and 1322 humanized mice 2 (treated). Figure 8 B). Unique CDR3 analysis showed that the mean number of complementary nucleotide sequences in the untreated and treated groups were 379 and 199.5, respectively, while each sample contained 390 in the untreated humanized mouse 1 group, 364 in the untreated humanized mouse 2 group, 273 in the treated humanized mouse 1 group, and 122 in the treated humanized mouse 2 group. Figure 8 CD). Differences were found in the inverse Simpson index across groups ( Figure 8 (E and F). The clonal index increased from 6.80 and 1.94 in the untreated group to 35.3 and 4.86 in the treated group, respectively. Our data indicate that the inoculation treatment resulted in an increase in TRB CDR3 clonal diversity.

[0074] 4. TRBV Preference Usage, Frequency of Use, and Characteristic Analysis

[0075] Based on the usage of TRBV fragments in the TRB CDR3 database, statistical analysis was performed on the corresponding V fragments. Simultaneously, different families and related subfamilies of V fragments were analyzed to obtain TRBV preferred usage, frequency of use, and characteristic analysis. See [link to documentation]. Figure 9 The TRBV family is divided into 25 families and 41 subfamilies. TRBVs such as V4, V5, V7, V12, and V20 are highly expressed in the treatment group and have many subfamilies. Figure 9 (AE). In humanized mice 1, the top 5 TRBVs in the treated group were TRBV9, TRBV20-1, TRBV15, TRBV12-3, and TRBV7-8, accounting for 49.04% of the total clones. In contrast, TRBV20-1, TRBV12-3, TRBV9, TRBV10-3, and TRBV7-6 were the main used fragments in the untreated group, accounting for approximately 72.4%. In humanized mice 2, compared to the untreated group, TRBV12-4, TRBV19, TRBV20-1, TRBV15, and TRBV7-9 accounted for 42.3% in the treated group, while TRBV12-4, TRBV20-1, TRBV9, TRBV15, and TRBV7-9 were the main ones in the untreated group, accounting for 93.7%.

[0076] 5. Analysis of TRBV and TRBJ gene fragment combinations (VJ)

[0077] To analyze the usage of TRBV and TRBJ gene fragment combinations, we used a VJ Junction Circos plot. We statistically analyzed the TRBV and TRBJ gene fragment combinations in each sample. Each colored block represents a gene fragment; the upper segment is the V fragment, and the lower segment is the J fragment. Wider blocks indicate higher frequency of fragment usage, and more connecting lines indicate a higher frequency of the VJ combination. See [link / reference needed]. Figure 10 The rearrangement kinetics of TRBV-Js were analyzed. TRBVs primarily bound to TRBJ2-7 (approximately 23.8%), TRBJ2-1 (approximately 23.0%), and TRBJ2-3 (approximately 18.2%). In the untreated group, the corresponding TRBVs were primarily combined with TRBJ2-7 (approximately 43.5%), TRBJ2-1 (approximately 28.1%), and TRBJ2-3 (approximately 10.8%). Compared to the untreated group, the percentage of TRBJ2-1 decreased from approximately 77.2% initially to approximately 58.9%, and TRBJ2-7 increased from approximately 5.78% to approximately 33.7%. TRBJ2-3 decreased significantly from approximately 13.3% to approximately 1.97%. Most TRBV-J combinations showed high expression in both groups (expression frequency >0.1% in both groups).

[0078] 6. Analysis of the similarity calculation and the number of shared clone species in each of multiple sample groups.

[0079] To compare the similarity between samples in the TRB CDR3 database, we used the BUB index to calculate the similarity before and after humanized mouse treatment. The darker the color, the closer the number is to 1, indicating a higher similarity between the two samples. This method aims to statistically analyze changes in shared clone species across multiple samples. The total number of clones from all samples is summed, and the percentages of shared and non-shared clone species are compared. The intersection is the percentage of shared clone species = number of shared clone species / total number of clones in four samples; the non-intersection is the percentage of non-shared clone species = number of non-shared clone species / total number of clones in four samples. For example... Figure 11 The following describes the analysis of similarity and shared clones among TRB CDR3 libraries. The Baroni Urbani and Buser (BUB) indices and heatmaps were used to demonstrate the similarity among TRB CDR3 clone libraries in humanized mice. Figure 11 A). The results showed that the similarity between untreated groups was higher than that between mice constructed from the same donor. Tumor immunotherapy resulted in significant heterogeneity of TRB CDR3 clones among samples. Venn diagram analysis showed that there was 11 clone overlaps among the groups out of a total of 914 clones (sequence numbers: 1, 2, 3, 8, 12, 49, 56, 86, 82, 94, 95). Figure 11 B). Humanized mice 1 constructed from female-derived PBMNCs shared 9.05% of their clones between treated and untreated samples (55 clones out of a total of 608 clones) (Sequence numbers: 1, 2, 3, 5, 7, 8, 9, 10, 11, 12, 15, 17, 18, 19, 25, 26, 29, 30, 33, 34, 35, 37, 43, 49, 50, 56, 57, 58, 59, 60, 61, 82-104, 157), while humanized mice 2 constructed from male-derived PBMNCs shared approximately 10.5% of their clones (46 clones out of a total of 440 clones) (Sequence numbers: 1, 2, 3, 4, 8, 12, 31, 49, 56, 82, 86, 94, 95, 105-139). The data above indicate that the number of shared clones among these groups is low.

[0080] 7. Shared clone frequency tracking graph

[0081] To track the origins of the top 20 clones in samples treated with humanized mice, we used a clonal tracking method to track the frequency changes of high-frequency clones among the shared clones. The vertical axis represents clone frequency, and the horizontal axis shows the samples before and after humanized mouse treatment, respectively. Each colored block represents a clone, with its frequency measured at the highest point of the colored block. The black portion represents the sum of the frequencies of other unshown shared clones (low frequencies), and the light gray portion represents the sum of the frequencies of clones without shared frequencies. Figure 12 Analysis of the dynamic changes of the top 20 clones by shared clonal proportions (serial numbers: 1-20). After treatment with humanized mouse 1, the highest proportion of the shared clone TGTGCCAGCGTGAGAGGGTTCGGGAGGAGTTCTC increased from 1.91% in the untreated group to 9.39% in the treated group. After treatment with humanized mouse 2, the highest proportion of the shared clone TGTGCCAGACCAGGGTGGTTTGGTCAATCAGAGAGTTCTTC decreased from 71.38% in the untreated group to 41.15% in the treated group. In the treated groups, the proportions of the top 20 clones by shared clonal proportions all changed significantly (serial numbers: 56, 111, 94, 125, 115, 109, 118, 108, 95, 112, 140, 141, 106, 116, 129, 49, 127, 114, 142, 143). The proportion of these clones was very small in the untreated group, but significantly increased in the treated group. These results indicate that immune infusion of tumor cells leads to a significant change in the clonality of host TCR-T cells.

[0082] 8. Comparison of clonal proliferation changes in samples

[0083] To statistically analyze the proliferation of shared clones after humanized mouse treatment, we used the Berger-Parker Index as the clonal proliferation index to analyze the proliferation of shared clones, and plotted and displayed the top 15-20 clones in the shared clones using a bar chart. Figure 13 The Berger-Parker index was used to calculate the expansion of dominant shared clones. In humanized mouse 1, the proportion of the top 20 high-frequency shared clones varied considerably, being 3.06% ± 0.02% in the treatment group and 0.5% ± 0.008% (mean ± SEM) in the untreated sample, with a P < 0.0001 between the two groups. In humanized mouse 2, these numbers were 4.44% ± 0.09% and 4.15% ± 0.15%, respectively, with a P = 0.9447, which may be due to the influence of a single clone that accounted for more than 70% of the original sample. These results further indicate that most dominant clones in the treatment group were generated by stimulation under cancer cell inoculation conditions, rather than by the expansion of original endogenous T cells.

[0084] 9. Tracking analysis of dominant clones in multiple samples

[0085] To compare the origin and proportion changes of dominant clones after treatment in humanized mice, we selected clones with a frequency higher than 1% in each sample from each group, and sorted them according to their frequency in the treatment group. We then selected the top 50 clones from humanized mouse 1 (serial numbers: 1-50) and the top 50 clones from humanized mouse 2 (serial numbers: 56, 111, 94, 125, 115, 109, 118, 108, 95, 112, 1...). The following numbers (40, 141, 106, 116, 129, 49, 127, 114, 142, 143, 144, 86, 113, 123, 128, 145, 146, 147, 148, 2, 124, 149, 150, 1, 12, 120, 121, 126, 151, 152, 153, 154, 155, 156, 3, 4, 8, 13, 22, 31) are used to illustrate their variations using a heatmap. Blue indicates high frequency, yellow indicates low-high frequency, and gray indicates no such clone. Figure 14 The study employed clonal tracing to analyze clonal origins. The analysis revealed that the top 50 dominant clones in the treatment group were virtually nonexistent or present in the untreated group at extremely low proportions. This indicates that many of the dominant or predominant clones in the treatment group were generated after immune infusion stimulation, or that some low-frequency clones amplified into dominant clones after immune infusion. Furthermore, the dominant clones differed among different humanized mice, suggesting that even with the same treatment, the resulting clones may not be identical. This may be related to specific in vivo immune environments, such as the different peptides presented by antigen-presenting cells (APCs), such as monocytes and dendritic cells (DCs).

[0086] 10. Compare clonal diversity calculations across multiple sample groups.

[0087] To statistically analyze changes in clonal diversity among samples, we used a clonal snail diagram to illustrate the proportions of clonal diversity. The first layer includes "1", "2", and "3+", representing the percentage of T cells with one, two, and three or more clones, respectively. The proportions of "1" and "2" are crucial and significantly influence the calculation of T cell diversity. The second layer, Q1-Q5, represents the proportion of each 20% of T cell types (sorted by TCR clone frequency from high to low), visually reflecting TCR clonality. The third layer shows the amino acid sequences of the CDR3 region of the top five TCR clones. The wider this region, the higher the clonal proliferation of a particular TCR. Figure 15 The study found that tumor cell immune infusion induced specific TRB CDR3 clonal expansion, resulting in increased diversity.

[0088] 11. After tumor immunization, humanized mice were injected with live, corresponding tumor cells, and their tumor burden was assessed.

[0089] To assess whether infusion of inactive cancer cells affected the growth of tumor xenografts and the survival of mice, we further infused humanized mice with 1×10⁻⁶ cells after two consecutive infusions of inactive cancer cells. 6 Hematologic malignancies NAML6-EGFP and 1×10 6 Triple-negative breast cancer cells MDA-MB-231 were used. Twenty days post-injection, tumor burden expressing green fluorescent protein (EGFP) was monitored. Specifically, flow cytometry was used to detect EGFP in peripheral blood, bone marrow, spleen, and liver of the target mice. Figure 16 The study found that in the control group, the proportion of EGFP-labeled tumor cells was high in the bone marrow, liver, intestine, and spleen (10.51% ± 1.67, mean ± standard error of mean), but very low in peripheral blood, even undetectable. This suggests that the bone marrow, liver, intestine, and spleen are the niches for tumor cell survival. In the tumor cell immunization infusion group, the proportion was significantly reduced to only 1.92% ± 0.82 (mean ± standard error of mean), indicating that the humanized mouse model immunized with inactive tumor cells effectively inhibited tumor growth in vivo.

[0090] 12. Humanized mice were injected with live, corresponding tumor cells after tumor immunization treatment, and their survival was assessed.

[0091] To assess whether infusion of inactive cancer cells affected mouse survival, we further infused humanized mice with 1×10⁻⁶ cells after two consecutive infusions of inactive cancer cells. 6 Hematologic malignancies NAML6-EGFP and 1×10 6 Triple-negative breast cancer cells MDA-MB-231 were used. Mouse mortality time was observed, and survival curves were plotted. Figure 17 The results showed that untreated control NCGs gradually died approximately 20 days after infusion of live tumor cells. In contrast, humanized mice receiving tumor immunotherapy showed significantly prolonged survival after xenogeneic inoculation of tumor cells. sequence list <110> The First Affiliated Hospital of Zhejiang University School of Medicine <120> A method for constructing a T-cell receptor library targeting specific tumor cells <160> 157 <170> SIPOSequenceListing 1.0 <210> 1 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 1 tgtgccagca gcgtagaagg ggttcgggat gagcagttct tc 42 <210> 2 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 2 tgtgccagca gccccggact agcgggagtg tacgagcagt acttc 45 <210> 3 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 3 tgtgccagca gtttaggaat ggcagatacg cagtatttt 39 <210> 4 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 4 tgcagtgcta gagaccgaca gggcgccggc tacgagcagt acttc 45 <210> 5 <211> 51 <212> DNA <213> Artificial sequence (unknown) <400> 5 tgtgccagca gctcgacggg actagcggga ggagaagata cgcagtattt t 51 <210> 6 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 6 tgtgccacca gcagagcggg agcctcggca gatacgcagt atttt 45 <210> 7 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 7 tgtgccagca cctccccgga cagccaagag acccagtact tc 42 <210> 8 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 8 tgtgccagca gccaagacga aacctacgag cagtacttc 39 <210> 9 <211> 51 <212> DNA <213> Artificial sequence (unknown) <400> 9 tgtgccagca gtgggtccgg tctggggacag gcgaacactg aagctttctt t 51 <210> 10 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 10 tgtgccagca gctcctccgg ggggtacact gaagctttct tt 42 <210> 11 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 11 tgcgccagca gtgaaaatcc gggtggtctc ggggagctgt ttttt 45 <210> 12 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 12 tgcagtgctc cgggacaggg ggcccatgag cagttcttc 39 <210> 13 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 13 tgtgccagct caccactggg acggtacaat gagcagttct tc 42 <210> 14 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 14 tgtgccacca gcagagctag aaccggggcc aacgtcctga ctttc 45 <210> 15 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 15 tgtgcctgga gtcgggacgg ctacgagcag tacttc 36 <210> 16 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 16 tgtgccacca gcagagtagc aggggaagag cagtacttc 39 <210> 17 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 17 tgtgccagca gtgcagggag gaatcagccc cagcatttt 39 <210> 18 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 18 tgtgccagta gtatctctca ggacactgaa gctttcttt 39 <210> 19 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 19 tgtgccagca gtttaggcac ggacattcag tacttc 36 <210> 20 <211> 54 <212> DNA <213> Artificial sequence (unknown) <400> 20 tgtgccagca gtcccaaccg gggtggggtc tctagcacag atacgcagta tttt 54 <210> twenty one <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> twenty one tgcgccagca tcccggggga tggtagcgag cagtacttc 39 <210> twenty two <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> twenty two tgtgccagca gtcctcgaca gggcgttaac aatgagcagt tcttc 45 <210> twenty three <211> 30 <212> DNA <213> Artificial sequence (unknown) <400> twenty three tgcagtgctc tgagggatgg ctacaccttc 30 <210> twenty four <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> twenty four tgcgccagca gcttgatggc gggacagggc agcaatgagc agttcttc 48 <210> 25 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 25 tgtgccagca gcccgagccc taactacgag cagtacttc 39 <210> 26 <211> 57 <212> DNA <213> Artificial sequence (unknown) <400> 26 tgcgccagca gcttgagtgt gggggggcca gggtcctcct acaatgagca gttcttc 57 <210> 27 <211> 33 <212> DNA <213> Artificial sequence (unknown) <400> 27 tgtgccagca gccaaggaaa aacgcagtat ttt 33 <210> 28 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 28 tgtgccagca ggcgtatagc gggaggagga gatacgcagt atttt <210> 29 <211> 39 <212> DNA <213> Unknown (unknown) <400> 29 39. tgcgccagca gccaggtcac aggagaaaaa ctgtttttt <210> 30 <211> 45 <212> DNA <213> Unknown (unknown) <400> 30 tgtgccagca ggtctaccgg gacagggtct cttgagctgt ttttt <210> 31 <211> 42 <212> DNA <213> Unknown (unknown) <400> 31 tgcagcgttc aagcggggagg gaacaccggg gagctgtttt tt <210> 32 <211> 54 <212> DNA <213> Unknown (unknown) <400> 32 54. tgtgccacca gtccctcgac tagtgtccgg agctcctaca atgagcagtt cttc <210> 33 <211> 45 <212> DNA <213> Unknown (unknown) <400> 33 tgtgccagca gcttaagccc agcggacgac aatgagcagt tcttc <210> 34 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 34 tgtgccagca gctcggacag aaacactgaa gctttcttt 39 <210> 35 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 35 tgtgccacca gcagcggagt atatgagcag ttcttc 36 <210> 36 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 36 tgtgccagca cagaaggtac agatacgcag tatttt 36 <210> 37 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 37 tgtgccacta cccccctgca gggtaaatat ggctacaccttc 42 <210> 38 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 38 tgtgccacca gcagagtagc gggtgagacc cagtacttc 39 <210> 39 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 39 tgtgccagca gcgcccccaa cagtgagcag tacttc 36 <210> 40 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 40 tgcgccagca gctcgactcc gggactagac ggtaatgagc agttcttc 48 <210> 41 <211> 54 <212> DNA <213> Artificial sequence (unknown) <400> 41 tgtgccagca gttatactcgaa aggactagcg ggaaaatcag gggagctgtt tttt 54 <210> 42 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 42 tgtgcctgga gtgatatgaa tagcaatcag ccccagcatt tt 42 <210> 43 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 43 tgtgccagca gttacatggg tgcaactaat gaaaaactgt ttttt 45 <210> 44 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 44 tgtgccagca gctcaggact agcgggctac aatgagcagt tcttc 45 <210> 45 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 45 tgcagtgcta gggagttggc taatgaaaaa ctgtttttt 39 <210> 46 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 46 tgtgccagca gcccggacag ggcgtcagct ttcttt 36 <210> 47 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 47 tgtgccagca gcgccgacag ggggactgaa gctttcttt 39 <210> 48 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 48 tgtgccagca gtggggccgg ggacagtaat tcacccctcc acttt 45 <210> 49 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 49 tgcagtgcgg acagggggtt caacgagcag tacttc 36 <210> 50 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 50 tgtgccagca gccaagatcg agggacaggg aatcagcccc agcatttt 48 <210> 51 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 51 tgtgccagca gcccccgcgc aggcaatcag ccccagcatt tt 42 <210> 52 <211> 48 <212> DNA <213> Artificial Sequence (unknown) <400> 52 tgtgccagca gcttagcgga atccgggagc ggcggggagc tgtttttt 48 <210> 53 <211> 45 <212> DNA <213> Artificial Sequence (unknown) <400> 53 tgtgccagca gcgtagtggc agggggctac tatggctaca ccttc 45 <210> 54 <211> 54 <212> DNA <213> Artificial Sequence (unknown) <400> 54 tgtgccagca gtcgaccccc cctaactagc ggggaataca atgagcagtt cttc 54 <210> 55 <211> 45 <212> DNA <213> Artificial Sequence (unknown) <400> 55 tgtgccagct caccaaggca gggggactac aatgagcagt tcttc 45 <210> 56 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 56 tgtgccagca cccagggtgg tttggtcaat gagcagttct tc 42 <210> 57 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 57 tgtgccagca gccccccagg gagcgcctac aatgagcagt tcttc 45 <210> 58 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 58 tgtgccagca gtgcaggacc gtacgagcag tacttc 36 <210> 59 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 59 tgtgccagct cacttgacag ttcctacgag cagtacttc 39 <210> 60 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 60 tgtgccagca gtttcttact tatgaacact gaagctttct tt 42 <210> 61 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 61 tgtgccacca gcagagaagg gggggagacc cagtacttc 39 <210> 62 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 62 tgcgccagca gccccgacag ggggcgcgag cagtacttc 39 <210> 63 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 63 tgcgccagca gcttgggcgg gacagagtac aatgagcagt tcttc 45 <210> 64 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 64 tgtgccagca gcttagttga acattcaccc ctccacttt 39 <210> 65 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 65 tgtgccagca gcaagcggga caggggccgt ggctacaccttc 42 <210> 66 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 66 tgcagtgcaa ttcagggggc gcgggccaaa aacattcagt acttc 45 <210> 67 <211> 45 <212> DNA <213> Artificial Sequence (unknown) <400> 67 tgtgccagca gctatatggg acagggatct cagccccagc atttt 45 <210> 68 <211> 39 <212> DNA <213> Artificial Sequence (unknown) <400> 68 tgtgccagta gtatttccca ggacactgaa gctttcttt 39 <210> 69 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 69 tgtgccagca gtccgggctc ctataattca cccctccact tt 42 <210> 70 <211> 60 <212> DNA <213> Artificial Sequence (unknown) <400> 70 tgtgccatca gtgaaggcgt acggtggact agcggagcga acaccgggga gctgtttttt 60 <210> 71 <211> 39<k <212> DNA <213> Artificial Sequence (unknown) <400> 71 tgcgccagca gccctgacac gggtggggaa gctttcttt 39 <210> 72 <211> 39 <212> DNA <213> Artificial Sequence (unknown) <400> 72 tgtgccagca gccccacagg gagcactgaa gctttcttt 39 <210> 73 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 73 tgtgccagcg cccccagggc ccccaactat ggctacacct tc 42 <210> 74 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 74 tgtgccagca gttcgacagg gcgagatgac gagcagtact tc 42 <210> 75 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 75 tgtgccacca gcatttcgtg ggggaacact gaagctttct tt 42 <210> 76 <211> 33 <212> DNA <213> Artificial Sequence (unknown) <400> 76 tgtgccagca gcgacccgaa ggagctgttt ttt 33 <210> 77 <211> 39 <212> DNA <213> Artificial Sequence (unknown) <400> 77 tgcgccagca acccatcggg ggtcggtgaa gctttcttt 39 <210> 78 <211> 54 <212> DNA <213> Unknown (unknown) <400> 78 tgcagtgcta gagatccgat cactagcggg ggtgggatcg atgagcagtt cttc 54 <210> 79 <211> 45 <212> DNA <213> Unknown (unknown) <400> 79 tgtgccagca gcttggccgc gtggggggcg gagacccagt acttc 45 <210> 80 <211> 36 <212> DNA <213> Unknown (unknown) <400> 80 36. tgtgccaccg gacagggttt ctacgagcag tacttc <210> 81 <211> 39 <212> DNA <213> Unknown (unknown) <400> 81 tgtgccacca gcagagtggc aggagagacc cagtacttc <210> 82 <211> 42 <212> DNA <213> Unknown (unknown) <400> 82 tgcagtgtac actggacagg gggcacagat acgcagtatt tt <210> 83 <211> 48 <212> DNA <213> Unknown (unknown) <400> 83 tgcgccagca gctggaggag agggacaggg caagagaccc agtacttc 48 <210> 84 <211> 48 <212> DNA <213> Artificial Sequence (unknown) <400> 84 tgcgccagca gcccgggtca ggactggtcg tttaacgagc agtacttc 48 <210> 85 <211> 45 <212> DNA <213> Artificial Sequence (unknown) <400> 85 tgtgccagca gctcccggac aggggaggac tatggctaca ccttc 45 <210> 86 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 86 tgtgccagcc gatattcatt cgacagcaat gagcagttct tc 42 <210> 87 <211> 48 <212> DNA <213> Artificial Sequence (unknown) <400> 87 tgtgccagca gtttagcacc gggacaggct tacaatgagc agttcttc 48 <210> 88 <211> 48 <212> DNA <213> Artificial Sequence (unknown) <400> 88 tgcgccagca gagcactagc gggacttaac accggggagc tgtttttt 48 <210> 89 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 89 tgtgccacca gcagagtaac gaggaacact gaagctttct tt 42 <210> 90 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 90 tgcgccagca gcctacctag cggatacaat gagcagttct tc 42 <210> 91 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 91 tgtgccagca gcgtagagaa caccggggag ctgtttttt 39 <210> 92 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 92 tgtgccagca gcttcctggg caggggctat acgcagtatt tt 42 <210> 93 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 93 tgcagtgcta tcaggacagc agcctacgag cagtacttc 39 <210> 94 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 94 tgtgccacca gcagaggagg ggacggttcc tacgagcagt acttc 45 <210> 95 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 95 tgtgccagca gcctatggac gtcgggagac aatgagcagt tcttc 45 <210> 96 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 96 tgtgccagca gctcccaagc gggagggcgc tacaatgagc agttcttc 48 <210> 97 <211> 33 <212> DNA <213> Artificial sequence (unknown) <400> 97 tgtgccagta gtatgtacac tgaagctttc ttt 33 <210> 98 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 98 tgtgcctgga gcgcctttat tcaggggggg gcagagaccc agtacttc 48 <210> 99 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 99 tgcgccagca gccaagtcgg gccgggaggt agtttttccc tccacttt 48 <210> 100 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 100 tgtgccagca accaggcggg gggtccggcg gagacccagt acttc 45 <210> 101 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 101 tgtgctagca gcttaggctt caccggggag ctgtttttt 39 <210> 102 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 102 tgcgccagca gtgaaaatcc gggggtctc ggggagctgt ttttt 45 <210> 103 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 103 tgtgccagca gcgtgggtgg ccaagagacc cagtacttc 39 <210> 104 <211> 57 <212> DNA <213> Artificial sequence (unknown) <400> 104 tgcgccagca gcttgagtgt gggggggcca gggtcctcct acactgagca gttcttc 57 <210> 105 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 105 tgtgccatca gtgagtccgg ggggcgaaac accggggagc tgtttttt 48 <210> 106 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 106 tgcagtgcta gttcaagatt gaaagatacg cagtatttt 39 <210> 107 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 107 tgtgccagca gtttcgtgag gggccacaat gagcagttct tc 42 <210> 108 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 108 tgcagtgctc cgccgggact agattacaat gagcagttct tc 42 <210> 109 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 109 tgtgccagca gcttaaggac tcgatcccct aacaatgagc agttcttc 48 <210> 110 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 110 tgtgccagca gctggggact agcgggagtc tatgacattc agtacttc 48 <210> 111 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 111 tgtgccagta gtatagggcc agcatacgag cagtacttc 39 <210> 112 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 112 tgtgccagca gcccagggtc tcacgagcag tacttc 36 <210> 113 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 113 tgcagtgctc ctcgtgacag ggcacatcag ccccagcatt tt 42 <210> 114 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 114 tgtgccagca gccgaagcga ctcctacgag cagtacttc 39 <210> 115 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 115 tgtgccagca gcttagtcgg tatgggggtt tcctacgagc agtacttc 48 <210> 116 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 116 tgtgccagca gttatactcatc cgggagctcc tacgagcagt acttc 45 <210> 117 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 117 tgggccagca cccagggtgg tttggtcaat gagcagttct tc 42 <210> 118 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 118 tgtgccagca agggactagc gggcatctcc tacgagcagt acttc 45 <210> 119 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 119 tgtgccagca gtccggggac ctcttacaat gagcagttct tc 42 <210> 120 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 120 tgtgccagca ccccgggtgg tttggtcaat gagcagttct tc 42 <210> 121 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 121 tgtgccagca ccgagggtgg tttggtcaat gagcagttct tc 42 <210> 122 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 122 tgtgccagca cccagggtgg tttgttcaat gagcagttct tc 42 <210> 123 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 123 tgtgccagca gctttactag cgggatgggg gagcagttct tc 42 <210> 124 <211> 36 <212> DNA <213> Artificial sequence (unknown) <400> 124 tgcgccagca gccgtctcac agatacgcag tatttt 36 <210> 125 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 125 tgcagtgccc ctgaccccca ggtgtacaat gagcagttct tc 42 <210> 126 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 126 tgtgccagca gttggtcaag gctcaatgag cagttcttc 39 <210> 127 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 127 tgtgccagca gttggagcgg gagggcctcc aatgagcagt tcttc 45 <210> 128 <211> 45 <212> DNA <213> Artificial Sequence (unknown) <400> 128 tgtgccagta gtatagtagg aggggcgaac actgaagctt tcttt 45 <210> 129 <211> 39 <212> DNA <213> Artificial Sequence (unknown) <400> 129 tgtgccagca gttcctcgat tcgattcggc tacaccttc 39 <210> 130 <211> 39 <212> DNA <213> Artificial Sequence (unknown) <400> 130 tgtgccagca gcctatacag gcagggtgaa gctttcttt 39 <210> 131 <211> 45 <212> DNA <213> Artificial Sequence (unknown) <400> 131 tgcagtgcct tagacgggga acggggcaat cagccccagc atttt 45 <210> 132 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 132 tgtgccagca cccagggtgg attggtcaat gagcagttct tc 42 <210> 133 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 133 tgtgccagca cccatggtgg tttggtcaat gagcagttct tc 42 <210> 134 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 134 tgtgccagta gtatcgggac tagcgggaga cacgagcagt acttc 45 <210> 135 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 135 tgtgccagca cccagggtgg tttggtaaat gagcagttct tc 42 <210> 136 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 136 tgtgccacca gtgattggca gggaactact gagcagttct tc 42 <210> 137 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 137 tgtgccagca cccagggtgg tttggtcgat gagcagttct tc 42 <210> 138 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 138 tgtgccagca gcttaaggac tcgatcccct accaatgagc agttcttc 48 <210> 139 <211> 51 <212> DNA <213> Artificial sequence (unknown) <400> 139 tgtgccagca gccaagatca ccggactagc gggagttcgg agctgttttt t 51 <210> 140 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 140 tgtgccacca taggggggga gtacaatgag cagttcttc 39 <210> 141 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 141 tgtgccagca gcagtcagag gatcaccggg gagctgtttt tt 42 <210> 142 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 142 tgcgccagca gccaactagc ggtcaccggg gagctgtttt tt 42 <210> 143 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 143 tgtgccagca gtgcccgaca ggggagagac gagcagtact tc 42 <210> 144 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 144 tgtgccagca gcttggtgtc agaatccatt cagtacttc 39 <210> 145 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 145 tgcgccagca gccaaggtgc ggggaggtcc tacaatgagc agttcttc 48 <210> 146 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 146 tgtgccagca gccccatatt caaaaatcag ccccagcatt tt 42 <210> 147 <211> 45 <212> DNA <213> Artificial sequence (unknown) <400> 147 tgtgccagca gccaaacagg tcatagcaca gatacgcagt atttt 45 <210> 148 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 148 tgtgccagca gcttagcggc tagcaatgag cagttcttc 39 <210> 149 <211> 51 <212> DNA <213> Artificial sequence (unknown) <400> 149 tgtgccagca gttcccgagt agcggggggc ataacagata cgcagtattt t 51 <210> 150 <211> 45 <212> DNA <213> Artificial Sequence (unknown) <400> 150 tgcagcgttg agacagacag ggggcggggg gagacccagt acttc 45 <210> 151 <211> 39 <212> DNA <213> Artificial Sequence (unknown) <400> 151 tgtgccagta gtatagggcc agcatacgag cagcacttc 39 <210> 152 <211> 42 <212> DNA <213> Artificial Sequence (unknown) <400> 152 tgtgccagca gttatacagg ggtcgcagat acgcagtatt tt 42 <210> 153 <211> 54 <212> DNA <213> Artificial Sequence (unknown) <400> 153 tgtgccagca gtaatgacag gggaggacta tcctataatt cacccctcca cttt 54 <210> 154 <211> 39 <212> DNA <213> Artificial Sequence (unknown) <400> 154 tgcagcgttc gccaggggga atctaatgag cagttcttc 39 <210> 155 <211> 39 <212> DNA <213> Artificial sequence (unknown) <400> 155 tgtgccagca gcttacgagg taacaatgag cagttcttc 39 <210> 156 <211> 48 <212> DNA <213> Artificial sequence (unknown) <400> 156 tgtgccagca gcaacggact agcgggttcc cacaatgagc agttcttc 48 <210> 157 <211> 42 <212> DNA <213> Artificial sequence (unknown) <400> 157 tgtgccagta ccaacaccgc gaacaccggg gagctgtttt tt 42

Claims

1. A method for constructing a T-cell receptor library targeting specific tumor cells, characterized in that, This can be achieved through the following steps: (1) Preparation of hematopoietic stem and progenitor cells using peripheral blood mononuclear cells: Peripheral blood was centrifuged using a gradient centrifugation solution to obtain mononuclear cells from the white membrane layer. These cells were then processed using a calcium-free solution. 2+ and Mg 2+ Wash 2-3 times with phosphate-buffered saline and culture mononuclear cells with a self-assembled polypeptide hydrogel composed of L-arginine, glycine and L-aspartic acid, RGD. (2) Establishment of humanized mice: After culturing the cells in step (1) with the self-assembling peptide RGD for 10-15 days, the expanded cells were treated with trypsin-EDTA, filtered, and washed 2-3 times with phosphate-buffered saline. 7-8 week old NOD-Prkdc cells were then harvested. em26Cd52 Il2rg em26Cd22 / Nju mice were irradiated with 1.8 g of iodine. Four hours later, the treated cells were divided into groups of 7-8 x 10⁻⁶ cells. 5 The cells were injected into mice via tibial injection. Three weeks after transplantation, the chimerism and type of human immune cells were analyzed by flow cytometry. (3) Humanized mice were inoculated with mitomycin C-inactivated tumor cells NALM 6 and MDA-MB-231. Two tumor cell lines were used: NALM-6, a B-cell precursor leukemia cell line, and MDA-MB-231, a triple-negative breast cancer cell line. NALM-6 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum, while MDA-MB-231 cells were cultured in Dulbecco modified Eagle medium containing 10% fetal bovine serum. Both cell lines carried green fluorescent protein. After entering the logarithmic growth phase, DNA synthesis and mitosis were inhibited for 2-3 hours with 10 mg / mL mitomycin C. Cells were then collected, and each tumor cell line was cultured at a rate of 1 × 10⁻⁶ cells / mL. 6 The cells were injected into humanized mice via the tail vein, and a booster treatment was administered once on day 7. (4) Construction of a library of T cell receptor B chain complementarity-determining region sequences Human T cells were collected from humanized mice and purified using the EasySep Human CD3 Positive Selection Kit II. Total RNA was extracted using Trizol reagent, and 28S- and 18S-RNA transcription bands were detected using 1.2% agarose gel to detect RNA integrity. The T cell receptor B chain was sequenced and library constructed using ImmuHub TCR technology. (5) Analysis of the clonal characteristics of the TRB CDR3 library The FASTA sequence dataset was submitted to IMGT / highV QUEST for gene interpretation to construct a cancer-targeting TRBCDR3 gene library. Information for each clone was obtained, including clone number, clone frequency, CDR3 gene sequence, CDR3 amino acid sequence, and V, D, J, and C segments. The similarity and differences of the TRB CDR3 libraries across groups were analyzed, including clone type, number diversity, and clone proliferation. The total number of each clonal type was calculated by comparing the identical AA sequences of CDR3 across groups. Further analysis was conducted on the increased TRB clonal types and their frequency changes shared among clones in each group. To calculate novel products under immune stimulation conditions, the characteristics, number, and frequency of new clonal types were further calculated. (6) Establishment of tumor-bearing mouse model NALM 6 cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS), and MDA-MB-231 breast cancer cells were cultured in Dulbecco modified Eagle medium (DMEM) containing 10% FBS. 300 μL of PBS was diluted with 1×10⁻⁶ PBS. 6 NAML6-EGFP and 1×10 6 MDA-MB-231-EGFP cell suspension was injected into NCGs mice via the tail vein. Tumor growth was measured by flow cytometry 20 days after transplantation, and the survival time of the mice was assessed.

2. The method for constructing a T-cell receptor library according to claim 1, characterized in that, The self-assembled polypeptide RGD culture in step (1) involves diluting the RGD with 20% sucrose, sonicating it, and encapsulating PBMNCs within the self-assembled polypeptide RGD. The RGD is then placed in hematopoietic cell culture medium SFEMII for 15-30 minutes to form a three-dimensional structure. The supernatant is then removed, and the RGD is cultured with 100 ng / ml small molecule stem cell growth factor, 100 ng / ml FMS-like tyrosine kinase 3 ligand, 20 ng / ml thrombopoietin, 2 ng / ml vascular endothelial growth factor, 20 ng / ml interleukin-3, 20 ng / ml interleukin-6, 1 μM aryl hydrocarbon receptor antagonist StemRegenin 1, and 25 μg / ml vitamin C. The culture medium is changed every 2-3 days until 10-15 days have elapsed, at which point the expanded cells contain hematopoietic stem and progenitor cells.

3. The method for constructing a T-cell receptor library according to claim 1, characterized in that, In step (2), chimerism of human hematopoietic cells, including human leukocyte antigen CD45, dendritic cells, monocytes and T cells, was detected in mice. This was considered a successful humanization model and was used in subsequent experiments to construct a TCR-T library targeting tumor cells.

4. The method for constructing a T-cell receptor library according to claim 1, characterized in that, Step (4) Specific steps: The first reaction system uses a 5' unbiased amplification scheme to introduce a unique molecular barcode into the PCR reaction system for cDNA synthesis. For the TRB V fragment TRBV, two reaction systems are used for amplification. The first system adds TRBV amplification primers for the complementarity-determining region V and the V region, and cycles at 95℃ for 15 minutes, 94℃ for 30 seconds, for 15 cycles, then at 60℃ for 40 minutes, 72℃ for 30 seconds, 94℃ for 30 seconds, for 10 cycles, then at 72℃ for 10 minutes, and stores at 4℃. The second reaction system uses the first round of PCR products as a template, and continues amplification using the same primers and the same reaction conditions, using PE150 The system performed PCR product sequencing. Based on the UMB adapter, repetitive and low-quality sequences in the original database were removed. Fragments of the V, D, J, and C genes were mapped to reference sequences in the International Immunogenetic Information Database to obtain a nucleotide and amino acid expression sequence library of TRB CDR3. After further removing the stop codon, a database of TRB CDR3 nucleotide and corresponding amino acid sequences was obtained.

Images