A SNP molecular marker for genetic improvement of chicken carcass traits

Abstract

The present invention discloses a SNP molecular marker for genetically improving chicken carcass traits. The present invention obtains a SNP molecular marker that can be used for genetically improving chicken carcass traits from the chicken riboprotein large subunit 38 gene (RPL38), and also provides primers and kits for detecting the SNP molecular marker. The SNP molecular marker of the present invention, the primers or kits for detecting the SNP marker can be used to screen chicken individuals with good carcass traits, improve chicken carcass traits, and perform genetic improvement. The SNP molecular marker of the present invention can be used for molecular marker-assisted breeding of chicken carcass traits, has the advantages of low cost and high accuracy, and is conducive to the development of broiler genetic breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular marker breeding, and specifically relates to a SNP molecular marker for genetically improving chicken carcass traits. Background Art

[0002] Carcass traits are one of the most important economic traits of broilers, including live weight before slaughter, shank length, chest width, half-clean carcass weight, breast meat weight, leg meat weight, wing weight, shank and claw weight, and small intestine length. In addition to the different degrees of influence of feeding methods on broiler carcass traits, genetic factors also play a vital role.

[0003] Single nucleotide polymorphism (SNP) is a molecular breeding technology commonly used in molecular marker-assisted selection (MAS). It is widely present in biological populations and can be accurately and stably inherited by offspring. As a stable DNA molecular marker, SNP has been widely used in large-scale breeding of various animals including chickens. The relevant molecular genetic markers established by breeders through the study of SNP have effectively promoted the development of broiler genetic breeding in my country. With the development of SNP markers, these markers have been applied to the screening of functional genes for economic traits of various animals based on the precise positioning of genes, and a large number of excellent genes have been developed and utilized.

[0004] The chicken ribosomal protein large subunit 38 gene (RPL38) is located in the cytoplasm, belongs to the L38E family of ribosomal proteins, and is located on chromosome 18 of the chicken. In the study of human diseases and plants, the RPL38 gene was once used as a housekeeping gene and was believed to be stably expressed in all cells. However, more and more studies have shown that in addition to participating in ribosome composition and affecting protein translation, ribosomal proteins are also involved in a variety of extra-ribosomal functions such as cell proliferation, cell differentiation, cell apoptosis, cell development regulation, malignant transformation of normal cells, DNA repair and drug resistance. Some studies have also found that the RPL38 gene can control gene expression through internal ribosome entry sites, and even control translation by binding to ribosomes, thereby regulating the development of animal embryos. However, there have been no reports on RPL38 in poultry breeding work, and it is still unclear whether RPL38 can affect poultry carcass traits. Summary of the invention

[0005] The purpose of the present invention is to enrich SNP molecular markers related to chicken carcass traits, provide a SNP molecular marker for genetically improving chicken carcass traits, and promote the development of broiler genetic breeding in my country.

[0006] The first object of the present invention is to provide a SNP molecular marker for genetically improving chicken carcass traits.

[0007] The second object of the present invention is to provide detection primers for the SNP site.

[0008] The third object of the present invention is to provide a detection kit for detecting the SNP molecular marker.

[0009] The fourth object of the present invention is to provide the use of the SNP molecular marker, the detection primer or the detection kit in the molecular marker-assisted breeding of chicken carcass traits.

[0010] A fifth object of the present invention is to provide a method for screening chicken individuals with good carcass traits.

[0011] A sixth object of the present invention is to provide a method for genetic improvement of chicken carcass traits.

[0012] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0013] The present invention performs single nucleotide polymorphism detection on the chicken riboprotein large subunit 38 gene (RPL38, located on chromosome 18), and obtains SNP molecular markers that can be used for genetic improvement of chicken carcass traits by analyzing the correlation between different genotypes and chicken carcass traits, providing a scientific basis for molecular breeding of auxiliary chicken carcass traits.

[0014] The present invention provides a SNP molecular marker for genetically improving chicken carcass traits, wherein the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1; the 216th position of the nucleotide sequence shown in SEQ ID NO.1 is a SNP site: C>T; the carcass traits of chicken individuals with the SNP molecular marker CC genotype are significantly lower than those of chicken individuals with CT or TT genotypes.

[0015] Specifically, the carcass traits include live weight before slaughter, shank length, chest width, chest depth, body oblique length, half-clean weight, breast meat weight, leg meat weight, wing weight, shank and claw weight and / or small intestine length.

[0016] Based on the SNP molecular markers described in the present invention, those skilled in the art can use conventional primer design methods to design detection primers for amplifying the SNP sites described in the present invention, and use the designed detection primers to detect the genotype of the SNP site in chicken individuals, which can be used for molecular marker-assisted breeding of chicken carcass traits. Therefore, the present invention also applies to protect the detection primers for detecting the SNP sites described in the present invention.

[0017] Specifically, the detection primer is designed based on the sequence shown in SEQ ID NO.1, and the amplified sequence thereof contains the SNP site described in the present invention.

[0018] The present invention also provides a detection kit for detecting the SNP molecular marker, wherein the detection primer of the present invention is contained in the kit.

[0019] In addition to primers, the kit also contains reagents required for PCR amplification.

[0020] In view of the fact that the SNP molecular markers described in the present invention are significantly correlated with chicken carcass traits, the present invention also applies to protect the use of the SNP molecular markers, the detection primers or the detection kit described in the present invention in molecular marker-assisted breeding of chicken carcass traits.

[0021] The present invention also provides a method for screening chicken individuals with good carcass traits, the method comprising: using the detection primers of the SNP site of the present invention to amplify the genomic DNA of the chicken individual to be tested and performing genotyping of the SNP site on the chicken individual, and the chicken individual with a CT or TT genotype shown in the typing result is a chicken individual with good carcass traits.

[0022] The present invention also provides a method for genetic improvement of chicken carcass traits, the method comprising: using a strain bred using the method for improving chicken carcass traits of the present invention as a breeding chicken, increasing the frequency of the dominant allele at the SNP molecular marker site of the present invention through breeding generation by generation, thereby improving the carcass traits of offspring chickens.

[0023] The present invention has the following beneficial effects:

[0024] The present invention performs single nucleotide polymorphism detection on the chicken riboprotein large subunit 38 gene (RPL38), and obtains SNP molecular markers that can be used for genetic improvement of chicken carcass traits by analyzing the correlation between different genotypes and chicken carcass traits. In addition, the present invention also provides primers and a kit for detecting the SNP molecular markers. The SNP molecular markers of the present invention, the primers and the kit for detecting the SNP markers can be used to screen chicken individuals with good carcass traits, improve chicken carcass traits, and perform genetic improvement. The SNP molecular markers of the present invention can be used for molecular marker-assisted breeding of chicken carcass traits, and have the advantages of low cost and high accuracy, which is conducive to the development of broiler genetic breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a schematic diagram of the typing of the SNP site: C>T described in the present invention. DETAILED DESCRIPTION

[0026] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0027] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0028] Example 1 PCR amplification of chicken RPL38 gene

[0029] 1. Animal materials

[0030] A total of 325 91-day-old Xinghua chicken × recessive White Lock F2 resource groups were selected, and 1.2 mL of subwing venous blood was collected using a vacuum anticoagulant tube and stored in a -80°C low-temperature refrigerator for subsequent DNA extraction.

[0031] The live weight, carcass weight, half-eviscerated weight, full-eviscerated weight, breast weight, leg weight, wing weight, shin and claw weight, small intestine length, chest width, chest depth, body oblique length, shin length, small intestine length and other traits of the chicken were measured before slaughter.

[0032] 2. Blood DNA extraction

[0033] The DNA extraction operations of all chicken individuals were carried out according to the instructions of the DNA extraction kit (NRBC Blood DNA Kit, OMEGA, D0715). The extracted DNA was tested for concentration and purity and then stored in a -20°C refrigerator for subsequent PCR amplification.

[0034] 3. Primer design

[0035] The present invention designs amplification primers based on the RPL38 gene sequence (Gene ID: 771528) provided by the NCBI official website. The primer information is shown in Table 1. The primers are synthesized by the Guangzhou branch of Beijing Qingke Biotechnology Co., Ltd., and the PCR product length is 912 bp.

[0036] Table 1 RPL38 gene PCR amplification primer information

[0037]

[0038] 4. PCR amplification of chicken RPL38 gene

[0039] The present invention uses 2×Taq MasterMix (Dye) (Kangwei Century, CW0682) reagent to perform PCR amplification of RPL38 gene. The PCR reaction system is shown in Table 2. The PCR reaction procedure is performed according to the instructions of 2×Taq MasterMix (Dye), and the annealing temperature is 58°C.

[0040] Table 2 PCR amplification system

[0041]

[0042] The PCR product was sent to the Guangzhou Branch of Beijing Tsingke Biotechnology Co., Ltd. for Sanger sequencing. The nucleotide sequence of the PCR product is shown as follows (SEQ ID NO.1):

[0043] CCAAAGCCAAGTTGCAGCTGGTGGGAAGCTATTTGCAAATATTACCCTGCCTGTGACTTCGTAAGTCTTTGACAAGCTAAAAGATGTCGTTCCGCTAAAGCTCTGCGACACCTGACAAGTGAATCACGCTTAAGCTCAAGTTTTCTATTGTTGCGAATACAAAGACAATTATAATTGAAAAGCTGGGCTGTCTTGTCTCGGTATTTAACAACGTGCGAGGAGTTTTCCTTTATTTTTTCCTGTATTTGGATGGAGCTGTCATGGGAAGAGGTGCTTTAATTCTGGAAATGTTTTGTTAACTCAGCGGTGTGGGCGAGAGAGGGATAGCTCCGTGCACACTGCTATTGTAGTTGCTGACAGCTGCTTACAAAGCATTTCAATACCTTTCAACTCGTTCTAGATTTTGCTGCAGCTCTACTGCTTGTAATGCTGAGCTGCCAGGGCTGTGCAGTGGGAAAGGAGAGCGACTGACCACAGCTCTGAGCAAGCTGCTTAGATAAAACAGCCCTGCGTGGCTATAAAGGATAGGAAGCACTGCTTGCAGCCATGCAGAGTTGAGCAGACCGATTACAGGGGTCGGTGCTGCTATTCAGATGCAAAGGATTACACGAGGAAATCGGTCCAGCATGCACTGCTATGCTCTATTGAGAGTTTGTGATGCTGTGGGCTTCTGATGCTACTTGTAAATATCTGCTATGAGGCAAAAAGATCACGATAAAGCTGTTTGCTTTGAGAGACCTGAATAGTGTCTGGGAGGCAGCATGCCGAACCCTGTGCAGCTGGCCATCAGCACTGTAGAGAAAGTGCTCAGTTTGAATTTTCCTCAGCACGTGAGGGGTTGCAGTTGTCCTCCATGCTGAGGGGAAATAGGAGAACTGGAGTGGGAAATGGTTCGTAAAAGGGACTGCGTGG

[0044] This sequence is identical to the sequence shown in >Chromosome 18:9734285-9735196.

[0045] The sequencing results showed that the SNP mutation site 9734500 (i.e., the 216th position of the sequence shown in SEQ ID NO.1) in the chicken RPL38 gene was C>T.

[0046] Example 2 Genotyping of SNP sites, gene frequency calculation and genotype frequency calculation

[0047] The present invention uses DNAstar software to analyze the peak diagram of SNP site 9734500: C>T in Sanger sequencing results. The typing diagram of the SNP site: C>T is as follows: Figure 1 As shown, it includes three genotypes: CC, CT, and TT. The present invention also calculates the genotype frequency and allele frequency of the SNP site: C>T typing results, and the calculation results are shown in Table 3:

[0048] Table 3 Genotype frequency and allele frequency results of SNP site 9734500: C>T

[0049]

[0050] Example 3 Association analysis between SNP site 9734500: C>T and carcass traits

[0051] The present invention uses the mixed linear model in SPSS software (version 24.0) to analyze the correlation between different genotypes of SNP loci and different phenotypic traits of the F2 resource group of Xinghua chicken×recessive White Rock chicken.

[0052] The analysis model is as follows: Yijklm=μ+Gi+Sj+Hk+fl+eijklm; among them, Yijklm represents the individual trait phenotypic value, μ represents the population mean, Gi represents the genotype effect value of the marker (i=3), Sj represents the gender effect value, Hk represents the batch effect value, fl represents the family effect value, and eijklm represents the random error value; during the calculation process, Gi, Sj, and Hk are used as fixed factors, and fl is used as a random factor; the Borferroin method is used for multiple comparisons, and p<0.05 indicates a significant level.

[0053] The genotyping results of 325 Xinghua chicken × recessive White Lock F2 resource groups and the statistical analysis results of carcass traits such as live weight before slaughter, carcass weight, half-eviscerated weight, full-eviscerated weight, breast weight, leg weight, wing weight, shank and claw weight, small intestine length, chest width, chest depth, body oblique length, shank length and small intestine length are shown in Table 4:

[0054] Table 4 Results of association analysis between SNP site 9734500: C>T and carcass traits

[0055]

[0056] Note: Mean±SE, mean±standard error; n, number of individuals; different lowercase letters in the same row indicate significant differences (p<0.05), and no letters indicate no significant differences (p>0.05).

[0057] From the above results, it can be seen that the carcass traits of chicken individuals with SNP molecular marker CC genotype are significantly lower than those of chicken individuals with CT or TT genotype, and the carcass traits are specifically live weight before slaughter, shank length, chest width, chest depth, body oblique length, half-clean weight, breast weight, leg weight, wing weight, shank and claw weight and small intestine length.

[0058] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention. Sequence Listing <110> South China Agricultural University <120> A SNP molecular marker for genetic improvement of chicken carcass traits <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 912 <212> DNA <213> Artificial Sequence <400> 1 ccaaagccaa gttgcagctg gtgggaagct atttgcaaat attaccctgc ctgtgacttc 60 gtaagtcttt gacaagctaa aagatgtcgt tccgctaaag ctctgcgaca cctgacaagt 120 gaatcacgct taagctcaag ttttctattg ttgcgaatac aaagacaatt ataattgaaa 180 agctgggctg tcttgtctcg gtatttaaca acgtgcgagg agttttcctt tattttttcc 240 tgtatttgga tggagctgtc atgggaagag gtgctttaat tctggaaatg ttttgttaac 300 tcagcggtgt gggcgagaga gggatagctc cgtgcacact gctattgtag ttgctgacag 360 ctgcttacaa agcatttcaa tacctttcaa ctcgttctag attttgctgc agctctactg 420 cttgtaatgc tgagctgcca gggctgtgca gtgggaaagg agagcgactg accacagctc 480 tgagcaagct gcttagataa aacagccctg cgtggctata aaggatagga agcactgctt 540 gcagccatgc agagttgagc agaccgatta caggggtcgg tgctgctatt cagatgcaaa 600 ggattacacg aggaaatcgg tccagcatgc actgctatgc tctattgaga gtttgtgatg 660 ctgtgggctt ctgatgctac ttgtaaatat ctgctatgag gcaaaaagat cacgataaag 720 ctgtttgctt tgagagacct gaatagtgtc tgggaggcag catgccgaac cctgtgcagc 780 tggccatcag cactgtagag aaagtgctca gtttgaattt tcctcagcac gtgaggggtt 840 gcagttgtcc tccatgctga ggggaaatag gagaactgga gtgggaaatg gttcgtaaaa 900 gggactgcgt gg 912 <210> 2 <211> twenty three <212> DNA <213> Artificial Sequence <400> 2 ccaaagccaa gttgcagctg gtg 23 <210> 3 <211> twenty two <212> DNA <213> Artificial Sequence <400> 3 ccacgcagtc ccttttacga ac 22

Claims

1. Use of a reagent for detecting SNP molecular markers for genetically improving chicken carcass traits in chicken carcass trait molecular marker-assisted breeding, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, and the 216th position of the nucleotide sequence shown in SEQID NO.1 is the SNP site: C > T; the SNP site of the SNP molecular marker is that the carcass traits of chicken individuals with CC genotype are significantly lower than those of chicken individuals with CT or TT genotypes; the carcass traits are live weight before slaughter, shank length, chest width, chest depth, body oblique length, half-clean weight, breast weight, leg weight, wing weight, shank and claw weight and / or small intestine length; the chicken is the F2 generation of Xinghua chicken × recessive White Rock chicken.

2. The use of the detection primers for the SNP sites described in claim 1 in molecular marker-assisted selection of chicken carcass traits, characterized in that: The detection primer is designed based on the sequence shown in SEQ ID NO.1, and its amplified sequence contains the SNP site; the carcass traits of chicken individuals with CC genotype at the SNP site are significantly lower than those of chicken individuals with CT or TT genotype; the carcass traits are live weight before slaughter, shank length, chest width, chest depth, body oblique length, half-cleaned weight, breast weight, leg weight, wing weight, shank and claw weight and / or small intestine length; the chicken is the F2 generation of Xinghua chicken × recessive White Rock chicken.

3. The use according to claim 2, characterized in that: The nucleotide sequence of the upstream primer of the detection primer is shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.

3.

4. A method for screening chickens with good carcass traits, characterized in that: The detection primers of the SNP sites described in claim 2 are used to amplify the genomic DNA of the chicken individuals to be tested and perform genotyping. The typing results show that the chicken individuals with CT or TT genotypes are chicken individuals with good carcass traits; the carcass traits are live weight before slaughter, shank length, chest width, chest depth, body oblique length, half-cleaned weight, breast weight, leg weight, wing weight, shank and claw weight and / or small intestine length; the chicken is the F2 generation of Xinghua chicken × recessive White Rock chicken.

5. A method for genetic improvement of chicken carcass traits, characterized in that: The strain screened by the method described in claim 4 is used as breeding chicken, and the frequency of the dominant allele of the SNP molecular marker site described in claim 1 is increased generation by generation through breeding, thereby improving the carcass traits of the offspring chickens; the carcass traits are live weight before slaughter, shank length, chest width, chest depth, body oblique length, half-clean weight, breast weight, leg weight, wing weight, shank weight and / or small intestine length; the dominant allele is T; the offspring chickens are the hybrid offspring of Xinghua chicken and recessive White Rock chicken.

Images