A protease mutant

By substituting amino acids into the 10R protease of Nocardia species NRRL 18262, a protease mutant was designed and expressed in host cells, solving the problem of insufficient fermentation activity and improving cost-effectiveness.

CN115247166BActive Publication Date: 2025-11-25NANJING BESTZYME BIO ENG CO LTD +1
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202210454485.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2021-04-27
Filing Date
2022-04-27
Publication Date
2025-11-25
Estimated Expiration
2042-04-27

AI Technical Summary

Technical Problem

Existing proteases have insufficient fermentation activity in host cells, resulting in high production costs and making it difficult to meet the needs of industrial production.

Method used

By substituting the 11th amino acid of the 10R protease in Nocardia spp. 18262, a protease mutant was designed and expressed in Gram-positive and Gram-negative strains to enhance its fermentation activity.

Benefits of technology

It significantly improved the fermentation activity of proteases in host cells, reduced production costs, and provided a higher production capacity and application basis for industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003617493890000051
    Figure BDA0003617493890000051
  • Figure BDA0003617493890000053
    Figure BDA0003617493890000053
  • Figure BDA0003617493890000071
    Figure BDA0003617493890000071
Patent Text Reader

Abstract

The application discloses a protease mutant, which has substitution of amino acids at the 11th position corresponding to SEQ ID NO:1; and the mutant has protease activity. The amino acid sequence of the protease mutant is shown as SEQ ID NO:2. In addition, through scientific mutation point scheme design and a large number of mutant screening experiments, the protease mutant obtained by the application has significantly increased fermentation activity in host cells compared with parent protease, is beneficial to reducing the production cost of the enzyme in industrial production, improving the protease product capacity of a factory, providing a basis for the wide application of the protease in different fields, and has good application prospect and industrial value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of genetic engineering and enzyme engineering, and relates to a proteinase mutant, in particular to a proteinase mutant derived from Nocardiopsis sp. NRRL 18262 (hereinafter referred to as 10R proteinase). BACKGROUND

[0002] Proteinase is a kind of enzyme preparation which specifically hydrolyzes protein, and is one of the largest industrial enzyme preparation products in the world in terms of output and market, and has been widely applied in various fields such as food, washing, feed and the like.

[0003] Protein is an essential nutrient factor for animals, and most livestock ingest essential protein from plant-derived protein (for example, oilseed crops, legumes and cereals).

[0004] When plant protein raw materials such as soybean meal are added in the feed of monogastric animals such as pigs and poultry, a considerable proportion of soybean protein is not effectively digested (the apparent ileal protein digestibility in piglets, growing pigs and poultry is only about 80%). Adding exogenous proteinase has very important significance for supplementing the deficiency of endogenous enzymes in the animal body, improving the utilization rate of feed protein, reducing feed costs, promoting the growth of livestock and poultry, and reducing environmental pollution.

[0005] Most protein digestion occurs in the small intestine of animals, and proteinase as a feed additive plays a role in the intestinal tract of monogastric animals such as pigs and poultry, and must go through two important steps of feed pelleting and passing through the stomach. The feed pelleting requires that the proteinase still maintains high activity under high temperature conditions, and the passing through the stomach requires that the proteinase has good stability under strong acidic conditions.

[0006] Many proteinases derived from Nocardiopsis sp. have good performance in terms of heat resistance and acid stability, and maintain high activity in the pH range of 6-7.5, which has potential application value in the feed industry. The 10R proteinase from Nocardiopsis sp. NRRL 18262 is disclosed in the patent WO88 / 03947. In addition, the 10R proteinase also has good application prospects in the fields of detergents and food processing, and the patent WO2005 / 035747 discloses the application of Nocardiopsis sp. proteinase mutant in the field of detergents; the patent WO2008 / 077890 discloses the method for producing yeast extract by using 10R proteinase; and the patent WO2009 / 147105 discloses the application of 10R proteinase in the production of casein hydrolysate.

[0007] However, it is very challenging to produce these proteases in large quantities by recombinant expression in preferred Bacillus expression host cells, and therefore, improvements in the production of these proteases are of high interest to the enzyme industry. WO 2004 / 111219 discloses improving the production of the 10R protease by adding amino acids to the C-terminus of the protease and / or modifying the existing C-terminus, WO 2005 / 123914 discloses improving the production of the 10R protease in Bacillus by lowering the fermentation temperature, and WO 2005 / 123915 discloses improving the production of the 10R protease by constructing multicopies of at least two ORFs stably maintained in the same orientation at the same chromosomal location in B. licheniformis. Further improvements in the production of the 10R protease are still of great interest for industrial production to reduce the production costs. SUMMARY

[0008] To solve the problems in the prior art, the present application aims to provide a protease mutant, which has significantly increased fermentation activity in host cells compared to wild-type proteases, and is beneficial for reducing the production cost of the enzyme in industrial production.

[0009] In one aspect, the present application provides a protease mutant, which has a substitution of an amino acid at position 11 corresponding to SEQ ID NO: 1; and the mutant has protease activity.

[0010] Preferably, the amino acid at position 11 of the mutant is substituted with I.

[0011] Preferably, the amino acid sequence of the mutant is:

[0012] (1) the amino acid sequence as shown in SEQ ID NO: 2;

[0013] (2) the amino acid sequence of the mature polypeptide of the polypeptide as shown in SEQ ID NO: 2;

[0014] (3) an amino acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or more sequence identity to SEQ ID NO: 2; or

[0015] (4) an amino acid sequence obtained by adding, substituting, deleting or inserting one or several amino acids to the amino acid sequence as shown in SEQ ID NO: 2.

[0016] Preferably, the parent protease of the protease mutant is from Nocardiopsis sp. NRRL 18262, and the amino acid sequence of the parent protease is shown as SEQ ID NO: 1.

[0017] In another aspect, the present application also provides a polynucleotide encoding the protease mutant according to any one of the above.

[0018] Preferably, the polynucleotide sequence of the protease mutant is:

[0019] (1) a polynucleotide sequence shown as SEQ ID NO: 3;

[0020] (2) a polynucleotide sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to SEQ ID NO: 3;

[0021] (3) a polynucleotide sequence obtained by adding, substituting, deleting or inserting one or several nucleotides to the polynucleotide sequence shown as SEQ ID NO: 3;

[0022] (4) a polynucleotide sequence hybridizing to the polynucleotide sequence of (1), (2) or (3) or its full-length complement under stringent conditions; or

[0023] (5) a polynucleotide sequence different from the polynucleotide sequence of (1), (2), (3), (4) due to the degeneracy of the genetic code.

[0024] In the present application, the stringent conditions refer to, for a probe of at least 100 nucleotides in length, pre-hybridization and hybridization in 5X SSPE, 0.3% SDS, 200 micrograms / ml sheared and denatured salmon sperm DNA and 50% formamide at 42°C for 12 to 24 hours, following standard Southern blot procedures. The support material is finally washed in 2X SSC, 0.2% SDS at 65°C for three times, each for 15 minutes.

[0025] The present application also provides a nucleic acid construct, an expression vector or an expression plasmid comprising the above-mentioned polynucleotide, which is operably linked to one or several (several) control sequences directing the production of the polypeptide in an expression host cell.

[0026] The present application also provides a host cell comprising the above-mentioned nucleic acid construct, expression vector or expression plasmid; the host cell is a gram-positive strain or a gram-negative strain.

[0027] The gram-positive strain is Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus lentus, etc.

[0028] The gram-negative strain is Escherichia coli.

[0029] The application further provides a pUC57-10Rmut-Cm-amyE plasmid construction method, which comprises the following steps:

[0030] Step one, linearizing the pUC57-BsaI-free plasmid with BamHI-HindIII, taking the genome DNA of Bacillus subtilis ATCC6051a strain as a template, performing PCR amplification, and recombining three fragments to obtain the pUC57-BsaI-free-amyE plasmid;

[0031] Step two, linearizing the pUC57-BsaI-free-amyE plasmid with BsaI, respectively taking the 10Rmut gene synthesis plasmid and the genome DNA of Bacillus licheniformis ATCC14580 as templates, respectively performing PCR amplification, and recombining three fragments to obtain the pUC57-10Rmut-Cm-amyE plasmid.

[0032] The application further provides a mutant strain 10Rmut construction method, which comprises the following steps:

[0033] Step one, transforming the gram-positive strain and the gram-negative strain into experimental host bacteria;

[0034] Step two, preparing competent cells of the experimental host bacteria;

[0035] Step three, transforming the pUC57-10Rmut-Cm-amyE plasmid into the competent cells to obtain the mutant strain.

[0036] In the application, the terms involved and explanations are as follows:

[0037] Protease: It is a general term for a class of enzymes that hydrolyze protein peptide chains. According to the way of degrading polypeptides, it is divided into two categories of endopeptidases and exopeptidases. The former can cut the large molecular weight polypeptide chain in the middle to form smaller molecular weight proteins and peptones; the latter can be divided into carboxypeptidases and aminopeptidases, which respectively hydrolyze the peptide chain to form amino acids from the free carboxyl terminal or free amino terminal of the polypeptide.

[0038] Mature polypeptide: It refers to a polypeptide in its final form after translation and any post-translational modification, such as N-terminal processing, C-terminal truncation, glycosylation, phosphorylation, etc. It is known in the art that a host cell can produce a mixture of two or more different mature polypeptides (i.e., having different C-terminal and / or N-terminal amino acids) expressed from the same polynucleotide.

[0039] Parent protease: refers to a protease which can produce the mutant of the present application after the mutation described in the present application, and the parent protease can be a naturally produced (wild type) protease or a mutant thereof prepared by a suitable method, and the parent can also be an allelic variant.

[0040] Protease mutant: refers to a mutated protease obtained by one or more mutations in the sequence compared with the amino acid sequence of the parent protease, and the expression of the mutant is carried out in a host cell after the mutant gene is transferred into a plasmid.

[0041] Host cell: refers to any cell type susceptible to transformation, transfection, transduction, etc. with a vector comprising the nucleic acid of the present application; encompasses any progeny of the parent cell which results from the replication of the parent cell, which can not be identical to the parent cell due to mutations that occur during replication.

[0042] Substitution: refers to replacing the original amino acid occupying a certain position with a different amino acid.

[0043] Protease activity: protease activity is expressed in units of protease activity, which is defined as the amount of enzyme that converts its specific substrate to produce 1 μg or 1 μmol of product in 1 min, and is defined as 1 unit of protease activity. For example, in the examples of the present application, it is defined as 1 g or 1 mL of enzyme, which hydrolyzes casein to produce 1 μg of tyrosine in 1 min under certain temperature and pH conditions, which is 1 unit of enzyme activity, expressed as U / g (U / mL).

[0044] Sequence identity: the percentage of sequence identity is determined by a computer program based on dynamic programming algorithm. Preferred computer programs within the scope of the present application include BLAST (Basic Local Alignment Search Tool) search program designed to explore all available sequence databases, regardless of whether the query is a protein or DNA. BLAST version 2.0 (Gapped BLAST) of the search tool is already publicly available on the Internet (currently http: / / www.ncbi.nlm.nih.gov / BLAST / ). It uses an exploratory algorithm to search for local alignments rather than global alignments, which can detect relationships between sequences that share only isolated regions. The score specified in the BLAST search has a well-defined statistical interpretation. The program is preferably run with selectable parameters set to default values.

[0045] In describing the protease mutants of the present application, the following nomenclature is used for ease of reference.

[0046] In all cases, the accepted IUPAC one-letter or three-letter amino acid abbreviations are used. For substitutions of amino acids, the following nomenclature is used: original amino acid, position, substituting amino acid. For example, substitution of alanine for threonine at position 16 is designated "Thr16Ala" or "T16A".

[0047] The beneficial effects of the present application include that the present application obtains the proteinase mutant with significantly increased fermentation activity in host cells compared with its parent proteinase through scientific mutation point scheme design and a large number of mutant screening experiments. The proteinase mutant in the present application is conducive to reducing the production cost of proteinase in industrial production, improving the production capacity of proteinase products in factories, providing a basis for its wide application in different fields, and has good application prospect and industrial value. BRIEF DESCRIPTION OF DRAWINGS

[0048] Figure 1 is a schematic diagram of pUC57-10Rmut-Cm-amyE plasmid. DETAILED DESCRIPTION

[0049] The present application is further described in conjunction with the following specific examples and drawings. The process, conditions, experimental methods, etc. for implementing the present application are the general knowledge and common sense in the art, and the present application does not have special limitations.

[0050] Example 1 Construction of recombinant plasmid of protease and its mutant

[0051] The amino acid sequence of wild-type 10R protease derived from Nocardiopsis sp. NRRL 18262 is shown in SEQ ID NO. 1, and the polynucleotide sequence is shown in SEQ ID NO. 4; the amino acid sequence of 10R protease mutant is shown in SEQ ID NO. 2, and the polynucleotide sequence of 10R protease mutant is shown in SEQ ID NO. 3. The amyE gene promoter of ATCC6051a strain is used to express 10R protease gene and its mutant gene, which is contained at the end of amyE-5' fragment and directly connected with aprE signal peptide, and the promoter sequence is as follows:

[0052]

[0053] The signal peptide is selected from the signal peptide of alkaline protease gene (aprE) of Clostridium kluyveri, and the amino acid sequence (SEQ ID NO. 8) is as follows:

[0054]

[0055] 10R protease propeptide amino acid sequence (SEQ ID NO. 9) is as follows:

[0056]

[0057] The terminator is selected from the terminator sequence of Bacillus amyloliquefaciens alpha-amylase gene (amyQ), the sequence of which is as follows: TAATCAATAAAAAAACGCTGTGCGGTTAAAGGGCACAGCGTTTTTTTGTGTAT (SEQ ID NO. 10)

[0058] The nucleotide sequences of aprE signal peptide, 10R protease (including propeptide and mature peptide) wild type and M11I mutant are all optimized according to the codon bias of Bacillus subtilis 168 strain (at http: / / www.jcat.de / website), and are subjected to gene synthesis by Genscript Company. The plasmid containing the 10R protease wild type nucleotide gene synthesis fragment is named 10R-wt plasmid, and the plasmid containing the 10R protease mutant nucleotide gene synthesis fragment is named 10Rmut plasmid.

[0059] The pUC57-BsaI-free plasmid (obtained by destroying the BsaI restriction site by point mutation from the pUC57 plasmid) is used as the backbone for construction. The pUC57-BsaI-free plasmid is linearized with BamHI-HindIII, and the 2674bp fragment is recovered from the gel. The amyE upstream homologous arm (referred to as amyE-5’) is amplified using the amyE-5’-F and amyE-5’-R primers with the Bacillus subtilis ATCC6051a strain genomic DNA as the template, and the PCR product size is 668bp. The amyE site downstream homologous arm (referred to as amyE-3’) is amplified using the amyE-3’-F and amyE-3’-R primers, and the PCR product size is 671bp. The three fragments of 2674bp, 668bp and 671bp are recombined using CloneZ recombinase (produced by Genscript Company) to obtain the plasmid pUC57-BsaI-free-amyE. The plasmid inserts 2 BsaI sites between the amyE-5’ and amy-3’ fragments for subsequent plasmid construction. The primer sequences are shown in Table 1.

[0060] The pUC57-Bsal-free-amyE plasmid was linearized with Bsal to obtain a 3876 bp fragment. A fragment containing the aprE signal peptide, 10R protease (propeptide + mature peptide) wild type sequence, and amyQ terminator was amplified using the 10R-wt plasmid as the template and 10R-F and 10R-R as primers, and the PCR product size was 1271 bp (wt). A chloramphenicol resistance gene expression cassette was amplified using the B. licheniformis ATCC 14580 genomic DNA as the template and Cm-F and Cm-R as primers, and the PCR product size was 1264 bp. The three fragments of 3876 bp, 1271 bp (wt), and 1264 bp were recombined using CloneZ recombinase (produced by Genscript) to obtain a plasmid called pUC57-10Rwt-Cm-amyE, and the primer sequences are shown in Table 1, and the plasmid full sequence is shown in SEQ ID NO. 6.

[0061] A fragment containing the aprE signal peptide, 10R protease (propeptide + mature peptide) M11I mutant sequence, and amyQ terminator was amplified using the 10Rmut plasmid as the template and 10R-F and 10R-R as primers, and the PCR product size was 1271 bp (mut). The three fragments of 3876 bp, 1271 bp (mut), and 1264 bp were recombined using CloneZ recombinase (produced by Genscript) to obtain a plasmid called pUC57-10Rmut-Cm-amyE, and the primer sequences are shown in Table 1, and the plasmid full sequence is shown in SEQ ID NO. 5.

[0062] Table 1 Primer name and sequence (SEQ ID NO. 11-18)

[0063] Primer name Primer sequence (5'→ 3') amyE-5' -F tcggtacctcgcgaatgcatctagatatcggatccgcggcattatgtttgaatttccgtttaaag (SEQ ID NO. 11) amyE-5' -R ctTgagacctttgagcttccgagactggtctcatcttgacactccttatttgattttttgaagac (SEQ ID NO. 12) amyE-3' -F aagatgagaccagtctcggaagctcaaaggtctcaagcgcccaagtgcccggtcagaatc (SEQ ID NO. 13) amyE-3' -R acaggaaacagctatgaccatgattacgccaagcttcttcactaacgatgcctttgaaaatcttc (SEQ ID NO. 14) 10R-F taagtcttcaaaaaatcaaataaggagtgtcaagaatgaaaaaacctcttggcaaaatcgttg (SEQ ID NO. 15) 10R-R agttgggtaacgccagggttttcccagtcacgacgttatacacaaaaaaacgctgtgccc (SEQ ID NO. 16) Cm-F aacgtcgtgactgggaaaacc (SEQ ID NO. 17) Cm-R agccaggctgattctgaccgggcacttgggcgctttattggtatgactggttttaagcgc (SEQ ID NO. 18)

[0064] Example 2 Construction of B. subtilis wild type 10R protease expression strain and its M11I mutant strain

[0065] The experimental host strain A164Δ4-comK was obtained by modifying the B. subtilis ATCC6051a strain, and the modification involved inactivation of the aprE, nprE, spo, and amyE genes, wherein a comK gene for improving the competence value was integrated at the aprE site and was operated by a xylose inducible promoter.

[0066] The A164Δ4-comK competent cell preparation method is as follows: a single colony is picked from a plate and inoculated in 50 ml of LB liquid medium (formula: 1% Tryptone, 0.5% yeast extract, 1% NaCl), and cultured at 37°C and 200 rpm overnight. The next morning, the overnight culture is diluted with sterile LB liquid medium to an OD of about 1.0, 20 ml of the diluted bacterial solution is added to 1 ml of 30% xylose solution, mixed, and then transferred to a 250 ml sterile flask, and cultured at 37°C and 200 rpm for 2 h. Then, 5 ml of 50% glycerol is added and mixed, and the resulting competent cells are obtained. The competent cells are divided into 100 ul per tube, and immediately transformed or stored in a -80°C refrigerator for later use.

[0067] 500 ng of the pUC57-10Rwt-Cm-amyE plasmid and the pUC57-10Rmut-Cm-amyE plasmid constructed in Example 1 of the present application are respectively transferred into A164Δ4-comK competent cells, which are cultured at 37°C and 200 rpm for 2 h, and then diluted to 10 -2 100 ul of the diluted solution is then spread on LB solid medium (formula: 1% Tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar) containing 2% skim milk and 5 ng / ul chloramphenicol, and cultured at 37°C for 1-2 days. The colonies with hydrolysis rings are selected for colony PCR and sequencing verification. The resulting 10R protease wild-type strain is named 10R-wt strain, and the mutant strain is named 10Rmut strain.

[0068] Example 3: Shake flask fermentation

[0069] The 10Rmut strain and the 10R-wt wild-type strain obtained in Example 2 of the present application are subjected to shake flask fermentation. The experimental method is as follows: an appropriate amount of each bacterial strain is inoculated into a 250 ml flask containing 50 ml of LB liquid seed medium, and cultured at 37°C and 220 rpm overnight. Then, 1% of each bacterial strain is inoculated into a 250 ml flask containing 50 ml of AKP fermentation medium (formula: 10% glucose, 6% soybean cake powder, 1% anhydrous disodium hydrogen phosphate), and cultured at 37°C and 220 rpm for 96 h. Then, 2 ml of the fermentation broth is centrifuged at 12000 rpm for 2 min, and the supernatant is detected for alkaline protease activity.

[0070] The enzyme activity detection is carried out according to the detection method of alkaline protease preparation in GB 1886.174-2016 “National Food Safety Standard Food Additives Food Industry Enzyme Preparation”. The protease activity is expressed by protease activity unit, which is defined as 1 g or 1 mL of enzyme, 1 μg of tyrosine is produced by hydrolysis of casein under certain temperature and pH conditions for 1 min, that is, 1 enzyme activity unit, expressed by U / g (U / mL). The detection principle is as follows: under certain temperature and pH conditions, the protease hydrolyzes the casein substrate to produce amino acids containing phenolic groups (such as tyrosine, tryptophan, etc.), under alkaline conditions, the Folin reagent is reduced to generate molybdenum blue and tungsten blue, and the absorbance of the solution is measured at a wavelength of 680 nm by a spectrophotometer. The enzyme activity is proportional to the absorbance, and thus the enzyme activity of the product can be calculated.

[0071] The shake flask fermentation results are shown in Table 2 below, and the fermentation activity of the 10R-wt strain is defined as 1.00, and the fermentation activity of the 10Rmut strain is calculated by comparison with the fermentation activity of the 10R-wt.

[0072] Table 2 10Rmut shake flask fermentation results

[0073]

[0074] As can be seen from Table 2, the shake flask fermentation activity of the 10Rmut strain is about 60% higher than that of the 10R-wt strain, which shows that the M11I point mutation has a very significant effect on improving the fermentation enzyme activity of the 10R protease.

[0075] The protection scope of the present application is not limited to the above examples. Changes and advantages that can be thought of by those skilled in the art without departing from the spirit and scope of the present application are included in the present application, and are protected by the appended claims. SEQUENCE LISTING <110> Nanjing Baisijie Biological Engineering Co., Ltd., Jinan Baisijie Biological Engineering Co., Ltd. <120> A proteinase mutant <160> 18 <170> PatentIn version 3.3 <210> 1 <211> 188 <212> PRT <213> Artificial sequence <400> 1 Ala Asp Ile Ile Gly Gly Leu Ala Tyr Thr Met Gly Gly Arg Cys Ser 1 5 10 15 Val Gly Phe Ala Ala Thr Asn Ala Ala Gly Gin Pro Gly Phe Val Thr 20 25 30 Ala Gly His Cys Gly Arg Val Gly Thr Gin Val Thr He Gly Asn Gly 35 40 45 Arg Gly Val Phe Glu Gin Ser Val Phe Pro Gly Asn Asp Ala Ala Phe 50 55 60 Val Arg Gly Thr Ser Asn Phe Thr Leu Thr Asn Leu Val Ser Arg Tyr 65 70 75 80 Asn Thr Gly Gly Tyr Ala Thr Val Ala Gly His Asn Gin Ala Pro He 85 90 95 Gly Ser Ser Val Cys Arg Ser Gly Ser Thr Thr Gly Trp His Cys Gly 100 105 110 Thr He Gin Ala Arg Gly Gin Ser Val Ser Tyr Pro Glu Gly Thr Val 115 120 125 Thr Asn Met Thr Arg Thr Thr Val Cys Ala Glu Pro Gly Asp Ser Gly 130 135 140 Gly Ser Tyr He Ser Gly Thr Gin Ala Gin Gly Val Thr Ser Gly Gly 145 150 155 160 Ser Gly Asn Cys Arg Thr Gly Gly Thr Thr Phe Tyr Gin Glu Val Thr 165 170 175 Pro Met Val Asn Ser Trp Gly Val Arg Leu Arg Thr 180 185 <210> 2 <211> 188 <212> PRT <213> Artificial Sequence <400> 2 Ala Asp Ile Ile Gly Gly Leu Ala Tyr Thr Ile Gly Gly Arg Cys Ser 1 5 10 15 Val Gly Phe Ala Ala Thr Asn Ala Ala Gly Gln Pro Gly Phe Val Thr 20 25 30 Ala Gly His Cys Gly Arg Val Gly Thr Gln Val Thr Ile Gly Asn Gly 35 40 45 Arg Gly Val Phe Glu Gln Ser Val Phe Pro Gly Asn Asp Ala Ala Phe 50 55 60 Val Arg Gly Thr Ser Asn Phe Thr Leu Thr Asn Leu Val Ser Arg Tyr 65 70 75 80 Asn Thr Gly Gly Tyr Ala Thr Val Ala Gly His Asn Gln Ala Pro Ile 85 90 95 Gly Ser Ser Val Cys Arg Ser Gly Ser Thr Thr Gly Trp His Cys Gly 100 105 110 Thr Ile Gln Ala Arg Gly Gln Ser Val Ser Tyr Pro Glu Gly Thr Val 115 120 125 Thr Asn Met Thr Arg Thr Thr Val Cys Ala Glu Pro Gly Asp Ser Gly 130 135 140 Gly Ser Tyr Ile Ser Gly Thr Gln Ala Gln Gly Val Thr Ser Gly Gly 145 150 155 160 Ser Gly Asn Cys Arg Thr Gly Gly Thr Thr Phe Tyr Gln Glu Val Thr 165 170 175 Pro Met Val Asn Ser Trp Gly Val Arg Leu Arg Thr 180 185 <210> 3 <211> 567 <212> DNA <213> Artificial Sequence <400> 3 gctgatatca tcggcggcct tgcttacaca atcggcggcc gttgctctgt tggcttcgct 60 gctacaaacg ctgctggcca acctggcttc gttacagctg gccattgcgg ccgtgttggc 120 acacaagtta caatcggcaa cggccgtggc gttttcgaac aatctgtttt ccctggcaac 180 gatgctgctt tcgttcgtgg cacatctaac ttcacactta caaaccttgt ttctcgttac 240 aacacaggcg gctacgctac agttgctggc cataaccaag ctcctatcgg ctcttctgtt 300 tgccgttctg gctctacaac aggctggcat tgcggcacaa tccaagctcg tggccaatct 360 tttcttacc ctgaaggcac agttacaaac atgacacgta caacagtttg cgctgaacct 420 ggcgattctg gcggctctta catctctggc acacaagctc aaggcgttac atctggcggc 480 tctggcaact gccgtacagg cggcacaaca ttctaccaag aagttacacc tatggttaac 540 tcttggggcg ttcgtcttcg tacataa 567 <210> 4 <211> 567 <212> DNA <213> Artificial Sequence <400> 4 gctgatatca tcggcggcct tgcttacaca atgggcggcc gttgctctgt tggcttcgct 60 gctacaaacg ctgctggcca acctggcttc gttacagctg gccattgcgg ccgtgttggc 120 acacaagtta caatcggcaa cggccgtggc gttttcgaac aatctgtttt ccctggcaac 180 gatgctgctt tcgttcgtgg cacatctaac ttcacactta caaaccttgt ttctcgttac 240 aacacaggcg gctacgctac agttgctggc cataaccaag ctcctatcgg ctcttctgtt 300 tgccgttctg gctctacaac aggctggcat tgcggcacaa tccaagctcg tggccaatct 360 gtttcttacc ctgaaggcac agttacaaac atgacacgta caacagtttg cgctgaacct 420 GGCGATTCTG GC GGCTCTTAC ATCTCTGGC ACACAAGCTC AAGGC GTTAC ATCTGGCGGC 480 TCTGGCAACT GCCGTACAGG CGGCACAACA TTCTACCAAG AAGTTACACCT ATGGTTAAC 540 TCTTGGGGCG TTCGTCTTCG TACATAA 567 <210> 5 <211> 6306 <212> DNA <213> Artificial Sequence <400> 5 TCGC GC GTTT CGGTGATGAC GGTGAAAACC TCTGACACAT GCAGCTCCCG GAGACGGTCA 60 CAGCTTGTC TGTAA GC GGAT GCCGGGAGC AGAC AAG CCCGTC AGGGCGCGTC AGCGGGGTG 120 TTGGCGGGTG TC GGGGCTGG CTTAAC TATGC GGC ATCAGAGC AGATTGTA CTGAGAGTGC 180 ACC ATATGC GGTGTGAAAT ACCGC ACAGAT GCGTAAGGAG AAAATACC GC ATCAGGC GCC 240 ATTCGC CATT CAGGC TGC GC AACT GTTGGG AAGGGCGATC GGTGC GGGCCTCTTC GCTAT 300 TACGCCAGCT GGC GAAAGGGGG ATGTGC TGC AAGGC GATT AAGTTGGGTA C GCC AGGGGT 360 TTTCCCAGTC ACGACGTTGT AAAACGACGG CCAGTGAATT CGAGCTCGGT ACCTC GC GAA 420 TGCA TCTAGAT ATCGGATCC GC GGC ATAT GTTTGAA TTT CC GTTTAAAG AATGGGCTGC 480 aagccttgtg tttttgttca tcattatctt atattactgc atcagggctg cggcatccgg 540 aatgctcatg ccgagaatag acaccaaaga agaactgcaa aaacgggtga agcagcagcg 600 aatagaatca attgcggtcg cctttgcggt agtggtgctt acgatgtacg acagggggat 660 tccccataca ttcttcgctt ggctgaaaat gattcttctt tttatcgtct gcggcggcgt 720 tctgtttctg cttcggtatg tgattgtgaa gctggcttac agaagagcgg taaaagaaga 780 aataaaaaag aaatcatctt ttttgtttgg aaagcgaggg aagcgttcac agtttcgggc 840 agcttttttt ataggaacat tgatttgtat tcactctgcc aagttgtttt gatagagtga 900 ttgtgataat tttaaatgta agcgttaaca aaattctcca gtcttcacat cggtttgaaa 960 ggaggaagcg gaagaatgaa gtaagaggga tttttgactc cgaagtaagt cttcaaaaaa 1020 tcaaataagg agtgtcaaga atgaaaaaac ctcttggcaa aatcgttgct tctacagctc 1080 ttcttatctc tgttgctttc tcttcttcta tcgcttctgc tgctacaggc gctcttcctc 1140 aatctcctac acctgaagct gatgctgttt ctatgcaaga agctcttcaa cgtgatcttg 1200 atcttacatc tgctgaagct gaagaacttc ttgctgctca agatacagct ttcgaagttg 1260 atgaagctgc tgctgaagct gctggcgatg cttacggcgg ctctgttttc gatacagaat 1320 ctcttgaact tacagttctt gttacagatg ctgctgctgt tgaagctgtt gaagctacag 1380 gcgctggcac agaacttgtt tcttacggca tcgatggcct tgatgaaatc gttcaagaac 1440 ttaacgctgc tgatgctgtt cctggcgttg ttggctggta ccctgatgtt gctggcgata 1500 cagttgttct tgaagttctt gaaggctctg gcgctgatgt ttctggcctt cttgctgatg 1560 ctggcgttga tgcttctgct gttgaagtta caacatctga tcaacctgaa ctttacgctg 1620 atatcatcgg cggccttgct tacacaatcg gcggccgttg ctctgttggc ttcgctgcta 1680 caaacgctgc tggccaacct ggcttcgtta cagctggcca ttgcggccgt gttggcacac 1740 aagttacaat cggcaacggc cgtggcgttt tcgaacaatc tgttttccct ggcaacgatg 1800 ctgctttcgt tcgtggcaca tctaacttca cacttacaaa ccttgtttct cgttacaaca 1860 caggcggcta cgctacagtt gctggccata accaagctcc tatcggctct tctgtttgcc 1920 GTTCTGGCTC TACAACAGGC TGGCATTGCG GCACAATCCA AGCTCgtggcc aatctgttt 1980 CTTACCCTGA AGGCACAGTT ACAAACATGA CACGTACAAC AGTTTGCgct gaacctggcg 2040 ATTCTGGCGG CTCTTACATC TCTGGCACAC AAGCTCAAGG CGTACATCT GGCggctctg 2100 GCAACTGCCG TACAGGCggc acaacattct accaagaagt tacacctatg gttaactctt 2160 GGGGCgttcg tcttcgtaca taataatcaa taaaaaaacg ctgtgcggtt aaagggcaca 2220 GCgttttttt gtgtataacg tcgtgactgg gaaaaccctg gcgttaccca acttaatcgc 2280 CTTGCAGCAC ATCCCCCTTT CGCCAGCTGG CGTAATAGCG AAGAGGCCCG CACCgatcgc 2340 CCTTCCCAAC AGTTGCgcag cctgaatggc gaatggcgct agcagcacgc catagtgact 2400 GGCGATgctg tcggaatgga cgacggcaat agttaccctt attatcaaga taagaaagaa 2460 AAGGATTttt cgctacgctc aaatccttta aaaaaacaca aaagaccaca ttttttaatg 2520 TGGTCTTTTA TTCTTCAACT AAAGCACCCA TTAGTTCAAC AAACGAAAAT TGGATAAAGT 2580 GGGATATTTT TAAAATATAT ATTTATGTTA CAGTAATATT GACTTTTAAA AAAGGATTGA 2640 ttctaatgaa gaaagcagac aagtaagcct cctaaattca ctttagataa aaatttagga 2700 ggcatatcaa atgaacttta ataaaattga tttagacaat tggaagagaa aagagatatt 2760 taatcattat ttgaaccaac aaacgacttt tagtataacc acagaaattg atattagtgt 2820 tttataccga aacataaaac aagaaggata taaattttac cctgcattta ttttcttagt 2880 gacaagggtg ataaactcaa atacagcttt tagaactggt tacaatagcg acggagagtt 2940 aggttattgg gataagttag agccacttta tacaattttt gatggtgtat ctaaaacatt 3000 ctctggtatt tggactcctg taaagaatga cttcaaagag ttttatgatt tatacctttc 3060 tgatgtagag aaatataatg gttcggggaa attgtttccc aaaacaccta tacctgaaaa 3120 tgctttttct ctttctatta ttccatggac ttcatttact gggtttaact taaatatcaa 3180 taataatagt aattaccttc tacccattat tacagcagga aaattcatta ataaaggtaa 3240 ttcaatatat ttaccgctat ctttacaggt acatcattct gtttgtgatg gttatcatgc 3300 aggattgttt atgaactcta ttcaggaatt gtcagatagg cctaatgact ggcttttata 3360 atatgagata atgccgactg tactttttac agtcggtttt ctaacgatac attaataggt 3420 acgaaaaagc aacttttttt gcgcttaaaa ccagtcatac caataaagcg cccaagtgcc 3480 cggtcagaat cagcctggct ttgattacgt gctaaatggt ttatataatg actcgggctt 3540 aagcggttct cttccccatt gagggcaagg ctagacggga cttaccgaaa gaaaccatca 3600 atgatggttt cttttttgtt cataaatcag acaaaacttt tctcttgcaa aagtttgtga 3660 agtgttgcac aatataaatg tgaaatactt cacaacaaa aagacatcaa agaaacat 3720 3780 ggttttgttg gaagcagtta tgcatttgcg ttaattaacc aaaggaatcac agatgagctt 3840 3900 3960 gctgatattg tctgcatttg cgccggagca aaccaaaaac ctggtgagac acgccttgaa 4020 4080 catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 4140 gagccggaag cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa 4200 ttgcgttgcg ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat 4260 gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc 4320 tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 4380 cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 4440 gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 4500 gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 4560 gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 4620 ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 4680 atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 4740 tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 4800 ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 4860 gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 4920 ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 4980 ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt ttgtttgca 5040 agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 5100 ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 5160 aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta 5220 tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 5280 cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga 5340 tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagat ccacgctcac 5400 cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc 5460 ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta 5520 gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 5580 gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 5640 gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 5700 gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 5760 tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag 5820 aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc 5880 cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 5940 caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 6000 cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 6060 ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 6120 aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 6180 tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg 6240 tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 6300 ttcgtc 6306 <210> 6 <211> 6306 <212> DNA <213> Artificial Sequence <400> 6 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180 accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc 240 attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat 300 tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt 360 tttcccagtc acgacgttgt aaaacgacgg ccagtgaatt cgagctcggt acctcgcgaa 420 tgcatctaga tatcggatcc gcggcattat gtttgaattt ccgtttaaag aatgggctgc 480 aagccttgtg tttttgttca tcattatctt atattactgc atcagggctg cggcatccgg 540 aatgctcatg ccgagaatag acaccaaaga agaactgcaa aaacgggtga agcagcagcg 600 aatagaatca attgcggtcg cctttgcggt agtggtgctt acgatgtacg acagggggat 660 tccccataca ttcttcgctt ggctgaaaat gattcttctt tttatcgtct gcggcggcgt 720 tctgtttctg cttcggtatg tgattgtgaa gctggcttac agaagagcgg taaaagaaga 780 aataaaaaag aaatcatctt ttttgtttgg aaagcgaggg aagcgttcac agtttcgggc 840 agcttttttt ataggaacat tgatttgtat tcactctgcc aagttgtttt gatagagtga 900 ttgtgataat tttaaatgta agcgttaaca aaattctcca gtcttcacat cggtttgaaa 960 ggaggaagcg gaagaatgaa gtaagaggga tttttgactc cgaagtaagt cttcaaaaaa 1020 tcaaataagg agtgtcaaga atgaaaaaac ctcttggcaa aatcgttgct tctacagctc 1080 ttcttatctc tgttgctttc tcttcttcta tcgcttctgc tgctacaggc gctcttcctc 1140 aatctcctac acctgaagct gatgctgttt ctatgcaaga agctcttcaa cgtgatcttg 1200 atcttacatc tgctgaagct gaagaacttc ttgctgctca agatacagct ttcgaagttg 1260 atgaagctgc tgctgaagct gctggcgatg cttacggcgg ctctgttttc gatacagaat 1320 ctcttgaact tacagttctt gttacagatg ctgctgctgt tgaagctgtt gaagctacag 1380 gcgctggcac agaacttgtt tcttacggca tcgatggcct tgatgaaatc gttcaagaac 1440 ttaacgctgc tgatgctgtt cctggcgttg ttggctggta ccctgatgtt gctggcgata 1500 cagttgttct tgaagttctt gaaggctctg gcgctgatgt ttctggcctt cttgctgatg 1560 ctggcgttga tgcttctgct gttgaagtta caacatctga tcaacctgaa ctttacgctg 1620 atatcatcgg cggccttgct tacacaatgg gcggccgttg ctctgttggc ttcgctgcta 1680 caaacgctgc tggccaacct ggcttcgtta cagctggcca ttgcggccgt gttggcacac 1740 aagttacaat cggcaacggc cgtggcgttt tcgaacaatc tgttttccct ggcaacgatg 1800 ctgctttcgt tcgtggcaca tctaacttca cacttacaaa ccttgtttct cgttacaaca 1860 caggcggcta cgctacagtt gctggccata accaagctcc tatcggctct tctgtttgcc 1920 gttctggctc tacaacaggc tggcattgcg gcacaatcca agctcgtggc caatctgttt 1980 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 tttctcctct ctctcctctc ctctcctctc ctgctgctgc tgctgctgct gctgctgctg 60 ggcatatcaa atgaacttta ataaaattga tttagacaat tggaagagaa aagagatatt 2760 taatcattat ttgaaccaac aaacgacttt tagtataacc acagaaattg atattagtgt 2820 tttataccga aacataaaac aagaaggata taaattttac cctgcattta ttttcttagt 2880 gacaagggtg ataaactcaa atacagcttt tagaactggt tacaatagcg acggagagtt 2940 aggttattgg gataagttag agccacttta tacaattttt gatggtgtat ctaaaacatt 3000 ctctggtatt tggactcctg taaagaatga cttcaaagag ttttatgatt tatacctttc 3060 tgatgtagag aaatataatg gttcggggaa attgtttccc aaaacaccta tacctgaaaa 3120 tgctttttct ctttctatta ttccatggac ttcatttact gggtttaact taaatatcaa 3180 taataatagt aattaccttc tacccattat tacagcagga aaattcatta ataaaggtaa 3240 ttcaatatat ttaccgctat ctttacaggt acatcattct gtttgtgatg gttatcatgc 3300 aggattgttt atgaactcta ttcaggaatt gtcagatagg cctaatgact ggcttttata 3360 atatgagata atgccgactg tactttttac agtcggtttt ctaacgatac attaataggt 3420 acgaaaaagc aacttttttt gcgcttaaaa ccagtcatac caataaagcg cccaagtgcc 3480 cggtcagaat cagcctggct ttgattacgt gctaaatggt ttatataatg actcgggctt 3540 aagcggttct cttccccatt gagggcaagg ctagacggga cttaccgaaa gaaaccatca 3600 atgatggttt cttttttgtt cataaatcag acaaaacttt tctcttgcaa aagtttgtga 3660 agtgttgcac aatataaatg tgaaatactt cacaaacaaa aagacatcaa agagaaacat 3720 accctggaag gatgattaat gatgaacaaa catgtaaata aagtagcttt aatcggagcg 3780 ggttttgttg gaagcagtta tgcatttgcg ttaattaacc aaggaatcac agatgagctt 3840 gtggtcattg atgtaaataa agaaaaagca atgggcgatg tgatggattt aaaccacgga 3900 aaggcgtttg cgccacaacc ggtcaaaaca tcttacggaa catatgaaga ctgcaaggat 3960 gctgatattg tctgcatttg cgccggagca aaccaaaaac ctggtgagac acgccttgaa 4020 ttagtagaaa agaacttgaa gattttcaaa ggcatcgtta gtgaagaagc ttggcgtaat 4080 catggtcata gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac 4140 GAGCCGGAAG CATAAAGTGT AAAGCCTGGG GTGCCTAATG AGTGAGCTAA CTCACATTA A 4200 TTGCCTTGCCT CACTGCCTGC TTTCAGTCGG GAAACCTGTC GTGCCAGCTG CTTAA 4260 GAATCGGCCA ACAGCGCGGG GAGAGGCGGT TTGCCTATCG GGCAGTCTTC GCCTTCCTCG C 4320 TCACCGGCTC GCTGCAGTCC GGTGTTTGGC TGCAGCGAGC GGTATCAGCT CACTCAAAGG 4380 CAGTACGGTA TCCACAGAAT CAGGGGATAA CGCAGGAAAG AACATGTGAG CAAAAG 4440 GCCAGCAAAG GCCAGGAACC GTAAGGAGCC GCGTTGCTGG CTTTTTCCTA GAGCTCC 4500 GCCCCCTGAC GAGCATCACA AAAATCGACG CTCAAGTCAG AGGTGGCGAA ACCCGACAG 4560 GACTATAAAG ATACCAGGCG TTTCCCCCTG GAAGCTCCCT CGTGCGCTCT CCTGTTCCGA 4620 CCCTGCCGCT TACCAGAACC TGTCCGCCTT TCTCCCTTCG GGAAGCGTGG CGCTTTCTC 4680 ATAGCTCACG CTGTAAGTAT CTCAGTTCGG TGTAAGTCGT TCGCTCCAAG CTGGGCTGTG 4740 TGCACGAACC CCCCCTTCAG CCCGACCAGT GCAGCCTTAT CAGGTAACAT CGTCTTGAAG 4800 CCAACCCGTA AGACACGACT TATCGCCACT GGCAGCAGCC ACTGGTAACA GGATTAGCA 4860 gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 4920 ctagaagaac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 4980 ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt ttgtttgca 5040 agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 5100 ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa 5160 aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta 5220 tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag 5280 cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga 5340 tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagat ccacgctcac 5400 cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc 5460 ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta 5520 gttcgccagt tatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac 5580 gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat 5640 gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa 5700 gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg 5760 tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag 5820 aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc 5880 cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct 5940 caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat 6000 cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg 6060 ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc 6120 aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 6180 tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg 6240 tctaagaaac cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct 6300 ttcgtc 6306 <210> 7 <211> 123 <212> DNA <213> Artificial Sequence <400> 7 gtaagcgtta acaaaattct ccagtcttca catcggtttg aaaggaggaa gcggaagaat 60 gaagtaagag ggatttttga ctccgaagta agtcttcaaa aaatcaaata aggagtgtca 120 aga 123 <210> 8 <211> 27 <212> PRT <213> Artificial Sequence <400> 8 Met Lys Lys Pro Leu Gly Lys Ile Val Ala Ser Thr Ala Leu Leu Ile 1 5 10 15 Ser Val Ala Phe Ser Ser Ser Ile Ala Ser Ala 20 25 <210> 9 <211> 165 <212> PRT <213> Artificial Sequence <400> 9 Ala Thr Gly Ala Leu Pro Gln Ser Pro Thr Pro Glu Ala Asp Ala Val 1 5 10 15 Ser Met Gln Glu Ala Leu Gln Arg Asp Leu Asp Leu Thr Ser Ala Glu 20 25 30 Ala Glu Glu Leu Leu Ala Ala Gln Asp Thr Ala Phe Glu Val Asp Glu 35 40 45 Ala Ala Ala Glu Ala Ala Gly Asp Ala Tyr Gly Gly Ser Val Phe Asp 50 55 60 Thr Glu Ser Leu Glu Leu Thr Val Leu Val Thr Asp Ala Ala Ala Val 65 70 75 80 Glu Ala Val Glu Ala Thr Gly Ala Gly Thr Glu Leu Val Ser Tyr Gly 85 90 95 Ile Asp Gly Leu Asp Glu Ile Val Gln Glu Leu Asn Ala Ala Asp Ala 100 105 110 Val Pro Gly Val Val Gly Trp Tyr Pro Asp Val Ala Gly Asp Thr Val 115 120 125 Val Leu Glu Val Leu Glu Gly Ser Gly Ala Asp Val Ser Gly Leu Leu 130 135 140 Ala Asp Ala Gly Val Asp Ala Ser Ala Val Glu Val Thr Thr Ser Asp 145 150 155 160 Gln Pro Glu Leu Tyr 165 <210> 10 <211> 53 <212> DNA <213> Artificial Sequence <400> 10 taatcaataa aaaaacgctg tgcggttaaa gggcacagcg tttttttgtg tat 53 <210> 11 <211> 65 <212> DNA <213> Artificial Sequence <400> 11 tcggtacctc gcgaatgcat ctagatatcg gatccgcggc attatgtttg aatttccgtt 60 taaag 65 <210> 12 <211> 65 <212> DNA <213> Artificial Sequence <400> 12 cttgagacct ttgagcttcc gagactggtc tcatcttgac actccttatt tgattttttg 60 aagac 65 <210> 13 <211> 60 <212> DNA <213> Artificial Sequence <400> 13 aagatgagac cagtctcgga agctcaaagg tctcaagcgc ccaagtgccc ggtcagaatc 60 <210> 14 <211> 65 <212> DNA <213> Artificial Sequence <400> 14 acaggaaaca gctatgacca tgattacgcc aagcttcttc actaacgatg cctttgaaaa 60 tcttc 65 <210> 15 <211> 63 <212> DNA <213> Artificial Sequence <400> 15 taagtcttca aaaaatcaaa taaggagtgt caagaatgaa aaaacctctt ggcaaaatcg 60 ttg 63 <210> 16 <211> 60 <212> DNA <213> Artificial Sequence <400> 16 agttgggtaa cgccagggtt ttcccagtca cgacgttata cacaaaaaaa cgctgtgccc 60 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <400> 17 aacgtcgtga ctgggaaaac c 21 <210> 18 <211> 60 <212> DNA <213> Artificial Sequence <400> 18 agccaggctg attctgaccg ggcacttggg cgctttattg gtatgactgg ttttaagcgc 60

Claims

1. A protease mutant, characterized in that, The amino acid sequence of the mutant is as shown in SEQ ID NO:

2.

2. A polynucleotide, characterized in that, Encodes the protease mutant as described in claim 1.

3. The polynucleotide as described in claim 2, characterized in that, The polynucleotide sequence of the protease mutant is as shown in SEQ ID NO:

3.

4. A nucleic acid construct, expression vector, or expression plasmid, characterized in that, The nucleic acid construct, expression vector, or expression plasmid comprises the polynucleotide as described in claim 2 or 3.

5. A host cell, characterized in that, The host cell comprises the nucleic acid construct, expression vector, or expression plasmid as described in claim 4.

6. The host cell as described in claim 5, characterized in that, The host cell is a Gram-positive or Gram-negative bacterial strain.

7. The host cell as described in claim 6, characterized in that, The Gram-positive strains are Bacillus subtilis, Bacillus licheniformis, Bacillus amyloliquefaciens, or Bacillus tarda; the Gram-negative strains are Escherichia coli.

Citation Information

Patent Citations

  • Low-temperature active alkaline protease from nocardiopsis dassonvillei and its preparation

    WO1988003947A1

  • Improved proteases and methods for producing them

    WO2004111219A1

  • Protease variants

    WO2005035747A1

  • Improved methods of producing heterologous proteases

    WO2005123914A1

  • Stably maintained multiple copies of at least two ORF in the same orientation

    WO2005123915A1