Deoxyribonucleic acid aptamer specifically binding to glutathione and use thereof

By using DNA aptamers that specifically bind to glutathione (such as Aptamin G), the problem of glutathione being easily oxidized in dosage forms is solved, and the stability and antioxidant function of glutathione in cosmetics, health foods and pharmaceutical compositions are maintained.

CN115349016BActive Publication Date: 2025-09-09NEXMOS CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202180018134.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2021-02-22
Filing Date
2021-02-25
Publication Date
2025-09-09
Estimated Expiration
2041-02-25

AI Technical Summary

Technical Problem

Glutathione is easily oxidized in common dosage forms and has poor stability, resulting in low bioavailability in neutral or alkaline environments, making it difficult to effectively absorb and maintain its antioxidant function.

Method used

Deoxyribonucleic acid (DNA) aptamers (such as Aptamin G) that specifically bind to glutathione are used to stabilize glutathione, inhibit oxidation by binding to it, and maintain its reduced state. It is used in cosmetics, health functional foods, and pharmaceutical compositions.

Benefits of technology

It effectively prevents glutathione from oxidation, maintains its reduced state and antioxidant function, enhances the skin care effect of cosmetics, and prolongs the stability and efficacy of foods and drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115349016B_ABST
    Figure CN115349016B_ABST
Patent Text Reader

Abstract

The present invention relates to a single-stranded deoxyribonucleic acid (DNA) aptamer that inhibits glutathione oxidation or stabilizes glutathione by binding to glutathione, a method for preventing glutathione oxidation and stabilizing glutathione using the aptamer, and applications of the aptamer in various fields, including pharmaceuticals, cosmetics, and foods. The single-stranded deoxyribonucleic acid aptamer is characterized by having one or more stem-loop structures. The aptamer of the present invention can be applied to various fields, including pharmaceuticals, cosmetics, and foods, where glutathione oxidation prevention and stabilization are required.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a deoxyribonucleic acid (DNA) aptamer that specifically binds to glutathione and its use. More specifically, it relates to a deoxyribonucleic acid aptamer that specifically binds to glutathione and a method for preventing and stabilizing glutathione using the aptamer, as well as applications of the aptamer in various fields such as medicine, cosmetics and food. Background Art

[0002] Glutathione (GSH) is a tripeptide composed of three amino acids: glutamic acid, cysteine, and glycine. It is known to be an antioxidant, anti-inflammatory, anti-carcinogen, anti-aging, and immune-enhancing nutrient that prevents damage to vital cellular components caused by reactive oxygen species such as free radicals, peroxides, lipid peroxides, and heavy metals.

[0003] However, in conventional dosage forms, the thiol group of glutathione (GSH) is easily oxidized over time to form glutathione disulfide (GSSG), thereby reducing stability. Since glutathione has a low ability to pass through cell membranes, its absorption into cells is very low. Due to its instability in neutral or alkaline environments, its utilization rate in the body is very low, resulting in a problem of low utilization rate. Therefore, there has long been a need for new methods and materials to inhibit the oxidation of glutathione.

[0004] Existing patent literature

[0005] Korean Patent Publication No. 10-2018-0054508 Summary of the Invention

[0006] Technical issues

[0007] The present invention has been made in response to the above-mentioned needs, and an object of the present invention is to provide a method for preventing glutathione from being oxidized and stabilizing it.

[0008] Another object of the present invention is to provide a substance that functions to prevent glutathione oxidation.

[0009] Another object of the present invention is to provide a substance that stabilizes glutathione.

[0010] Another object of the present invention is to provide a use of a substance that prevents glutathione oxidation and stabilizes glutathione as a cosmetic or health functional food.

[0011] Another object of the present invention is to provide a substance that maintains the function of glutathione for a long period of time by maintaining and stabilizing the reduced state of glutathione.

[0012] Another object of the present invention is to prepare cosmetics, health functional foods and foods by using a method for maintaining the antioxidant function of glutathione for a long time by maintaining the reduced state and stabilizing it.

[0013] Technical Solution

[0014] To achieve the above object, the present invention provides a deoxyribonucleic acid aptamer selected from the group consisting of base sequences represented by SEQ ID NO: 1 to SEQ ID NO: 26, which inhibits the oxidation of glutathione or stabilizes glutathione by binding to glutathione.

[0015] Furthermore, the present invention provides a method for stabilizing glutathione by treating the aptamer of the present invention with glutathione.

[0016] Furthermore, the present invention provides a cosmetic composition comprising the aptamer of the present invention as an active ingredient.

[0017] Furthermore, the present invention provides a food composition comprising the aptamer of the present invention as an active ingredient.

[0018] In one embodiment of the present invention, preferably, the food is a food selected from the group consisting of beverages, biscuits, candies, dairy products, chewing gums, sauces, breads and ice cream, but is not limited thereto.

[0019] Furthermore, the present invention provides a pharmaceutical composition comprising the aptamer of the present invention as an active ingredient.

[0020] In the present invention, aptamin is defined as an aptamer that protects antioxidants. For example, aptamin G is a DNA aptamer that specifically binds to glutathione and prevents glutathione from oxidation and stabilizes it.

[0021] 1. Application examples of cosmetics based on Aptamin G

[0022] The present invention provides Aptamin G, which is a deoxyribonucleic acid aptamer that specifically binds to glutathione.

[0023] The present invention provides Aptamin G as an aptamer that prevents glutathione from oxidation and stabilizes it.

[0024] Furthermore, the present invention provides a cosmetic comprising Aptamin G.

[0025] In one embodiment of the present invention, preferably, the cosmetic comprising Aptamin G is characterized by having the effects of preventing skin aging, removing wrinkles, whitening, and moisturizing, but is not limited thereto.

[0026] Furthermore, the present invention provides a cosmetic comprising Aptamin G, which is prepared by the method of the present invention.

[0027] In one embodiment of the present invention, preferably, the Aptamin G is characterized in that a specific component is attached to its end, and the specific component has the effects of preventing skin aging, removing wrinkles, whitening, and moisturizing, but is not limited thereto.

[0028] Furthermore, the specific ingredients of the present invention can use all raw materials used in cosmetics, regardless of any type of extract or active substance. Examples include green tea extract, licorice extract, paper mulberry extract, mulberry bark extract, gold extract, kudzu extract, red ginseng extract, which are good for whitening, apricot extract, oil extract, orange extract, lemon extract, bamboo extract, guava extract, rosemary extract, cornus extract, ganoderma lucidum extract, ginkgo extract, Yurong Xishisan extract, Ziyindan extract, which are good for moisturizing, papaya extract, cactus fruit extract, red lantern pepper extract, aloe extract, loofah extract, seaweed extract, carrot extract with antioxidant effect, soybean extract, grapefruit seed extract, grape seed extract, purslane extract, caviar, pomegranate, ginseng extract, peach extract, Chuanxiong extract, Centella asiatica extract, chamomile extract, lithospermum root extract, bitter Ginseng extract, angelica extract, peppermint extract (good for acne), Saururus chinensis extract, Houttuynia cordata extract, peony extract, wood vinegar (good for inflammation and bacteria), dandelion extract, calendula extract, phellodendron bark extract, citrus aurantium extract, gold extract, fennel extract, comfrey extract, chestnut peel extract (good for pore tightening), green tea extract, glycerin (moisturizing), panthenol, hyaluronic acid, ceramide, beta-glucan, arbutin (good for whitening), vitamin C, whitense, retinol, astaxanthin, anthocyanins, polyphenols, elastin (good for elasticity), collagen, coenzyme Q10, effectin, EGF, propolis (good for inflammation and bacteria), allantoin, phytostan, tumid acid, antioxidant vitamin E (natural tocopherol), ROE (rosemary oil extract), grapefruit seed extract, and other extracts.

[0029] Furthermore, the present invention provides a cosmetic composition comprising the Aptamin G of the present invention.

[0030] Furthermore, the uses of the cosmetic raw materials / materials comprising Aptamin G of the present invention are briefly described below.

[0031] Glutathione, a key ingredient in functional cosmetics, is known to be a very unstable substance. When exposed to air, it easily binds to oxygen and decomposes, rapidly losing its function. Aptamin G captures this substance, inhibiting its binding to oxygen and maintaining its maximum stability.

[0032] Aptasensing is a method for sensing various skin conditions and releasing the desired substance in response to them. Aptasensing can be used in cosmetic treatments and other applications. Aptasensing can sense adenosine triphosphate (ATP) secreted at varying concentrations depending on skin temperature, or cytokines secreted according to skin conditions, and then create a system that secretes active ingredients accordingly. This allows for the secretion of appropriate amounts of anti-aging substances, designed to regulate duration or reduce unnecessary overload on the skin.

[0033] Aptamers utilize the three-dimensional structure of single-stranded deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) to detect specific substances. While similar to antigen-antibody reactions, aptamers are much smaller, allowing their activity to be modulated in a variety of ways. Compared to antibodies, aptamers are easier to produce and store. Furthermore, unlike antibodies, aptamers can be synthesized to bind to very small chemical substances (such as glutathione). Preparation through chemical synthesis facilitates maintaining a certain degree of efficacy.

[0034] Glutathione is a tripeptide composed of three amino acids: glutamic acid, cysteine, and glycine. It exists in a reduced form and an oxidized form, glutathione disulfide, in which the sulfhydryl group is oxidized.

[0035] The reduced state of glutathione can be maintained by the bases constituting the aptamer of the present invention and the thiol group of glutathione ( Figure 1 ).

[0036] Glutathione maintained in a reduced state by binding to Aptamin G of the present invention can be used in various skin care compositions and health functional foods in various dosage forms, such as cream-type and hydrogel-type compositions containing collagen, elastin, hyaluronic acid, and the like.

[0037] The present invention also includes methods for slowly releasing glutathione in response to various skin conditions using aptamers that react differently depending on the skin condition or external stimuli (e.g., ultraviolet light, skin temperature, or acidity) (aptamer sensing). For example, methods include methods in which the structure of the aptamer changes in response to ultraviolet light exposure, releasing bound glutathione, or methods in which the structure of bound aptamin G changes in response to changes in adenosine triphosphate levels in response to changes in skin temperature or acidity, releasing glutathione.

[0038] Furthermore, the present invention includes cosmetics using various dosage forms (serum, gel, lotion, cream, toner, mask pack, etc.) containing Aptamin G and glutathione of the present invention as active ingredients.

[0039] In one embodiment of the present invention, preferably, the cosmetic composition further comprises one or more of collagen, elastin, hyaluronic acid, and peptide, but is not limited thereto.

[0040] 2. Health functional foods using Aptamin G or Aptamin G and glutathione complexes

[0041] The present invention provides a health functional food composition comprising the Aptamin G and glutathione complex of the present invention or Aptamin G alone as an active ingredient.

[0042] Examples of glutathione suitable for the health functional food of the present invention include glutathione, vitamin A, vitamin C, vitamin D, vitamin E, vitamin K, vitamin B6, vitamin B12, vitamin B1, vitamin B2, vitamin H, folic acid, hydrochloric acid, pantothenic acid, and mixtures thereof. Examples of suitable mineral nutrients contained in the health functional food composition include one or more selected from sodium, potassium, calcium, magnesium, phosphorus, sulfur, chlorine, iron, copper, iodine, zinc, selenium, manganese, chromium, molybdenum, fluorine, cobalt, and compounds thereof.

[0043] Various herbs can also be used as health functional foods. Typically, herbs are selected from herbs with various medicinal or dietary supplement properties. Typically, herbs are aromatic plants or parts of plants that can be used as medicine or flavor.

[0044] Furthermore, the present invention provides a method for maintaining the reduced state of an antioxidant substance containing glutathione by binding glutathione to Aptamin G to thereby delay the oxidation rate.

[0045] Hereinafter, the present invention will be described.

[0046] Similar to glutathione, the present invention can also be used to prepare and use health functional foods by combining antioxidant substances that are highly unstable to oxidation, such as vitamin C, vitamin A (retinol), vitamin E, astaxanthin, resveratrol, polyphenols, coenzyme Q10, peptides, and oils, with aptamers. This prevents oxidation (decomposition) of the substances, thereby maximizing their desired effects. Furthermore, by inducing the release of the substances under targeted conditions through aptamer induction, the effects of the substances can be maximized.

[0047] Furthermore, the present invention can provide a complex of an aptamer developed in accordance with an antioxidant component and the antioxidant component, or can provide an active aptamer and antioxidant component alone.

[0048] In one embodiment of the present invention, the antioxidant substance containing glutathione is preferably a substance selected from the group consisting of vitamin C, vitamin A, retinol, vitamin E, astaxanthin, resveratrol, 4'-acetyl-resveratrol, catechin, various polyphenols, various polyphenols, epigallocatechin gallate, coenzyme Q10, ubiquinol, ubiquinone, omega-3 and oil, but is not limited thereto.

[0049] 3. Beverages and food compositions utilizing Aptamin G and / or Aptamin G and glutathione component complexes

[0050] The present invention provides a beverage composition comprising the complex of Aptamin G and glutathione of the present invention as an active ingredient, or a beverage composition comprising Aptamin G alone.

[0051] In one embodiment of the present invention, preferably, the composition further comprises one or more of collagen, elastin, hyaluronic acid and peptide, but is not limited thereto.

[0052] Furthermore, the present invention provides a food composition comprising the aptamer and / or antioxidant of the present invention as an active ingredient.

[0053] In one embodiment of the present invention, preferably, the food composition further comprises one or more of collagen, elastin, hyaluronic acid and peptide, but is not limited thereto.

[0054] In one embodiment of the present invention, preferably, the food composition is biscuits, candies, dairy products, chewing gums, sauces, breads or ice cream, but is not limited thereto.

[0055] Furthermore, the present invention provides a method for preparing a food by adding the Aptamin G of the present invention to the food.

[0056] In other embodiments of the present invention, preferably, when the above-mentioned food or beverage composition is absorbed into the body and changes the structure of Aptamin G, the bound glutathione is released, or the amount of adenosine triphosphate changes with the changes in the internal environment, causing the structure of the bound Aptamin G to change and release glutathione, but the present invention is not limited thereto.

[0057] Furthermore, compared to existing methods, the method of preventing glutathione oxidation and stabilizing it using aptamers is a safe and almost innovative new method that can be applied to various industries to maximize its effectiveness.

[0058] In particular, it will serve as a catalyst for a revolutionary shift from the existing chemical-based cosmetics, food, animal, and pharmaceutical markets to a DNA-based market. Furthermore, it has already been applied in various fields across various industries. In the future, it is expected to provide explosive growth and innovative solutions in the DNA market.

[0059] 4. Pharmaceutical compositions utilizing Aptamin G or Aptamin G and glutathione complexes

[0060] When the composition of the present invention is a pharmaceutical composition, it can be used in the indications that show the pharmacological effects of glutathione mentioned in the background technology. For the administration of the composition of the present invention, in addition to the active ingredient of the above-mentioned record, it can also include pharmaceutically acceptable carriers, excipients or diluents. The above-mentioned carriers, excipients and diluents can be lactose, glucose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, gum arabic, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinyl pyrrolidone, water, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate and mineral oil etc.

[0061] The pharmaceutical composition of the present invention can be formulated into oral dosage forms such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, sprays, external preparations, suppositories, or sterile injection solutions according to conventional methods. Specifically, commonly used diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants can be used during formulation. Solid preparations for oral administration include, but are not limited to, tablets, pills, powders, granules, and capsules. In addition to the above-mentioned active ingredients, such solid preparations can also be mixed with one or more excipients, such as starch, calcium carbonate, sucrose, lactose, gelatin, etc. In addition, lubricants such as magnesium stearate and talc can also be used in addition to simple excipients. Liquid preparations for oral administration can also be prepared by adding various excipients, such as wetting agents, sweeteners, aromatics, and preservatives, in addition to liquid substances and liquid paraffin. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, oils, freeze-dried preparations, and suppositories. Non-aqueous solvents and suspensions include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectables such as ethyl oleate. Suppository bases include Witepsol, macromolecular compounds, Tween 61, cocoa butter, tartar resin, and glycerin gelatin.

[0062] The appropriate dosage of the pharmaceutical composition of the present invention varies depending on the patient's condition and weight, the severity of the disease, the form of the drug, the time, etc., but can be appropriately selected by relevant practitioners. Preferably, the daily dosage of the above-mentioned composition can be 0.001 mg / kg body weight to 500 mg / kg body weight, and can be administered once a day or divided into several doses.

[0063] Effects of the Invention

[0064] The present invention demonstrates that the aptamer of the present invention has the effect of preventing glutathione oxidation and stabilizing it. It is anticipated that the aptamer of the present invention has the function of regulating the release rate of skin active ingredients and adjusting the release of antioxidant substances according to the amount of specific substances secreted by the skin.

[0065] The aptamers of the present invention have the effect of preventing the oxidation of antioxidant substances such as glutathione. Using the aptamers of the present invention alone or in complex with glutathione, for example, by using aptamers that selectively bind to glutathione, they can maintain glutathione in its reduced state, thereby maintaining its antioxidant function for a long time. Consequently, they can be used in various dosage forms of functional cosmetics, health functional foods, and foods. Using aptamers that selectively bind to glutathione, even small amounts of glutathione can be expected to maximize antioxidant and stabilizing effects.

[0066] Furthermore, the present invention shows that the present invention utilizes an aptamer that selectively binds to glutathione to maintain the reduced state of physiologically active ingredients such as glutathione to maintain long-term antioxidant and stabilizing functions, thereby being used in a variety of health drinks, antioxidant drinks, antioxidant foods, and the like.

[0067] Furthermore, compared to existing methods, the method of using aptamers to prevent glutathione oxidation and stabilize it is a safe and nearly revolutionary new method that can be applied to various industries to maximize its effectiveness. In particular, it will be a catalyst for a revolutionary shift from the existing chemical-based cosmetics, health food, food, animal products, and pharmaceutical markets to a DNA-based market. Furthermore, it is already being applied in various fields across various industries. In the future, it is expected to provide explosive growth and innovative solutions for the DNA market. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] Figure 1 Figure 2 shows that glutathione is stabilized by hydrogen bonds between the bases that constitute the aptamer and the thiol groups of glutathione.

[0069] Figure 2 The figure shows the process of systematic evolution of ligands by exponential enrichment (SELEX) for preparing aptamers that specifically bind to glutathione;

[0070] Figure 3 The bar graph shows the tyrosinase activity rates of Aptamin G1 (SEQ ID NO: 24), Aptamin G4 (SEQ ID NO: 25), and Aptamin G12 (SEQ ID NO: 26), which specifically bind to glutathione.

[0071] Figure 4 This is a bar graph showing the tyrosinase activities of Aptamin G1 (SEQ ID NO: 17), Aptamin G4 (SEQ ID NO: 18), and Aptamin G12 (SEQ ID NO: 19) that specifically bind to glutathione, as confirmed by cell-based assays.

[0072] Figure 5 The graph is a graph showing the antioxidant efficacy test (DTNB assay) of Aptamin G1 (sequence 24), Aptamin G4 (sequence 25), and Aptamin G12 (sequence 26) that specifically bind to glutathione; DETAILED DESCRIPTION

[0073] The present invention will be described in detail below by way of non-limiting examples. However, the following examples are for the purpose of illustrating the present invention only and should not be construed as limiting the scope of the present invention.

[0074] In the present invention, in order to prevent rapid oxidation of the target (glutathione), all buffers and solutions were stirred in Chelex100 resin (BioRad) for 1 hour, filtered through a 0.2 μM filter screen, and then sprayed with nitrogen (N2 gas) (Praxair) for 10 minutes and prepared using molecular biology grade water (Phenix Research) that removed incidental metals.

[0075] Example 1: Screening and sequence analysis of DNA aptamers

[0076] Glutathione SELEX:

[0077] Glutathione is 10 15 The method uses a DNA library composed of unique oligonucleotides to perform 9 rounds of exponential enrichment ligand system evolution technology. The composition of the buffer used is as follows: 50mM sodium acetate (Sodium Acetate, pH 5.5) (Sigma), phosphate buffered saline (PBS) containing 1mM MgCl2, 0.05% Tween 20 (Tween 20) (Sigma), 1% bovine serum albumin (BSA) (Sigma) and 1mM glutathione (Sigma). The stringency of the exponential enrichment ligand system evolution technology is used to reduce the binding time of the aptamer to the target, change the composition of the buffer and change it by reducing the concentration of the target in the free molecule dissolution ( Figure 2 ).

[0078] Screening of DNA aptamers

[0079] Candidate aptamers were obtained by analyzing the biological information of a rich library generated by systematic evolution of ligands by exponential enrichment. The top 26 candidates were screened for their ability to protect glutathione from oxidation. The results are shown in Table 1 below.

[0080] Table 1

[0081]

[0082]

[0083] Example 2: Whitening efficacy test (in vitro tyrosinase activity) (N=5)

[0084] In this experiment, the final concentrations of each component were 20 μM glutathione, 0.2 μM Apt G, and 0.01% arbutin.

[0085] The experimental method is as follows.

[0086] The aptamer specifically binding to glutathione obtained by the above-mentioned exponential enrichment ligand system evolution technology was dissolved in triply distilled water, heated at 95°C for 5 minutes, and then gradually cooled to room temperature to form a three-dimensional structure.

[0087] The aptamer prepared above was prepared by dissolving 300 μM glutathione and 3 μM (molar concentration 100:1) in triplicate distilled water and reacting for 30 minutes.

[0088] To a 96-well plate, 200 μL of 0.1 M potassium phosphate buffer (pH 6.5), 20 μL of sample, 20 μL of 2 KU / mL tyrosinase, and 60 μL of 1.0 mM tyrosine were added sequentially and reacted at 37°C for 10 minutes.

[0089] After the reaction, the absorbance was measured at a wavelength of 490 nm using a plate reader.

[0090] The results are as follows Figure 3 shown. Figure 3 This is a bar graph confirming the tyrosinase activities of Aptamin G1 (SEQ ID NO: 24), Aptamin G4 (SEQ ID NO: 25), and Aptamin G12 (SEQ ID NO: 26) that specifically bind to glutathione.

[0091] pass Figure 3 The results confirmed that glutathione inhibited tyrosinase activity by about 75%, and when glutathione formed a complex with the above-mentioned Aptamin G sequence, the efficacy of glutathione in inhibiting tyrosinase activity was further improved by more than 10%.

[0092] For reference, sequence 24 (CGAACAGCATGGAGGCGCGCCCGTTGTGCCGTGC) of the G1 sequence used in the present invention is a part of sequence 2 in the patent application.

[0093] Sequence 25 (CGAGTGAACGACGAGGCGCGTCACACTGCG), which is a G4 sequence, is a part of sequence 5 in the patent application.

[0094] Example 4: Whitening efficacy test (In vitro cell-based tyrosinase activity) (N=5, Arbutin (Arb) only N=3)

[0095] In this experiment, the final concentrations of the components were 100 μM glutathione, 1 μM Apt G, and 0.01% arbutin.

[0096] The experimental method is as follows.

[0097] The glutathione-specific aptamer obtained through the exponential enrichment ligand system evolution technique was dissolved in triply distilled water, heated at 95°C for 5 minutes, and then slowly cooled to room temperature to form a three-dimensional structure. 100 μM glutathione and 1 μM of the prepared aptamer (molar concentration 100:1) were dissolved in culture medium and reacted at room temperature for 30 minutes.

[0098] MNT-1 cells were placed in a 6-well plate and cultured in an incubator at 37°C and 5% CO2 for 24 hours.

[0099] After the prepared samples were processed separately, they were cultured again in a constant temperature incubator at 37°C and 5% CO2 for 72 hours.

[0100] After the culture is completed, the cells are removed from the culture plate using ice-cold lysis buffer (RIPA buffer + protease inhibitor), transferred to an EP-tube, and centrifuged to obtain only the supernatant.

[0101] Lysate, L-DOPA, and potassium phosphate buffer solution (pH 6.5) were placed in a 96-well culture plate and mixed (the same amount of protein was used in each test group according to protein quantification).

[0102] After incubation in a 37°C, 5% CO2 incubator for 1 hour, the absorbance was measured at a wavelength of 475 nm using a microplate reader.

[0103] The results are as follows Figure 4 shown.

[0104] Figure 4This is a bar graph showing the tyrosinase activities of Aptamin G1 (SEQ ID NO: 17), Aptamin G4 (SEQ ID NO: 18), and Aptamin G12 (SEQ ID NO: 19) that specifically bind to glutathione, as confirmed by cell-based assays.

[0105] Figure 4 The results showed that glutathione did not inhibit tyrosinase activity. It was confirmed that when glutathione formed a complex with the Aptamin G sequence, it inhibited tyrosinase activity by about 25%, showing an inhibitory effect similar to that of 0.01% arbutin as a positive control.

[0106] Example 6: Antioxidant efficacy test (sulfhydryl group (-SH) determination, N=5)

[0107] In this experiment, the final concentrations of each component were 125 μM glutathione and 1.25 μM Aptamin G.

[0108] The experimental method is as follows.

[0109] The aptamer specifically binding to glutathione obtained by the above-mentioned exponential enrichment ligand system evolution technology was dissolved in triply distilled water, heated at 95°C for 5 minutes, and then gradually cooled to room temperature to form a three-dimensional structure.

[0110] 250 μM glutathione and 2.5 μM of the aptamer prepared above (molar concentration ratio 100:1) were dissolved in three times distilled water and reacted at room temperature for 30 minutes.

[0111] The glutathione-Aptamin G complex was stored under strict conditions (37° C.) for a period of time, and samples were obtained at intervals of 4 days for a total of 16 days.

[0112] Before testing the sample, 10 mM DTNB (4 mg / ml, buffer: 0.1 M potassium phosphate buffer, pH 8.0) was prepared, and the sample (50 μl) was mixed with the same volume (50 μl) of DTNB solution and then shaken incubation was performed.

[0113] After the reaction, the UV absorbance value was measured using a microplate reader at a wavelength of 412 nm and a ref wavelength of 605 nm.

[0114] The results are as follows Figure 5 shown.

[0115] Figure 5 The graph shows the antioxidant efficacy test of Aptamin G1 (sequence 24), Aptamin G4 (sequence 25), and Aptamin G12 (sequence 26) that specifically bind to glutathione.

[0116] pass Figure 5 The results confirmed that although the amount of glutathione remained about 60% after 16 days of oxidation, on the 16th day, more than 85% of glutathione was not oxidized by Aptamin G1, G4, and G12 (aptamers of sequence 24, sequence 25, and sequence 26, respectively).

Claims

1. A deoxyribonucleic acid aptamer, characterized in that: The deoxyribonucleic acid aptamer is composed of the base sequence represented by SEQ ID NO: 26, and inhibits the oxidation of glutathione or stabilizes glutathione by binding to glutathione, wherein the deoxyribonucleic acid aptamer inhibits tyrosinase activity.

2. A method for stabilizing glutathione, characterized in that, Glutathione is treated with the deoxyribonucleic acid aptamer according to claim 1.

3. A cosmetic composition, characterized in that Contains the deoxyribonucleic acid aptamer according to claim 1 as an active ingredient.

4. A food composition, characterized in that Contains the deoxyribonucleic acid aptamer according to claim 1 as an active ingredient.

5. The food composition according to claim 4, wherein The food is a food selected from the group consisting of beverages, biscuits, candies, dairy products, chewing gums, sauces, breads and ice cream.

6. A pharmaceutical composition, characterized in that Contains the deoxyribonucleic acid aptamer according to claim 1 as an active ingredient.

Citation Information

Patent Citations

  • Method for preventing oxidation of antioxidant material using aptamer, material, and use thereof

    KR1020180054508A

  • Method for preventing oxidation of antioxidant material using aptamer, material, and use thereof

    CN109862866A

  • Aptamer specifically binding to L-Ascorbic acid and use of the same

    US20190078094A1