A method for preparing adenylated nucleic acid product

Abstract

The present invention belongs to the field of nucleic acid technology. In order to solve the problem that the target substrate cannot be completely free of connection byproducts without introducing chemical groups for modification, and the introduction of chemical groups will bring difficulties to subsequent applications in the current preparation of adenylated nucleic acid products, the present invention provides a method for preparing adenylated nucleic acid products. Step 1, designing an auxiliary DNA chain; Step 2, phosphorylating the nucleic acid chain to be adenylated; Step 3, adenylation reaction catalyzed by T4DNA ligase, under the action of the ligase, the 3′ end of the auxiliary DNA chain forms a gap state with the nucleic acid chain to be adenylated, and contains multiple mismatches, so that the connection cannot continue after adenylation, and the dynamic change returns to the initial neck ring structure; after the ligase adenylates the substrate nucleic acid, it falls off and quickly forms an enzyme-AMP complex, thereby avoiding further connection and achieving the accumulation of adenylated nucleic acid products.

Description

Technical Field

[0001] The invention belongs to the field of nucleic acid technology, and specifically relates to a method for preparing adenylated nucleic acid products. Background Art

[0002] Adenylated DNA or RNA (AppDNA / AppRNA) can be used to screen DNA and ribozymes in vitro, broaden the range of RNA substrates that can be catalyzed by DNA and ribozymes, construct miRNA libraries and next-generation sequencing, 5′ end labeling, construct DNA nanostructures, explore the catalytic properties of ligases in the absence of ATP, and improve the efficiency of circular nucleic acid preparation. The existing methods for preparing adenylated nucleic acid products are divided into two categories: chemical synthesis and enzymatic methods. The chemical synthesis method combines nucleic acid substrates with ATP and Mg to form a ligase. 2+ , imidazole, and react at room temperature to obtain an adenylated product; or 5' phosphate imidazole adenosine is coupled to 5' monophosphate to synthesize AppDNA. However, the above chemical methods are cumbersome and require multiple chemical reactions. There are also problems such as the inability to quantitatively convert substrates to products and the difficulty in purifying the products during extraction due to the aqueous phase system. At present, the chemical method can only meet the preparation of adenylated products below 11nt. When the sequence length is greater than 11nt, the adenylation efficiency decreases. At the same time, many reagents used in the chemical method are harmful to human health and the ecological environment. Compared with the chemical method, the enzymatic method is more efficient in preparing adenylated nucleic acid products and has a wider range of substrates. It also uses less chemical reagents and is environmentally friendly, so it has good development prospects.

[0003] The enzymatic preparation of adenylated nucleic acid products is specifically characterized in that the products are obtained by catalyzing nucleic acid substrates with DNA ligase or RNA ligase. According to the pathways for the production of adenylated nucleic acid products, it can be found that the intermediate products are difficult to accumulate under ideal ligation reaction conditions and are often rapidly consumed for ligation, making it difficult to grasp the balance between adenylation and ligation reactions. Therefore, how to effectively control the adenylation reaction and accumulate adenylated nucleic acid products is a key issue that needs to be solved in the current enzymatic preparation.

[0004] The existing enzymatic method requires the addition of auxiliary oligonucleotides to promote adenylation, but this method often requires complex designs such as multiple auxiliary chains, high ATP concentration or high enzyme amount reaction conditions, and the introduction of mismatches. At the same time, it cannot avoid the problem of low yield of ligation byproducts and adenylated products. This method has poor reproducibility, limited applicable sequence length and type, and cannot obtain adenylated products with high yield. Some researchers have also developed a method for adenylation without adding auxiliary DNA chains, that is, trying to use ligase to directly catalyze a single-stranded nucleic acid substrate, and hinder the ligation by modifying the amino group or dideoxy at the 3′ end of the target substrate, and finally obtaining nearly 100% adenylated products. However, the product prepared by this method is a modified nucleic acid, not a natural nucleic acid, which brings difficulties to subsequent applications.

[0005] The above methods show that there are a wide range of enzymes that can be used to prepare adenylated nucleic acid products, and there is no need for complicated and cumbersome chemical steps, which illustrates the advantages of enzymatic methods over chemical synthesis. However, even though enzymatic methods are diverse, they still have shortcomings. The method of adding auxiliary DNA chains generally has the problems of low yield of adenylated products, and even if a large amount of ATP is added to inhibit the connection, the appearance of connection by-products cannot be completely avoided, and poor versatility. Although the improved method without adding auxiliary DNA chains can achieve a yield close to 100%, it requires chemical modification of the substrate nucleic acid, which increases the preparation cost, and the product is no longer natural DNA; in addition, the ligase used, such as TS2126 RNA ligase, has not yet been commercialized, which adds difficulties to the actual preparation. The above problems all show that there is no method that can efficiently, universally, simply and conveniently prepare adenylated nucleic acid products. Summary of the invention

[0006] In order to solve the problem that the target substrate cannot be completely free of ligation byproducts without introducing chemical groups for modification, and the introduction of chemical groups will bring difficulties to subsequent applications in the current preparation of adenylated nucleic acid products, the present invention provides a method for preparing adenylated nucleic acid products, wherein an auxiliary DNA chain with a specific structure is designed, and the auxiliary DNA chain comprises a stem-loop structure, a complementary region to the nucleic acid chain to be adenylated (sometimes referred to as the target chain, substrate chain), a spacer region and a terminal region. After the auxiliary DNA chain is hybridized with the nucleic acid chain to be adenylated, an adenylation reaction is carried out by T4 DNA ligase under suitable temperature conditions. The method of the present invention utilizes the dynamic change property of the stem-loop structure, that is, the auxiliary DNA chain has a short-term unstable structure, the stem-loop will open instantly and then recover quickly. When the stem-loop structure is opened, the 3′ end of the auxiliary DNA chain will combine with the nucleic acid chain to be adenylated under the action of the ligase to form a gap state (Nick structure). Although there are multiple mismatches under this structure, the adenylation reaction can be completed under the action of T4 connection. It is precisely because of these mismatches that the connection cannot continue after adenylation, and it dynamically changes back to the initial neck-loop structure. On the other hand, once the ligase falls off after adenylation of the substrate nucleic acid, it will be quickly combined with ATP in the system again to form an enzyme-AMP complex. In this way, even if the dynamic equilibrium just now occurs again, the enzyme-AMP complex cannot catalyze the adenylated nucleic acid chain to form a phosphodiester bond, thereby avoiding further connection and achieving the accumulation of adenylated nucleic acid products.

[0007] This method can achieve almost complete conversion of substrate nucleic acid into adenylated products under general reaction conditions without the need to add high-concentration ATP or increase chemical modification. The ligation byproducts can be completely suppressed by controlling the reaction time, that is, the substrate nucleic acid can be efficiently adenylated simply and conveniently, solving the current problem of low yield of adenylated nucleic acid products and the inability to avoid ligation byproducts. It can be applied to DNA composed of almost all sequences, and can be extended to the adenylation of RNA, completely solving the problem of changing the adenylation reaction conditions and even changing the ligase for different nucleic acid substrates. The method is efficient, universal, simple and convenient, low-cost, and highly practical. The product contains almost no ligation byproducts, and is particularly suitable for the industrial preparation of adenylated nucleic acid products.

[0008] A method for preparing an adenylated nucleic acid product comprises the following steps:

[0009] Step 1, designing an auxiliary DNA chain, wherein the auxiliary DNA chain is a single strand, and is composed of a stem-loop structure, a spacer region, a complementary region and a terminal region connected in sequence from the 3′ end to the 5′ end, wherein the stem-loop structure contains a stem of 3-10 bp and a single-stranded loop of 3-10 nt; the length of the spacer region is 2-10 nt, and the last base of the spacer region is complementary to the first base at the 3′ end of the auxiliary DNA chain; the complementary region is a sequence complementary to the nucleic acid chain to be adenylated, the first base at the 3′ end of the complementary sequence is complementary to the first base at the 5′ end of the nucleic acid chain to be adenylated, and the other bases are complementary in sequence, and the complementary sequence is at least 10 nt and at most the length of the nucleic acid chain to be adenylated; the terminal region is completely mismatched with the nucleic acid chain to be adenylated or contains 5-8 mismatched bases;

[0010] Step 2, phosphorylating the nucleic acid chain to be adenylated, and omitting this step for the nucleic acid chain to be adenylated with a phosphate structure at the 5′ end;

[0011] Step 3, adenylation reaction catalyzed by T4 DNA ligase. The adenylation reaction system includes T4 DNA ligase, deionized water, the auxiliary DNA chain designed in step 1, and the nucleic acid chain to be adenylated with a phosphate structure at the 5′ end. The reaction temperature is 78-90°C for 1-5 minutes, and then the temperature is lowered to 20-28°C and maintained for a period of time to allow the two chains to fully hybridize. After pre-denaturation, T4 DNA ligase, react at 16-40℃. Under the action of ligase, the 3′ end of the auxiliary DNA chain combines with the nucleic acid chain to be adenylated to form a gap structure. In addition to the first base at the 3′ end of the auxiliary DNA chain being complementary to the last base in the spacer region, the auxiliary DNA chain and the spacer region have at least one pair of bases that are complementary. This structure contains multiple mismatches, which prevent the substrate from continuing to connect after being adenylated, and the auxiliary DNA chain then dynamically changes back to the initial neck ring structure; after the ligase adenylates the substrate nucleic acid, it falls off and will be quickly recombined with ATP in the system to form an enzyme-AMP complex. The enzyme-AMP complex cannot catalyze the formation of phosphodiester bonds in the adenylated nucleic acid chain, thereby avoiding further connection and achieving the accumulation of adenylated nucleic acid products; after the reaction, the T4 DNA ligase is inactivated.

[0012] Preferably, the nucleic acid chain to be adenylated is a short-chain nucleic acid, either DNA or RNA, with a length of 10-300 nt, preferably 20-100 nt, more preferably 30-60 nt.

[0013] Preferably, the loop of the stem-loop structure in the auxiliary DNA has random bases and can be any non-complementary (i.e., does not form a stable structure) sequence; preferably, the length is 3-8nt; more preferably, the length is 3-6nt; and even more preferably, its base composition is GAA or TTT.

[0014] Preferably, the stem of the stem-loop structure in the auxiliary DNA is 3-8 bp in length; more preferably, it is 3-6 bp in length; and even more preferably, its base composition is GAG (from the 3′ end to the 5′ end).

[0015] Preferably, the spacer region of the auxiliary DNA has a length of 2-8 nt, more preferably, a length of 3-6 nt.

[0016] Preferably, the length of the complementary region in the auxiliary DNA is 10-300 nt, preferably 20-100 nt, more preferably 30-60, and further preferably 10-15 nt.

[0017] The functions of the non-complementary terminal region include: 1) avoiding the formation of sticky ends or blunt end structures (these two structures will attract ligase and reduce the efficiency of adenylation reaction), and 2) facilitating the subsequent separation of adenylated products (single-stranded DNA that is completely complementary to the auxiliary DNA can be added to facilitate the removal of the auxiliary DNA). Preferably, the terminal region is a sequence consisting of 5-8 bases; more preferably, it is a sequence consisting of repeated bases that is completely mismatched with the nucleic acid chain to be adenylated; more preferably, the terminal region is a 6nt T base.

[0018] Preferably, the concentration of the auxiliary DNA chain in the adenylation system is greater than the nucleic acid chain to be adenylated, and preferably the molar concentration ratio of the auxiliary DNA chain to the nucleic acid chain to be adenylated is (1.1-10):1, more preferably (1.5-3):1, and even more preferably 2:1.

[0019] Preferably, in step 2, the phosphorylation reaction system includes deionized water, T4 polynucleic acid kinase and its buffer, ATP, and oligonucleotides. Preferably, the buffer composition is 70mM Tris-HCl, 10mM MgCl2 and 5mM DTT, and the buffer pH is 7.6. Preferably, a standard phosphorylation reaction system requires the addition of 21.2μL deionized water, 4.0μL 10×T4 polynucleic acid kinase buffer, 4.8μL 1mM ATP, 8.0μL 100μM oligonucleotides and 2.0μL T4 polynucleic acid kinase. Preferably, the reaction is carried out at 37°C for 12h, and the T4 polynucleic acid kinase is inactivated by treatment at 75°C for 10min.

[0020] Preferably, in step three, the temperature is 80°C when the auxiliary DNA chain is fully hybridized with the nucleic acid chain to be adenylated, the reaction is carried out for 3 minutes, and then the temperature is lowered to 25°C at 0.1°C / s and maintained for 10 minutes; preferably, after pre-denaturation, T4 DNA ligase is added at room temperature, the reaction is carried out at 37°C for 15 minutes-4 hours, and after the reaction is completed, the T4 DNA ligase is inactivated by treatment at 75°C for 15 minutes.

[0021] Preferably, the triple adenylation reaction system in the step is: 2.0 μL 10×T4 DNA ligase buffer is added to 9.5 μL deionized water, the buffer composition is 400 mM Tris, 100 mM MgCl2, 100 mM DTT, 5 mM ATP, the buffer pH is 7.8, and then 5.0 μL 20 μM nucleic acid chain to be adenylated and 1.5 μL 100 μM auxiliary DNA chain are added; after pre-denaturation, 2 μL T4 DNA ligase is added at room temperature, and the final concentration of the system is 5.0 μM nucleic acid chain to be adenylated, 7.5 μM auxiliary DNA chain, 0.5 U / μL T4 DNA ligase and 1×T4 DNA ligase buffer; after the reaction is completed, the T4 DNA ligase is inactivated at 75° C. for 15 min.

[0022] Beneficial effects:

[0023] (1) The auxiliary DNA chain used in the method for preparing adenylated nucleic acid products of the present invention is a short hairpin end and a spacer region, which helps T4 DNA ligase catalyze the reaction of the substrate to stay at the adenylated nucleic acid stage, thereby achieving a large amount of accumulation of adenylated nucleic acid products and avoiding the generation of ligation by-products.

[0024] (2) The method is highly versatile. For target nucleic acid substrates of different sequence compositions and lengths, efficient adenylation can be achieved by simply changing the sequence composition of the complementary hybridization region between the auxiliary chain and the target nucleic acid substrate.

[0025] (3) The method is simple, convenient and low-cost. Efficient adenylation can be achieved simply by designing a short hairpin and a mismatched structure, without the need to add high-concentration ATP or introduce chemically modified groups, and can be carried out under the general reaction conditions of the ligase.

[0026] In summary, this method can achieve extensive and efficient adenylation of nucleic acid substrates through simple operation and design, fundamentally realizing the conversion of substrate nucleic acid into adenylated nucleic acid products, and has good application potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 A schematic diagram of a method for preparing adenylated nucleic acid products;

[0028] Figure 2 is the chemical structural formula of adenylated nucleic acid;

[0029] Figure 3 Example 1 Schematic diagram and results of preparing an AppDNA chain with a length of 32 nt;

[0030] Figure 4 Example 2 Schematic diagram and results of preparing an AppDNA chain with a length of 41 nt;

[0031] Figure 5 Example 3 Schematic diagram and results of preparing an AppDNA chain with a length of 57 nt;

[0032] Figure 6 Example 4 Schematic diagram and results of preparing an AppDNA chain with a length of 41 nt using auxiliary DNA chains with different sequence compositions;

[0033] Figure 7 Example 5 Schematic diagram and results of preparing an AppDNA chain with a length of 36 nt;

[0034] Figure 8 Example 6 Schematic diagram and results of preparing an AppDNA chain with a length of 43 nt;

[0035] Fig. 9 Example 7 Schematic diagram and results of preparing an AppDNA chain with a length of 45 nt;

[0036] Fig.10 Example 8 Schematic diagram and results of preparing an AppDNA chain with a length of 48 nt;

[0037] Fig.11 Example 9 Schematic diagram and results of preparing an AppRNA chain with a length of 36 nt. DETAILED DESCRIPTION

[0038] The structure of the DNA auxiliary chain and its changes and functions during the reaction process are described in detail below in conjunction with the accompanying drawings.

[0039] The sequence composition of the auxiliary DNA chain is as follows Figure 1 As shown, the bases are represented by the code "N" or "M", and the stem-loop structure is from 3'-N 1 To M c -5′; the spacer region is from M c The next digit to M β -5′, where N 1 With base M β Complementary; the first base at the 3′ end of the complementary region is M γ The terminal region is composed of 5-8 bases (the figure takes the 6 bases T that are not complementary to the nucleic acid chain to be adenylated as an example); the "..." in the figure is a sequence of random length to indicate that the length of this part is adjustable and the bases are random.

[0040] The auxiliary DNA chain has a short-term unstable structure, the hairpin structure will be opened, and at the same time, under the action of the ligase, the 3′ end of the auxiliary DNA chain will combine with the nucleic acid chain to be adenylated to form a gap state ( Figure 1 Although this structure contains multiple mismatches (such as M α With N 2), but can also complete the adenylation reaction under the action of T4 ligation chain. Because of the instability of the gap state, the connection cannot be continued after the adenylation reaction is completed, and the auxiliary DNA chain returns to the original stem-loop structure. Once adenylated, the ligase will break away and re-form the enzyme-AMP structure. In this way, even if the above structural changes occur again, the enzyme-AMP complex cannot catalyze the formation of phosphodiester bonds in the adenylated nucleic acid chain, thereby avoiding further connection and achieving the accumulation of adenylated nucleic acid products and will not connect.

[0041] The present invention will be further described below in conjunction with specific embodiments.

[0042] The DNA sequences in the following examples were synthesized by Shanghai Sangon Biotechnology Co., Ltd. T4 Polynucleotide Kinase and 10×T4 Polynucleotide Kinase buffer A used for phosphorylation and T4 DNA ligase and 10×T4 DNA ligase buffer used for adenylation were purchased from Thermo Scientific. UltraGelRed nucleic acid dye was purchased from Qingdao Sangon Biotechnology Co., Ltd. Other reagents such as acrylamide, N,N-methylenebisacrylamide, ammonium persulfate (APS) and tetramethylethylenediamine (TEMED) were all domestic analytical grade reagents.

[0043] The following examples are intended to demonstrate the feasibility and practicability of the method of the present invention.

[0044] Example 1

[0045] (1) Raw materials

[0046] D32(5′→3′):

[0047] CTGAGTCGGAGACACGCAGGGATGAGATGGTT (32nt, SEQ ID NO: 1)

[0048] Aid-D32(5′→3′):

[0049] TTTTTTGTGTCTCCGACTCAGCCCTCTTTGAG (32nt, SEQ ID NO: 2)

[0050] (2) Phosphorylation of the target chain to be adenylated

[0051] Mix 21.2 μL of deionized water, 4.0 μL of 10×T4 polynucleotide kinase buffer (70 mM Tris-HCl, 10 mM MgCl2, 5 mM DTT, pH 7.6), 4.8 μL of 1 mM ATP, 8.0 μL of 100 μM oligonucleotide chain to be adenylated (21S-X) and 2.0 μL of T4 polynucleotide kinase (10 U), react at 37°C for 12 h, treat at 75°C for 10 min to inactivate T4 Polynucleotide Kinase, and obtain the phosphorylated target chain to be adenylated.

[0052] (3) Adenylation target chain

[0053] Add 2.0μL 10×T4 DNA ligase buffer (400mM Tris, pH 7.8, 100mM MgCl2, 100mM DTT, 5mM ATP) to 9.5μL deionized water, then add 5.0μL D-32 (20μM) to be adenylated and 1.5μL Aid-D32 (100μM). Vortex and centrifuge to mix well, then put into PCR, react at 80℃ for 3min, cool to 25℃ at 0.1℃ / s and keep for 10min to allow the two chains to fully hybridize. After pre-denaturation, add 2.0μL T4 DNA ligase (5U) at room temperature. The final concentration of the system is 5.0μM D-32, 7.5μM Aid-D32, 0.5U / μL T4 DNA ligase and 1×T4 DNA ligase buffer, react at 37℃ for 4 hours, and inactivate T4 DNA ligase at 75℃ for 15min after the reaction.

[0054] (3) Electrophoresis detection

[0055] The experimental results were characterized by 15% denaturing polyacrylamide gel and analyzed by Image Lab software.

[0056] Figure 3 A is a sequence diagram. Figure 3 B is the adenylation result of D32 to be adenylated. D32 represents the DNA substrate chain to be adenylated, and App-D32 represents the adenylated product of D32. The results show that the D32 DNA chain with a length of 32 nt was catalyzed by T4 DNA ligase to obtain more than 95% AppDNA product in 4 hours without ligation byproducts.

[0057] Example 2

[0058] (1) Raw materials

[0059] D41(5′→3′):

[0060] CGCTCAGCTTCCTTATAGCCGCTCTTCGAATTCTCTAGAAT (41nt, SEQ ID NO: 3)

[0061] Aid-D41(5′→3′):

[0062] TTTTTTAAGCTGAGCGCCCTCTTTGAG (27nt, SEQ ID NO: 4)

[0063] (2) The phosphorylation and adenylation methods of D41 were the same as those in Example 1.

[0064] Figure 4 A is a sequence diagram. Figure 4 B is the adenylation result of D41 to be adenylated. D41 represents the DNA substrate chain to be adenylated, and App-D41 represents the adenylated product of D41. The results show that the D41 DNA chain with a length of 41 nt was catalyzed by T4 DNA ligase to obtain more than 95% App DNA product in 1 hour without ligation byproducts.

[0065] Example 3

[0066] 1) Raw materials

[0067] Yadapter (5′→3′):

[0068] GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCTCGTATGCCGTCTTCTGCTTG (57nt, SEQ IDNO: 5)

[0069] Aid-Yadapter (5′→3′):

[0070] TTTTTTTGTGCTCTTCCGATC CCCTCTTTGAG (32nt, SEQ ID NO: 6)

[0071] (2) The phosphorylation and adenylation methods of Yaadapter are the same as those in Example 1.

[0072] Figure 5 A is a sequence diagram. Figure 5 B is the adenylation result of the Yaadapter to be adenylated. Yadapter represents the DNA substrate chain to be adenylated, and App-Yadapter represents the adenylated product of Yaadapter. The results show that the Yaadapter DNA chain with a length of 57 nt was catalyzed by T4 DNA ligase to obtain more than 95% AppDNA product in 10 minutes without ligation byproducts.

[0073] From the results shown in the figure, it can be inferred that this method is suitable for adenylation reactions of different lengths and different 5' terminal bases. Only by adjusting the reaction time, more than 95% AppDNA can be obtained for DNA substrates of different sequence compositions and lengths, indicating that this method has good versatility.

[0074] Example 4

[0075] (1) Raw materials

[0076] D41(5′→3′):

[0077] CGCTCAGCTTCCTTATAGCCGCTCTTCGAATTCTCTAGAAT (41nt, SEQ ID NO: 3)

[0078] Aid-1(5′→3′):

[0079] TTTTTTAAGCTGAGCGTCTCGGAACGA (27nt, SEQ ID NO: 7)

[0080] Aid-2 (5′→3′):

[0081] TTTTTTAAGCTGAGCGACACGCTCCGT (27nt, SEQ ID NO: 8)

[0082] Aid-3(5′→3′):

[0083] TTTTTTAAGCTGAGCGGCCGTGGAACAC (28nt, SEQ ID NO: 9)

[0084] (2) The phosphorylation and adenylation methods of D41 were the same as those in Example 1.

[0085] Figure 6 A is a sequence diagram. Figure 6 BD is the adenylation result of D41 to be adenylated. D41 represents the DNA substrate chain to be adenylated, and App-D41 represents the adenylated product of D41. In this embodiment, the length and base composition of the three auxiliary chains (Aid chains) are changed according to the patent requirements to verify the universality of the method. The results show that the D41 DNA chain with a length of 41nt, assisted by three different Aid chains and catalyzed by T4 DNA ligase for different times, all obtained more than 95% AppDNA products without ligation byproducts, confirming the effectiveness and universality of the method.

[0086] Example 5

[0087] (1) Raw materials

[0088] D36 (5′→3′):

[0089] GCAATACGTAACTGAACGAAGTGGCATGCAAGCTTG (36nt, SEQ ID NO: 10)

[0090] Aid-D36(5′→3′):

[0091] GGCTTCTACGTATTGCCTTCGTCGAAGACG (30n, SEQ ID NO: 11)

[0092] (2) The phosphorylation and adenylation methods of D36 were the same as those in Example 1.

[0093] Figure 7 A is a sequence diagram. Figure 7 B is the adenylation result of D36 to be adenylated. D36 represents the DNA substrate chain to be adenylated, and App-D36 represents the adenylated product of D36. The results show that the D36 DNA chain with a length of 36 nt was catalyzed by T4 DNA ligase to obtain more than 95% AppDNA product in 2 hours without ligation byproducts.

[0094] Example 6

[0095] (1) Raw materials

[0096] IonP1-43(5′→3′):

[0097] ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT (43nt, SEQ ID NO: 12)

[0098] Aid-IonP1-43(5′→3′):

[0099] TTTTTTTGGGCAGTCGGTGATCCCTCCCGCTTTTGGCG (37nt, SEQ ID NO: 13)

[0100] (2) The phosphorylation and adenylation methods of IonP1-43 were the same as those in Example 1.

[0101] Figure 8 A is a sequence diagram. Figure 8B is the adenylation result of IonP1-43 to be adenylated. IonP1-43 represents the DNA substrate chain to be adenylated, and App-IonP1-43 represents the adenylated product of IonP1-43. The results show that the 43nt IonP1-43 DNA chain was catalyzed by T4 DNA ligase to obtain more than 95% AppDNA product in 12 hours without ligation byproducts.

[0102] Example 7

[0103] (1) Raw materials

[0104] SMRT-45(5′→3′):

[0105] ATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTTGAGAGAGAT (45nt, SEQ ID NO: 14)

[0106] Aid-SMRT-45(5′→3′):

[0107] TTTTTTGGAAAAGAGAGAGATCCCTCTTTGAG (32nt, SEQ ID NO: 15)

[0108] (2) The phosphorylation and adenylation methods of SMRT-45 are the same as those in Example 1.

[0109] Fig. 9 A is a sequence diagram. Fig. 9 B is the adenylation result of SMRT-45 to be adenylated. SMRT-45 represents the DNA substrate chain to be adenylated, and App-SMRT-45 represents the adenylated product of SMRT-45. The results show that the SMRT-45 DNA chain with a length of 45 nt was catalyzed by T4 DNA ligase to obtain more than 95% AppDNA product in 10 minutes without ligation byproducts.

[0110] Example 8

[0111] (1) Raw materials

[0112] BGI-48 (5′→3′):

[0113] AGTCGGAGGCCAAGCGGTCTTAGGAAGACAACAACTCCTTGGCTCACA (48nt, SEQ ID NO: 16)

[0114] Aid-BGI-48(5′→3′):

[0115] TTTTTTGCTTGGCCTCCGACTCCCTCTTTGAG (32nt, SEQ ID NO: 17)

[0116] (2) The phosphorylation and adenylation methods of BGI-48 were the same as those in Example 1.

[0117] Fig.10 A is a sequence diagram. Fig.10 B is the adenylation result of BGI-48 to be adenylated. BGI-48 represents the DNA substrate chain to be adenylated, and App-BGI-48 represents the adenylated product of BGI-48. The results show that the BGI-48 DNA chain with a length of 48 nt was catalyzed by T4 DNA ligase to obtain more than 95% AppDNA product in 10 minutes without ligation byproducts.

[0118] It can be inferred from the results shown in the figure that this method is suitable for adenylation reactions of different lengths and different 5' terminal bases. Only by adjusting the base composition and length of the Aid chain and controlling the reaction time, AppDNAs of different sequence compositions and lengths can be prepared, indicating that this method has good versatility.

[0119] Example 9

[0120] (1) Raw materials

[0121] R8-d28(5′→3′):

[0122]

[0123] (Note: The underlined bold parts are ribonucleotides)

[0124] Aid-R8-d28(5′→3′):

[0125] TTTTTTCAGACTGGCATTGGCCCCTCTTTGAG (32nt, SEQ ID NO: 19)

[0126] R8-d28 (36 nt) was synthesized by Genewise (Suzhou) Biotechnology Co., Ltd. (with 5′ terminal phosphorylation modification).

[0127] (2) Adenylation target chain

[0128] The adenylation method was the same as in Example 1, except that the reaction time was delayed to 36 hours and T4 DNA ligase was inactivated at 75° C. for 15 minutes after the reaction.

[0129] Fig.11A is a sequence diagram, and 11B is the adenylation result. This method is used for adenylation of RNA, and the reaction time needs to be appropriately extended or the length of the auxiliary chain neck needs to be adjusted. As shown in the result figure, the 36nt R8-d28 RNA chain was catalyzed by T4 DNA ligase for 36 hours to obtain more than 95% AppRNA products without ligation byproducts, indicating that this method can also be applied to RNA.

[0130] The embodiments described above are only descriptions of the preferred implementation modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for preparing an adenylated nucleic acid product, characterized in that: The following steps are involved: Step 1, designing an auxiliary DNA chain, wherein the auxiliary DNA chain is a single strand, and is composed of a stem-loop structure, a spacer region, a complementary region and a terminal region connected in sequence from the 3′ end to the 5′ end, wherein the stem-loop structure contains a 3-4 bp stem and a 2-3 nt single-stranded loop; the length of the spacer region is 2-4 nt, and the last base of the spacer region is complementary to the first base at the 3′ end of the auxiliary DNA chain; the complementary region is a sequence complementary to the nucleic acid chain to be adenylated, the first base at the 3′ end of the complementary sequence is complementary to the first base at the 5′ end of the nucleic acid chain to be adenylated, and the other bases are complementary in sequence, and the complementary sequence is at least 10 nt and at most 10-100 nt, the length of the nucleic acid chain to be adenylated; the terminal region is a sequence composed of 5-8 bases, and the terminal region is completely mismatched with the nucleic acid chain to be adenylated or contains 5-8 mismatched bases; Step 2, phosphorylating the nucleic acid chain to be adenylated, and omitting this step for the nucleic acid chain to be adenylated with a phosphate structure at the 5′ end; Step 3, adenylation reaction catalyzed by T4 DNA ligase. The adenylation reaction system includes T4 DNA ligase and its buffer, ATP, deionized water, the auxiliary DNA chain designed in step 1, and the nucleic acid chain to be adenylated with a phosphate structure at the 5′ end. The reaction temperature is 78-90°C for 1-5 minutes, and then the temperature is lowered to 20-28°C and maintained for a period of time to allow the two chains to fully hybridize. After pre-denaturation, T4 DNA ligase is added at room temperature and the reaction is carried out at 16-40°C for 10 min-12 h. Under the action of ligase, the 3′ end of the auxiliary DNA chain combines with the nucleic acid chain to be adenylated to form a gap structure. In addition to the first base at the 3′ end of the auxiliary DNA chain being complementary to the last base in the spacer region, the auxiliary DNA chain and the spacer region have at least one pair of bases that are complementary. This structure contains multiple mismatches, which prevent the substrate from continuing to connect after being adenylated, and the auxiliary DNA chain then dynamically changes back to the initial neck ring structure; the ligase falls off after adenylation of the substrate nucleic acid and will be quickly re-bound by ATP in the system to form an enzyme-AMP complex, which cannot catalyze the formation of phosphodiester bonds in the adenylated nucleic acid chain, thereby achieving the accumulation of adenylated nucleic acid products; after the reaction is completed, the T4 DNA ligase is inactivated at high temperature.

2. The method for preparing an adenylated nucleic acid product according to claim 1, characterized in that: The terminal region is a sequence consisting of repeated bases.

3. The method for preparing an adenylated nucleic acid product according to claim 1, characterized in that: The concentration of the auxiliary DNA chain in the adenylation system is greater than that of the nucleic acid chain to be adenylated.

4. The method for preparing an adenylated nucleic acid product according to claim 1, characterized in that: In the step 2, the phosphorylation reaction system includes deionized water, T4 polynucleic acid kinase and its buffer, ATP, and oligonucleotides; the reaction is carried out at 37° C., and the enzyme is inactivated after the reaction is completed.

5. The method for preparing an adenylated nucleic acid product according to claim 1, characterized in that: In the step 2, a standard phosphorylation reaction system is required to add 21.2 μL of deionized water, 4.0 μL of 10×T4 polynucleic acid kinase buffer, 4.8 μL of 1 mM ATP, 8.0 μL of 100 μM oligonucleotide and 2.0 μL of T4 polynucleic acid kinase, wherein the buffer composition is 70 mM Tris-HCl, 10 mM MgCl2 and 5 mM DTT, and the buffer pH is 7.6; react at 37° C. for 12 h, and treat at 75° C. for 10 min to inactivate T4 polynucleic acid kinase.

6. The method for preparing an adenylated nucleic acid product according to claim 1, characterized in that: In the step three, first, react at a temperature of 78-90°C for 1-5 minutes, then cool to 20-28°C and maintain for a period of time to allow the auxiliary DNA chain to fully hybridize with the nucleic acid chain to be adenylated; after pre-denaturation, add T4 DNA ligase at room temperature, incubate at 16-40°C, and inactivate T4 DNA ligase at high temperature after the reaction is completed.

7. The method for preparing an adenylated nucleic acid product according to claim 1, characterized in that: The triple adenylation reaction system in the step is: 2.0 μL 10×T4 DNA ligase buffer is added to 9.5 μL deionized water, the buffer composition is 400 mM Tris, 100 mM MgCl2, 100 mM DTT, 5 mM ATP, the buffer pH is 7.8, and then 5.0 μL 20 μM nucleic acid chain to be adenylated and 1.5 μL 100 μM auxiliary DNA chain are added; after pre-denaturation, 2 μL T4 DNA ligase is added, and the final concentration of the system is 5.0 μM nucleic acid chain to be adenylated, 7.5 μM auxiliary DNA chain, 0.5 U / μL T4 DNA ligase and 1×T4 DNA ligase buffer; incubation at 16-40° C., and high temperature inactivation of T4 DNA ligase after the reaction is completed.

Images