Preparation method and application of virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials

Abstract

The present invention provides a preparation method and application of a virus molecular imprinting-aptamer sensor based on a persistent luminescent nanomaterial. The virus molecular imprinting-aptamer sensor proposed in the present invention is composed of a magnetic molecular imprinting polymer and aptamer-functionalized persistent luminescent nanoparticles Zn2GeO4:Mn 2+ The ZGO-H5N1Apt is composed of a 2-mer aptamer (ZGO-H5N1Apt) and a 2-mer aptamer (ZGO-H5N1Apt). Their simultaneous recognition of the H5N1 virus produces a strong, sustained luminescence signal. Leveraging the unique luminescence properties of persistent luminescent nanomaterials and the high selectivity of the imprinted polymer and aptamer, the constructed sensor effectively eliminates background interference from autofluorescent substances in serum samples, enabling highly sensitive and selective detection of the H5N1 virus. This provides a new approach for the design and practical application of virus molecular imprinting sensors in complex biological samples.

Description

Technical Field

[0001] The present invention belongs to the technical field of analytical chemistry detection, and in particular relates to a preparation method and application of a virus molecular imprinting-aptamer sensor based on a luminescence attenuation strategy. Background Art

[0002] In recent years, influenza viruses, such as influenza viruses, have been primarily classified into two types: A and B. These viruses can be further divided into subtypes such as H1N1, H3N2, H5N1, and H7N9 based on differences in the hemagglutinin (HA) and neuraminidase (NA) present in the viral envelope. Numerous viral detection methods have been developed, such as cell culture, reverse transcription polymerase chain reaction (RT-PCR), and enzyme-linked immunosorbent assay (ELISA). These methods often suffer from poor stability, long detection cycles, and high costs [Cassedy, A., Parle-McDermott, A., O'Kennedy, R., Front. Mol. Biosci., 2021, 8].

[0003] Molecularly imprinted polymers (MIPs), as artificial biomimetic receptors, offer advantages such as strong specific recognition, high stability, and low cost, and are attracting increasing attention in the field of virus detection. Molecular imprinting technology utilizes the topographical memory between the imprinted cavity and the target virus, as well as hydrogen bonding, electrostatic interactions, hydrophobic interactions, and coordination interactions, to achieve highly selective recognition of target molecules.

[0004] In recent years, virus molecular imprinting sensing technology has been well developed. Among them, virus molecular imprinting fluorescence sensors have received widespread attention in the field of virus detection due to their high sensitivity and strong selectivity. For example, the Gast team developed a virus molecular imprinting polymer and studied the binding behavior of fluorescently labeled viruses and imprinted polymers, providing ideas for the fluorescent sensing and visualization detection of virus molecular imprinting [Gast M., Wondany F., Raabe B., Michaelis J., Sobek H., Mizaikoff B., Anal. Chem., 2020, 92, 3050-3057]. Wankar et al. prepared a polythiophene nanofilm molecular imprinting fluorescence sensor for the detection of tobacco necrosis virus, achieving specific detection of the target, with a detection limit of 2.29 ng L -1[Wankar S., Turner NW, Krupadam RJ, Biosens. Bioelectron., 2016, 82, 20-25]. Our group synthesized virus-imprinted polymers with red and green fluorescence, respectively, and constructed virus fluorescence sensors to achieve simultaneous visual detection of hepatitis A and hepatitis B viruses [Luo LH, Zhang F., Chen CY, Cai CQ Anal. Chem., 2019, 91, 15748-15756]. However, when these virus-imprinted sensors are used to detect viruses in complex biological samples such as serum, the interference of autofluorescence background from other substances in the serum is severe, becoming the biggest obstacle to the practical application of the developed sensors.

[0005] To eliminate the interference of autofluorescence background, various photochemical probes based on X-ray scintillation nanomaterials and persistent luminescence nanomaterials have been developed. Among them, persistent luminescence nanoparticles (PLNPs) can continue to emit light for minutes, hours, or even days after the excitation stops, enabling the detection of targets without the need for in situ excitation, completely avoiding the autofluorescence background interference of interfering substances. In addition, PLNPs have many other advantages, such as low toxicity, easy modification, and stable and long-lasting luminescence intensity. Therefore, PLNPs have great advantages in the fields of biosensing and bioimaging [Shi LX, Shao JJ, Jing X.H., Zheng WW, Liu H., Zhao Y., ACS Sustain. Chem. Eng., 2019, 8, 686-694; Wang J., Ma QQ, Wang Y.Q., Shen HJ, Yuan Q., Nanoscale., 2017, 9, 6204-6218]. Therefore, applying this material in the field of virus molecular imprinting sensing can effectively eliminate the background interference of autofluorescent substances in complex samples and has important potential application value.

[0006] Based on the above background, combining virus molecular imprinting technology with PLNPs nanomaterials to construct virus molecular imprinting sensors has potential application value in solving the problems of serious background interference from autofluorescent substances in samples and unsatisfactory selectivity when current virus sensors are used to detect target viruses in complex biological samples. It is of great significance for the practical application and promotion of virus sensors. Summary of the Invention

[0007] In response to the problems of severe fluorescence background interference and low selectivity when existing virus fluorescence sensors are used for complex biological sample detection, the present invention provides a method for preparing a virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials, and applies the sensor to the specific identification and detection of viruses, effectively avoiding background interference from autofluorescent substances in serum samples.

[0008] In order to achieve the above-mentioned object of the invention, the embodiment of the present invention is implemented through the following technical solutions:

[0009] A method for preparing a virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials is provided. The method is characterized in that the method comprises the following process steps:

[0010] (1) First, magnetic Fe3O4 was used as the imprinting carrier material and modified with silane reagents tetraethylorthosilicate (TEOS) and 3-methacryloyloxypropyltrimethoxysilane (MPS), and a large number of C=C double bonds were grafted onto its surface. Subsequently, acrylamide, acrylic acid (AA), and methyl acrylate (MA) were selected as functional monomers, and N,N'-methylenebis(acrylamide) (MBA) was used as a cross-linker. In the presence of the template, azobisisobutyronitrile (AIBN) was added to initiate polymerization, and the template was embedded in the cross-linked polymer network. The combination of multiple functional monomers can provide multiple groups to bind to the template virus, reducing nonspecific adsorption. After removing the embedded H5N1 virus, an imprinting cavity that matches the size and shape of the H5N1 virus was obtained. The MIP containing the specific imprinting cavity was used as a recognition probe and separation element for selective binding to the H5N1 virus.

[0011] (2) Synthesis of long-lasting luminescent nanomaterials Zn2GeO4:Mn 2+ ZGO (ZGO) was functionalized with an aptamer. The synthesized ZGO was first amino-modified with APTES. Then, a carboxyl-modified H5N1 aptamer was immobilized on the amino-modified ZGO surface via amide reaction to form ZGO-H5N1 Apt. Leveraging the high specificity of the H5N1 aptamer, it was used as a secondary recognition probe to selectively identify the H5N1 virus.

[0012] (3) The target virus H5N1 can simultaneously bind to the H5N1 imprinted cavity on the magnetic MIP surface and the aptamer on the ZGO-H5N1 Apt surface, ultimately forming a ZGO-H5N1 Apt@H5N1@MIP sandwich structure. After magnetic separation, the magnetic nanoparticles that formed the sandwich structure separated from the solution system, but the ZGO-H5N1 Apt that did not form a sandwich structure remained in the solution. As the H5N1 virus concentration gradually increased, the amount of ZGO-H5N1 Apt in the supernatant gradually decreased, thus generating a PL signal that varied with the H5N1 virus concentration.

[0013] Furthermore, the present invention provides a method for using a virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials. The method is characterized in that the method comprises the following process steps:

[0014] (1) Adding different concentrations of H5N1 virus under optimal conditions, recording the corresponding PL signals on a fluorescence spectrophotometer, and investigating the detection range and detection limit of the sensor for H5N1 virus;

[0015] (2) Other viruses similar to the template virus H5N1 were selected to investigate the selectivity and competitive adsorption capacity of the sensor for the H5N1 virus;

[0016] (3) Adding common substances in serum to investigate the anti-interference ability of the sensor;

[0017] (4) The sensor is placed for different periods of time and then analyzed to examine the temporal stability of the sensor;

[0018] (5) The sensor was used to recover serum spiked with H5N1 virus to investigate its practical application capability.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] (1) Using magnetic nanoparticles as imprinting carriers can improve the separation efficiency of target viruses after MIP adsorption;

[0021] (2) Improve the specific recognition ability of the target virus based on the dual recognition of H5N1 virus by MIP and aptamer;

[0022] (3) The long-lasting luminescent nanoparticles ZGO are used as the signal output of the sensor. Their long-lasting luminescence performance effectively overcomes the background fluorescence interference of complex biological matrices such as serum and improves the detection sensitivity

[0023] (4) The sensor detection process does not require high professional skills of the operator and has the potential to be used for clinical diagnosis of viral diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] [ Figure 1 Schematic diagram of the construction principle of virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials

[0025] [ Figure 2 Principle verification: PL signal intensity diagrams of ZGO, ZGO+H5N1, NIP+ZGO, MIP+ZGO, NIP+H5N1+ZGO, and MIP+H5N1+ZGO

[0026] [ Figure 3(A) XRD pattern of ZGO NPs; (B) fluorescence emission spectrum (excitation wavelength 254 nm, concentration 0.2 mg / mL, inset shows photos of ZGO NPs with and without UV excitation); (C) UV absorption spectrum; (D) continuous luminescence decay curve of ZGO at 536 nm after 15 min of excitation with 254 nm UV lamp.

[0027] [ Figure 4 ](A) FT-IR spectra of ZGO and ZGO-NH2; (B) Zeta potential of ZGO-OH, ZGO-NH2, ZGO-H5N1 Apt, and ZGO-HBVApt in PBS buffer (pH=7.4, 10mM); (C) FT-IR spectra of Fe3O4(a), Fe3O4@SiO2(b), Fe3O4@SiO2@C=C(c), MIP(d), and NIP(e); (D) Zeta potential of Fe3O4, Fe3O4@SiO2, and Fe3O4@SiO2@C=C in deionized water

[0028] [ Figure 5 ](A) SEM of Fe3O4@SiO2, (B) MIP, (C) NIP and DLS of (D) Fe3O4@SiO2, (E) MIP and (F) NIP.

[0029] [ Figure 6 (A) Effect of H5N1 (0, 0.0032, 0.0064, 0.0128, 0.032, 0.064, 0.128, 0.32, 0.64, 1.28, 3.2, 6.4, 12.8, 32 HAU / mL) on PL intensity; (B) ΔI of MIP PL Linear relationship between the concentration of H5N1 solution (0.0128-1.28HAU / mL)

[0030] [ Figure 7 (A) Selectivity and (B) competition experiments of MIP / NIP (concentrations of H5N1, H7N9, and H9N2: 0.64 HAU / mL; HAV and HBV: 4 ng / mL); (C) anti-interference ability of MIP (concentration of H5N1, 0.64 HAU / mL; Na + , K + Mg 2+ , Ca 2+ 、HCO3 - 、HPO4 2- , glucose, L-proline concentrations, 50 μM, 25 μM, 25 μM, 25 μM, 25 μM, 10 μM, 25 μM) and (D) stability (H5N1 concentration, 0.64 HAU / mL) Specific implementation plan

[0031] Here, the specific embodiments of the present invention will be further described in detail with reference to the accompanying drawings and examples. The following examples are used to illustrate the present invention, but do not limit the scope of application and extension of the present invention.

[0032] Example 1: Preparation method of virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials

[0033] (1) Preparation of long-lasting luminescent nanoparticles ZGO: First, GeO2 (3 mmol) was dissolved in 3 mL of NaOH (2 mol / L) to obtain a Na2GeO3 (1 mol / L) solution. Then, Mn(NO3)2 (0.005 mmol) and Zn(NO3)2·6H2O (2 mmol) were dissolved in 10 mL of ultrapure water and mixed with 300 μL of 68 wt% HNO3 under vigorous stirring. Subsequently, 1 mL of Na2GeO3 (1 mol / L) was added dropwise to the above solution. The pH value of the mixture was quickly adjusted to 9.0 with NH3·H2O (28 wt%) and continued to stir at room temperature (400 rpm) for 1 h. The mixture was then transferred to a polytetrafluoroethylene autoclave (50 mL) and reacted at 220°C for 4 h.

[0034] Wash with water several times and dry in vacuum at 60℃;

[0035] (2) Preparation of H5N1 aptamer-modified ZGO: First, the obtained ZGO powder was dispersed in a 5 mmol / L NaOH solution and ultrasonically dispersed for 1 h. After stirring overnight (600 rpm), the mixture was centrifuged, washed with ultrapure water, and vacuum-dried to obtain hydroxylated ZGO (ZGO-OH). Next, 100 mg of ZGO-OH was ultrasonically dispersed in 40 mL of N,N-dimethylformamide (DMF), stirred vigorously, and 400 μL of 3-aminopropyltriethoxysilane (APTES) was added dropwise. The mixture was reacted at 80°C for 24 h. The resulting ZGO-NH2 was collected by centrifugation (10,000 rpm), washed with DMF, and dried in vacuo at 60°C. 10 μL of the 10 μM aptamer was added to 240 μL of PBS buffer (pH = 7.4, 10 mM), followed by the addition of 125 μL of EDC (1 mol / L) and 125 μL of NHS (0.25 mol / L), and the mixture was shaken at 37°C for 1 h to activate the aptamer. The resulting activated H5N1 virus aptamer was then added to 4.5 mL of PBS buffer containing 10 mg of ZGO-NH2 and shaken at 37°C overnight. Finally, the supernatant was washed with PBS until no UV signal of the aptamer was detected, and ZGO-H5N1 Apt was collected by centrifugation at 10000 r. Finally, it was dispersed in PBS (pH=7.4, 10 mM) buffer and stored at 4°C for future use.

[0036] H5N1 aptamer sequence (5'-3'): COOH-GTGTGCATGGATAGCACGTAACGGTGTAGTAG ATACGTGCGGGTAGGAAGAAAGGGAAATAGTTGTCCTGTTG

[0037] (3) Preparation of imprinted polymer particles (MIP) and non-imprinted polymer particles (NIP): First, Fe3O4@SiO2 NPs were prepared and C=C modified. 1.35 g of FeCl3·6H2O was dissolved in 40 mL of ethylene glycol to obtain a clear solution, and then 3.6 g of NaAc and 1 g of polyethylene glycol were added. After vigorous stirring for 30 min, the mixture was transferred to a polytetrafluoroethylene reactor and reacted at 200°C for 24 h. The black product was washed several times with water and ethanol and dried under vacuum at 60°C to obtain Fe3O4 nanoparticles. 0.5 g of Fe3O4 was added to a mixture of 50 mL of 2-isopropanol and 2 mL of deionized water and sonicated for 30 min. Then, 5 mL of ammonia and 2.5 mL of LTEOS were added under mechanical stirring (600 rpm) and reacted at 45°C for 6 h. The product was washed several times with water and ethanol and dried in vacuum at 60°C overnight to obtain Fe3O4@SiO2 NPs. 0.1g of Fe3O4@SiO2 NPs was then dispersed in 150mL of anhydrous ethanol containing 6mL of MPS and reacted at 600 rpm for 24h at room temperature. The product was washed with ethanol and dried in vacuum at 50°C to obtain Fe3O4@SiO2@C=C.

[0038] Imprinting: 20 mg of Fe3O4@SiO2@C=C, 0.2 mmol acrylamide, 0.2 mmol acrylic acid, 0.1 mmol methyl acrylate, and 100 μL of 128 HAU / mL template virus H5N1 were dispersed in 5 mL DMF and preassembled at 65°C for 2 h with stirring. Next, 0.2 mmol of MBA dissolved in 1 mL DMF was added to the solution and stirred under a nitrogen atmosphere for 30 min. 15 mg of AIBN dissolved in 1 mL DMF was added to the mixture to initiate polymerization. After polymerization at 65°C for 6 h, the product was washed with ultrapure water to remove residual monomers and virus. The template virus H5N1 was then repeatedly eluted with a mixture of methanol and acetic acid in a volume ratio of 9:1 until no H5N1 virus fluorescence signal was observed in the supernatant. The resulting product was vacuum-dried at 50°C for later use. The preparation of the non-imprinted polymer (NIP) was identical to the above, except that no template was added.

[0039] (4) Preparation of the virus molecular imprinting-aptamer sensor: The prepared MIP was dispersed in PBS buffer (pH = 7.4, 10mM) to obtain a MIP solution with a concentration of 0.2mg / mL. The H5N1 virus to be detected was added and incubated under optimized adsorption conditions for 60min. Subsequently, 100μL 1mg / mL ZGO-H5N1 Apt was added to the above solution and incubated under the same conditions for 60min. A ZGO-H5N1Apt@H5N1@MIP sandwich structure was formed and separated by magnetic force, while the remaining ZGO-H5N1 Apt that did not form a sandwich structure remained in the supernatant. An appropriate amount of supernatant was added to a cuvette, and its PL intensity at 536nm was measured in phosphorescence mode on a Hitachi F-4600 fluorescence spectrophotometer (excitation wavelength 250nm, excitation slit width, 10nm, emission slit width, 10nm). By calculating the PL intensity difference ΔI of the supernatant before and after adding H5N1 virus PL The H5N1 virus concentration was evaluated and a virus molecular imprinting-aptamer sensor for detecting the H5N1 virus was eventually constructed.

[0040] Example 2: Feasibility verification of the virus molecular imprinting-aptamer sensor for detecting viruses

[0041] In order to verify the feasibility of the present invention, this embodiment verifies the construction principle of the sensor. Figure 2 As shown, the PL signal of ZGO-H5N1 Apt is highest at 536 nm. The PL signal of ZGO-H5N1Apt decreases slightly after the addition of H5N1, NIP, or MIP alone, indicating that the presence of H5N1, MIP, or NIP has little interference with the PL of ZGO-H5N1 Apt. The PL decreases slightly after the addition of H5N1 to NIP, while the intensity decreases significantly after the addition of H5N1 to MIP. Based on the above analysis, it can be concluded that H5N1 specifically binds to the magnetic MIP and ZGO-H5N1 Apt to form a ZGO-H5N1 Apt@H5N1@MIP sandwich structure. The PL signal of the supernatant after magnetic separation is significantly reduced, while the NIP only nonspecifically adsorbs a small amount of H5N1, resulting in a smaller PL change. This further demonstrates that the proposed MIP-aptamer sensor has excellent selectivity for the target virus H5N1.

[0042] Example 3: Performance, morphology and structural characterization of the viral molecular imprinting-aptamer sensor and its intermediates.

[0043] The ZGO nanoparticles were characterized by X-ray diffractometer, fluorescence spectroscopy and UV-visible absorption spectroscopy. Figure 3As shown: The prepared ZGO nanoparticles show high crystallinity and have the standard rhombohedral phase Zn2GeO4 (JCPDS11-0687) ( Figure 3 A) Due to Mn 2+ The prepared ZGO nanoparticles emit bright green light at 536 nm due to the electronic transition of 4T1(4G)-6A1(6S). Figure 3 B), can be excited by ultraviolet light from 200nm to 300nm ( Figure 3 C), and showed excellent sustained luminescence characteristics after 15 min of 254 nm UV light excitation ( Figure 3 D). These results indicate that ZGO was successfully synthesized;

[0044] The ZGO and its modification process, MIP and NIP preparation process were characterized by Fourier transform infrared spectroscopy and potentiometric particle size analyzer. Figure 4 1125 and 1040 cm -1 The strong absorption band corresponds to O-Si-O stretching vibration, 3416 cm -1 Corresponding to NH expansion belt, 2933cm -1 The corresponding -CH2- asymmetric / symmetric stretching bands indicate the successful amino functionalization of ZGO ( Figure 4 A). ZGO-NH2 was then functionalized with a carboxyl-modified H5N1 aptamer to obtain ZGO-H5N1 Apt via amidation. The zeta potential of ZGO-NH2 in PBS buffer at pH 7.4 was 17.6 mV, while further modification with the H5N1 aptamer resulted in a potential shift to -2.13 mV ( Figure 4 B), indicating the successful preparation of ZGO-H5N1 Apt. Figure 4 C, 1093 and 800 cm -1 The corresponding O-Si-O stretching and bending vibrations indicate the successful coating of SiO2 on the Fe3O4 surface. -1 The absorption peak is due to the incomplete reaction of the functional monomer and cross-linker C=C in the polymer layer. Compared with MIP, the infrared spectrum of NIP does not change significantly, because the only difference between NIP and MIP is whether the template virus is added during the synthesis. The potential change from Fe3O4 to Fe3O4@SiO2@C=C indicates the successful modification of the C=C double bond ( Figure 4 D);

[0045] The morphology and size of Fe3O4@SiO2, MIP and NIP were further characterized by scanning electron microscopy (SEM) and potentiometric particle size analyzer. Figure 5 As shown, the particles are basically spherical, and the particle size of Fe3O4@SiO2 is about 460nm ( Figure 5 A, D), and further imprinting polymerization resulted in the MIP particle size increasing to approximately 520 nm, indicating that the MIP was successfully prepared ( Figure 5 B, E). The molecular imprinting layer on the surface of Fe3O4@SiO2 nanoparticles is about 30 nm thick and can uniquely identify the corresponding template virus. In addition, compared with NIP, obvious depressions can be observed on the surface of MIP ( Figure 5 C, F) The specific recognition cavity remains after virus elution. Comparison of the morphological characteristics of MIP and NIP indicates that the imprinting is successful and template elution has little effect on the entire particle.

[0046] Example 4: Application of the virus molecular imprinting-aptamer sensor.

[0047] The experimental conditions for this example were: 0.2 mg / mL MIP, 0.2 mg / mL ZGO-H5N1 Apt, pH 7.4, incubation temperature 37°C, and two-step incubation times of 60 and 60 minutes. The specific protocol involved adding a specific concentration of H5N1 virus to a 0.2 mg / mL MIP solution, adsorbing at 37°C with shaking for 60 minutes, then adding 0.2 mg / mL ZGO-H5N1 Apt, incubating for 60 minutes, and magnetic separation. The supernatant was then collected and its fluorescence intensity measured.

[0048] (1) Detection and analysis of H5N1 virus at different concentrations by the virus molecular imprinting-aptamer sensor

[0049] According to the above experimental steps, the virus molecular imprinting-aptamer sensor of the present invention was used to detect and analyze H5N1 virus solutions of different concentrations. The results are as follows: Figure 6 As shown in Figure 2, the PL intensity in the supernatant after magnetic separation decreased with the increase of H5N1 virus concentration, and there was a good linear relationship in the range of 0.0128HAU / mL to 1.28HAU / mL (Y = 1421.4 + 627.8X, R 2 =0.9913), and the limit of detection (LOD) was 0.0128 HAU / mL. The results show that the sensor can detect trace amounts of viruses, and the detection strategy is simple and effective, meeting the requirements for early diagnosis of viruses.

[0050] (2) Selectivity and competition experiments of the virus molecular imprinting-aptamer sensor for H5N1 virus

[0051] Other viruses similar to the template virus were selected to investigate the selectivity and competitive adsorption capacity of the virus molecular imprinting-aptamer sensor of the present invention for H5N1 virus. HAV, HBV, H7N9 and H9N2 were used as non-target viruses. Figure 7As shown in A, the interaction of H5N1 virus with MIP and ZGO-H5N1 Apt resulted in the greatest change in PL intensity, while the PL intensity only changed slightly after the addition of the other four viruses, indicating that the developed MIP-aptamer sensor can selectively adsorb H5N1. H5N1 / IF othervirus ) and imprinting factor (IF = ΔI PL,MIP / ΔI PL,NIP ), the IF of H5N1 and SF of other viruses were calculated and listed in Table 1. It is worth noting that the imprinting factor of the target virus H5N1 is 6.72, and the selectivity factors for other non-target viruses are all higher than 4, indicating that the proposed MIP-aptamer sensor has excellent selectivity.

[0052] Next, competitive tests were performed using HAV, HBV, H7N9, and H9N2. Figure 7 As shown in B, when H5N1 was added, the PL intensity changed significantly. At the same time, the ΔI PL The changes are negligible, indicating that the proposed MIP-aptasensor has significant recognition and anti-interference capabilities for the target viruses.

[0053] Table 1 Imprinting factors of H5N1 virus and selective factors of other viruses

[0054]

[0055] (3) Investigation of the Anti-interference Ability and Stability of the Virus Molecular Imprinting-Aptamer Sensor

[0056] In order to investigate the detection ability of the virus molecular imprinting-aptamer sensor in serum samples, Figure 7 As shown in C, select Na + , K + Mg 2+ , Ca 2+ 、HCO3 - 、HPO4 2- The anti-interference ability of the sensor was investigated by the presence of serum, glucose and L-proline. The results showed that the influence of serum was negligible and the proposed virus molecular imprinting-aptamer sensor had excellent anti-interference ability.

[0057] In order to analyze the stability of the proposed virus molecular imprinting-aptamer sensor over time, the same batch of materials were used for H5N1 detection after 0, 2, 4, 6, 8, and 10 weeks. Figure 7 As shown in D, after a period of time, the detected ΔI PL The signal weakened somewhat, but after 10 weeks its intensity was 82.4% of the original value, indicating satisfactory stability.

[0058] (4) Recovery of H5N1 virus serum spiked with the virus molecular imprinting-aptamer sensor

[0059] The spike recovery method was used to evaluate the analytical capabilities of the aforementioned method for real-world samples. Three human serum samples diluted 100-fold with phosphate buffer (pH 7.4, 10 mmol / L) were spiked with H5N1 virus at concentrations of 0.064, 0.128, and 0.64 HAU / mL, respectively. The H5N1 virus was detected and analyzed using the virus molecular imprinting aptamer sensor prepared by the present invention. The experimental results, shown in Table 2, showed spike recovery rates ranging from 100.9% to 119.7%. Subsequently, the dilution factor was further reduced for further investigation. Three human serum samples diluted 50-fold with phosphate buffer (pH 7.4, 10 mmol / L) were spiked with H5N1 virus solutions at concentrations of 0.064, 0.128, and 0.64 HAU / mL, respectively. The H5N1 virus was detected and analyzed using the virus molecular imprinting aptamer sensor prepared by the present invention. The experimental results, shown in Table 3, showed spike recovery rates ranging from 93.77% to 105.0%.

[0060] Table 2 Detection results of H5N1 in 100-fold diluted human serum

[0061]

[0062] Table 3 Detection results of H5N1 in 50-fold diluted human serum

[0063]

Claims

1. A method for preparing a virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials, characterized by: Magnetic Fe3O4 nanoparticles were used as imprinting carriers for imprinting, and after elution, magnetic imprinted polymers with H5N1 imprinted cavities were obtained, and the persistent luminescent nanomaterial Zn2GeO4:Mn 2+ (ZGO) and functionalized it with an H5N1 aptamer. Finally, the two materials were used simultaneously to recognize the H5N1 virus. After magnetic separation, the supernatant produced a PL signal that varied with the H5N1 concentration. The PL signal was recorded to ultimately construct the virus molecular imprinting-aptamer sensor. The preparation method comprises the following steps: 1) Preparation of ZGO and its aptamer functionalization: Mn(NO3)2 and Zn(NO3)2·6H2O were mixed, and 300μL of 68wt% HNO3 and 1mL of 1mol / LNa2GeO3 were added successively. The pH value was quickly adjusted to 9.0 with NH3·H2O, and the mixture was stirred at room temperature for 1h, transferred to a polytetrafluoroethylene autoclave, and reacted at 220℃ for 4h. The mixture was washed with water and dried to obtain ZGO powder. The obtained ZGO powder was dispersed in NaOH solution and stirred overnight to obtain hydroxylated ZGO-OH, which was then ultrasonically dispersed in DMF. APTES was added dropwise and reacted at 80℃ for 24h to obtain ZGO-NH2. The activated H5N1 virus aptamer was added to PBS buffer containing ZGO-NH2, shaken at 37℃ overnight, and finally washed with PBS until the ultraviolet signal of the aptamer in the supernatant was undetectable, thereby obtaining the aptamer-functionalized ZGO material ZGO-H5N1 Apt. 2) Preparation of MIP and NIP: FeCl3·6H2O, NaAc, and polyethylene glycol were mixed and hydrothermally reacted to obtain Fe3O4 nanoparticles. NH3·H2O and TEOS were then added to coat the surface of the Fe3O4 nanoparticles with a layer of silica to obtain Fe3O4@SiO2. This was dispersed in anhydrous ethanol containing MPS and stirred at room temperature for 24 h to obtain Fe3O4@SiO2@C=C. 20 mg Fe3O4@SiO2@C=C was ultrasonically dispersed in a DMF solution, followed by the addition of acrylamide, acrylic acid, methyl acrylate, and the template virus H5N1. The mixture was stirred at 65°C for pre-assembly for 2 hours. Next, the crosslinker MBA and the initiator AIBN were added and stirred for 30 minutes under a nitrogen atmosphere to deoxygenate. After polymerization at 65°C for 6 hours, the resulting product was repeatedly eluted with a mixture of methanol and acetic acid in a volume ratio of 9:1 to remove the template virus H5N1 until no fluorescence signal of the H5N1 virus was observed in the supernatant, thereby obtaining MIP. The preparation of non-imprinted polymer (NIP) was the same as above, except that no template virus was added. 3) Construction of the virus molecular imprinting-aptamer sensor: The prepared MIP was dispersed in PBS buffer, the H5N1 virus to be detected was added, and the mixture was shaken and incubated under optimized adsorption conditions. Subsequently, ZGO-H5N1 Apt was added to the above solution and shaken and incubated under the same conditions. Finally, the supernatant after magnetic separation was collected, and an appropriate amount of the supernatant was added to a cuvette. The PL intensity was measured and recorded on a Hitachi F-4600 fluorescence spectrophotometer in phosphorescence mode. The PL intensity difference ΔI before and after the addition of the H5N1 virus was calculated. PL Evaluate H5N1 virus concentration and ultimately construct a virus molecular imprinting-aptamer sensor based on long-lasting luminescent nanomaterials for detecting H5N1 virus; The detection conditions of the virus molecular imprinting-aptamer sensor are: excitation wavelength: 250 nm, emission wavelength: 536 nm, excitation slit: 10 nm, emission slit: 10 nm.

2. The method for preparing a virus molecular imprinting-aptamer sensor based on persistent luminescent nanomaterials according to claim 1, characterized in that: The amounts of APTES, MPS, acrylamide, acrylic acid, methyl acrylate, template virus H5N1, MBA, and AIBN were 400 μL, 6 mL, 0.2 mmol, 0.2 mmol, 0.1 mmol, 100 μL 128 HAU / mL, 0.2 mmol, and 15 mg, respectively; The amount of MIP in the virus molecular imprinting-aptamer sensor is 0.2 mg / mL, the amount of ZGO-H5N1 Apt is 0.2 mg / mL, the pH is 7.4, the incubation temperature is 37° C., and the two-step incubation time is 60 min and 60 min.

3. Application of the virus molecular imprinting-aptamer sensor based on the persistent luminescent nanomaterial prepared by the preparation method according to claim 1, characterized in that: The virus molecular imprinting-aptamer sensor was used to analyze H5N1 virus solutions of different concentrations to evaluate its detection range and detection limit for the H5N1 virus.

4. Application of the virus molecular imprinting-aptamer sensor based on the persistent luminescent nanomaterial prepared by the preparation method according to claim 1, characterized in that: The virus molecular imprinting-aptamer sensor was used to detect different virus solutions of the same concentration and a mixed solution of the target virus and the interfering virus to evaluate its selectivity and competitive adsorption capacity for the H5N1 virus.

5. Application of the virus molecular imprinting-aptamer sensor based on the persistent luminescent nanomaterial prepared by the preparation method according to claim 1, characterized in that: The virus molecular imprinting-aptamer sensor was used to detect H5N1 virus solutions containing various interfering substances to evaluate its anti-interference ability for H5N1 virus detection; materials stored for different times were used to construct the virus molecular imprinting-aptamer sensor, and the H5N1 virus solutions were analyzed to examine its temporal stability.

6. Application of the virus molecular imprinting-aptamer sensor based on the persistent luminescent nanomaterial prepared by the preparation method according to claim 1, characterized in that: The virus molecular imprinting-aptamer sensor was applied to the spike recovery of H5N1 virus solution in human serum to evaluate the analytical ability of the virus molecular imprinting-aptamer sensor for H5N1 virus in actual samples.

Images