A thaumatin mutant and application thereof

Abstract

The present application relates to the technical field of genetic engineering and protein modification, and particularly relates to a thaumatin mutant and application thereof. The applicant screens a mutation site which significantly improves the sweetness of thaumatin by protein engineering technology, and overexpresses the mutation site in Pichia pastoris. The mutant can be used as a sweetener and widely applied in the field of feed or food processing.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, and in particular to a thaumatin mutant and application thereof. BACKGROUND

[0002] In the 1960s, cyclamate was suspected to be carcinogenic, so people began to look for natural sucrose substitutes. In the late 1960s, a sweet-tasting protein, thaumatin, was discovered in the fruit of a tropical plant, Thaumatococcus danielli Benth, also known as thaumatin. Thaumatin has super-high sweetness, and the sweetness of the same mass of thaumatin is about 1600 times that of sucrose. Moreover, as a protein, it has many advantages such as being natural, low-calorie, safe and non-toxic, and degradable into amino acids required by the human body, and fully meets the psychological needs of consumers today to eat healthily and nutritiously. Therefore, the market demand for pure natural, low-calorie sweeteners is also increasing.

[0003] In 1979, natural thaumatin was first approved in Japan as a natural food additive for the market; in 1981, it was approved for use in pharmaceuticals in the UK, and in 1986, it was approved as a safe food additive; in 1994, it was approved in Europe as a sweetener and flavor enhancer. Subsequently, similar approvals have been made in many countries, and the US Food and Drug Administration (FDA) and the American Spice and Extract Manufacturers Association (FEMA) also consider thaumatin to be safe and can be used in food. In 2014, China also formally approved thaumatin as a food additive.

[0004] Currently, naturally extracted plant thaumatin not only has limited planting area, but also has low yield. In addition, due to genetic variation of plants or seasonal and climatic conditions, the supply of raw materials is unstable, resulting in non-single molecules of plant-extracted thaumatin, and great differences between different batches. Although Thaumatococcus danielli has been commercially planted and harvested in West Africa, and a few companies in the UK, Germany and Japan produce high-purity thaumatin based on traditional processes, but on the international market, the average transaction price of high-purity thaumatin is 4000 euros / kg. Thaumatin has a broad application prospect, and in order to meet market demand, researchers have used genetic engineering technology to introduce thaumatin into different hosts, such as microorganisms and higher plants, in the hope of obtaining a large amount of recombinant active thaumatin protein. However, the recombinant thaumatin protein either has low yield or no sweetness, and the results are not satisfactory. Overbeeke believes that the expression level of thaumatin in microorganisms needs to be at a level that can make its cost comparable to that of naturally extracted thaumatin, and so far no study has reached this level. SUMMARY

[0005] The present application is to solve the prior art problems, through protein engineering technology, a series of gene mutation sites capable of improving the sweetness of Thaumatin are screened, and Thaumatin is overexpressed in Pichia pastoris, so as to meet the requirements of industrialization.

[0006] The present application relates to a Thaumatin mutant, the mutant comprises an amino acid sequence having at least 90% identity with SEQ ID NO: 1, and comprises an amino acid substitution at at least one position selected from the group consisting of 28, 133, 174, compared with SEQ ID NO: 1.

[0007] The amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity compared with SEQ ID NO: 1.

[0008] The amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity compared with SEQ ID NO: 1.

[0009] In some embodiments of the present application, the mutant comprises at least one amino acid substitution selected from the group consisting of G28A, Q133S, K174V.

[0010] In some embodiments of the present application, the mutant comprises a substitution or a combination of substitutions selected from the group consisting of G28A, Q133S, K174V, G28A / Q133S, Q133S / K174V, G28A / K174V, G28A / Q133S / K174V.

[0011] In some embodiments of the present application, the amino acid sequence of the mutant is as shown in SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO: 7.

[0012] In some embodiments of the present application, the nucleotide sequence encoding the mutant is as shown in SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO: 8.

[0013] The present application also relates to a recombinant expression plasmid carrying the nucleotide sequence encoding the mutant described above.

[0014] The present application also relates to a host cell comprising the recombinant expression plasmid described above.

[0015] In some embodiments of the present application, the host cell is Pichia pastoris (P. pastoris). Pichia pastoris ).

[0016] The recombinant expression plasmid is introduced into a host cell of Pichia pastoris to perform recombinant expression, and the sweetness of the obtained somatin mutant is significantly improved.

[0017] The present application also relates to a sweetener comprising the somatin mutant.

[0018] The present application also relates to application of the sweetener in food or feed.

[0019] The somatin mutants SOMA1-B1, SOMA1-B2 and SOMA1-B3 provided by the present application have sweetness increased by 60%, 140% and 200% respectively after expression in Pichia pastoris, and unexpected technical effects are achieved.

[0020] The mutants can be widely applied as sweeteners in the fields of feed and food processing, and have wide application prospects. DETAILED DESCRIPTION

[0021] The present application uses conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as the methods described in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can use other conventional methods, experimental schemes and reagents in the field on the basis of the technical solutions described in the present application, and are not limited to the limitations of the specific embodiments of the present application.

[0022] Strains and vectors: E. coli DH5a preserved by the present company, Pichia pastoris GS115, vector pPIC9k, Amp, G418, Zeocin purchased from Invitrogen Company.

[0023] Enzymes and kits: DNA polymerase purchased from Takara Company, T4 ligase, restriction endonuclease purchased from Fermentas Company, plasmid extraction kit and gel purification and recovery kit purchased from Omega Company, GeneMorph II random mutagenesis kit purchased from Beijing Bomaishi Biological Technology Co., Ltd.

[0024] Culture medium formula:

[0025] E. coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0026] LB + Amp medium: LB medium plus 100 μg / mL ampicillin;

[0027] Yeast culture medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0028] YPD + Zeocin medium: YPD medium plus 100 μg / ml Zeocin;

[0029] Yeast screening medium (MD medium): 1.34% YNB, 4x10 -5 biotin, 1% glycerol, 2% agarose;

[0030] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4x10 -5 biotin, 1% glycerol;

[0031] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4x10 -5 biotin, 0.5% methanol.

[0032] Example 1 Gene synthesis of thaumatin SOMA1

[0033] According to the gene sequence in GenBank, a thaumatin gene found in Thaumatococcus daniellii is named SOMA1, and the GenBank number is P02883.2. After removing its own signal peptide, the amino acid sequence of the thaumatin protein is SEQ ID NO: 1, and the encoding nucleotide sequence is SEQ ID NO: 2. The whole gene synthesis was performed by Huada Gene Company; the full-length of SOMA1 gene is 645 bp.

[0034] Example 2 Screening of thaumatin SOMA1 mutants

[0035] In order to further improve the sweet activity of thaumatin SOMA1, a large number of mutations of the gene were screened by directed evolution technology; using thaumatin SOMA1 as a template, primer 1 (F) and primer 1 (R) were used for PCR amplification by using GeneMorph II random mutation PCR kit (Stratagene).

[0036] Primer 1 (F): GCGC GAATTC GCTACTTTCGAGATCGTTAACAGAT;

[0037] Primer 1 (R): TAAAGCGGCCGC TTATCATTCATCCTCCAATTCCAAG.

[0038] glue recovery PCR product, Eco RI, Not After enzyme digestion, the treated product was connected with pET21a vector treated by the same enzyme, and then transformed into E. coli BL21 (DE3) and coated on LB+Amp plate for 37°C inverted culture. After the appearance of the transformants, they were picked one by one with toothpicks and added into 96-well plates, each well containing 150 ul of LB+Amp medium containing 0.1 mM IPTG, and cultured at 37°C, 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the bacterial cells were resuspended with buffer, and repeatedly frozen and thawed to break the wall, obtaining E. coli cell lysate containing thaumatin. The supernatant was removed by centrifugation, and the sweet activity of thaumatin was determined.

[0039] The experimental results show that some mutations have no effect on the sweet activity of SOMA1, and some mutations even make the sweet activity lower. Finally, the applicant screened the combination of mutation sites with significantly improved sweet activity: single-point mutation G28A, two-point mutation G28A / Q133S, and three-point mutation G28A / Q133S / K174V.

[0040] The thaumatin mutant containing single-point mutation G28A is named SOMA1-B1, and its amino acid sequence is SEQ ID NO: 3, and the encoding nucleotide sequence is SEQ ID NO: 4;

[0041] The thaumatin mutant containing two-point mutation G28A / Q133S is named SOMA1-B2, and its amino acid sequence is SEQ ID NO: 5, and the encoding nucleotide sequence is SEQ ID NO: 6;

[0042] The thaumatin mutant containing three-point mutation G28A / Q133S / K174V is named SOMA1-B3, and its amino acid sequence is SEQ ID NO: 7, and the encoding nucleotide sequence is SEQ ID NO: 8.

[0043] The genes of the above mutants were synthesized by Huada Gene Company.

[0044] The above three mutants were amplified by PCR using primer 1 (F) and primer 1 (R), and the PCR conditions were as follows: denaturation at 94°C for 5 min, then denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles, and then 72°C for 10 min. The lengths of SOMA1-B1, SOMA1-B2 and SOMA1-B3 genes are the same as that of SOMA1 gene, and the full length is 645 bp.

[0045] Example 3 Construction of Pichia pastoris engineering bacteria for recombinant expression of thaumatin

[0046] 1. Construction of recombinant plasmid

[0047] The cloned SOMA1 and three mutant genes (SOMA1-B1, SOMA1-B2, SOMA1-B3) were double-digested with restriction enzymes Eco R I and Not I, and 100 μl of the enzyme digestion system was as follows: 40 μl of PCR product of SOMA1 (SOMA1-B1, SOMA1-B2, SOMA1-B3), 10×H buffer 10 μl, 10×BSA 10 μl, Eco R I 5 μl, Not I 5 μl, ddH2O 30 μl. After 4 h of enzyme digestion at 37℃, the fragments were recovered by agarose gel electrophoresis.

[0048] The expression vector pPIC9K was single-digested with restriction enzyme Eco R I, and 100 μl of the enzyme digestion system was as follows: 20 μl of expression vector pPIC9K, 10×H buffer 10 μl, Eco R I 5 μl, ddH2O 65 μl. After 4 h of enzyme digestion at 37℃, the fragments were recovered by agarose gel electrophoresis. The recovered fragments were single-digested with restriction enzyme Not I, and 100 μl of the enzyme digestion system was as follows: 20 μl of pPIC9K recovered fragments, 10×H buffer 10 μl, 10×BSA 10 μl, 10×Triton 10 μl, Not I 5 μl, ddH2O 45 μl. After 4 h of enzyme digestion at 37℃, the fragments were recovered by agarose gel electrophoresis.

[0049] The recovered fragments were ligated with T4 DNA ligase, and 10 μl of the ligation system was as follows: 1 μl of SOMA1 (SOMA1-B1, SOMA1-B2, SOMA1-B3) recovered fragments, 1 μl of pPIC9K recovered fragments, 1 μl of T4 DNA ligase, 7 μl of ddH2O. Eco R I and NotIThe SOMA1 fragment, SOMA1-B1 fragment, SOMA1-B2 fragment and SOMA1-B3 fragment digested by double enzymes were respectively connected with the expression vector pPIC9K digested by the same enzymes to construct the recombinant expression plasmids pPIC9K-SOMA1, pPIC9K-SOMA1-B1, pPIC9K-SOMA1-B2 and pPIC9K-SOMA1-B3.The connection system was as follows: 5 μl of the double enzyme digestion product of the expression vector pPIC9K, 3 μl of the double enzyme digestion product of the SOMA1 (SOMA1-B1, SOMA1-B2 and SOMA1-B3) gene, 1 μl of 10×T4 ligase buffer and 1 μl of T4 ligase.The connection was carried out at 22 ℃ overnight, and the transformants were transformed into E. coli DH5α, and the transformants were picked and sequenced to verify.The transformants correctly verified by sequencing were transferred into LB+Amp liquid medium, and cultured at 37 ℃ overnight, and the plasmids were extracted, which were the recombinant yeast expression plasmids pPIC9K-SOMA1 (pPIC9K-SOMA1-B1, pPIC9K-SOMA1-B2 and pPIC9K-SOMA1-B3).

[0050] 2. Transformation and screening

[0051] The recombinant yeast expression plasmids pPIC9K-SOMA1, pPIC9K-SOMA1-B1, pPIC9K-SOMA1-B2 and pPIC9K-SOMA1-B3 were respectively linearized, and the linearized products were purified by a column purification kit, and then transformed into Pichia pastoris GS115 by electroporation, and coated on MD plates.The colonies grown on the MD plates were Pichia pastoris engineering strains, which were then coated on YPD plates containing different concentrations of geneticin G418 to screen the multi-copy transformants. Sal IThe recombinant yeast expression plasmids pPIC9K-SOMA1, pPIC9K-SOMA1-B1, pPIC9K-SOMA1-B2 and pPIC9K-SOMA1-B3 were respectively linearized, and the linearized products were purified by a column purification kit, and then transformed into Pichia pastoris GS115 by electroporation, and coated on MD plates.The colonies grown on the MD plates were Pichia pastoris engineering strains, which were then coated on YPD plates containing different concentrations of geneticin G418 to screen the multi-copy transformants.

[0052] 3. Shake flask fermentation verification

[0053] The single multi-copy transformants were respectively inoculated into BMGY medium, and cultured at 30 ℃ with 220 rpm shaking for 24 hours, and then transferred into BMMY medium, and cultured at 30 ℃ with 220 rpm shaking, and 0.5% methanol was added every 24 hours.The supernatant was subjected to sweet protein activity determination after the expression was induced for 4 days.

[0054] The results showed that the sweetness of the SOMA1 in the transformant reached 500 times that of the standard sucrose, and the protein content was 0.50 g / l, and the transformant was numbered as SOMA1-15.

[0055] The sweetness of the SOMA1-B1 reached 800 times that of the standard sucrose, and the protein content was 0.48 g / l, and the transformant was numbered as SOMA1-B1-48.

[0056] SOMA1-B2 has a sweetness of up to 1200 times of the standard sucrose, and the protein content is 0.53 g / l, and the transformant is numbered as SOMA1-B2-12;

[0057] SOMA1-B3 has a sweetness of up to 1500 times of the standard sucrose, and the protein content is 0.49 g / l, and the transformant is numbered as SOMA1-B3-44.

[0058] The above results show that the sweetness of the somatin mutants SOMA1-B1, SOMA1-B2 and SOMA1-B3 provided by the present application is increased by 60%, 140% and 200% respectively after expression in Pichia pastoris, which achieves an unexpected technical effect.

[0059] I. Sweetness detection method of sweet protein

[0060] The sweetness of the sweet protein is identified by a blind test. The control group of the blind test uses 10% sucrose aqueous solution, and the sample to be detected is prepared into different concentration gradients and randomly numbered. A 10-person evaluation team tastes the sample to determine the sample with the same or similar sweetness as the 10% sucrose aqueous solution in different concentration gradients, so as to calculate the sweetness of the sample.

[0061] The formula is: relative sucrose sweetness multiple = 10 x dilution multiple.

[0062] Preparation of sweet protein samples with different concentration gradients: 1.0 g of sweet protein sample is weighed and diluted with distilled water to 100 ml to obtain a 1.0% sample solution; 1.0% sample solution is weighed and further diluted with distilled water to obtain a sample solution with different dilution multiples of 2, 4, 6, 8, 10, 20, 50, 100, 200 and 300.

[0063] II. Detection of protein content by Coomassie brilliant blue method

[0064] 1. Reagents

[0065] (1) Coomassie brilliant blue G-250 staining solution: 100 mg of Coomassie brilliant blue G-250 is dissolved in 50 ml of 95% ethanol, 100 ml of 85% phosphoric acid is added, and water is added to dilute to 1 liter. It can be used at room temperature for 1 month;

[0066] (2) Standard protein solution: bovine serum albumin is used to determine the protein content by micro-Kjeldahl method in advance. According to its purity, a 1 mg / ml protein standard solution is prepared;

[0067] (3) Preparation of standard stock solution: 0.05 g of crystalline bovine serum albumin was accurately weighed on an analytical balance, dissolved in a small beaker with a small amount of distilled water, and then transferred to a 50 ml volumetric flask. The residue in the beaker was rinsed several times with a small amount of distilled water, and the rinse was also poured into the volumetric flask. Finally, the volume was adjusted to the mark with distilled water. The standard stock solution was prepared, with a bovine serum albumin concentration of 1000 μg / ml.

[0068] 2. Preparation of standard curve.

[0069] (1) Take 6 test tubes, number them, and add reagents according to the table below, mix well.

[0070] Tube No. 1 2 3 4 5 6 Sample (ml) 0 0.1 0.2 0.3 0.4 0.5 Water (ml) 2.0 1.9 1.8 1.7 1.6 1.5 Protein content (mg / ml) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 0 0.05 0.1 0.15 0.2 0.25

[0071] Accurately pipette 2.5 ml of Coomassie brilliant blue solution into 6 clean test tubes, accurately pipette 0.1 ml of each of the above solutions into the corresponding numbered test tubes, vortex mix, and let stand at room temperature for 5 min. Adjust the zero with test tube No. 1, measure the colorimetric value at 595 nm, and record the absorbance value.

[0072] (2) Draw the standard curve: record the absorbance values of tubes 1-6, with protein content (μg) as the abscissa and absorbance as the ordinate, and draw the standard curve. Note that the colorimetric cup must be washed clean because Coomassie brilliant blue has strong staining ability. Do not use a quartz cup for measurement.

[0073] 3. Sample determination

[0074] Sample preparation:

[0075] (1) Liquid sample: Dilute the sample to be tested to a protein content of 0.1-0.3 mg / ml, control the absorbance value after removing the blank (after subtracting the blank) to be between 0.2-0.4;

[0076] (2) Solid sample: Accurately weigh 1.0000 g of sample into a 100 ml triangular flask, add 20 ml of deionized water with a pipette, magnetically stir for 10 min, centrifuge at 4000 rpm for 10 min, take the supernatant for further dilution to determine the protein content, and refer to the liquid sample for dilution method.

[0077] Sample detection:

[0078] Take clean test tubes, add 2.5 ml of Coomassie brilliant blue solution, then add the sample to be tested, vortex shake, and let stand at room temperature for 5 min. Use the standard curve blank as a control, use a 1 cm light path microcuvette to measure the absorbance at 595 nm, and calculate the protein content according to the standard curve.

[0079] 4. Protein content calculation

[0080] Protein content = X * dilution factor * standard sample conversion coefficient.

[0081] X: Protein content (mg / ml) calculated according to the calibration curve;

[0082] Calibration value: The calibration sample is 47 mg / ml, and a coefficient is calculated according to the measured value.

[0083] The somatin mutant provided by the application can be widely applied as a sweetener in the fields of feed, food processing and the like, and has a wide application prospect. SEQUENCE LISTING <110> Weifang Kangdien Biotechnology Co., Ltd. Qingdao Blue Bio Group Co., Ltd. <120> A somatin mutant and application thereof <160> 8 <170> SIPOSequenceListing 1.0 <210> 1 <211> 213 <212> PRT <213> Artificial Sequence (Artificial Sequence) <400> 1 Ala Thr Phe Glu Ile Val Asn Arg Cys Ser Tyr Thr Val Trp Ala Ala 1 5 10 15 Ala Ser Lys Gly Asp Ala Ala Leu Asp Ala Gly Gly Arg Gin Leu Asn 20 25 30 Ser Gly Glu Ser Trp Thr Ile Asn Val Glu Pro Gly Thr Asn Gly Gly 35 40 45 Lys Ile Trp Ala Arg Thr Asp Cys Tyr Phe Asp Asp Ser Gly Ser Gly 50 55 60 Ile Cys Lys Thr Gly Asp Cys Gly Gly Leu Leu Arg Cys Lys Arg Phe 65 70 75 80 Gly Arg Pro Pro Thr Thr Leu Ala Glu Phe Ser Leu Asn Gin Tyr Gly 85 90 95 Lys Asp Tyr He Asp He Ser Asn He Lys Gly Phe Asn Val Pro Met 100 105 110 Asp Phe Ser Pro Thr Thr Arg Gly Cys Arg Gly Val Arg Cys Ala Ala 115 120 125 Asp He Val Gly Gin Cys Pro Ala Lys Leu Lys Ala Pro Gly Gly Gly 130 135 140 Cys Asn Asp Ala Cys Thr Val Phe Gin Thr Ser Glu Tyr Cys Cys Thr 145 150 155 160 Thr Gly Lys Cys Gly Pro Thr Glu Tyr Ser Arg Phe Phe Lys Arg Leu 165 170 175 Cys Pro Asp Ala Phe Ser Tyr Val Leu Asp Lys Pro Thr Thr Val Thr 180 185 190 Cys Pro Gly Ser Ser Asn Tyr Arg Val Thr Phe Cys Pro Thr Ala Leu 195 200 205 Glu Leu Glu Asp Glu 210 <210> 2 <211> 645 <212> DNA <213> Artificial Sequence <400> 2 gctactttcg agatcgttaa cagatgctcc tacactgttt gggctgctgc ttctaagggt 60 gatgctgctt tagatgctgg tggtagacaa ttgaactctg gtgagtcctg gactatcaac 120 gtcgagccag gtactaatgg tggtaagatc tgggctagaa ccgactgtta cttcgacgat 180 tctggttccg gtatctgtaa gactggtgac tgtggtggtt tgctgagatg caagagattt 240 ggtagaccac caactacctt ggccgagttc tccttgaatc aatacggtaa ggactacatc 300 gacatctcca acatcaaggg tttcaacgtc ccaatggact tctccccaac tactcgtggt 360 tgtagaggtg ttagatgtgc tgccgatatc gttggtcaat gtccagctaa gttgaaggct 420 ccaggtggtg gttgtaacga cgcttgtact gttttccaga cctccgagta ctgttgtacc 480 actggtaagt gtggtccaac tgagtactcc agattcttca agagattgtg cccagacgcc 540 ttctcctacg ttttggataa gccaactacc gtcacttgtc caggttcctc caactacaga 600 gttaccttct gtccaactgc cttggaattg gaggatgaat gataa 645 <210> 3 <211> 213 <212> PRT <213> Artificial Sequence <400> 3 Ala Thr Phe Glu Ile Val Asn Arg Cys Ser Tyr Thr Val Trp Ala Ala 1 5 10 15 Ala Ser Lys Gly Asp Ala Ala Leu Asp Ala Gly Ala Arg Gln Leu Asn 20 25 30 Ser Gly Glu Ser Trp Thr Ile Asn Val Glu Pro Gly Thr Asn Gly Gly 35 40 45 Lys Ile Trp Ala Arg Thr Asp Cys Tyr Phe Asp Asp Ser Gly Ser Gly 50 55 60 Ile Cys Lys Thr Gly Asp Cys Gly Gly Leu Leu Arg Cys Lys Arg Phe 65 70 75 80 Gly Arg Pro Pro Thr Thr Leu Ala Glu Phe Ser Leu Asn Gln Tyr Gly 85 90 95 Lys Asp Tyr Ile Asp Ile Ser Asn Ile Lys Gly Phe Asn Val Pro Met 100 105 110 Asp Phe Ser Pro Thr Thr Arg Gly Cys Arg Gly Val Arg Cys Ala Ala 115 120 125 Asp Ile Val Gly Gln Cys Pro Ala Lys Leu Lys Ala Pro Gly Gly Gly 130 135 140 Cys Asn Asp Ala Cys Thr Val Phe Gln Thr Ser Glu Tyr Cys Cys Thr 145 150 155 160 Thr Gly Lys Cys Gly Pro Thr Glu Tyr Ser Arg Phe Phe Lys Arg Leu 165 170 175 Cys Pro Asp Ala Phe Ser Tyr Val Leu Asp Lys Pro Thr Thr Val Thr 180 185 190 Cys Pro Gly Ser Ser Asn Tyr Arg Val Thr Phe Cys Pro Thr Ala Leu 195 200 205 Glu Leu Glu Asp Glu 210 <210> 4 <211> 645 <212> DNA <213> Artificial Sequence <400> 4 gctactttcg agatcgttaa cagatgctcc tacactgttt gggctgctgc ttctaagggt 60 gatgctgctt tagatgctgg tgctagacaa ttgaactctg gtgagtcctg gactatcaac 120 gtcgagccag gtactaatgg tggtaagatc tgggctagaa ccgactgtta cttcgacgat 180 tctggttccg gtatctgtaa gactggtgac tgtggtggtt tgctgagatg caagagattt 240 ggtagaccac caactacctt ggccgagttc tccttgaatc aatacggtaa ggactacatc 300 gacatctcca acatcaaggg tttcaacgtc ccaatggact tctccccaac tactcgtggt 360 tgtagaggtg ttagatgtgc tgccgatatc gttggtcaat gtccagctaa gttgaaggct 420 ccaggtggtg gttgtaacga cgcttgtact gttttccaga cctccgagta ctgttgtacc 480 actggtaagt gtggtccaac tgagtactcc agattcttca agagattgtg cccagacgcc 540 ttctcctacg ttttggataa gccaactacc gtcacttgtc caggttcctc caactacaga 600 gttaccttct gtccaactgc cttggaattg gaggatgaat gataa 645 <210> 5 <211> 213 <212> PRT <213> 人工序列(Artificial Sequence) <400> 5 Ala Thr Phe Glu Ile Val Asn Arg Cys Ser Tyr Thr Val Trp Ala Ala 1 5 10 15 Ala Ser Lys Gly Asp Ala Ala Leu Asp Ala Gly Ala Arg Gln Leu Asn 20 25 30 Ser Gly Glu Ser Trp Thr Ile Asn Val Glu Pro Gly Thr Asn Gly Gly 35 40 45 Lys Ile Trp Ala Arg Thr Asp Cys Tyr Phe Asp Asp Ser Gly Ser Gly 50 55 60 Ile Cys Lys Thr Gly Asp Cys Gly Gly Leu Leu Arg Cys Lys Arg Phe 65 70 75 80 Gly Arg Pro Pro Thr Thr Leu Ala Glu Phe Ser Leu Asn Gin Tyr Gly 85 90 95 Lys Asp Tyr He Asp He Ser Asn He Lys Gly Phe Asn Val Pro Met 100 105 110 Asp Phe Ser Pro Thr Thr Arg Gly Cys Arg Gly Val Arg Cys Ala Ala 115 120 125 Asp He Val Gly Ser Cys Pro Ala Lys Leu Lys Ala Pro Gly Gly Gly 130 135 140 Cys Asn Asp Ala Cys Thr Val Phe Gin Thr Ser Glu Tyr Cys Cys Thr 145 150 155 160 Thr Gly Lys Cys Gly Pro Thr Glu Tyr Ser Arg Phe Phe Lys Arg Leu 165 170 175 Cys Pro Asp Ala Phe Ser Tyr Val Leu Asp Lys Pro Thr Thr Val Thr 180 185 190 Cys Pro Gly Ser Ser Asn Tyr Arg Val Thr Phe Cys Pro Thr Ala Leu 195 200 205 Glu Leu Glu Asp Glu 210 <210> 6 <211> 645 <212> DNA <213> Artificial Sequence <400> 6 gctactttcg agatcgttaa cagatgctcc tacactgttt gggctgctgc ttctaagggt 60 gatgctgctt tagatgctgg tgctagacaa ttgaactctg gtgagtcctg gactatcaac 120 gtcgagccag gtactaatgg tggtaagatc tgggctagaa ccgactgtta cttcgacgat 180 tctggttccg gtatctgtaa gactggtgac tgtggtggtt tgctgagatg caagagattt 240 ggtagaccac caactacctt ggccgagttc tccttgaatc aatacggtaa ggactacatc 300 gacatctcca acatcaaggg tttcaacgtc ccaatggact tctccccaac tactcgtggt 360 tgtagaggtg ttagatgtgc tgccgatatc gttggttctt gtccagctaa gttgaaggct 420 ccaggtggtg gttgtaacga cgcttgtact gttttccaga cctccgagta ctgttgtacc 480 actggtaagt gtggtccaac tgagtactcc agattcttca agagattgtg cccagacgcc 540 ttctcctacg ttttggataa gccaactacc gtcacttgtc caggttcctc caactacaga 600 gttaccttct gtccaactgc cttggaattg gaggatgaat gataa 645 <210> 7 <211> 213 <212> PRT <213> Artificial Sequence <400> 7 Ala Thr Phe Glu Ile Val Asn Arg Cys Ser Tyr Thr Val Trp Ala Ala 1 5 10 15 Ala Ser Lys Gly Asp Ala Ala Leu Asp Ala Gly Ala Arg Gln Leu Asn 20 25 30 Ser Gly Glu Ser Trp Thr Ile Asn Val Glu Pro Gly Thr Asn Gly Gly 35 40 45 Lys Ile Trp Ala Arg Thr Asp Cys Tyr Phe Asp Asp Ser Gly Ser Gly 50 55 60 Ile Cys Lys Thr Gly Asp Cys Gly Gly Leu Leu Arg Cys Lys Arg Phe 65 70 75 80 Gly Arg Pro Pro Thr Thr Leu Ala Glu Phe Ser Leu Asn Gln Tyr Gly 85 90 95 Lys Asp Tyr Ile Asp Ile Ser Asn Ile Lys Gly Phe Asn Val Pro Met 100 105 110 Asp Phe Ser Pro Thr Thr Arg Gly Cys Arg Gly Val Arg Cys Ala Ala 115 120 125 Asp Ile Val Gly Ser Cys Pro Ala Lys Leu Lys Ala Pro Gly Gly Gly 130 135 140 Cys Asn Asp Ala Cys Thr Val Phe Gln Thr Ser Glu Tyr Cys Cys Thr 145 150 155 160 Thr Gly Lys Cys Gly Pro Thr Glu Tyr Ser Arg Phe Phe Val Arg Leu 165 170 175 Cys Pro Asp Ala Phe Ser Tyr Val Leu Asp Lys Pro Thr Thr Val Thr 180 185 190 Cys Pro Gly Ser Ser Asn Tyr Arg Val Thr Phe Cys Pro Thr Ala Leu 195 200 205 Glu Leu Glu Asp Glu 210 <210> 8 <211> 645 <212> DNA <213> Artificial Sequence <400> 8 gctactttcg agatcgttaa cagatgctcc tacactgttt gggctgctgc ttctaagggt 60 gatgctgctt tagatgctgg tgctagacaa ttgaactctg gtgagtcctg gactatcaac 120 gtcgagccag gtactaatgg tggtaagatc tgggctagaa ccgactgtta cttcgacgat 180 tctggttccg gtatctgtaa gactggtgac tgtggtggtt tgctgagatg caagagattt 240 ggtagaccac caactacctt ggccgagttc tccttgaatc aatacggtaa ggactacatc 300 gacatctcca acatcaaggg tttcaacgtc ccaatggact tctccccaac tactcgtggt 360 TGGAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT 66 CCTGGAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT 66 CCTGGAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT 66 CCTGGAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT 66 CCTGGAGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGTGGT 66

Claims

1. A thaumatin mutant, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO: 3 or SEQ ID NO: 5 or SEQ ID NO:

7.

2. The mutant according to claim 1, wherein The encoding nucleotide sequence of the mutant is shown in SEQ ID NO: 4 or SEQ ID NO: 6 or SEQ ID NO:

8.

3. A recombinant expression plasmid, characterized in that: The plasmid carries the nucleotide sequence encoding the mutant according to claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. Use of the thaumatin mutant according to claim 1 as a sweetener in feed or food processing.