Acetyl-coa acetyltransferase mutants and uses thereof

Abstract

The application provides an acetyl-CoA acetyltransferase mutant and application thereof. The acetyl-CoA acetyltransferase mutant comprises a mutation of the 377th amino acid of acetyl-CoA acetyltransferase from T to any amino acid; the any amino acid does not include T. The application can reasonably enhance the metabolic flow capacity of the central metabolic pathway, and further improve the yield and conversion rate of glutamic acid by weakening or knocking out the acetyl-CoA acetyltransferase gene, especially by mutating the 377th amino acid of acetyl-CoA acetyltransferase into an amino acid other than threonine, while the growth performance of the strain is ensured. The application also provides a recombinant microorganism with weakened or knocked out acetyl-CoA acetyltransferase gene, and the glutamic acid fermentation production performance of the recombinant microorganism is significantly improved, the yield and sugar acid conversion rate of glutamic acid are high, and the growth performance of the strain is good, which provides a powerful tool for large-scale industrial production of glutamic acid.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more specifically, to acetyl-CoA acetyltransferase mutants and their applications. Background Technology

[0002] L-glutamate, chemically known as α-aminoglutarate, has the molecular formula C5H9NO4 and a molecular weight of 147.13076 Da. It is an acidic amino acid containing two carboxyl groups. Glutamate is one of the most abundant amino acids, playing a crucial role not only in protein synthesis but also in nutrition and signal transduction. Glutamate or its monosodium salt (MSG) can be used as a food additive to enhance the umami flavor of food, and is therefore widely produced industrially. Currently, the most common production method for glutamate is fermentation. Compared to the complexity of enzymatic and chemical synthesis processes and the toxicity of raw materials, fermentation offers advantages such as safer raw material sources, lower production costs, and a single product.

[0003] Although research on fermentation for glutamic acid production has been developing for decades, the production performance of glutamic acid strains still needs further improvement. This restricts the large-scale industrial production of glutamic acid and is not conducive to saving production costs. Summary of the Invention

[0004] The purpose of this invention is to provide acetyl-CoA acetyltransferase mutants and their applications.

[0005] Another objective of this invention is to provide a genetically engineered bacterium that produces amino acids (especially Corynebacterium glutamicum, which produces glutamic acid), its construction method, and its application.

[0006] To achieve the objective of this invention, in a first aspect, this invention provides an acetyl-CoA acetyltransferase mutant, wherein the mutant comprises a mutation in the 377th amino acid of acetyl-CoA acetyltransferase from T to any amino acid; wherein the arbitrary amino acid does not include T.

[0007] Preferably, the mutant contains a mutation in which the 377th amino acid of acetyl-CoA acetyltransferase is changed from T to A or E.

[0008] In this invention, acetyl-CoA acetyltransferase is derived from Corynebacterium glutamicum, whose reference sequence number on NCBI is WP_065532577.1 (SEQ ID NO:1).

[0009] In a second aspect, the present invention provides a nucleic acid molecule (SEQ ID NO:2) encoding the acetyl-CoA acetyltransferase mutant.

[0010] Thirdly, the present invention provides biological materials containing the nucleic acid molecules, including but not limited to recombinant DNA, expression cassettes, transposons, plasmid vectors, viral vectors, engineered bacteria, or transgenic cell lines.

[0011] Fourthly, the present invention provides any of the following applications of the nucleic acid molecule or biological materials containing the nucleic acid molecule:

[0012] (1) Used in the fermentation production of amino acids;

[0013] (2) Used to increase the fermentation yield of amino acids;

[0014] (3) Used to construct genetically engineered bacteria that produce amino acids.

[0015] In this invention, the amino acids include glutamic acid-like amino acids, such as glutamic acid, glutamine, proline, and arginine.

[0016] Fifthly, the present invention provides a method for constructing a genetically engineered bacterium that produces amino acids. By using genetic engineering techniques, mutations are introduced into the genome of a bacterium capable of producing amino acids, so that the acetyl-CoA acetyltransferase (SEQ ID NO:1) it encodes contains a T377A or T377E mutation site.

[0017] Preferably, the bacteria can be species of Escherichia, Corynebacterium, or Bacillus.

[0018] More preferably, the bacteria is Corynebacterium glutamicum.

[0019] In one specific embodiment of the present invention, the Corynebacterium glutamicum is strain MHZ-0112-8 (accession number CGMCC No. 11941), see ZL201610119402.2.

[0020] In another specific embodiment of the present invention, the Corynebacterium glutamicum is strain MHZ-0701 (accession number CGMCC No. 13757), see ZL201710385500.5.

[0021] When the mutation site is T377A, the strain construction method includes the following steps:

[0022] A. Using Phusion superfidelity polymerase, with the genome of Corynebacterium glutamicum MHZ-0112-8 as a template, and UP-1F and T377A-UP-1R, T377A-DN-2F and DN-2R as primers, PCR amplification was performed to obtain recombinant fragment UP and recombinant fragment DN, respectively; then, using UP and DN as templates, and UP-1F and DN-2R as primers, homologous recombination fragments were obtained by PCR amplification.

[0023] B. The obtained homologous recombination fragment was digested with enzymes XbaI and PstI. Simultaneously, plasmid pK18-mobsacB (purchased from Wuhan Miaoling Biotechnology Co., Ltd.) was digested with enzymes XbaI and PstI, ligated with T4 DNA ligase, transformed into competent E. coli cells, and positive clones were screened. The plasmid was named pK18-BBD29_11410. T377A Then pK18-BBD29_11410 T377A Transformed into Corynebacterium glutamicum MHZ-0112-8 and screened for positive transformants;

[0024] The primer sequences used are as follows:

[0025] UP-1F: 5′-CGTCCCTGCCAAGAAGCGCGG-3′

[0026] T377A-UP-1R: 5′-TTTCACGCTGCATGCGGTGAGCCAAGGTTACTGCCATGCG-3′

[0027] T377A-DN-2F: 5′-CGCATGGCAGTAACCTTGGCTCACCGCATGCAGCGTGAAA-3′

[0028] DN-2R: 5′-CCAGTGCCGTTTTCGCGGCA-3′.

[0029] In a sixth aspect, the present invention provides an amino acid-producing genetically engineered bacterium constructed according to the above method.

[0030] In a seventh aspect, the present invention provides the application of genetically engineered bacteria constructed according to the above method in the fermentation production of amino acids (including glutamic acid, glutamine, proline, and arginine) or in increasing the fermentation yield of amino acids.

[0031] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0032] This invention weakens or knocks out the acetyl-CoA acetyltransferase gene, specifically by mutating amino acid position 377 of acetyl-CoA acetyltransferase to an amino acid other than threonine. This effectively enhances the metabolic flux of the central metabolic pathway, thereby increasing glutamate yield and conversion rate while maintaining the growth performance of the strain. This invention also provides recombinant microorganisms with weakened or knocked-out acetyl-CoA acetyltransferase genes (i.e., the BBD29_11410 gene). These recombinant microorganisms exhibit significantly improved glutamate fermentation production performance, with higher glutamate yield and sugar-acid conversion rate, while maintaining good strain growth performance.

[0033] Using MHZ-0112-8 as the starting strain, the BBD29_11410 gene was modified by T377A point mutation, which increased the glutamic acid conversion rate from 53.3% to 57.0%, an increase of 3.7 percentage points compared with the starting strain. Detailed Implementation

[0034] This invention provides a method for improving the fermentation production capacity of L-glutamic acid amino acids, especially L-glutamic acid.

[0035] The present invention adopts the following technical solution:

[0036] This invention provides a mutant BBD29_11410 protein (i.e., an acetyl-CoA acetyltransferase mutant), wherein the threonine at position 377 of the protein encoded by the BBD29_11410 gene (i.e., the acetyl-CoA acetyltransferase gene) is mutated to alanine or glutamic acid.

[0037] The present invention also provides a DNA molecule encoding the aforementioned BBD29_11410 protein variant (containing the T377A mutation site), wherein the DNA molecule refers to a mutation in the 1129th base of the BBD29_11410 gene where A is mutated to G. Specifically, the nucleotide sequence of the DNA molecule is shown in SEQ ID NO:2.

[0038] The present invention also provides an amino acid sequence with equivalent function formed by replacing, deleting, or adding one or more amino acids to the amino acid sequence shown in SEQ ID NO:1.

[0039] The present invention also provides a recombinant strain of Corynebacterium glutamicum, which is obtained by expressing the above-mentioned DNA molecule in a glutamate-producing / proline-producing bacterium; wherein the glutamate-producing bacterium is MHZ-0112-8 and the proline-producing bacterium is MHZ-0701.

[0040] The present invention also provides a method for constructing the above-mentioned recombinant strain of Corynebacterium glutamicum, comprising:

[0041] (1) Construct a recombinant plasmid in which the threonine at position 377 of the protein encoded by the BBD29_11410 gene is mutated to alanine;

[0042] (2) Transform the recombinant plasmid into Corynebacterium glutamate, screen the transformants with kanamycin-containing selective medium, and culture the screened transformants in liquid brain heart extract medium.

[0043] (3) After dilution, the culture was spread on a solid brain heart extract medium containing 10% sucrose and cultured to obtain recombinant strains.

[0044] Specifically, the construction method includes:

[0045] (1) Construct a recombinant plasmid pK18-BBD29_11410(T377A) with a threonine mutation at position 377 of the protein encoded by the BBD29_11410 gene to alanine;

[0046] (2) Transform the recombinant plasmid into Corynebacterium glutamate, screen the transformants with selective medium containing 15 mg / L kanamycin, and culture the screened transformants overnight in liquid brain heart extract medium at 31.5℃ and 220 rpm with shaking.

[0047] (3) After dilution, the culture was spread on a solid brain heart extract medium containing 10% sucrose and incubated at 31.5℃ for 36 hours to obtain the recombinant strain.

[0048] In one specific embodiment of the present invention, the starting strain is *Corynebacterium glutamicum* MHZ-0112-8 with accession number CGMCC No. 11941. A pure culture of *Corynebacterium glutamicum* MHZ-0112-8 was deposited on December 25, 2015, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), with accession number CGMCC No. 11941. *Corynebacterium glutamicum* MHZ-0112-8 (CGMCC No. 11941) has been disclosed in ZL201610119402.2.

[0049] The originating strain MHZ-0701 is *Corynebacterium glutamicum*. A pure culture of *Corynebacterium glutamicum* MHZ-0701 was deposited on March 15, 2017, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), with accession number CGMCC No. 13757. The *Corynebacterium glutamicum* MHZ-0701 (CGMCC No. 13757) mentioned in this invention has been disclosed in ZL201710385500.5.

[0050] It should be understood that the present invention also provides the application of the above-mentioned recombinant strain of Corynebacterium glutamicum in the fermentation production of glutamic acid or proline.

[0051] Furthermore, the present invention provides a method for producing glutamic acid, comprising:

[0052] The above-mentioned recombinant strain of Corynebacterium glutamicum was inoculated into slant culture medium for slant culture. The bacterial growth on the slant culture medium was picked and inoculated into seed culture medium for seed culture. The seed culture was then transferred into fermentation medium for fermentation.

[0053] In the glutamic acid fermentation production method provided by this invention, the slant culture medium used is: yeast powder 5g / L, beef extract 10g / L, peptone 10g / L, sodium chloride 10g / L, agar powder 2.5g / L, pH 7.0-7.2.

[0054] The seed culture medium used was: glucose 25 g / L, urea 3.0 g / L, K2HPO4·3H2O 2.2 g / L, MgSO4·7H2O 0.9 g / L, corn steep liquor 33 mL / L, soybean meal hydrolysate 22 mL / L, pH 7.0-7.2.

[0055] The fermentation medium used was: glucose 60 g / L, ammonium sulfate 15 g / L, KH2PO4 1.0 g / L, MgSO4·7H2O 0.4 g / L, FeSO4·7H2O 1.0 mg / L, MnSO4·5H2O 1.0 mg / L, VB1 200 μg / L, biotin 300 μg / L, soybean hydrolysate 0.48 g / L, pH 7.2-7.5.

[0056] The seed culture method includes: shaking culture at 31.5℃ and 220rpm until the mid-to-late logarithmic growth stage, with a culture time of 10-14h.

[0057] Fermentation culture methods include: shaking culture at 31.5℃ and 220rpm for 12-20h.

[0058] In the proline fermentation production method provided by this invention, the seed activation culture medium used is: 1% yeast extract, 1% peptone, 0.5% sodium chloride, 0.5% glucose, 2% agar, pH 7.2.

[0059] The seed culture medium used was: corn steep liquor 2.5%, glucose 1.0%, ammonium sulfate 0.4%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.1%, urea 0.1%, CaCO3 0.5%, pH 7.2.

[0060] The fermentation medium used was: corn steep liquor 0.6%, glucose 12.0%, ammonium sulfate 3.7%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.1%, CaCO3 4%, VH 70μg / L, VB1·HCl 80μg / L, pH 7.2.

[0061] The fermentation culture method includes: shaking culture at 33℃ and 220r / min for 72h.

[0062] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples are conducted under conventional experimental conditions, such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001), or as recommended by the manufacturer's instructions.

[0063] The primer sequences used in the following examples are shown in Table 1.

[0064] Table 1 Primer sequences

[0065] UP-1F CGTCCCTGCCAAGAAGCGCGG T377A-UP-1R TTTCACGCTGCATGCGGTGAGCCAAGGTTACTGCCATGCG T377A-DN-2F CGCATGGCAGTAACCTTGGCTCACCGCATGCAGCGTGAAA T377E-UP-1R TTTCACGCTGCATGCGGTGAGACAAGGTTACTGCCATGCG T377E-DN-2F CGCATGGCAGTAACCTTGTCTCACCGCATGCAGCGTGAAA DN-2R CCAGTGCCGTTTTCGCGGCA T377A-identification-F CGCATGGCAGTAACCTTGG T377E-identification-F CGCATGGCAGTAACCTTGT ID-F CTGCGTCGCGAATACGGCAT ID-R AGCGCGTAACCCTCAGATGG P82 CTCGTATGTTGTGTGGAATTGTG P85 CGCCCTGAGTGCTTGCGGCA

[0066] Example 1: Recombinant plasmid pK18-BBD29_11410 T377A Construction and introduction of mutations into MHZ-0112-8 strain

[0067] Primers were designed based on the sequence of the BBD29_11410 gene in the NCBI database, and the primer sequences are shown in Table 1. Using Phusion ultrafidelity polymerase (New England BioLabs), primer pairs UP-1F / T377A-UP-1R and T377A-DN-2F / DN-2R were used, and the genome of *Corynebacterium glutamicum* MHZ-0112-8 was used as a template to prepare recombinant fragments. The PCR program was: 98℃ denaturation for 10 s, 50℃ annealing for 20 s, 72℃ extension for 15 s, 30 cycles; and a final extension at 72℃ for 10 min. The obtained fragments were purified using an agarose gel extraction kit (Tiangen). Subsequently, using UP-1F / DN-2R as primer pairs and upstream and downstream homologous arms as templates, recombinant fragments were prepared, and the PCR program was: 98℃ denaturation for 10 s, 50℃ annealing for 20 s, 72℃ extension for 30 s, 30 cycles; and a final extension at 72℃ for 10 min. The obtained recombinant fragment was purified using an agarose gel extraction kit (Tiangen), then digested with XbaI / PstI. Simultaneously, pK18-mobsacB was digested with XbaI / PstI, and the fragment was ligated to the vector using T4 DNA ligase (TransGen Biotech). The resulting cells were transformed into Trans1T1 competent cells (TransGen Biotech). Kanamycin-resistant clones were selected, and XbaI / PstI digestion confirmed the presence of the pK18mobsacB fragment. Further sequencing (Invitrogen) confirmed the correct insertion. The resulting plasmid was named pK18-BBD29_11410. T377A .

[0068] pK18-BBD29_11410 T377AThe bacteria were transferred into Corynebacterium glutamicum MHZ-0112-8, and recombinant colonies were selected on selective medium containing 15 mg / L kanamycin. Colony PCR was performed using Fast Taq DNA polymerase (TransGen Biotech) with primer pairs UP-1F / P85 and P82 / DN-2R to identify KanR clones. The PCR program was: 94℃ for 30 s, 50℃ for 30 s, 72℃ for 45 s, for a total of 30 cycles; followed by a final extension at 72℃ for 10 min. Clones amplifying fragments of 1.2 kb and 1.1 kb, respectively, with the two primer pairs were considered positive clones. The selected positive clones were inoculated into antibiotic-free BHI medium and cultured for 12-14 hours. The bacterial culture was diluted 100-1000 times and spread on solid BHI medium containing 10% sucrose and cultured for 36 hours. The selected strains were further tested for kanamycin resistance phenotype. KanS recombinants were selected and the point mutation recombinants were verified using the identification primer pair ID-F / T377A-identification-F. By exploring the annealing temperature, recombinants containing point mutations were obtained. The obtained positive recombinants were amplified and sequenced using ID-F / ID-R. The correct recombinant was 1.2kb in length. The correctly sequenced strain was named MHZ-0112-14.

[0069] Example 2: Shake-flask verification of glutamic acid production by strain MHZ-0112-14

[0070] The recombinant Corynebacterium glutamicum MHZ-0112-14 constructed in Example 1 was fermented to verify its glutamic acid production performance, as detailed below:

[0071] The strain, frozen in glycerol tubes at -80℃, was activated by inoculating it onto agar slant medium. After culturing at 31.5℃ for 24 hours, bacterial growth occurred. Bacterial growth was picked from the freshly activated slant and inoculated into the aforementioned seed culture medium. The culture was then incubated at 31.5℃ with shaking at 220 rpm until the mid-to-late logarithmic growth stage, for 12 hours, yielding a seed culture. A 10% inoculum of this seed culture was inoculated into a 500 ml shake flask containing 20 ml of fermentation medium and incubated at 31.5℃ with shaking at 220 rpm for 16 hours. After complete sugar consumption, the concentration of L-glutamic acid accumulated in the culture medium was measured.

[0072] The culture medium formula is as follows:

[0073] Slant culture medium: yeast extract 5 g / L, beef extract 10 g / L, peptone 10 g / L, sodium chloride 10 g / L, agar powder 2.5 g / L, pH 7.0-7.2. Sterilize the prepared culture medium at 121℃ and 0.1 MPa for 30 min.

[0074] Seed culture medium: glucose 25 g / L, urea 3 g / L, K₂HPO₄·3H₂O 2.2 g / L, MgSO₄·7H₂O 0.9 g / L, corn steep liquor 33 mL / L, soybean meal hydrolysate 22 mL / L, pH 7.0-7.2. Sterilize the prepared culture medium at 121℃ and 0.1 MPa for 15 min.

[0075] Fermentation medium: glucose 60 g / L, ammonium sulfate 15 g / L, KH2PO4 1 g / L, MgSO4·7H2O 0.4 g / L, FeSO4·7H2O 1.0 mg / L, MnSO4·5H2O 1 mg / L, VB1 200 μg / L, biotin 300 μg / L, soybean hydrolysate 0.48 g / L. Adjust the pH to 7.2-7.5 with NaOH. Sterilize the prepared medium at 121℃ and 0.1 MPa for 15 min. Finally, add 1.0 g of heat-sterilized calcium carbonate.

[0076] The fermentation results are shown in Table 2, OD 600 The turbidity of the culture medium diluted 100 times at 600 nm is used to represent cell mass, and Glu (g / L) represents the amount of accumulated L-glutamate. Using MHZ-0112-8 as the starting strain, after modifying BBD29_11410 with the T377A point mutation, the glutamate conversion rate increased from 53.3% to 57.0%, a 3.7 percentage point increase compared to the starting strain.

[0077] Table 2. Detection of glutamic acid content in mutant strains.

[0078] MHZ-0112-8 0.404±0.013 32.0±0.15 53.3±0.15 MHZ-0112-14 0.395±0.025 34.2±0.06 57.0±0.21

[0079] Example 3: Recombinant plasmid pK18-BBD29_11410 T377E Construction and introduction of mutations into MHZ-0112-8 strain

[0080] Primers were designed based on the sequence of the BBD29_11410 gene in the NCBI database, and the primer sequences are shown in Table 1. Using Phusion ultrafidelity polymerase (New England BioLabs), primer pairs UP-1F / T377E-UP-1R and T377E-DN-2F / DN-2R were used. Recombinant fragments were prepared using the genome of *Corynebacterium glutamicum* MHZ-0112-8 as a template. The PCR program was: 98℃ denaturation for 10 s, 50℃ annealing for 20 s, 72℃ extension for 15 s, 30 cycles; and a final extension at 72℃ for 10 min. The obtained fragments were purified using an agarose gel extraction kit (Tiangen). Then, using UP-1F / DN-2R as primer pairs and upstream and downstream homologous arms as templates, recombinant fragments were prepared. The PCR program was: 98℃ denaturation for 10 s, 50℃ annealing for 20 s, 72℃ extension for 30 s, 30 cycles; and a final extension at 72℃ for 10 min. The obtained recombinant fragment was purified using an agarose gel extraction kit (Tiangen), then digested with XbaI / PstI. Simultaneously, pK18-mobsacB was digested with XbaI / PstI, and the fragment was ligated to the vector using T4 DNA ligase (TransGen Biotech). The ligation was performed on Trans1T1 competent cells (TransGen Biotech), and kanamycin-resistant clones were selected. XbaI / PstI digestion confirmed the presence of the pK18mobsacB fragment in the clones. Sequencing (Invitrogen) further confirmed the correct insertion. The resulting plasmid was named pK18-BBD29_11410. T377E .

[0081] pK18-BBD29_11410 T377EThe bacteria were transferred into Corynebacterium glutamicum MHZ-0112-8, and recombinant colonies were selected on selective medium containing 15 mg / L kanamycin. Colony PCR was performed using Fast Taq DNA polymerase (TransGen Biotech) with primer pairs UP-1F / P85 and P82 / DN-2R to identify KanR clones. The PCR program was: 94℃ for 30 s, 50℃ for 30 s, 72℃ for 45 s, for a total of 30 cycles; followed by a final extension at 72℃ for 10 min. Clones amplifying fragments of 1.2 kb and 1.1 kb, respectively, with the two primer pairs were considered positive clones. The selected positive clones were inoculated into antibiotic-free BHI medium and cultured for 12-14 hours. The bacterial culture was diluted 100-1000 times and spread on solid BHI medium containing 10% sucrose and cultured for 36 hours. The selected strains were further tested for kanamycin resistance phenotype. KanS recombinants were selected and the point mutation recombinants were verified using the identification primer pair ID-F / T377E-identification-F. By exploring the annealing temperature, recombinants containing point mutations were obtained. The obtained positive recombinants were amplified and sequenced using ID-F / ID-R. The correct recombinant was 1.2kb in length. The correctly sequenced strain was named MHZ-0112-15.

[0082] Example 4: Shake-flask verification of glutamic acid production by strain MHZ-0112-15

[0083] The recombinant Corynebacterium glutamicum MHZ-0112-15 constructed in Example 3 was fermented to verify its glutamic acid production performance, as detailed below:

[0084] The strain, frozen in glycerol tubes at -80℃, was activated by inoculating it onto agar slant medium. After culturing at 31.5℃ for 24 hours, bacterial growth occurred. Bacterial growth was collected from the freshly activated slant and inoculated into the aforementioned seed culture medium. The culture was then incubated at 31.5℃ with shaking at 220 rpm until the mid-to-late logarithmic growth stage, for 12 hours, yielding a seed culture. A 10% inoculum of this seed culture was then inoculated into a 500 ml shake flask containing 20 ml of fermentation medium and incubated at 31.5℃ with shaking at 220 rpm for 16 hours. After complete sugar consumption, the concentration of L-glutamic acid accumulated in the culture medium was measured.

[0085] The culture medium formula is as follows:

[0086] Slant culture medium: 5 g / L yeast extract, 10 g / L beef extract, 10 g / L peptone, 10 g / L sodium chloride, 2.5 g / L agar powder, pH 7.0-7.2. Sterilize the prepared culture medium at 121℃ and 0.1 MPa for 30 min.

[0087] Seed culture medium: glucose 25 g / L, urea 3 g / L, K2HPO4·3H2O 2.2 g / L, MgSO4·7H2O 0.9 g / L, corn steep liquor 33 mL / L, soybean meal hydrolysate 22 mL / L, pH 7.0-7.2. Sterilize the prepared culture medium at 121℃ and 0.1 MPa for 15 min.

[0088] Fermentation medium: glucose 60 g / L, ammonium sulfate 15 g / L, KH2PO4 1 g / L, MgSO4·7H2O 0.4 g / L, FeSO4·7H2O 1.0 mg / L, MnSO4·5H2O 1 mg / L, VB1 200 μg / L, biotin 300 μg / L, soybean hydrolysate 0.48 g / L, adjusted to pH 7.2-7.5 with NaOH, sterilized at 121℃ and 0.1 MPa for 15 min, and finally added 1.0 g of heat-sterilized calcium carbonate.

[0089] The fermentation results are shown in Table 3. OD 600 The turbidity of the culture medium diluted 100 times at 600 nm is used to represent cell mass, and Glu (g / L) represents the amount of accumulated L-glutamate. Using MHZ-0112-8 as the starting strain, after modifying BBD29_11410 with a T377E point mutation, the glutamate conversion rate increased from 53.3% to 59.1%, an increase of 5.8 percentage points compared to the starting strain.

[0090] Table 3. Detection of glutamic acid content in mutant strains.

[0091] MHZ-0112-8 0.404±0.013 32.0±0.15 53.3±0.15 MHZ-0112-15 0.410±0.014 35.5±0.30 59.1±0.09

[0092] Example 5: Recombinant plasmid pK18-BBD29_11410 T377A Construction and introduction of mutations into MHZ-0701 strain

[0093] Primers were designed based on the sequence of the BBD29_11410 gene in the NCBI database, and the primer sequences are shown in Table 1. Using Phusion ultrafidelity polymerase (New England BioLabs), primer pairs UP-1F / T377A-UP-1R and T377A-DN-2F / DN-2R were used. Recombinant fragments were prepared using the genome of *Corynebacterium glutamicum* MHZ-0701 as a template. The PCR program was: 98℃ denaturation for 10 s, 50℃ annealing for 20 s, 72℃ extension for 15 s, 30 cycles; and a final extension at 72℃ for 10 min. The obtained fragments were purified using an agarose gel extraction kit (Tiangen). Then, using UP-1F / DN-2R as primer pairs and upstream and downstream homologous arms as templates, recombinant fragments were prepared. The PCR program was: 98℃ denaturation for 10 s, 50℃ annealing for 20 s, 72℃ extension for 30 s, 30 cycles; and a final extension at 72℃ for 10 min. The obtained recombinant fragment was purified using an agarose gel extraction kit (Tiangen), then digested with XbaI / PstI. Simultaneously, pK18-mobsacB was digested with XbaI / PstI, and the fragment was ligated to the vector using T4 DNA ligase (TransGen Biotech). The ligation was performed on Trans1T1 competent cells (TransGen Biotech), and kanamycin-resistant clones were selected. XbaI / PstI digestion confirmed the presence of the pK18mobsacB fragment in the clones. Sequencing (Invitrogen) further confirmed the correct insertion. The resulting plasmid was named pK18-BBD29_11410. T377A .

[0094] pK18-BBD29_11410 T377AThe bacteria were transferred into Corynebacterium glutamicum MHZ-0701, and recombinant colonies were selected on selective medium containing 15 mg / L kanamycin. Colony PCR was performed using Fast Taq DNA polymerase (TransGen Biotech) with primer pairs UP-1F / P85 and P82 / DN-2R to identify KanR clones. The PCR program was: 94℃ for 30 s, 50℃ for 30 s, 72℃ for 45 s, for a total of 30 cycles; followed by a final extension at 72℃ for 10 min. Clones amplifying fragments of 1.2 kb and 1.1 kb, respectively, with the two primer pairs were considered positive clones. The selected positive clones were inoculated into antibiotic-free BHI medium and cultured for 12-14 hours. The bacterial culture was diluted 100-1000 times and spread on solid BHI medium containing 10% sucrose and cultured for 36 hours. The selected strains were further tested for kanamycin resistance phenotype. KanS recombinants were selected and the point mutation recombinants were verified using the identification primer pair ID-F / T377A-identification-F. By exploring the annealing temperature, recombinants containing point mutations were obtained. The obtained positive recombinants were amplified and sequenced using ID-F / ID-R. The correct recombinant was 1.2kb in length. The correctly sequenced strain was named MHZ-0702.

[0095] Example 6: Shake-flask verification of proline production by strain MHZ-0702

[0096] 1. Culture medium

[0097] Seed activation medium: 1% yeast extract, 1% peptone, 0.5% sodium chloride, 0.5% glucose, 2% agar, pH 7.2.

[0098] Seed culture medium: corn steep liquor 2.5%, glucose 1.0%, ammonium sulfate 0.4%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.1%, urea 0.1%, CaCO3 0.5%, pH 7.2.

[0099] Fermentation medium: corn steep liquor 0.6%, glucose 12.0%, ammonium sulfate 3.7%, magnesium sulfate 0.05%, potassium dihydrogen phosphate 0.1%, CaCO3 4%, VH 70μg / L, VB1·HCl 80μg / L, pH 7.2.

[0100] 2. Shake-flask fermentation

[0101] (1) Seed culture: Pick 1 loop of MHZ-0701 and MHZ-0702 slant seeds and inoculate them into a 500mL Erlenmeyer flask containing 20mL of seed culture medium. Culture at 33℃ and 220r / min for 16-22h with shaking.

[0102] (2) Fermentation culture: 2 mL of seed culture was inoculated into a 500 mL Erlenmeyer flask containing 20 mL of fermentation culture medium and cultured at 33 °C and 220 r / min for 72 h.

[0103] (3) Centrifuge 1 mL of fermentation broth (12000 rpm, 2 min), collect the supernatant, and use HPLC to detect the L-proline content in the fermentation broth of engineered bacteria and control bacteria. The concentrations are shown in Table 4.

[0104] Table 4. L-proline content detection

[0105] L-proline concentration g / L 37.4±0.011 41.9±0.018 Sugar-acid conversion rate % 31.16±0.014 34.91±0.026

[0106] It can be seen that the L-proline conversion rate of the starting strain MHZ-0701 was 31.16%, while that of the engineered strain MHZ-0702 was 34.91%. The conversion rate increased by 3.75 percentage points, indicating that the mutation at position 377 of the BBD29_11410 gene is beneficial to improving the proline conversion rate.

[0107] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> Li Yan <120> Acetyl-CoA acetyltransferase mutants and their applications <130> KHP211117875.3 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 408 <212> PRT <213> Corynebacterium glutamicum <400> 1 Met Asn Pro Gln Asp Ile Val Ile Cys Ser Pro Leu Arg Thr Pro Val 1 5 10 15 Gly Ala Tyr Gly Gly Ser Phe Thr Gly Val Pro Val Glu Glu Leu Ala 20 25 30 Thr Thr Val Ile Asn Ala Ile Val Glu Ala Thr Gly Ile Thr Gly Asp 35 40 45 Asp Val Asp Asp Leu Ile Leu Gly Gln Ala Ser Pro Asn Gly Ala Ala 50 55 60 Pro Ala Leu Gly Arg Val Val Ala Leu Asp Ser Lys Leu Gly Gln Asn 65 70 75 80 Val Pro Gly Met Gln Leu Asp Arg Arg Cys Gly Ser Gly Leu Gln Ala 85 90 95 Ile Val Thr Ala Ala Ala His Val Ala Ser Gly Ala Ala Asp Leu Ile 100 105 110 Val Ala Gly Gly Ala Glu Ser Met Ser Arg Val Glu Tyr Thr Val Ser 115 120 125 Gly Asp Ile Arg Trp Gly Val Lys Gly Gly Asp Met Gln Leu Arg Asp 130 135 140 Arg Leu Ala Glu Ala Arg Glu Thr Ala Gly Gly Arg Asn His Pro Ile 145 150 155 160 Pro Gly Gly Met Ile Glu Thr Ala Glu Asn Leu Arg Arg Glu Tyr Gly 165 170 175 Ile Ser Arg Glu Glu Gln Asp Lys Ile Ser Ala Ala Ser Gln Gln Arg 180 185 190 Trp Gly Lys Ala Ala Asp Ala Gly Leu Phe Asp Asp Glu Ile Val Pro 195 200 205 Val Thr Val Pro Ala Lys Lys Arg Gly Gln Glu Pro Thr Ile Val Ser 210 215 220 Arg Asp Glu His Gly Arg Pro Gly Thr Thr Val Glu Lys Leu Ala Ala 225 230 235 240 Leu Arg Pro Ile Met Gly Arg Gln Asp Ala Glu Ala Thr Val Thr Ala 245 250 255 Gly Asn Ala Ser Gly Gln Asn Asp Gly Ala Ala Ala Val Ile Val Thr 260 265 270 Thr Arg Ala Lys Ala Glu Glu Lys Gly Leu Arg Pro Val Met Arg Leu 275 280 285 Ala Gly Trp Ser Val Ala Ala Val Pro Pro Glu Thr Met Gly Ile Gly 290 295 300 Pro Val Pro Ala Thr Lys Lys Val Leu Asp Arg Leu Gly Leu Thr Leu 305 310 315 320 Glu Asp Ile Gly Ala Ile Glu Leu Asn Glu Ala Phe Ala Ala Gln Ala 325 330 335 Leu Ser Val Leu Lys Glu Trp Asn Ile Ser Trp Glu Asp Glu Arg Val 340 345 350 Asn Pro Leu Gly Ser Gly Ile Ser Met Gly His Pro Val Gly Ala Thr 355 360 365 Gly Ala Arg Met Ala Val Thr Leu Thr His Arg Met Gln Arg Glu Asn 370 375 380 Thr Gln Tyr Gly Leu Ala Thr Met Cys Ile Gly Gly Gly Gln Gly Leu 385 390 395 400 Ala Ala Val Phe Glu Lys Glu Asn 405 <210> 2 <211> 1227 <212> DNA <213> Artificial Sequence <400> 2 atgaaccctc aagatattgt catctgttcc ccattgcgca ccccagttgg tgcttacggc 60 ggatccttca ccggcgtccc tgttgaagaa ttggccacca ccgtgatcaa cgcgatcgtt 120 gaggcaaccg gcatcaccgg cgacgatgtg gacgatctga tcctcggcca ggcatccccc 180 aacggtgcgg ctccagcact gggccgtgtg gttgccttgg attccaaact tggccaaaac 240 gttccaggca tgcagcttga tcgccgctgt ggttccggcc tgcaggcaat tgtcaccgct 300 gctgcgcacg ttgcatccgg tgctgctgat ctgatcgtcg caggtggcgc ggaatccatg 360 agccgcgttg agtacaccgt gtccggcgat atccgttggg gtgtcaaggg cggcgacatg 420 cagcttcgtg accgccttgc agaagcacgc gaaaccgctg gcggacgcaa ccacccgatc 480 cccggtggca tgatcgagac cgctgagaac ctgcgtcgcg aatacggcat ctcccgcgag 540 gagcaggaca agatctccgc agcatcccag cagcgttggg gcaaggctgc tgatgcgggg 600 cttttcgacg acgagatcgt gccagtcacc gtccctgcca agaagcgcgg ccaggagcca 660 accatcgttt ctcgtgacga gcatggtcga ccaggaacaa ccgtcgaaaa gcttgctgct 720 ttgcgcccca tcatgggccg ccaggatgcg gaagcaaccg tcaccgctgg caacgcgtcc 780 ggccaaaatg atggcgctgc tgccgtcatc gtgaccactc gcgccaaggc cgaggagaag 840 ggcctgcgcc cagtcatgcg tttggctggc tggtctgtgg ctgctgttcc cccagagacc 900 atgggtattg gacctgttcc tgccaccaag aaggtcctgg atcgtttggg ccttaccctg 960 gaggacatcg gcgcgatcga actcaacgaa gctttcgcag ctcaggcact gtctgtgctc 1020 aaaggaatgga acatttcttg ggagaatgag cgcgtcaacc cactgggttc cggtatttcc 1080 atgggacacc cagtcggtgc caccggtgct cgcatggcag taaccttggc tcaccgcatg 1140 cagcgtgaaa acactcagta cggactggcc accatgtgca tcggtggcgg ccaggggctt 1200 gcagctgtct ttgaaaagga 1227

Claims

1. A method for constructing genetically engineered bacteria that produce amino acids, characterized in that, Using genetic engineering techniques, mutations were introduced into the genome of bacteria capable of producing amino acids, causing the encoded acetyl-CoA acetyltransferase to undergo only the T377E mutation; the amino acid sequence of the acetyl-CoA acetyltransferase before mutation is shown in SEQ ID NO:

1. The bacteria in question are Corynebacterium glutamicum (Bacillus glutamicum). Corynebacterium glutamicum ).

2. The method according to claim 1, characterized in that, The Corynebacterium glutamicum is strain MHZ-0112-8 or MHZ-0701; The accession number of strain MHZ-0112-8 is CGMCC No. 11941, and the accession number of strain MHZ-0701 is CGMCC No. 13757.

3. The genetically engineered bacteria that produce amino acids, constructed according to the method described in claim 1 or 2.

4. The application of the genetically engineered bacteria according to claim 3 in the fermentation production of amino acids or in increasing the fermentation yield of amino acids; in, The amino acid is glutamic acid or proline.