Two malt hexosan amylase mutants with enhanced starch hydrolysis ability, and preparation method and application thereof

Abstract

The application discloses two malt hexaose amylase mutants with enhanced starch hydrolysis ability, and a preparation method and application thereof. The amino acid sequences of the amylase mutants AmyM-A382T and AmyM-TR2 are shown in SEQ ID NO. 3 and SEQ ID NO. 4 respectively. The activity and conversion efficiency of the amylase mutant AmyM-A382T on raw starch and soluble starch are significantly improved. Compared with the amylase AmyM, the activity of AmyM-A382T is increased by 39% when soluble starch is used as a substrate, and the activity of AmyM-A382T is increased by 20-90% when raw starch of different sources is used as a substrate. The activity of the amylase mutant AmyM-TR2 on raw starch is significantly improved. Compared with the amylase AmyM, the activity of AmyM-TR2 is increased by 35-100% when raw starch of different sources is used as a substrate.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of genetic engineering and enzyme engineering, and particularly relates to two maltulose amylase mutants with enhanced starch hydrolysis ability, and a preparation method and application thereof. BACKGROUND

[0002] Starch is one of the most abundant polysaccharides in nature and is an extremely important food and industrial raw material. The preparation of starch sugar is one of the important directions of starch processing. The use of endo-acting amylase and exo-acting glucoamylase to convert starch into fermentable glucose has been widely applied in the ethanol fermentation industry. In addition, the use of enzymes such as alpha-amylase, beta-amylase, starch debranching enzyme and branching enzyme, and glycosyltransferase for catalysis has been widely concerned in the modification of starch to improve its industrial application value, enhance the nutritional quality of starch, and convert starch into high-value malt dextrin or malt oligosaccharide. Currently, commercial amylases are mainly derived from bacteria such as Bacillus and fungi such as Trichoderma and Aspergillus. In order to adapt to the high-temperature gelatinization pretreatment of starch, most industrial amylases need to have the characteristics of high temperature resistance. In order to improve the catalytic efficiency of enzymes, researchers have made various modifications to the heat resistance and catalytic activity of enzymes. However, most of them use Bacillus subtilis and Bacillus licheniformis and other bacteria, and Aspergillus-derived amylases as templates, and mainly improve the salt bridge, hydrogen bond binding force, increase the Ca 2+ binding capacity and other ways. Medium-temperature amylase is an important industrial enzyme with important application potential. It has the maximum catalytic activity in the medium-temperature range (30-60℃), and quickly inactivates when the temperature is higher than 80℃. This characteristic makes it have an important role in low-temperature and medium-temperature catalysis to reduce energy consumption, etc. At the same time, the characteristics of medium-temperature catalysis and high-temperature inactivation also make it have important application value in the baking field.

[0003] A malt hexaose amylase AmyM derived from Corallococcus sp. EGB is a mesophilic amylase capable of converting soluble starch into malt hexaose as the main product (ZL201310043628.5), which has high catalytic efficiency for both gelatinized starch and raw starch (AmyM, a Novel Maltohexaose-Forming α-Amylase from Corallococcus sp. Strain EGB. Appl Environ Microbiol, 2015, 8(6): 1977-1987; Efficient hydrolysis of raw starch by a maltohexaose-forming α-amylase from Corallococcus sp. EGB. LWT-Food Sci Technol, 2021, 152: 112361). The malt hexaose amylase AmyM can significantly improve the quality of bread and prolong the shelf life of bread in food baking, and its effect is better than that of commercial baking enzymes (Improvement of the quality and shelf life of wheat bread by malt hexaose producing α-amylase. J Cereal Sci, 2019, 87: 165-171), indicating that it has important application potential in amylase conversion and improvement of the quality of starch-based food. In order to promote the industrial application of the amylase AmyM and reduce the use cost, it is necessary to further improve the catalytic efficiency of the protein on starch. The present application uses sequence evolution analysis and domain truncation expression to obtain a variant protein with improved activity. SUMMARY

[0004] In order to improve the substrate catalytic efficiency of amylase to meet the requirements of the field of starch processing, the present application provides two mesophilic malt hexaose amylase mutants AmyM-A382T and AmyM-TR2 with enhanced starch hydrolysis capacity.

[0005] Another object of the present application is to provide the use of the mutants.

[0006] The object of the present application can be achieved by the following technical solutions:

[0007] An amino acid sequence of the amylase mutants AmyM-A382T and AmyM-TR2 described above, which sequences are shown in SEQ ID NO. 3 and SEQ ID NO. 4, respectively.

[0008] A gene encoding the amylase mutants described in the present application.

[0009] As a preferred embodiment of the present application, the gene sequences are shown in SEQ ID NO. 1 and SEQ ID NO. 2, respectively.

[0010] The present application also provides vectors capable of expressing the above-mentioned amylase mutants AmyM-A382T and AmyM-TR2.

[0011] Another object of the present application is to provide genetically engineered bacteria containing the amylase mutants AmyM-A382T and AmyM-TR2, which are preferably Pichia pastoris and Bacillus subtilis.

[0012] The present application also provides a preparation method of the above-mentioned amylase mutants, which is based on the amylase AmyM sequence described in the patent No. "ZL201310043628.5" and entitled "Alpha-amylase and its gene, genetically engineered bacteria containing the gene and application thereof", in which the alanine Ala at the 382th position is replaced by threonine Thr to obtain the amino acid sequence of AmyM-A382T (SEQ ID NO. 3), and the fragment between the 423rd and 522nd amino acids of the amylase AmyM protein is deleted to obtain the amino acid sequence of AmyM-TR2 (SEQ ID NO. 4).

[0013] The amylase mutant AmyM-A382T described in the present application has significantly improved activity and conversion efficiency on raw starch and soluble starch, and the activity on soluble starch is increased by 39% compared with the amylase AmyM; and the activity on raw starch from different sources is increased by 20-90% compared with the amylase AmyM. The amylase mutant AmyM-TR2 has significantly improved activity on raw starch, and the activity on raw starch from different sources is increased by 35-100% compared with the amylase AmyM.

[0014] In the bread baking experiment, the AmyM-TR2 described in the present application has more effect on improving the quality of bread compared with the amylase AmyM when the same amount of protein with the same activity unit is added.

[0015] The malt hexaose amylase mutants AmyM-A382T and AmyM-TR2 proteins described in the present application are used in the processing of starch-based food.

[0016] The amylase mutant proteins described in the present application are used in the liquefaction and saccharification of soluble starch and the preparation of high-quality malt oligosaccharides.

[0017] The amylase mutant proteins described in the present application are used in starch processing and food.

[0018] Advantages

[0019] 1. The present application is based on the amylase AmyM gene and amino acid sequence described in the patent number "ZL 201310043628.5" and the name "a-amylase and its gene, engineering bacteria containing the gene and its application", through multi-sequence evolutionary analysis, the key amino acids and domains are obtained, through multi-site mutation and truncation expression, the amylase mutant proteins AmyM-A382T and AmyM-TR2 with significantly improved catalytic efficiency are successfully obtained, wherein AmyM-A382T is obtained by mutating the 382th amino acid of maltotriose amylase AmyM from Ala to Thr, compared with AmyM, the mutant significantly improves the hydrolysis activity of soluble starch and raw starch; AmyM-TR2 is obtained by deleting the fragment between the 423th and 522th amino acids of maltotriose amylase AmyM, compared with AmyM, the mutant significantly improves the hydrolysis activity of raw starch.

[0020] 2. AmyM-TR2 and AmyM are applied to wheat bread baking, under the condition of adding the same amount of protein with unit activity, the bread quality determination results show that, compared with AmyM, the mutant AmyM-TR2 significantly improves the volume of bread, improves the hardness, chewiness of bread, improves the elasticity, resilience and cohesiveness of bread; in addition, both the mutant AmyM-TR2 and AmyM increase the content of resistant starch and slow-digestible starch in bread, and compared with AmyM, the mutant AmyM-TR2 reduces the digestion rate of starch.

[0021] 3. The engineering strain constructed by using the mutant protein coding gene can efficiently express the mutant protein, and the enzyme preparation produced can be used in starch processing, food industry, fermentation and other industries. BRIEF DESCRIPTION OF DRAWINGS

[0022] Figure 1 PCR amplification verification diagram of amylase mutant protein gene

[0023] M: DNA marker; CK: negative control

[0024] Figure 2 Heterologous expression scheme diagram of amylase mutant protein gene in Pichia pastoris and Bacillus subtilis

[0025] (a) expression scheme diagram with Pichia pastoris as host; (b) expression scheme diagram with Bacillus subtilis as host

[0026] Figure 3 SDS-PAGE analysis diagram of mutant recombinant protein obtained by purification

[0027] M: protein marker; -: yeast expression enzyme liquid without target gene

[0028] Figure 4 Comparative analysis of starch hydrolysis products by amylase mutant proteins

[0029] (a): Heat-treated starch product; (b): Raw wheat starch product; M: Sugar marker; 1: AmyM; 2: AmyM-A382T; 3: AmyM-TR2 Detailed Implementation

[0030] Example 1: Gene cloning of amylase mutant proteins AmyM-A382T and AmyM-TR2

[0031] Using the amylase AmyM gene and amino acid sequence described in patent number "ZL 201310043628.5" entitled "An α-amylase and its gene, an engineered bacterium containing the gene and its application" as a reference, PCR amplification of the α-amylase mutant protein was performed. Figure 1 The alanine Ala at position 382 of AmyM was selected and mutated to threonine Thr using a site-directed mutagenesis kit to obtain the gene sequence of the mutant AmyM-A382T, as shown in SEQ ID NO.1. Primers F1 is SEQ ID NO.5, R1 is SEQ ID NO.6, F2 is SEQ ID NO.7, and R2 is SEQ ID NO.8.

[0032] Amino acids 423 to 522 were deleted from the amino acid sequence of AmyM, that is, the glycosylation domain at the C-terminus of the protein was removed, and the first 422 amino acids at the N-terminus were expressed alone to obtain the gene sequence of the mutant AmyM-TR2, as shown in SEQ ID NO.2. Primers F2 were SEQ ID NO.7 and R3 were SEQ ID NO.9.

[0033] Example 2: Expression and activity determination of amylase mutant protein in Pichia pastoris

[0034] Using Pichia pastoris as the expression host, the PCR amplification product of the amylase mutant protein encoding gene was ligated into the pEFaA vector via enzyme ligation to construct pEFaA-amyM-A382T and pEFaA-amyM-TR2 plasmids. After sequencing verification, the constructed plasmids were linearized using the restriction endonuclease Sca I, and the linearized plasmids were introduced into Pichia pastoris GS115 competent cells by electroporation. Figure 2a) The electroporated bacteria solution was spread on YPD plates containing 100 μg / mL Zeocin, and after growth, colony PCR was performed using primers specific to the gene of interest to detect whether the gene of interest was integrated into the yeast chromosome. The positive clones were named P. pastoris GS115 (pEFaA-amyM-A382T) and P. pastoris GS115 (pEFaA-amyM-TR2). The expression strain P. pastoris GS115 (pEFaA-amyM-A382T) was streaked and cultured in a 50 mL liquid YPD flask at 28°C, 200 rpm for 24 h; then centrifuged at 4000 rpm for 5 min at room temperature, the supernatant was discarded, and the bacterial cells were resuspended in 25 mL BMMY medium, and the expression of the yeast cells was induced; continued to be cultured at 28°C, 200 rpm, and methanol was added every 24 h to a final concentration of 0.5% (v / v), for a total of 96 h of culture; after the culture was completed, the enzyme activity of the target protein was detected, and AmyM disclosed in ZL 201310043628.5 was used as a parallel control. The expressed protein was analyzed by SDS-PAGE Figure 3 ), and the expression amounts of AmyM-A382T and AmyM-TR2 were 0.03 and 0.27 mg / mL, respectively. The amylase activity in the fermentation supernatant was determined by the DNS method, and the results showed that the specific activity of AmyM-A382T on soluble starch was 19000 U / mg, which was 39% higher than that of AmyM; and the specific activity on raw rice starch was 187 U / mg, which was 95% higher than that of AmyM. The expression and activity determination method of the amylase mutant protein AmyM-TR2 were the same as above, and the results showed that the specific activity of AmyM-TR2 on raw rice starch was 187 U / mg, which was 95% higher than that of AmyM.

[0035] Example 3 Expression and activity determination of amylase mutant proteins in Bacillus subtilis

[0036] Bacillus subtilis was used as an expression host, and the PCR amplification product of the amylase mutant protein coding gene was ligated into the pEFaA-BS-Pac vector containing the upstream and downstream homologous arms of Bacillus subtilis by enzyme ligation transformation. The full-length gene containing the upstream and downstream homologous arms and the gene of interest was amplified by primers F4 and R4 using the recombinant plasmids pEFaA-BS-Pac-amyM-A382T and pEFaA-BS-Pac-amyM-TR2 as templates, and the primers F4 and R4 were as shown in SEQ ID NO. 10 and SEQ ID NO. 11, respectively. The mixture was incubated at 37°C for 90 min to transform the super competent cells of Bacillus subtilis SCK6 Figure 2b), the positive transformants were screened by coating on LLB plates containing 1.5% starch and 100 μg / mL Zeocin, and colony PCR was performed using the specific primers of the target gene to detect whether the target gene was integrated into the B. subtilis. The correct positive transformants were picked to 4 mL LB liquid and cultured at 37°C, 200 rpm, then transferred to 2x SR medium for induction expression, and cultured at 37°C, 200 rpm. After the culture, the expressed protein was analyzed by SDS-PAGE, the amylase activity was determined by DNS method, and the protein content was determined by Coomassie brilliant blue. The expression amounts of AmyM-A382T and AmyM-TR2 were 0.05 and 0.11 mg / mL, respectively, which were similar to the enzyme activity in yeast.

[0037] Example 4 Comparative analysis of starch hydrolysis products of amylase mutant proteins

[0038] Using heat-treated starch as the substrate and malt hexaose amylase AmyM as the control, the products were compared by TLC analysis of the hydrolysis products. The results showed that the amylase mutant proteins AmyM-A382T and AmyM-TR2 had good catalytic ability as AmyM, and the heat-treated starch was converted into malt hexaose as the main malt oligosaccharide mixture Figure 4 a). However, unlike gelatinized starch, when using wheat raw starch as the substrate, the amylase mutant proteins AmyM-A382T, AmyM-TR2 and AmyM all converted the wheat raw starch into maltose, maltotriose and maltotetraose as the main products Figure 4 b).

[0039] Example 5 Comparative analysis of the application of amylase mutant protein AmyM-TR2 and AmyM in bread baking

[0040] Bread baking experiment was established using commercial wheat flour. The formula was wheat flour (100 g), sodium chloride (1.5 g), yeast (1.8 g), water (40 ml), skimmed milk powder (4 g), and sugar (6 g), supplemented with 0.02 mg / kg of the starch enzyme, and the same dose of starch enzyme AmyM as control, to evaluate the difference between mutant protein AmyM-TR2 and wild-type AmyM in improving bread quality. The results showed that the mutant protein AmyM-TR2 involved in the patent significantly improved the quality compared with AmyM at the same additive dose, including increasing the volume of bread, pore size, and reducing hardness, etc. (Table). In addition, by comparing the starch digestion characteristics in bread treated with different starch enzymes, it was found that compared with AmyM, the variant protein AmyM-TR2 significantly reduced the content of rapidly digestible starch RDS in baked bread and increased the content of resistant starch RS. The results showed that the mutant AmyM-TR2 based on the sequence of malt hexaose amylase AmyM had more effect in improving the quality of bread.

[0041] Table 1 Quality characteristics of bread

[0042]

[0043] Volume: Bread volume; L * ,a * ,b * : represents the color value of the color of the object, respectively, the hundred darkness (black and white), red and green color, yellow and blue color; Cell to total area ratio: the ratio of pore to total area; Cell density: pore density; Mean cell area: average pore size.

[0044] Table 2 Digestion characteristics of bread

[0045]

[0046]

[0047] RDS: rapidly digestible starch; SDS: slowly digestible starch; RS: resistant starch; C ∞ : hydrolysis rate of starch at infinite time; k: starch hydrolysis constant. SEQUENCE LISTING <110> Nanjing Agricultural University <120> Two starch hydrolysis-enhanced malt hexaose amylase mutants and preparation method and application thereof <160> 11 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1566 <212> DNA <213> Corallococcus sp. EGB <400> 1 atgacgttga agacccgcct gctggccgtc tccacggccg gcctgttcgc cgccacgtcc 60 gccgtggcca agccgctcga tggagcgagc accgacgtga tgatccaggg cttccactgg 120 aactccgcca gcgcgggcgg gtggtggaac acggtaaaga acaacgcggc cacgctgaag 180 gccgcgggct tcacgatgat ctggctgccg ccgccctcgg acgcggcgtc cacgcagggc 240 tacctgcccc ggcagctcaa cgtgctcaac tccagctacg gcacggaggc ggagctcacc 300 gccgcgctgg ccgcgctcaa cgcgcagggc atcaagccca tcgcggacat cgtggtgaac 360 caccgcgtgg gcaccaccaa ctgggcggac ttcaccaacc ccacctggcc cggctgcagc 420 gcggtggtcg cgggtgacga gtggacgggc gcatgcggca acgccgacag cggcgagggc 480 tacgccgcgg cgcgcgacct ggaccactcg caggcgaacg tgcgcgcgga cctgaagacg 540 tggatgaaca gccgcctgaa gggcgtgggc ttcgcgggct ggcgcttcga cttcgtgaag 600 ggcttcgcgg gcagctacgt gaaggagtac gtcgccgcca cggacccctg gttctgcgtg 660 ggcgagttct ggcccaccaa ctacttcgac gcgaacaacc ccaacgactg gaagcagcag 720 atcgtcaact gggtggatgc cacgacgggc acctgcgccg cgttcgactt cgccaccaag 780 ggcctgctca acgacgcgct caccaacaac aactacacgc gcctgaaggc gtccgacggc 840 aagcccgcgg gcggcatcgg ctggtgggcc agccgccacg tcaccttcgt ggacaaccac 900 gacaccggcc ccagcgagtc gtgcggcaac gggcagaacc actggccggt gccgtgcgcc 960 aaggtgatgc agggctacgc ctacgtgctc acccatccgg gcatccccac cgtctactgg 1020 gcgcactact tcaactgggg cctgggcagc tccatcaagg cgctgatgga catccgcaag 1080 agcgcgggcc tcacgtctga atccaccgtc agcatccagc gcgcggagag cggcctgtac 1140 gcgacaatca tcggcggcaa ggtggcggtg aagctgggca gcggctcctg gagccccggc 1200 accggctgga cgcaggccgc ctccggcacc gactacaccg tgtggaccac caacacgccg 1260 ccccccaccg gcaccaccgc caacgtggag ttcgtgtgca acaacggcac gaccgtgatg 1320 GGCCAGAACG TCTACGTCAC CGGCAGCGTC GC GGAGCTCG ACACCTGGAG CCCCACCACC 1380 ACGAAGATTC TGAGCCCCAC CGC GTACCCCAC CTGGCGCGGC ACC TACGC GCTGCCCGCG 1440 AACACGACCG TGCAGTGGAA GTGCCTCAAG CGCGACGGCA GC GGCAACGTCT GTCTGGCAG 1500 GGC GGGAGCGACAACACCCTCACCACCCCGCCGCCGGCGGAGCACCA CCGCC ACCGCC 1560 AGCTTC 1566 <210> 2 <211> 1266 <212> DNA <213> C orallococcus sp. EGB <400> 2 ATGACGTTGA AGACCCGCCT GCTGGCCGTC TCCACGGCCG GCCTGTTCGC CGCCACGTCC 60 GCCGTGGCCA AGCCGCTCGA TGGAGCGAGC ACCGACGTGA TGATCCAGGG CTTCCACTGG 120 A ACTCCGCCA GC GC GGCGG GTGGTGGAAC ACGGTAAAGA ACAACGC GGCACGCTGAAG 180 GCCGC GGCTTCACGATGATCTGGCTGCCGCCCTCGGACGC GGC GTCACGCAGGGC 240 TACCTGCCCG GCAGCTCAAC GTGCTCAACT CCAGCTACGG CACGGAGGCG GAGCTCACC 300 GCCGCGCTGG CC GCGCTCAAC GC GC AGGGCATC AAG CCCATCGCGG ACATCGTGGT GAAC 360 caccgcgtgg gcaccaccaa ctgggcggac ttcaccaacc ccacctggcc cggctgcagc 420 gcggtggtcg cgggtgacga gtggacgggc gcatgcggca acgccgacag cggcgagggc 480 tacgccgcgg cgcgcgacct ggaccactcg caggcgaacg tgcgcgcgga cctgaagacg 540 tggatgaaca gccgcctgaa gggcgtgggc ttcgcgggct ggcgcttcga cttcgtgaag 600 ggcttcgcgg gcagctacgt gaaggagtac gtcgccgcca cggacccctg gttctgcgtg 660 ggcgagttct ggcccaccaa ctacttcgac gcgaacaacc ccaacgactg gaagcagcag 720 atcgtcaact gggtggatgc cacgacgggc acctgcgccg cgttcgactt cgccaccaag 780 ggcctgctca acgacgcgct caccaacaac aactacacgc gcctgaaggc gtccgacggc 840 aagcccgcgg mcggcatcgg ctggtgggcc agccgccacg tcaccttcgt ggacaaccac 900 gacaccggcc ccagcgagtc gtgcggcaac gggcagaacc actggccggt gccgtgcgcc 960 aaggtgatgc agggctacgc ctacgtgctc acccatccgg gcatccccac cgtctactgg 1020 gcgcactact tcaactgggg cctgggcagc tccatcaagg cgctgatgga catccgcaag 1080 agcgcgggcc tcacgtctga atccaccgtc agcatccagc gcgcggagag cggcctgtac 1140 gcggccatca tcggcggcaa ggtggcggtg aagctgggca gcggctcctg gagccccggc 1200 accggctgga cgcaggccgc ctccggcacc gactacaccg tgtggaccac caacacgccg 1260 cccccc 1266 <210> 3 <211> 522 <212> PRT <213> Myxobacterium Corallococcus sp. EGB (Corallococcus sp. EGB) <400> 3 Met Thr Leu Lys Thr Arg Leu Leu Ala Val Ser Thr Ala Gly Leu Phe 1 5 10 15 Ala Ala Thr Ser Ala Val Ala Lys Pro Leu Asp Gly Ala Ser Thr Asp 20 25 30 Val Met Ile Gln Gly Phe His Trp Asn Ser Ala Ser Ala Gly Gly Trp 35 40 45 Trp Asn Thr Val Lys Asn Asn Ala Ala Thr Leu Lys Ala Ala Gly Phe 50 55 60 Thr Met Ile Trp Leu Pro Pro Pro Ser Asp Ala Ala Ser Thr Gln Gly 65 70 75 80 Tyr Leu Pro Arg Gln Leu Asn Val Leu Asn Ser Ser Tyr Gly Thr Glu 85 90 95 Ala Glu Leu Thr Ala Ala Leu Ala Ala Leu Asn Ala Gln Gly Ile Lys 100 105 110 Pro Ile Ala Asp Ile Val Val Asn His Arg Val Gly Thr Thr Asn Trp 115 120 125 Ala Asp Phe Thr Asn Pro Thr Trp Pro Gly Cys Ser Ala Val Val Ala 130 135 140 Gly Asp Glu Trp Thr Gly Ala Cys Gly Asn Ala Asp Ser Gly Glu Gly 145 150 155 160 Tyr Ala Ala Ala Arg Asp Leu Asp His Ser Gln Ala Asn Val Arg Ala 165 170 175 Asp Leu Lys Thr Trp Met Asn Ser Arg Leu Lys Gly Val Gly Phe Ala 180 185 190 Gly Trp Arg Phe Asp Phe Val Lys Gly Phe Ala Gly Ser Tyr Val Lys 195 200 205 Glu Tyr Val Ala Ala Thr Asp Pro Trp Phe Cys Val Gly Glu Phe Trp 210 215 220 Pro Thr Asn Tyr Phe Asp Ala Asn Asn Pro Asn Asp Trp Lys Gln Gln 225 230 235 240 Ile Val Asn Trp Val Asp Ala Thr Thr Gly Thr Cys Ala Ala Phe Asp 245 250 255 Phe Ala Thr Lys Gly Leu Leu Asn Asp Ala Leu Thr Asn Asn Tyr 260 265 270 Thr Arg Leu Lys Ala Ser Asp Gly Lys Pro Ala Gly Gly Ile Gly Trp 275 280 285 Trp Ala Ser Arg His Val Thr Phe Val Asp Asn His Asp Thr Gly Pro 290 295 300 Ser Glu Ser Cys Gly Asn Gly Gln Asn His Trp Pro Val Pro Cys Ala 305 310 315 320 Lys Val Met Gln Gly Tyr Ala Tyr Val Leu Thr His Pro Gly Ile Pro 325 330 335 Thr Val Tyr Trp Ala His Tyr Phe Asn Trp Gly Leu Gly Ser Ser Ile 340 345 350 Lys Ala Leu Met Asp Ile Arg Lys Ser Ala Gly Leu Thr Ser Glu Ser 355 360 365 Thr Val Ser Ile Gln Arg Ala Glu Ser Gly Leu Tyr Ala Thr Ile Ile 370 375 380 Gly Gly Lys Val Ala Val Lys Leu Gly Ser Gly Ser Trp Ser Pro Gly 385 390 395 400 Thr Gly Trp Thr Gln Ala Ala Ser Gly Thr Asp Tyr Thr Val Trp Thr 405 410 415 Thr Asn Thr Pro Pro Pro Thr Gly Thr Thr Ala Asn Val Glu Phe Val 420 425 430 Cys Asn Asn Gly Thr Thr Val Met Gly Gln Asn Val Tyr Val Thr Gly 435 440 445 Ser Val Ala Glu Leu Asp Thr Trp Ser Pro Thr Thr Thr Lys Ile Leu 450 455 460 Ser Pro Thr Ala Tyr Pro Thr Trp Arg Gly Thr Tyr Ala Leu Pro Ala 465 470 475 480 Asn Thr Thr Val Gln Trp Lys Cys Leu Lys Arg Asp Gly Ser Gly Asn 485 490 495 Val Val Trp Gln Gly Gly Ser Asp Asn Thr Leu Thr Thr Pro Ala Ala 500 505 510 Gly Gly Ser Thr Thr Ala Thr Ala Ser Phe 515 520 <210> 4 <211> 422 <212> PRT <213> Corallococcus sp. EGB <400> 4 Met Thr Leu Lys Thr Arg Leu Leu Ala Val Ser Thr Ala Gly Leu Phe 1 5 10 15 Ala Ala Thr Ser Ala Val Ala Lys Pro Leu Asp Gly Ala Ser Thr Asp 20 25 30 Val Met Ile Gin Gly Phe His Trp Asn Ser Ala Ser Ala Gly Gly Trp 35 40 45 Trp Asn Thr Val Lys Asn Asn Ala Ala Thr Leu Lys Ala Ala Gly Phe 50 55 60 Thr Met Ile Trp Leu Pro Pro Pro Ser Asp Ala Ala Ser Thr Gin Gly 65 70 75 80 Tyr Leu Pro Arg Gin Leu Asn Val Leu Asn Ser Ser Tyr Gly Thr Glu 85 90 95 Ala Glu Leu Thr Ala Ala Leu Ala Ala Leu Asn Ala Gin Gly Ile Lys 100 105 110 Pro Ile Ala Asp Ile Val Val Asn His Arg Val Gly Thr Thr Asn Trp 115 120 125 Ala Asp Phe Thr Asn Pro Thr Trp Pro Gly Cys Ser Ala Val Val Ala 130 135 140 Gly Asp Glu Trp Thr Gly Ala Cys Gly Asn Ala Asp Ser Gly Glu Gly 145 150 155 160 Tyr Ala Ala Ala Arg Asp Leu Asp His Ser Gin Ala Asn Val Arg Ala 165 170 175 Asp Leu Lys Thr Trp Met Asn Ser Arg Leu Lys Gly Val Gly Phe Ala 180 185 190 Gly Trp Arg Phe Asp Phe Val Lys Gly Phe Ala Gly Ser Tyr Val Lys 195 200 205 Glu Tyr Val Ala Ala Thr Asp Pro Trp Phe Cys Val Gly Glu Phe Trp 210 215 220 Pro Thr Asn Tyr Phe Asp Ala Asn Asn Pro Asn Asp Trp Lys Gln Gln 225 230 235 240 Ile Val Asn Trp Val Asp Ala Thr Thr Gly Thr Cys Ala Ala Phe Asp 245 250 255 Phe Ala Thr Lys Gly Leu Leu Asn Asp Ala Leu Thr Asn Asn Asn Tyr 260 265 270 Thr Arg Leu Lys Ala Ser Asp Gly Lys Pro Ala Gly Gly Ile Gly Trp 275 280 285 Trp Ala Ser Arg His Val Thr Phe Val Asp Asn His Asp Thr Gly Pro 290 295 300 Ser Glu Ser Cys Gly Asn Gly Gln Asn His Trp Pro Val Pro Cys Ala 305 310 315 320 Lys Val Met Gln Gly Tyr Ala Tyr Val Leu Thr His Pro Gly Ile Pro 325 330 335 Thr Val Tyr Trp Ala His Tyr Phe Asn Trp Gly Leu Gly Ser Ser Ile 340 345 350 Lys Ala Leu Met Asp Ile Arg Lys Ser Ala Gly Leu Thr Ser Glu Ser 355 360 365 Thr Val Ser Ile Gln Arg Ala Glu Ser Gly Leu Tyr Ala Ala Ile Ile 370 375 380 Gly Gly Lys Val Ala Val Lys Leu Gly Ser Gly Ser Trp Ser Pro Gly 385 390 395 400 Thr Gly Trp Thr Gln Ala Ala Ser Gly Thr Asp Tyr Thr Val Trp Thr 405 410 415 Thr Asn Thr Pro Pro Pro 420 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <400> 5 gtacgcgaca atcatcggcg gcaaggtggc gg 32 <210> 6 <211> 32 <212> DNA <213> Artificial Sequence <400> 6 cgatgattgt cgcgtacagg ccgctctccg cg 32 <210> 7 <211> 24 <212> DNA <213> Artificial Sequence <400> 7 ggtaccaagc cgctcgatgg agcg 24 <210> 8 <211> twenty four <212> DNA <213> Artificial Sequence <400> 8 tctagagaag ctggcggtgg cggt 24 <210> 9 <211> twenty four <212> DNA <213> Artificial Sequence <400> 9 tctagagggg ggcggcgtgt tggt 24 <210> 10 <211> 19 <212> DNA <213> Artificial Sequence <400> 10 ctttgcggta gtggtgctt 19 <210> 11 <211> 19 <212> DNA <213> Artificial Sequence <400> 11 ctcatctgtg attccttgg 19

Claims

1. An alpha-amylase variant, characterized in that, The amino acid sequence of the α-amylase variant is as shown in SEQ ID NO. 3 or SEQ ID NO.

4.

2. A gene encoding the α-amylase variant of claim 1.

3. The gene of claim 2, wherein, The nucleotide sequences thereof are as shown in SEQ ID NO. 1 or SEQ ID NO. 2, respectively.

4. A recombinant plasmid containing the gene of the α-amylase variant of claim 2 or 3.

5. A recombinant microorganism containing the recombinant plasmid of claim 4.

6. The recombinant microorganism of claim 5, wherein The host microorganism is yeast or Bacillus subtilis.

7. Enzyme preparation for starch hydrolysis and baking obtained by using the recombinant microorganism of claim 5 or 6, characterized in that, The enzyme preparation contains the α-amylase variant of claim 1 as an active ingredient.

8. Use of the α-amylase variant of claim 1 or the enzyme preparation of claim 7 in starch conversion.

9. Use of the α-amylase variant of claim 1, wherein the amino acid sequence is as shown in SEQ ID NO. 4, or the enzyme preparation of claim 7, wherein the active ingredient is SEQ ID NO. 4, in improving bread quality.

Images