A method for delivering interfering RNA using cytoplasmic RNA viruses as vectors

Abstract

The present application relates to the field of biology, and provides a method for delivering interfering RNA by using cytoplasmic RNA virus as a carrier. The method comprises inserting RNA sequence with RNA cleavage activity at one end or both ends of the interfering RNA sequence by using cytoplasmic RNA virus as a carrier, wherein when the RNA sequence with RNA cleavage activity is inserted at one end of the interfering RNA sequence, a characteristic RNA sequence recognized by RNase is preferably inserted at the other end of the interfering RNA sequence to replace the intranuclear Drosha processing process, increase the cleavage efficiency of the interfering RNA, and achieve the purpose of interfering with the expression of target genes.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biopharmaceuticals, in particular to interfering RNA, and more particularly to a method for delivering interfering RNA using cytoplasmic RNA viruses as carriers. BACKGROUND

[0002] RNA drugs are a kind of oligonucleotide drugs that are currently widely concerned. They are expected to fill the gap in the field of molecular level treatment by regulating the expression of disease-related genes at the RNA level. In recent years, among the multiple oligonucleotide drugs approved by the FDA, there are various antisense nucleotide drugs that produce effects by complementarity with target genes, such as the thio deoxy nucleotide drug Vitravene, which inhibits the activity of the human cytomegalovirus (CMV) mRNA to treat cytomegalovirus (CMV) retinitis in AIDS patients. Two siRNA drugs, Onpattro and Givlaari, have been successively launched, making RNA interference technology attract the attention of many pharmaceutical companies. However, all commercial RNA drugs are currently chemically synthesized, require structural modification, and are embedded in liposomes or nanomaterials to avoid degradation of the preparation, resulting in high costs, such as the pricing of Givlaari at $575,000 per year. Therefore, the research and development of biological carriers carrying RNA drugs has gradually been concerned.

[0003] The currently preferred biological carriers are DNA vectors and DNA viruses, such as the most widely used adenovirus vector, which is commonly used as a tool vector in molecular biology. However, DNA viruses are usually nuclear viruses that can affect the stability and expression of the host genome, integrate into the host genome, and have high biological toxicity.

[0004] RNA viruses refer to viruses with RNA as their genetic material. Unlike DNA viruses, their genetic material replication usually occurs in the cytoplasm, and they can directly synthesize enzyme molecules or other protein molecules in the cytoplasm. According to the current classification of viruses, RNA viruses are divided into positive-strand RNA viruses, negative-strand RNA viruses, and double-strand RNA viruses. After the virus enters the cell, its positive-strand RNA can directly synthesize replication-related enzymes to amplify its genetic material, and then express replication, structure, and immune-related protein molecules to complete the work of amplification, proliferation, and release in the cell.

[0005] Attenuated RNA viruses are very good biological drug carriers, which can carry drugs into lesions and replicate in large quantities to ultimately achieve the purpose of drug delivery to the target, triggering autoimmune effects or inhibiting the expression of disease-related genes to treat related diseases. Currently, several modified attenuated RNA virus drugs have been reported and are in the clinical trial stage, with the main design direction being attenuated virus vaccines and modified virus vectors expressing related proteins. Most RNA viruses are cytoplasmic viruses, and only a few can enter the nucleus. One of the advantages of cytoplasmic RNA viruses as RNA drug carriers is that the design can be diversified. Both positive-strand viruses and negative-strand viruses can carry RNA drug molecules, thereby avoiding the influence on viral activity through various processing methods. Some viruses have tissue specificity, allowing RNA drug molecules to be expressed at the target. Another point is that it can be continuously replicated and expressed, reducing the amount of drug administration and lowering costs. In addition, RNA viruses usually complete this process in the cytoplasm, reducing the toxicity of the carrier virus to cell physiology and the endogenous miRNA production pathway, and not inserting into the chromosome to affect the stability of the host cell genome, making it safer.

[0006] However, so far cytoplasmic RNA viruses have not been developed as RNA interference drug expression vectors. Because RNA viruses usually only exist in the cytoplasm and do not enter the nucleus. Normal interference RNA processing requires entry into the nucleus, where it is recognized and processed by Drosha, released from the mRNA strand to form shRNA, then transported out of the cytoplasm by Exportin 5, further processed by Dicer to form double-stranded siRNA, and finally loaded into one of the chains by Ago to form RISC, which plays an interference role. Without entering the nucleus, it is difficult to process interference RNA relying only on a small amount of Drosha in the cytoplasm. In addition, RNA viruses need to carry their own replication, transcription, and translation-related genetic information, and the genome is generally large and has complex secondary structures, further increasing the difficulty of Drosha recognition. Therefore, theoretically, RNA viruses are not suitable as RNA interference drug expression vectors.

[0007] Due to the disadvantages of RNA virus vectors, there are only a few RNA viruses in the existing public data that deliver interference RNA, such as cytoplasmic RNA viruses Sendai virus, Sindbis virus, tick-borne encephalitis virus, and Kunjin virus. Nuclear RNA viruses such as influenza virus and Borna virus. Sendai virus causes structural abnormalities in the nuclear localization function of the Drosha protein, which is released into the cytoplasm through nuclear pores, and the small size and simple structure of Sendai virus make it easy to process miRNA precursor molecules inserted into the genome, compensating for the virus's inability to enter the nucleus.

[0008] Sindbis virus, TBE virus, Kunjin virus have their own unique processing methods, which are independent of Drosha recognition processing. Influenza virus and Borna virus are also cytoplasmic RNA viruses, but they can enter the nucleus, so they can be recognized and processed by Drosha.

[0009] However, most other cytoplasmic RNA viruses do not have the above characteristics, so it is difficult to use them to express interfering RNA. The main obstacle is the lack of Drosha in the cytoplasm, which leads to very low efficiency of interfering RNA processing, so additional processing pathways are needed to assist or replace Drosha processing.

[0010] Self-cleaving ribozymes are a class of RNA sequences that can cut RNA fragments at specific sites in their own sequences without the need for protease processing. For example, some documents report that using ribozymes in yeast can express functional gRNA. There is no application in cytoplasmic RNA viruses.

[0011] tRNA is an endogenous RNA composed of 76-90 nucleotides, which is mainly processed by RNase P and RNase Z at specific tRNA sites. These two enzymes mainly exist in mitochondria and cytoplasm. Csy4 exogenous enzyme is a homologous protein of cas9 protein, which can specifically recognize two identical recognition sites and cut at the 20th base of the recognition sequence.

[0012] In the article "A Multi-purpose Toolkit to Enable Advanced Genome Engineering in Plants", it is compared that in plants, both processing methods can process more efficient gRNA than traditional processing methods. There is no application in cytoplasmic RNA viruses. SUMMARY

[0013] In view of the shortcomings and deficiencies of the prior art, the present application provides a method for delivering interfering RNA using cytoplasmic RNA virus as a carrier. The specific application is as follows:

[0014] The present application provides a method for delivering interfering RNA using cytoplasmic RNA virus as a carrier, the method comprising: using cytoplasmic RNA virus as a carrier, inserting RNA sequence with RNA cleavage activity at one end or both ends of the interfering RNA sequence; wherein when the RNA sequence with RNA cleavage activity is inserted at one end of the interfering RNA sequence, the characteristic RNA sequence recognized by the RNA enzyme is preferably inserted at the other end of the interfering RNA sequence.

[0015] In the present application, as an exemplary illustration, the RNA sequence with RNA cleavage activity can be inserted at one end of the interfering RNA sequence; the RNA sequence with RNA cleavage activity can also be inserted at both ends of the interfering RNA sequence; the RNA sequence with RNA cleavage activity can also be inserted at one end of the interfering RNA sequence, and the characteristic RNA sequence recognized by the RNase can be inserted at the other end.

[0016] As an exemplary illustration, the interfering RNA in the method of the present application can be one, two or more interfering RNAs.

[0017] In the method of the present application, as one of the embodiments, the RNA sequence with RNA cleavage activity is a ribozyme selected from the group consisting of hepatitis D virus (HDV) ribozyme, hammerhead (HH) ribozyme, hairpin ribozyme, Varkud satellite ribozyme, CPEB3 ribozyme, CoTC ribozyme, or Clostridium orale glmS ribozyme, or a combination of two or more thereof.

[0018] In the method of the present application, as one of the embodiments, the method comprises inserting different ribozymes at both ends of the interfering RNA sequence; preferably, a hepatitis D virus (HDV) ribozyme and a hammerhead (HH) ribozyme are inserted at both ends of the interfering RNA sequence, respectively.

[0019] In the method of the present application, as one of the embodiments, the characteristic RNA sequence recognized by the RNase is selected from the group consisting of phenylalanine tRNA, or csy4 recognition site, or a combination of the two.

[0020] In the method of the present application, as one of the embodiments, two different ribozymes are inserted at both ends of the interfering RNA expression framework, respectively.

[0021] As one of the embodiments, the interfering RNA expression framework is inserted with tRNA or csy4 recognition site at one end of the interfering RNA, and HH or HDV ribozyme at the other end.

[0022] In the method of the present application, as one of the embodiments, the cytoplasmic RNA virus is selected from the group consisting of porcine reproductive and respiratory syndrome virus (PRRSV), measles virus, influenza virus, African swine fever virus, new coronavirus, swine flu virus, classical swine fever virus, and Newcastle disease virus; preferably, the cytoplasmic RNA virus is selected from the group consisting of porcine reproductive and respiratory syndrome virus (PRRSV), measles virus, and influenza virus.

[0023] In the method of the present application, as one of the embodiments, the method further comprises inserting the interfering RNA sequence into the genome of the cytoplasmic RNA virus.

[0024] In the method of the present application, as one of the embodiments, the method further comprises:

[0025] 1) Select different target genes according to different indications;

[0026] 2) Design interference RNA sequence according to target gene sequence, chemically synthesize siRNA oligo, and verify the interference activity of the siRNA oligo on the target gene in vitro;

[0027] 3) Design shRNA sequence according to the siRNA sequence;

[0028] 4) Insert ribozyme at one end or both ends of the siRNA sequence or shRNA sequence, and then construct the DNA sequence corresponding to the obtained RNA sequence into a cytoplasmic RNA virus expression vector; wherein,

[0029] When the ribozyme is inserted at one end of the siRNA sequence or shRNA sequence, the other end is preferably inserted with a tRNA or csy4 recognition site;

[0030] Further preferably, ribozymes are inserted at both ends of the siRNA sequence or shRNA sequence;

[0031] 5) Obtain a recombinant live virus through virus rescue.

[0032] In the method of the present application, as one of the embodiments, the method further comprises that the step 2) of verifying the interference activity of the siRNA oligo on the target gene in vitro further comprises: chemically synthesizing the target gene sequence, adding enzyme cutting sites and protection bases to the upstream and downstream primers of the target gene through PCR method, then double enzyme cutting the PCR fragment and the vector, and connecting to obtain a vector with the target gene.

[0033] In the method of the present application, as one of the embodiments, the method further comprises: in step 2), an interference RNA sequence is designed for each target gene, two deoxythymidine nucleotides are added at the 3' end of the interference sequence as the antisense strand of the small interfering nucleic acid sequence, and two deoxythymidine nucleotides are added at the 3' end of the complementary sequence of the interference sequence as the sense strand of the small interfering nucleic acid sequence, and the oligo is chemically synthesized. As an exemplary description, the interference RNA sequence is completed by a technical service company according to the site found by professional software, and the interference RNA is designed based on the antisense complementary principle.

[0034] In the method of the present application, as one of the embodiments, the step 2) of the method further comprises the following steps:

[0035] (2-1) When the 293T cells are cultured in a 10cm culture medium to 80-90% confluence, the culture solution is poured out, and the cells are washed twice with 3ml PBS;

[0036] (2-2) Add 1 ml Trypsin-EDTA solution, mix well, then remove the trypsin solution, and place at 37°C for 2-3 minutes;

[0037] (2-3) Add 2 ml complete medium, and blow to form a single cell suspension;

[0038] (2-4) Count using a hemocytometer, and inoculate the 24-well plate at a cell amount of about 1 x 10 5 cells per well;

[0039] (2-5) Dissolve 125 μl DEPC-H2O per 1 OD260 oligo, to a final concentration of about 20 μM;

[0040] (2-6) Transfection method of Lipo2000: Transfection method for each group of three repeated wells: add 150 μl Opti-MEM I (50 μl / well*3 wells) to a 1.5 ml EP tube, then add 60 ng of target gene plasmid (20 ng per well), and 1.5 ul of corresponding oligo (10 pmol per well / 500 ul, i.e. 20 nM transfection), mix well; add 150 μl Opti-MEM I (50 μl / well*3 wells) and 6 ul of transfection reagent lipo2000 to another 1.5 ml EP tube, mix well, and after standing for 5 min, mix the two, to a total volume of 300 ul, and stand at room temperature for 20 min;

[0041] (2-7) During the 20 min standing time, remove the culture medium from the 24-well plate inoculated the previous day, and add 400 μl / well of culture medium; after the standing time, add the transfection mixture to the above 24-well plate, 100 μl / well, with 3 repeats, shake the plate, and incubate in the incubator for 6 hours;

[0042] (2-8) Remove the transfection liquid, rinse with PBS, and continue to culture with the culture medium;

[0043] (2-9) Collect the cells after 24 hours of transfection, and perform dual luciferase detection according to the promega dual luciferase kit instructions.

[0044] In the method of the present application, as one of the embodiments, step 3) of the method further comprises: using the siRNA complementary sequence as the sense strand, using the shRNA commonly used loop ring (TTCAAGAGA), mir30 loop ring sequence, or mir155 loop ring sequence, using the siRNA sequence as the antisense strand, and adding two deoxythymidine nucleotides at the 3' end.

[0045] In the method of the present application, as one of the embodiments, step 4) of the method further comprises: synthesizing (A-B-C)n gene fragment;

[0046] wherein n is an integer between 1 and 5;

[0047] A and C are independently selected from an RNA sequence having RNA cleavage activity or a signature RNA sequence recognized by an RNA enzyme, wherein A and C are not simultaneously a signature RNA sequence recognized by an RNA enzyme;

[0048] said B is an interfering RNA;

[0049] In the present invention, as one of the embodiments, it is preferred that said RNA sequence having RNA cleavage activity is a ribozyme selected from a hepatitis delta virus (HDV) ribozyme, a hammerhead (HH) ribozyme, a hairpin ribozyme, a Varkud satellite ribozyme, a CPEB3 ribozyme, a CoTC ribozyme, or a Clostridium orale glmS ribozyme.

[0050] In the present invention, as one of the embodiments, it is preferred that said signature RNA sequence recognized by an RNA enzyme is selected from a phenylalanine tRNA or a csy4 recognition site.

[0051] said interfering RNA is selected from an siRNA, an shRNA or a combination thereof;

[0052] In the present invention, as one of the embodiments, it is preferred that said (A-B-C) n gene fragment is preferably a gene fragment of HDV-siRNA-HH, HDV-siRNA-HHL, (HDV-shRNA-HH)n, HDV-shRNAL-HH, HDV-HDV-shRNA-HH-HH, HDV-HDV-shRNA-HH, HDV-shRNA-HHL, HDV-shRNA-tRNA or Csy4 (exogenous enzyme)-HDV-shRNA-csy4 (recognition site);

[0053] by adding TRS (transcription regulatory sequence) and enzyme cutting site at both ends of PCR primer sequence, the primer is used for amplification of (A-B-C) n gene fragment, enzyme cutting PCR product, connecting to the same enzyme cut expression vector, obtaining a viral expression vector with siRNA fragment or shRNA fragment with ribozyme at both ends or with ribozyme at one end and tRNA or csy4 recognition site at the other end.

[0054] In the method of the present invention, as one of the embodiments, step 5) of the method further comprises:

[0055] (5-1) plate the cells in good condition in a 6-well plate, the density of the plate is 5x10 5Cells were cultured in a 37℃ CO2 incubator for 24h;

[0056] (5-2) When the cell fusion degree reached about 80%, the supernatant medium was discarded, and the cells were washed twice with PBS, and then 3% FBS-containing DMEM maintenance solution was added;

[0057] (5-3) According to the cell and the plasmid, a suitable transfection reagent was selected, and according to the transfection reagent instructions, the cytoplasmic RNA virus expression vector and the RFP-target gene virus expression vector with siRNA or shRNA fragments with ribozyme at both ends or with ribozyme at one end and tRNA or csy4 recognition site at the other end were transfected, and the cell morphology changes such as vacuoles and the like were observed after 96h of transfection, and the P0 generation was recorded;

[0058] (5-4) The P0 generation virus liquid was used to infect the newly plated cells with an infection multiplicity of 0.1, and after 72h of infection, the cells were placed in a-20℃ refrigerator for repeated freeze-thawing three times, and the virus liquid obtained by centrifugation at 800g for 5min was recorded as the P1 generation virus;

[0059] (5-5) The P1 generation virus was further subcultured according to the method of (5-4) and subcultured to P3 generation in turn, and the cells containing the P3 generation virus were placed in a-20℃ refrigerator for repeated freeze-thawing three times, and the P3 generation virus obtained by centrifugation at 800g for 5min was stored in a-80℃ refrigerator for standby.

[0060] The application further provides a use of the interference RNA-cell cytoplasmic RNA virus prepared by the foregoing method in the preparation of an antiviral drug and an interference RNA drug.

[0061] In the application, as one of the embodiments, the interference RNA is selected from African swine fever virus, influenza virus, measles virus, new coronavirus, swine influenza virus, classical swine fever virus, and Newcastle disease virus; and preferably the interference RNA of African swine fever virus, influenza virus, and new coronavirus.

[0062] In the application, as one of the embodiments, the antiviral drug includes drugs against African swine fever virus, influenza virus, measles virus, new coronavirus, swine influenza virus, classical swine fever virus, and Newcastle disease virus; and preferably the drugs against African swine fever virus, influenza virus, and new coronavirus.

[0063] In the method, as one of the embodiments, the method further includes that the cytoplasmic RNA virus is PRRSV, and the interference RNA is the interference RNA of African swine fever virus,

[0064] The interference RNA expression framework is constructed as follows: a) inserting an RNA sequence having RNA cleavage activity at one or both ends of the interference RNA sequence; wherein when the RNA sequence having RNA cleavage activity is inserted at one end of the interference RNA sequence, a characteristic RNA sequence recognized by an RNA enzyme is preferably inserted at the other end of the interference RNA sequence; b) then the interference RNA obtained in step a) is combined with a TRS (transcription regulatory sequence); or further inserting an EGFP or Csy4 exogenous enzyme or a combination of both between the interference RNA and the TRS.

[0065] The interference RNA expression framework is inserted into the negative strand of the PRRSV viral genome.

[0066] In the method of the present application, as one of the embodiments, the TRS (transcription regulatory sequence) is preferably TRS2, TRS3, TRS4, TRS5, TRS6, or TRS7, and most preferably TRS 6.

[0067] As one of the embodiments, the TRS sequence is obtained after transcription of a sequence selected from any one of SEQ ID NO: 159 to SEQ ID NO: 164.

[0068] In the method of the present application, as one of the embodiments, the RNA sequence having RNA cleavage activity is selected from one or more of a hepatitis D virus (HDV) ribozyme, a hammerhead (HH) ribozyme, a hairpin ribozyme, a Varkud satellite ribozyme, a CPEB3 ribozyme, a CoTC ribozyme, and a Clostridium dolosium glmS ribozyme; preferably different types of ribozymes are inserted at both ends of the interference RNA; and further preferably a hepatitis D virus ribozyme and a hammerhead ribozyme are inserted at both ends of the interference RNA, respectively.

[0069] In the method of the present application, as one of the embodiments, the interference RNA is in the form of siRNA (small interfering RNA), saiRNA (single-stranded interfering RNA processed by Ago2), G1, D1, D1L, shRNA (short hairpin RNA), shRNAL, preferably siRNA, shRNA, and most preferably shRNA.

[0070] In the method of the present application, as one of the embodiments, the target gene of the interfering RNA is selected from the following genes of the African swine fever virus: 0174L, EP296R, E165R, K196R, EP152R, CP204L, A240L, MGF360-9L, MGF360-10L, MGF360-11L, MGF360-12L, MGF360-13L, MGF360-14L, MGF360-18R, MGF505-1R, MGF505-2R, MGF505-3R, S273R, CP530R, B646L, NP419L, G1211R, F1055L, NP1450L, EP1242L, I243L, D250R, P1192R, M448R, or pA104R.

[0071] In the method of the present application, as one of the embodiments, the interfering RNA has a sequence represented by any one of SEQ ID NO: 47 to SEQ ID NO: 109, SEQ ID NO: 118 to SEQ ID NO: 144, preferably a sequence represented by any one of SEQ ID NO: 48, SEQ ID NO: 51, SEQ ID NO: 53 to SEQ ID NO: 72, SEQ ID NO: 74 to SEQ ID NO: 109, SEQ ID NO: 118 to SEQ ID NO: 122, or SEQ ID NO: 124 to SEQ ID NO: 144.

[0072] In the method of the present application, as one of the embodiments, the interfering RNA expression framework in the method is selected from the sequences with the following sequence characteristics: TRS6-EGFP-HDV-siRNA-HH; TRS6-EGFP-HDV-siRNA-HHL; TRS6-EGFP-HDV-G1-HH; TRS6-EGFP-HH-shRNA-HDV; TRS6-EGFP-HH-shRNAL-HDV; TRS6-EGFP-HDV-D1-HH; TRS6-EGFP-HDV-D1L-HH; TRS6-EGFP-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNAL-HH; TRS6-EGFP-HDV-HDV-shRNA-HH-HH; TRS6-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-HDV-HDV-shRNA-HH; TRS6-HDV-shRNA-HHL; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-EGFP-(HDV-shRNA-HH)*5; TRS6-EGFP-HDV-shRNA-tRNA; or TRS6-Csy4 (exogenous enzyme)-HDV-shRNA-csy4 (recognition site), preferably TRS6-EGFP-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNAL-HH; TRS6-HDV-shRNA-HHL; TRS6 HDV-shRNA-HH; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA HH; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA HH-HDV-shRNA HH; TRS6-EGFP-(HDV-shRNA HH)*5, and most preferably TRS6-HDV-shRNA-HHL.

[0073] In the method of the present application, as one of the embodiments, the sequence of the interfering RNA expression framework in the method is obtained after transcription of a sequence selected from any one of the following: SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 34 to SEQ ID NO: 46, SEQ ID NO: 110, SEQ ID NO: 111; preferably SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, and most preferably SEQ ID NO: 44.

[0074] In the method of the present application, as one of the embodiments, the interfering RNA expression framework in the method does not contain EGFP and is selected from a sequence having the following sequence characteristics: TRS6-HDV-siRNA-HH; TRS6-HDV-siRNA-HHL; TRS6-HDV-G1-HH; TRS6-HDV-D1-HH; TRS6-HDV-D1L-HH; TRS6-HDV-shRNAL-HH; TRS6-HDV-HDV-shRNA-HH-HH; TRS6-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-HDV-shRNA-HH-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-(HDV-shRNA-HH)*5; or TRS6-HDV-shRNA-tRNA, preferably TRS6-(HDV-shRNA-HH)*5.

[0075] In the method of the present application, as one of the embodiments, the sequence of the interfering RNA expression framework in the method is obtained after transcription of a sequence selected from any one of the following: SEQ ID NO: 145 to SEQ ID NO: 155; preferably SEQ ID NO: 154.

[0076] The present application also provides the use of the African swine fever virus interfering RNA-PRRSV virus prepared by the aforementioned method in the preparation of a medicine for treating or preventing African swine fever.

[0077] The present application also provides an interfering RNA-PRRSV virus medicine for treating or preventing African swine fever, which is prepared according to any one of the aforementioned methods.

[0078] The present application also provides an antiviral medicine or an interfering RNA medicine, which is prepared according to any one of the aforementioned methods.

[0079] The present application also provides a pharmaceutical composition containing any one of the aforementioned medicines.

[0080] Definitions

[0081] In the present application, siRNA is small interfering RNA; saiRNA is an RNA sequence that can be recognized and processed by Ago2; shRNA is short hairpin RNA; G1, D1, D1L are optimized sequences of shRNA, which have different RNA loop and pairing regions, and extend the sequences at both ends of shRNA; shRNAL is a lengthened shRNA with 4 T added at the end.

[0082] TRS is a transcription regulatory sequence.

[0083] Non-limiting examples of the DNA sequences of the interference RNA expression framework involved in the present application are shown in the following table:

[0084]

[0085]

[0086] Non-limiting examples of the interference RNA sequences involved in the present application are shown in the following table:

[0087]

[0088]

[0089]

[0090]

[0091]

[0092] Other sequences involved in the present application are shown in the following table, wherein SEQ ID NO: 156 to SEQ ID NO: 158 are cDNA sequences of phenylalanine tRNA, Csy4 exogenous enzyme and csy4 recognition site, respectively:

[0093]

[0094]

[0095] The present application has the following advantages and effects relative to the prior art:

[0096] The present application delivers interference RNA using cytoplasmic RNA virus, which can be expressed in vivo continuously, can reduce the dosage and cost, compared with the currently commercialized chemical synthesis of siRNA.

[0097] Compared to the more mature DNA vectors or DNA viral vector processing methods currently available, cytoplasmic RNA viruses do not insert into the host genome, thus offering better safety. RNA viruses typically complete the processing of interfering RNA in the cytoplasm, reducing the toxicity of the vector virus to cellular physiology and the endogenous miRNA generation pathway.

[0098] This invention increases the processing pathway of interfering RNA in cytoplasmic RNA viruses by designing and modifying the splicing method at both ends of the interfering RNA, thereby increasing the processing efficiency and thus the interference efficiency. Furthermore, since there are many types of cytoplasmic RNA viruses, the range of cytoplasmic RNA viruses that can be selected can be expanded. Attached Figure Description

[0099] Figure 1 Fluorescence and pathological changes of the P0-P3 generation packaged virus in Example 3. Detailed Implementation

[0100] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0101] Examples 1-4 below illustrate the use of PRRSV to express interfering RNA of African swine fever virus.

[0102] Example 1: Screening of Interfering RNA Sequences

[0103] This invention, through sequence alignment and protein function analysis of prevalent African swine fever viruses in China, screened out highly conserved key genes involved in African swine fever virus replication, immune evasion, and structural functions. The target genes and their encoded proteins are as follows:

[0104]

[0105]

[0106] For each target gene, three interfering RNA sequences were designed. Two deoxythymidine nucleotides were added to the 3' end of the interfering sequence to form the antisense strand of the small interfering nucleic acid sequence. Two deoxythymidine nucleotides were added to the 3' end of the complementary sequence of the interfering sequence to form the sense strand of the small interfering nucleic acid sequence. Oligo was then chemically synthesized.

[0107] In vitro validation of siRNA oligo:

[0108] 1. When 293T cells are cultured in 10cm medium to 80-90% confluence, the culture medium is discarded, and the cells are washed twice with 3ml PBS.

[0109] 2. Add 1 ml of Trypsin-EDTA solution, mix well, remove the trypsin solution, and incubate at 37°C for 2-3 minutes.

[0110] 3. Add 2 ml complete medium, and blow to make single cell suspension.

[0111] 4. Count by blood cell counting board, and inoculate in 24-well plate at about 1 x 10 5 cells per well.

[0112] 5. Dissolve 1 OD260 oligo in 125 μl DEPC-H2O, and the final concentration is about 20 μM.

[0113] 6. Transfection method of Lipo2000: Transfection method of three repeated wells in each group: add 150 μl Opti-MEM I (50 μl / well*3 well) in 1.5 ml EP tube, then add target gene plasmid 60 ng (20 ng per well), and corresponding oligo 1.5 ul (10 pmol per well / 500 ul, i.e. 20 nM transfection), mix; add 150 μl Opti-MEM I (50 μl / well*3 well) and 6 ul transfection reagent lipo2000 in another 1.5 ml EP tube, mix, and after 5 min, mix the two, and the total volume is 300 ul, and stand at room temperature for 20 min.

[0114] 7. During the period, remove the medium in the 24-well plate plated the day before, and add medium at 400 μl per well; after 20 min standing time, add the transfection mixture to the above 24-well plate, 100 μl per well, with 3 repeats, shake the plate, and incubate in the incubator for 6 hours.

[0115] 8. Remove the transfection liquid, rinse with PBS, and then add medium for continuous culture.

[0116] 9. Collect cells after 24 h of transfection, and detect dual luciferase according to the instructions of promega dual luciferase kit.

[0117] Table 1 verification result of interference rate

[0118]

[0119]

[0120]

[0121]

[0122]

[0123] Example 2 Construction of PRRSV virus expression vector

[0124] shRNA sequence synthesis: the corresponding shRNA is prepared from single-stranded siRNA as follows: the siRNA complementary sequence is used as the sense strand, the TTCAAGAGA or mir30 or mir155 loop sequence is used as the shRNA loop sequence, and the siRNA sequence is used as the antisense strand, and two deoxythymidine nucleotides are added at the 3' end.

[0125] PRRSV-shRNA virus expression vector:

[0126] pBAC-PRRSV-TRS6-EGFP (green fluorescent protein) vector construction refers to the literature (chengbao wang, A novel porcine reproductive and respiratory syndrome virus vector system that stably expresses enhanced green fluorescent protein as a separate transcription unit, Veterinary Research, 2013). The TRS6 (transcription regulatory sequence) + EGFP + shRNA fragment is chemically synthesized, and the TRS6 + EGFP + shRNA is amplified by PCR method, and AsisI and MluI enzyme cutting sites are added at both ends of the primers. The PCR product is double digested with AsisI and MluI, and ligated to the pBAC-PRRSV-TRS6-EGFP vector double digested with AsisI and MluI, to obtain the porcine reproductive and respiratory syndrome virus expression vector pBAC-PRRSV-TRS6-EGFP-shRNA with shRNA fragment.

[0127] PRRSV-RFP-target gene virus expression vector:

[0128] TRS6 + RFP (red fluorescent protein) + African swine fever target gene sequence is chemically synthesized, and TRS6 + RFP + African swine fever target gene sequence is amplified by PCR method, and AsisI and MluI enzyme cutting sites are added at both ends of the primers. The PCR product is double digested with AsisI and MluI, and ligated to the pBAC-PRRSV-TRS6-EGFP vector double digested with AsisI and MluI, to obtain the porcine reproductive and respiratory syndrome virus expression vector pBAC-PRRSV-TRS6-RFP-target gene with RFP + target gene. RFP and target gene are expressed in fusion, so that the degree of inhibition of the target gene can be judged by the fluorescence intensity of RFP.

[0129] Asis I and Mlu I enzyme digestion, enzyme connection, the conventional conditions refer to the Guide to Molecular Cloning: Asis I and Mlu I endonuclease in the environment of CutSmart Buffer, 37℃ enzyme digestion overnight; the connection condition is T4 DNA ligase in the environment of T4 DNA ligase buffer, 16℃ connection overnight.

[0130] Example 3 PRRSV recombinant virus rescue

[0131] The Marc-145 cells in good condition were plated in a 6-well plate, the plating density was 5x10 5 4 cells / ml, 2ml of DMEM complete medium was added to each well, and it was placed in a 37℃ CO2 incubator for 12h; the next day, the cell confluence reached about 80%, the supernatant medium was discarded, and it was washed twice with PBS, and 3% FBS-containing DMEM maintenance solution was added; the Attractene transfection reagent was selected, and the amount of 100μl of opti-MEM was added to each well, 1.2μg of plasmid and 4.5μl of transfection reagent, PRRSV-shRNA virus expression vector and PRRSV-RFP-target gene virus expression vector were transfected respectively, 96h after transfection, the cell morphology changed, and there were vacuoles and other lesions, and obvious green fluorescence (shRNA virus expression vector) or red fluorescence (RFP-target gene virus expression vector) could be observed under a fluorescence microscope, which was recorded as P0 generation; Marc-145 cells were infected with P0 virus liquid with a multiplicity of infection of 0.1, and the cell morphology changed after growing for 72h, with vacuoles and other lesions, and obvious green fluorescence (shRNA virus expression vector) or red fluorescence (RFP-target gene virus expression vector) could be observed under a fluorescence microscope, the cells were placed in a-20℃ refrigerator for repeated freeze-thawing three times, and the cells were broken to release the virus; the repeatedly freeze-thawed cells were transferred to a centrifuge tube and centrifuged at 800g for 5min, which was recorded as P1 virus; the P1 virus was further passaged to P3 virus, and the cells containing P3 virus were placed in a-20℃ refrigerator for repeated freeze-thawing three times, and the cells were transferred to a centrifuge tube and centrifuged at 800g for 5min, and P3 virus was obtained, and the virus was stored in a-80℃ refrigerator.

[0132] As Figure 1 shown, P0 is the first generation after virus expression vector transfection, a small amount of green and red fluorescence can be seen, indicating that the recombinant virus has been rescued, and with the increase of the number of passages, the virus titer increases continuously, and the green fluorescence and red fluorescence of P2 and P3 generations are very strong, and the virus titer has basically reached the highest peak.

[0133] Example 4 In vitro interference activity and interference RNA product determination

[0134] The main purpose of this study is to find drugs to treat or prevent African swine fever. The target cells of African swine fever virus are porcine alveolar macrophages. Therefore, the interference activity test in this study was carried out in porcine alveolar macrophages, taking QBH90544.1-siRNA-15 as an example.

[0135] Healthy porcine alveolar macrophages were seeded into 6-well plates at a density of 1×10⁻⁶. 6 Cells were cultured at a density of 1 cell / ml, with 2 ml of RPMI-1640 complete medium added to each well. The cells were incubated at 37°C in a CO2 incubator for 12 hours. On the second day, when cell confluence reached approximately 80%, the supernatant was discarded, and the cells were washed twice with PBS. RPMI-1640 maintenance medium containing 3% FBS was then added. To eliminate the influence of viral mutual inhibition on the interference rate test, PRRSV virus without the target gene and interfering RNA was used as a control. RNA was extracted from the viral fluids containing the target virus PRRSV-TRS6-RFP-target gene, PRRSV virus, and P3 generation PRRSV-TRS6-shRNA, and viral titers were determined by RT-PCR.

[0136] The specific steps for virus titer determination are as follows:

[0137] 1. Primer and probe design

[0138] Following the commonly used one-step RT-qPCR probe and primer design principles, primers and probes for RT-qPCR were designed using the primer and probe design software from Nanjing Genscript Biotech. The design region for the primers and probes was the ORF1a framework region of Porcine reproductive and respiratory syndrome virus (PRRSV), with an amplification band size of 85 bp. The design results are as follows:

[0139] PRRSV-F:GTTGAGCCCAATACGTCACC(Tm:56.03)

[0140] PRRSV-R:TCTTTCCAGCACCGTACCAT(Tm:56.03)

[0141] PRRSV-pro:FAM-ACTGCCAAACCGGAAGATCTTCCCA-TAMRA(Tm:62.15)

[0142] 2. Viral RNA extraction

[0143] RNA was extracted from the viral fluid using a kit from Shanghai Sangon Biotech Co., Ltd. (the viral fluid was obtained by repeatedly freezing and thawing the virus-infected cell fluid and then centrifuging it to remove cell precipitates).

[0144] After mixing the virus solution, take 0.1-0.2 mL virus solution sample in RNase-free 1.5 mL centrifuge tube. Add 0.6 mL Buffer Rlysis-VG to the centrifuge tube, mix well after oscillation for 30 s, and stand at room temperature for 10 min. Add 0.6 mL anhydrous ethanol, cover the tube cap and vortex for 15 s. After short centrifugation, transfer 700 μl solution to the centrifugal adsorption column, stand at room temperature for 2 min, centrifuge at 12,000 rpm at room temperature for 1 min, discard the penetrating liquid, and put the adsorption column back into the collection tube. After short centrifugation of the remaining solution, transfer all of it to the centrifugal adsorption column, stand at room temperature for 2 min, centrifuge at 12,000 rpm at room temperature for 1 min, discard the penetrating liquid, and put the centrifugal adsorption column back into the collection tube. Add 500 μl RPE Solution to the centrifugal adsorption column, centrifuge at 12,000 rpm at room temperature for 1 min, discard the penetrating liquid, and put the centrifugal adsorption column back into the collection tube. Repeat the above steps once. Centrifuge at 12,000 rpm at room temperature for 2 min, and discard the centrifuge tube containing the penetrating liquid. Put the centrifugal adsorption column into a new RNase-free 1.5 mL centrifuge tube, add 30-100 μl DEPC-treated ddH2O to the middle of the filter membrane of the centrifugal adsorption column, and then stand at room temperature for 2 min. Centrifuge at 12,000 rpm at room temperature for 2 min, and the sample in the collection tube is the viral RNA.

[0145] Measure the concentration and purity of the extracted viral RNA, and the OD260 / OD280 ratio of about 2.0 is a better purity RNA sample.

[0146] 3. Reverse transcription and qPCR

[0147] Use NEB one-step RT-qPCR kit for RT-qPCR amplification.

[0148] Use the viral RNA extracted in step 2 as a template (and water as a negative control), configure the RT-qPCR system as follows, and make 3 replicate wells for each sample. Put the configured system into an 8-tube or 96-well plate:

[0149] Luna universal probe one-step reaction mix (2*) 10ul Luna warmstart rt enzyme mix (20*) 1ul PRRSV-F (10 uM) 0.8ul PRRSV-R (10 uM) 0.8ul PRRSV-pro (10 uM) 0.4ul Template ≤ 1 ug Nuclease-free Water To 20ul

[0150] Put the 8-tube or 96-well plate into the Thermo 7500 fluorescent PCR instrument, select TaqMan quantitation standard curve ROX program, use ROX fluorescence as reference fluorescence, FAM fluorescence as reporter fluorescence, and TAMRA as quenched fluorescence, and set the position of the well diameter. After setting the program according to the following conditions, perform RT-PCR.

[0151]

[0152] 4. Analysis of experimental results

[0153] CT value of RT-PCR result can represent virus relative titer, CT value difference n represents copy number difference 2 n .

[0154] Take the virus titer minimum as standard, adjust PRRSV-TRS6-RFP-target gene, PRRSV control and P3 generation PRRSV-TRS6-shRNA virus titer to be consistent, then carry out double virus infection; 10 μl of each virus is added to 6-hole plate, totally 5 experimental groups, use experimental group 1 empty hole as blank control hole, experimental group 2 hole adds PRRSV-TRS6-RFP-target gene virus, experimental group 3 hole adds PRRSV-TRS6-RFP-target gene virus and PRRSV control virus, experimental group 4 hole adds PRRSV-TRS6-RFP-target gene virus and P3 generation PRRSV-TRS6-shRNA virus, experimental group 5 hole cell first transfects siRNA standard product, then adds PRRSV-TRS6-RFP-target gene virus, experimental group 2-5 hole plate each does two parallel, one of 6-hole plate is carried out repeated freeze-thawing after 72 h after infection, is transferred to centrifugal tube and centrifugation, 100 μl of lysis solution is taken and added to 96-hole plate, excitation light and emission light are respectively 580 and 610 wavelength, red light value is measured, according to the reduction of red light value, interference rate is evaluated;

[0155] Another 6-well plate assay interferes with RNA products, discard the supernatant in the plate, wash twice with PBS, then trypsinize for 1 min with EDTA-containing trypsin, discard the trypsin, add 1 ml of DMEM medium to blow the cells into a 1.5 ml centrifuge tube, wash twice with PBS, discard the residual PBS, add 450ul buffer RLT vortex for 30s, add 140ul mix, incubate at room temperature for 3 min; the lysis product is placed in a gDNA collection tube, centrifuged at 8000 rpm / min for 30s to collect the supernatant; add 1 volume of isopropanol and mix well, transfer the sample to an RNeasy Mini column, centrifuge at 8000 x g for 15 seconds, discard the supernatant; add 700ul Buffer RWT 8000 x g centrifuge for 15 seconds, remove the supernatant; add 500ul Buffer RPE 8000 x g centrifuge for 15 seconds, remove the supernatant, repeat this step once and then stand for 1 min; add 35ul RNeasy water, stand for 1 min, centrifuge at 12000 x g for 1 min to collect the filtrate; after determining the concentration, dilute the sample to the same concentration; use the sample dilution concentration as the template, use the standard 10-5 as the positive control, PRRSV-TRS6-RFP-90544.1 and PRRSV-TRS6-EGFP co-infection wells as negative controls, use the "A" method reagent kit of RiboGibb "A" to add "A", the system is RNA template 7ul, 5* poly(A) polymerase Buffer 2ul, poly(A) polymerase 1ul, mix the above system, then react at 37℃ for 1h; after reaction, reverse transcription is carried out, the system is RTase mix 4ul, 5*RTase buffer 4ul, miDETECT A Track Uni-RT primer 2ul and poly(A) Tailing product 10ul, mix the above system, then react at 42℃ for 1h, and then stand at 2℃ for 10 min; after reverse transcription, qPCR is carried out, the system is miDETECT A Track miRNA Forward Primer (10uM) 0.5ul, miDETECT A Track miRNA Uni-Reverse Primer (10uM) 0.5ul, 2*SYBR Green Mix 10ul, cDNA 2ul, and the system is supplemented with RNase-free water to 20ul and mixed evenly, first 95℃ for 10 min, then 95℃ for 2s and 60℃ for 30s for 40 cycles.

[0156] The experimental group 2 is only the target gene virus, the experimental group 3 is the target gene virus and the common PRRSV virus double virus infection, the purpose is to evaluate the influence of double virus infection on the red fluorescence value, the experimental group 4 is the target gene virus and the interference virus double virus infection, and the experimental group 5 is the siRNA standard product transfection and then the target gene virus infection.

[0157] The siRNA standard interference rate calculation formula is: (experimental group 2 red light value-experimental group 5 red light value) / (experimental group 2 red light value-blank red light value)*100%;

[0158] The siRNA standard interference rate calculation formula is: (experimental group 2 red light value-experimental group 5 red light value) / (experimental group 2 red light value-blank red light value)*100%;

[0159] Table 2 PAM cell interference rate and interference RNA test results

[0160]

[0161] Taking QBH90544.1-siRNA-15 as an example, the relative interference rates of the recombinant PRRSVs containing different RNA expression frameworks are compared according to the above interference rate determination method, and the specific results are as shown in Table 3.

[0162] The recombinant PRRSVs containing the following sequence characteristics are constructed according to the PRRSV-shRNA virus expression vector part of reference example 2. Taking TRS6-HDV-shRNA-HHL as an example, HDV-shRNA-HHL is chemically synthesized, and HDV-shRNA-HHL is amplified by PCR method. The primers are added with AsisI-TRS6 and MluI enzyme digestion sites at both ends. The PCR product is double digested by AsisI and MluI, and is connected to the pBAC-PRRSV-TRS6-EGFP vector double digested by AsisI and MluI, to obtain the blue ear virus expression vector with the HDV-shRNA-HHL fragment.

[0163] Table 3

[0164]

[0165]

[0166] In the sequence characteristics of the above table, siRNA is small interfering RNA; saiRNA is RNA sequence that can be recognized and processed by Ago2; shRNA is short hairpin RNA; G1, D1, D1L are optimized sequences of shRNA, which have different RNA loop and pairing regions, and the sequences at both ends of shRNA are extended; shRNAL is a lengthened shRNA, and 4 T are added at the end. Intron represents intron processing sequence. HDV is hepatitis delta virus ribozyme, HH is hammerhead ribozyme, and HHL is hammerhead ribozyme with 6-base pairing sequence extended to 10-base pairing sequence.

[0167] No. 1 is to directly insert a conventional shRNA into the PRRSV viral genome, and no interference rate is detected in the expression framework, which is presumed to be caused by the low processing efficiency of the shRNA expressed by the PRRSV virus, resulting in the failure to generate effective interfering RNA.

[0168] Frameworks 2-21 optimize the internal matching degree of shRNA, loop sequence, and end extension sequence to increase the processing efficiency of Drosha, and consider using intron cleavage instead of Drosha cleavage mode, but the result is still not ideal.

[0169] Framework 31 expresses Drosha exogenously in the cytoplasm, but the Drosha protein is too large to be packaged into the virus.

[0170] The remaining frameworks use self-cleavage ribozymes at both ends. HDV is a hepatitis delta virus ribozyme, and HH is a hammerhead ribozyme. Both ribozymes can self-cleave at specific sites of RNA to release shRNA. Considering the stability of the viral genome, the recognition sequence of the negative strand is designed, so that the positive strand of the genome can be avoided to be cut by the ribozyme, and the damage to the stability of the virus is smaller.

[0171] Nos. 23, 24, 26, and 36-46 are frameworks in which ribozymes are designed to the negative strand, and all have a certain interference rate. Nos. 22, 25, 27-30, and 32-35 are frameworks in which ribozymes are designed to the positive strand, and all do not obtain ideal results.

[0172] The above embodiments are the preferred embodiments of the present application, but the embodiments of the present application are not limited to the above embodiments, and any changes, modifications, substitutions, combinations, simplifications made without departing from the spirit and principles of the present application should be equivalent replacement methods, and all are included in the protection scope of the present application. SEQUENCE LISTING <110> FEDERAL BIOTECHNOLOGY (HENGQIN) CO., LTD. FEDERAL BIOTECHNOLOGY (HENGQIN) CO., LTD. FEDERAL BIOTECHNOLOGY (HENGQIN) CO., LTD. <120> A method for delivering interfering RNA using cytoplasmic RNA viruses as vectors <130> LAC201266P <160> 164 <170> SIPOSequenceListing 1.0 <210> 1 <211> 96 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 1 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacacattg catgcttggt 60 gttattcaag agataacacc aagcatgcaa tgttcg 96 <210> 2 <211> 106 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 2 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacacaccg cattgcatgc 60 ttggtgttat tcaagagata acaccaagca tgcaatgttt tttgcg 106 <210> 3 <211> 132 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 3 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagaagg ctgtatgctg 60 taacaccaag catgcaatgg ttttggccac tgactgacca ttgcgcttgg tgttacagga 120 caaggcctgt cg 132 <210> 4 <211> 124 <212> DNA <213> Artificial Sequence <400> 4 tgatggttcc gtggcaaccc ctttaaccag agtttcagaa ggctgtatgc tgtaacacca 60 agcatgcaat ggttttggcc actgactgac cattgcgctt ggtgttacag gacaaggcct 120 gtcg 124 <210> 5 <211> 134 <212> DNA <213> Artificial Sequence <400> 5 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagaagg ctgtatgctg 60 taacaccaag catgcaatgg ttttggccac tgactgacca ttgcatgctt ggtgttacag 120 gacaaggcct gtcg 134 <210> 6 <211> 143 <212> DNA <213> Artificial Sequence <400> 6 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacatgctg ttgacagtga 60 gcgacattgc atgcttggtg ttagtgaagc cacagatgta acacagcatg caatgctgcc 120 tactgcctcg gacttcaagg gcg 143 <210> 7 <211> 125 <212> DNA <213> Artificial Sequence <400> 7 ttgaaccaac tttaggcctg aattgaatgc tgttgacagt gagcgacatt gcatgcttgg 60 tgttagtgaa gccacagatg taacacagca tgcaatgctg cctactgcct cggacttcaa 120 gggcg 125 <210> 8 <211> 137 <212> DNA <213> Artificial Sequence <400> 8 tgatggttcc gtggcaaccc ctttaaccag agtttcatgc tgttgacagt gagcgacatt 60 gcatgcttgg tgttagtgaa gccacagatg taacaccaag catgcaatgc tgcctactgc 120 ctcggacttc aagggcg 137 <210> 9 <211> 177 <212> DNA <213> Artificial Sequence <400> 9 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacactgga ggcttgctga 60 aggctgtatg ctgtaacacc aagcatgcaa tggttttggc cactgactga ccattgcatg 120 cttggtgtta caggacacaa ggcctgttac tagcactcac atggaacaaa tggcccg 177 <210> 10 <211> 1186 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 10 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacattagt gaaccgtatg 60 acgtataggt gttggctcta tgccacgaca ttggtattgt caggagctgt gaccattggc 120 acagcccaaa acttgctgca cggaaacacc cttctgtgac agccctcttc aggggagatt 180 aggggtctgt ccctagcacc ttgcttccgg agttgcactg ctttacggtc tctccacccc 240 tttaaccatg tctgggatac ttgatcggtg cacgtgtacc cccaatgcca gggtgtttat 300 ggcggagggc caagtctact gcacacgatg tctcagtgca cggtctctcc ttcctctgaa 360 tctccaagtt cctgagcttg gggtgctggg cctattttat aggcccgaag agccactccg 420 gtggacgttg ccacgtgcat tccccactgt cgagtgctcc cccgccgggg cctgctggct 480 ttctgcgatc tttccaattg cacgaatgac cagtggaaac ctgaactttc aacaaagaat 540 ggtgcgggtc gcagctgaga tctacagagc cggccaactc acccctgcag ttctgaaggc 600 tctacaagtt tatgaacggg gttgtcgctg gtaccccatt gtcggacctg tccctggagt 660 ggccgtcttc gccaactccc tacatgtgag tgacaaacct ttcccgggag caactcatgt 720 gttaaccaac ttaccgctcc cgcagaggcc caagcctgag gacttttgcc cttttgagtg 780 tgctatggct gacgtctatg acattggtcg tgacgccgtc atgtatgtgg ccagagggaa 840 agtctccttt aaccagagtt tcagcggaac actggaggct tgctgaaggc tgtatgctgt 900 aacaccaagc atgcaatggt tttggccact gactgaccat tgcatgcttg gtgttacagg 960 acacaaggcc tgttactagc actcacatgg aacaaatggc ctgggctggt attctttggg 1020 cacctcagtg ttagaattgg gggaatgtgt ggtgaatggc actgattgac actgtgcctc 1080 taagtcacct attcaattag ggcgaccgtg tgggggtaaa gtttaattgg cgagaaccat 1140 gcggccgcaa ttaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaacg 1186 <210> 11 <211> 175 <212> DNA <213> Artificial Sequence <400> 11 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacactgga ggcttgctga 60 aggctgtatg ctgtaacacc aagcatgcaa tggttttggc cactgactga ccattgcgct 120 tggtgttaca ggacacaagg cctgttacta gcactcacat ggaacaaatg gcccg 175 <210> 12 <211> 188 <212> DNA <213> Artificial Sequence <400> 12 tgatggttcc gtggcaaccc ctttaaccag agtttcacga cttcttaacc caacagaagg 60 ctcgagaagg tatattgctg ttgacagtga gcgaattgca tgcttggtgt tatagtgaag 120 ccacagatgt ataacaccaa gcatgcaatg tgcctactgc ctcggacttc aaggggctag 180 aattcgcg 188 <210> 13 <211> 1197 <212> DNA <213> Artificial Sequence <400> 13 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacattagt gaaccgtatg 60 acgtataggt gttggctcta tgccacgaca ttggtattgt caggagctgt gaccattggc 120 acagcccaaa acttgctgca cggaaacacc cttctgtgac agccctcttc aggggagatt 180 aggggtctgt ccctagcacc ttgcttccgg agttgcactg ctttacggtc tctccacccc 240 tttaaccatg tctgggatac ttgatcggtg cacgtgtacc cccaatgcca gggtgtttat 300 ggcggagggc caagtctact gcacacgatg tctcagtgca cggtctctcc ttcctctgaa 360 tctccaagtt cctgagcttg gggtgctggg cctattttat aggcccgaag agccactccg 420 gtggacgttg ccacgtgcat tccccactgt cgagtgctcc cccgccgggg cctgctggct 480 ttctgcgatc tttccaattg cacgaatgac cagtggaaac ctgaactttc aacaaagaat 540 ggtgcgggtc gcagctgaga tctacagagc cggccaactc acccctgcag ttctgaaggc 600 tctacaagtt tatgaacggg gttgtcgctg gtaccccatt gtcggacctg tccctggagt 660 ggccgtcttc gccaactccc tacatgtgag tgacaaacct ttcccgggag caactcatgt 720 gttaaccaac ttaccgctcc cgcagaggcc caagcctgag gacttttgcc cttttgagtg 780 tgctatggct gacgtctatg acattggtcg tgacgccgtc atgtatgtgg ccagagggaa 840 agtctccttt aaccagagtt tcacgacttc ttaacccaac agaaggctcg agaaggtata 900 ttgctgttga cagtgagcga attgcatgct tggtgttata gtgaagccac agatgtataa 960 caccaagcat gcaatgtgcc tactgcctcg gacttcaagg ggctagaatt cgtgggctgg 1020 tattctttgg gcacctcagt gttagaattg ggggaatgtg tggtgaatgg cactgattga 1080 cactgtgcct ctaagtcacc tattcaatta gggcgaccgt gtgggggtaa agtttaattg 1140 gcgagaacca tgcggccgca attaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaacg 1197 <210> 14 <211> 352 <212> DNA <213> Artificial Sequence <400> 14 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacattgaa tgaggcttca 60 atactttaca gaatcgttgc ctgcacatct tggaaacact tgctgggatt acttcttcag 120 gttaacccaa cagaaggcta aagaaggtat attgctgttg acagtgagcg aattgcatgc 180 ttggtgttat agtgaagcca cagatgtata acaccaagca tgcaatgtgc ctcggacttc 240 aaggggctac tttaggagca attatcttgt ttactaaaac tgaatacctt gctatctctt 300 tgatacattt ttacaaagct gaattaaaat ggtataaatt aaatcacttt cg 352 <210> 15 <211> 332 <212> DNA <213> Artificial Sequence <400> 15 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacactgga ggcttgctga 60 aggctgtatg ctgtaacacc aagcatgcaa tggttttggc cactgactga ccattgcatg 120 cttggtgtta caggacacaa ggcctgttac tagcactcac atggaacaaa tggcccagat 180 ccgacttctt aacccaacag aaggctcgag aaggtatatt gctgttgaca gtgagcgaat 240[[ID=第十九]] tgcatgcttg gtgttatagt gaagccacag atgtataaca ccaagcatgc aatgtgccta 300 ctgcctcgga cttcaagggg ctagaattcg cg 332 <210> 16 <211> 488 <212> DNA <213> Artificial Sequence <400> 16 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacactgga ggcttgctga 60 aggctgtatg ctgtaacacc aagcatgcaa tggttttggc cactgactga ccattgcatg 120 cttggtgtta caggacacaa ggcctgttac tagcactcac atggaacaaa tggcccagat 180 cttgaatgag gcttcaatac tttacagaat cgttgcctgc acatcttgga aacacttgct 240 gggattactt cttcaggtta acccaacaga aggctaaaga aggtatattg ctgttgacag 300 tgagcgaatt gcatgcttgg tgttatagtg aagccacaga tgtataacac caagcatgca 360 atgtgcctcg gacttcaagg ggctacttta ggagcaatta tcttgtttac taaaactgaa 420 taccttgcta tctctttgat acatttttac aaagctgaat taaaatggta taaattaaat 480 cactttcg 488 <210> 17 <211> 310 <212> DNA <213> Artificial Sequence <400> 17 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtaag tatcaaggtt 60 acaagacagg tttaaggaga ccaatagaaa ctgggcttgt cgagacagag aagacctgga 120 ggcttgctga aggctgtatg ctgtaacacc aagcatgcaa tggttttggc cactgactga 180 ccattgcatg cttggtgtta caggacacaa ggcctgttac tagcactcac atggaacaaa 240 tggcctcttg cgtttctgat aggcacctat tggtcttact gacatccact ttgcctttct 300 ctccacagcg 310 <210> 18 <211> 323 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 18 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtaag tatcaaggtt 60 acaagacagg tttaaggaga ccaatagaaa ctgggcttgt cgagacagac gacttcttaa 120 cccaacagaa ggctcgagaa ggtatattgc tgttgacagt gagcgaattg catgcttggt 180 gttatagtga agccacagat gtataacacc aagcatgcaa tgtgcctact gcctcggact 240 tcaaggggct agaattcgtc ttgcgtttct gataggcacc tattggtctt actgacatcc 300 actttgcctt tctctccaca gcg 323 <210> 19 <211> 459 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 19 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtaag tatcaaggtt 60 acaagacagg tttaaggaga ccaatagaaa ctgggcttgt cgagacagac tggaggcttg 120 ctgaaggctg tatgctgtaa caccaagcat gcaatggttt tggccactga ctgaccattg 180 catgcttggt gttacaggac acaaggcctg ttactagcac tcacatggaa caaatggccc 240 agatccgact tcttaaccca acagaaggct cgagaaggta tattgctgtt gacagtgagc 300 gaattgcatg cttggtgtta tagtgaagcc acagatgtat aacaccaagc atgcaatgtg 360 cctactgcct cggacttcaa ggggctagaa ttcgtcttgc gtttctgata ggcacctatt 420 ggtcttactg acatccactt tgcctttctc tccacagcg 459 <210> 20 <211> 479 <212> DNA <213> Artificial Sequence <400> 20 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtaag tatcaaggtt 60 acaagacagg tttaaggaga ccaatagaaa ctgggcttgt cgagacagat tgaatgaggc 120 ttcaatactt tacagaatcg ttgcctgcac atcttggaaa cacttgctgg gattacttct 180 tcaggttaac ccaacagaag gctaaagaag gtatattgct gttgacagtg agcgaattgc 240 atgcttggtg ttatagtgaa gccacagatg tataacacca agcatgcaat gtgcctcgga 300 cttcaagggg ctactttagg agcaattatc ttgtttacta aaactgaata ccttgctatc 360 tctttgatac atttttacaa agctgaatta aaatggtata aattaaatca cttttcttgc 420 gtttctgata ggcacctatt ggtcttactg acatccactt tgcctttctc tccacagcg 479 <210> 21 <211> 615 <212> DNA <213> Artificial Sequence <400> 21 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtaag tatcaaggtt 60 acaagacagg tttaaggaga ccaatagaaa ctgggcttgt cgagacagac tggaggcttg 120 ctgaaggctg tatgctgtaa caccaagcat gcaatggttt tggccactga ctgaccattg 180 catgcttggt gttacaggac acaaggcctg ttactagcac tcacatggaa caaatggccc 240 agatcttgaa tgaggcttca atactttaca gaatcgttgc ctgcacatct tggaaacact 300 tgctgggatt acttcttcag gttaacccaa cagaaggcta aagaaggtat attgctgttg 360 acagtgagcg aattgcatgc ttggtgttat agtgaagcca cagatgtata acaccaagca 420 TGCAATGTGCC TC GGACTTC AAGGGGCTACTT TAGGAGCA ATTATCTT GTTTACT AAAAC 480 TGAATACCTT GCTATCTCTT TGATACATTT TTACA AAGCT GAATT AAAAT GGTATAAATT 540 AAATC ACTTTTCTT GC GTTT CTGATAGGCA CCTATTGGTC TTACTGACAT CC ACTTTGCC 600 TTTCTCTCCAC AGCG 615 <210> 22 <211> 900 <212> DNA <213> Artificial Sequence <400> 22 TGATGGTTCC GTGGCAACCC CTTTAACCAA GAGTTTCAGC GGAACAATGG TGCAAGGGC 60 GAGGAGCTGTT CACC GGGGT GGTGCCCATC CTGGTCGAGC TGGACGGCGA CGTAAACGGC 120 CACAAGTTCA GC GTTCCGGCG AGGGCGAGGG CGATGCCACC TACGGCAAGC TGACCCTG 180 AAGTTCATCT GCACCACC GGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTG 240 ACCTACGGCG TGCAGTGCTT CAGCCGCTAC CCCGACCACA TGAAGCAGCA CGACTTCTTC 300 AAGTCCGCCA TGCCC GAAGGCTACGTCCAG GAGCGCACCA TCTTCTTCAAG GACGACGGC 360 AAGTCCGCCA TGCCC GAAGGCTACGTCCAG GAGCGCACCA TCTTCTTCAAG GACGACGGC 360 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt gttactgatg 780 agtccgtgag gacgaaacga gtaagctcgt ctaacaccaa gcatgcaatg ggccggcatg 840 gtcccagcct cctcgctggc gccggctggg caacatgctt cggcatggcg aatgggaccg 900 <210> 23 <211> 900 <212> DNA <213> Artificial Sequence <400> 23 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 CACAAGTTCA GC GTGTCCGGC GAGGGCGAGG GC GATGCACCCTACGGCAAGCTGACCCTG 180 AAGTT CATCT GC ACC ACCGG CAAGCTGCCCGTGCCCTGGCCCACCCTCGT GACCACCCTG 240 ACCTACGGCGTGCAGTGCTTCAGCCGCTACCCC GACCACATGAAGCAGCACGACTTCTTC 300 AAGTT CATCT GC ACC ACCGG CAAGCTGCCCGTGCCCTGGCCCACCCTCGT GACCACCCTG 240 AAGTT CATCT GC ACC ACCGG CAAGCTGCCCGTGCCCTGGCCCACCCTCGT GACCACCCTG 240 CTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAAC 480 TACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAAC 540 TTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACC ACTACCAGCAG 600 AACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCC GACCAACC ACTACCTGAGCACCCAG 660 TCCGCCCTGAGCAAAGACCCCAACGAGAAGCGC GATCACA TG GT CCTGCTGGAGTTCGTG 720 ACC GCCGCCGGGATC ACTCTCGG CATGGACGAGCTGTACAAGTAATAAGTCCC ATTCGCC 780 ATGCCGAAGCATGTTGCCCA GCCGGCGCCAGCGAGGAGGCTGGGACC ATGCCGGCCCATT 840 gcatgcttgg tgttagacga gcttactcgt ttcgtcctca cggactcatc agtaacaccg 900 <210> 24 <211> 909 <212> DNA <213> Artificial Sequence <400> 24 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggcccatt 840 gcatgcttgg tgttagacga gcttactcgt ttcgtcctca cggactcatc agtaacacca 900 agcatgccg 909 <210> 25 <211> 939 <212> DNA <213> Artificial Sequence <400> 25 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataatg caatctgatg 780 agtccgtgag gacgaaacga gtaagctcgt cattgcatgc ttggtgttat agtgaagcca 840 cagatgtata acaccaagca tgcaatgttg gccggcatgg tcccagcctc ctcgctggcg 900 ccggctgggc aacatgcttc ggcatggcga atgggaccg 939 <210> 26 <211> 939 <212> DNA <213> Artificial Sequence <400> 26 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaaca 840 ttgcatgctt ggtgttatac atctgtggct tcactataac accaagcatg caatgacgag 900 cttactcgtt tcgtcctcac ggactcatca gattgcacg 939 <210> 27 <211> 919 <212> DNA <213> Artificial Sequence <400> 27 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt gttactgatg 780 agtccgtgag gacgaaacga gtaagctcgt ctaacaccaa gcatgcaatg ctgcatgctt 840 ggtgttatcg gccggcatgg tcccagcctc ctcgctggcg ccggctgggc aacatgcttc 900 ggcatggcga atgggaccg 919 <210> 28 <211> 1027 <212> DNA <213> Artificial Sequence <400> 28 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt aagtatcaag 780 gttacaagac aggtttaagg agaccaatag aaactgggct tgtcgagaca gagtgttact 840 gatgagtccg tgaggacgaa acgagtaagc tcgtctaaca ccaagcatgc aatgggccgg 900 catggtccca gcctcctcgc tggcgccggc tgggcaacat gcttcggcat ggcgaatggg 960 actcttgcgt ttctgatagg cacctattgg tcttactgac atccactttg cctttctctc 1020 cacagcg 1027 <210> 29 <211> 1066 <212> DNA <213> Artificial Sequence <400> 29 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt aagtatcaag 780 gttacaagac aggtttaagg agaccaatag aaactgggct tgtcgagaca gatgcaatct 840 gatgagtccg tgaggacgaa acgagtaagc tcgtcattgc atgcttggtg ttatagtgaa 900 gccacagatg tataacacca agcatgcaat gttggccggc atggtcccag cctcctcgct 960 ggcgccggct gggcaacatg cttcggcatg gcgaatggga ctcttgcgtt tctgataggc 1020 acctattggt cttactgaca tccactttgc ctttctctcc acagcg 1066 <210> 30 <211> 1050 <212> DNA <213> Artificial Sequence <400> 30 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt aagtatcaag 780 gttacaagac aggtttaagg agaccaatag aaactgggct tgtcgagaca gagtgttact 840 gatgagtccg tgaggacgaa acgagtaagc tcgtctaaca ccaagcatgc aatgctaatt 900 gcatgcttgg tgttatcggc cggcatggtc ccagcctcct cgctggcgcc ggctgggcaa 960 catgcttcgg catggcgaat gggactcttg cgtttctgat aggcacctat tggtcttact 1020 gacatccact ttgcctttct ctccacagcg 1050 <210> 31 <211> 3067 <212> DNA <213> Artificial Sequence <400> 31 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatgga gcccgaggag 60 accatgcccg acaagaacga ggaggaggag gaggagctgc tgaagcccgt gtggatcagg 120 tgcacccaca gcgagaacta ctacagcagc gaccccatgg accaggtggg cgacagcacc 180 gtggtgggca ccagcaggct gagggacctg tacgacaagt tcgaggagga gctgggcagc 240 aggcaggaga aggccaaggc cgccaggccc ccctgggagc cccccaagac caagctggac 300 gaggacctgg agagcagcag cgagagcgag tgcgagagcg acgaggacag cacctgcagc 360 agcagcagcg acagcgaggt gttcgacgtg atcgccgaga tcaagaggaa gaaggcccac 420 cccgacaggc tgcacgacga gctgtggtac aacgaccccg gccagatgaa cgacggcccc 480 ctgtgcaagt gcagcgccaa ggccaggagg accggcatca ggcacagcat ctaccccggc 540 gaggaggcca tcaagccctg caggcccatg accaacaacg ccggcaggct gttccactac 600 aggatcaccg tgagcccccc caccaacttc ctgaccgaca ggcccaccgt gatcgagtac 660 gacgaccacg agtacatctt cgagggcttc agcatgttcg cccacgcccc cctgaccaac 720 atccccctgt gcaaggtgat caggttcaac atcgactaca ccatccactt catcgaggag 780 atgatgcccg agaacttctg cgtgaagggc ctggagctgt tcagcctgtt cctgttcagg 840 gacatcctgg agctgtacga ctggaacctg aagggccccc tgttcgagga cagccccccc 900 tgctgcccca ggttccactt catgcccagg ttcgtgaggt tcctgcccga cggcggcaag 960 gaggtgctga gcatgcacca gatcctgctg tacctgctga ggtgcagcaa ggccctggtg 1020 cccgaggagg agatcgccaa catgctgcag tgggaggagc tggagtggca gaagtacgcc 1080 gaggagtgca agggcatgat cgtgaccaac cccggcacca agcccagcag cgtgaggatc 1140 gaccagctgg acagggagca gttcaacccc gacgtgatca ccttccccat catcgtgcac 1200 ttcggcatca ggcccgccca gctgagctac gccggcgacc cccagtacca gaagctgtgg 1260 aagagctacg tgaagctgag gcacctgctg gccaacagcc ccaaggtgaa gcagaccgac 1320 aagcagaagc tggcccagag ggaggaggcc ctgcagaaga tcaggcagaa gaacaccatg 1380 aggagggagg tgaccgtgga gctgagcagc cagggcttct ggaagaccgg catcaggagc 1440 gacgtgtgcc agcacgccat gatgctgccc gtgctgaccc accacatcag gtaccaccag 1500 tgcctgatgc acctggacaa gctgatcggc tacaccttcc aggacaggtg cctgctgcag 1560 ctggccatga cccaccccag ccaccacctg aacttcggca tgaaccccga ccacgccagg 1620 aacagcctga gcaactgcgg catcaggcag cccaagtacg gcgacaggaa ggtgcaccac 1680 atgcacatga ggaagaaggg catcaacacc ctgatcaaca tcatgagcag gctgggccag gacgacccca cccccagcag gatcaaccac aacgagaggc tggagttcct gggcgacgcc gtggtggagt tcctgaccag cgtgcacctg tactacctgt tccccagcct ggaggagggc 1860 ggcctggcca cctacaggac cgccatcgtg cagaaccagc acctggccat gctggccag aagctggagc tggacaggtt catgctgtac gcccacggcc ccgacctgtg cagggagagc 1980. gacctgaggc acgccatggc caactgcttc gaggccctga tcggcgccgt gtacctggag ggcagcctgg aggaggccaa gcagctgttc ggcaggctgc tgttcaacga ccccgacctg agggaggtgt ggctgaacta cccctgcac cccctgcagc tgcaggagcc caacaccgac aggcagctga tcgagaccag ccccgtgctg cagaagctga ccgagttcga ggaggccatc ggcgtgatct tcacccacgt gaggctgctg gccagggcct tcaccctgag gaccgtgggc 2280 ttcaaccacc tgaccctggg ccacaaccag aggatggagt tcctgggcga cagcatcatg cagctggtgg ccaccgagta cctgttcatc cacttccccg accaccacga gggccacctg accctgctga ggagcagcct ggtgaacaac aggacccagg ccaaggtggc cgaggagctg 2460 ggcatgcagg agtacgccat caccaacgac aagaccaaga ggcccgtggc cctgaggacc 2520 aagaccctgg ccgacctgct ggagagcttc atcgccgccc tgtacatcga caaggacctg 2580 gagtacgtgc acaccttcat gaacgtgtgc ttcttcccca ggctgaagga gttcatcctg 2640 aaccaggact ggaacgaccc caagagccag ctgcagcagt gctgcctgac cctgaggacc 2700 gagggcaagg agcccgacat ccccctgtac aagaccctgc agaccgtggg ccccagccac 2760 gccaggacct acaccgtggc cgtgtacttc aagggcgaga ggatcggctg cggcaagggc 2820 cccagcatcc agcaggccga gatgggcgcc gccatggacg ccctggagaa gtacaacttc 2880 ccccagatgg cccaccagaa gaggttcatc gagaggaagt acaggcagga gctgaaggag 2940 atgaggtggg agagggagca ccaggagagg gagcccgacg agaccgagga catcaagaag 3000 taatgataac accaagcatg caatggtttt ggccactgac tgaccattgc atgcttggtg 3060 ttattcg 3067 <210> 32 <211> 940 <212> DNA <213> Artificial Sequence <400> 32 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt gttactgatg 780 agtccgtgag gacgaaacga gtaagctcgt ctaacaccaa gcatgcaatg gttttggcca 840 ctgactgacc attgcatgct tggtgttatt ggccggcatg gtcccagcct cctcgctggc 900 gccggctggg caacatgctt cggcatggcg aatgggaccg 940 <210> 33 <211> 944 <212> DNA <213> Artificial Sequence <400> 33 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt gttactgatg 780 agtccgtgag gacgaaacga gtaagctcgt ctaacaccaa gcatgcaatg gttttggcca 840 ctgactgacc attgcatgct tggtgttatt ttttggccgg catggtccca gcctcctcgc 900 tggcgccggc tgggcaacat gcttcggcat ggcgaatggg accg 944 <210> 34 <211> 930 <212> DNA <213> Artificial Sequence <400> 34 TGATGGTTCC GTGGCAACCC CTTTAACCAA GAGTTTCAGC GGAACAATGG TGCAAGGGC 60 GAGGAGCTGT TCACCGGGGT GGTGCCCATC CTGGTCGAGC TGGACGGCGA CGTAACGGC 120 CACAAGTTCA GCgtGTCCGG CGAGGGCGAG GGCgATGCCA CCTACGGCAA GCTGACCCTG 180 AAGTTCATCT GCACCACCGG CAAGCTGCCC GTGCCCTGGC CCACCCTCGT GACCACCCTG 240 ACCTACGGCG TGCAGTGCTT CAGCCGCTAC CCCGACCACA TGAAGCAGCA CGACTTCTTC 300 AAGTCCGCCA TGCCCgaAGG CTACGTCCAG GAGCGACAAT CTTCTTCAAG GACGACGGC 360 AAGTCCGCCA TGCCCgaAGG CTACGTCCAG GAGCGACAAT CTTCTTCAAG GACGACGGC 360 CTGAAGGGCA TCGACTTCAA GGAGGACGGC AACATCCTGG GGCACAAGCT GGAGTACAAC 480 TACAACAGCC ACAACGTCTA TATCATGGCC GACAAGCAGA AGAACGGCAT CAAGGTGAAC 540 TTCAAGATCC GCCACAACAT CGAGGACGGC AGCgtGCAGC TCGCCGACCA CTACCAGCAG 600 AACACCCCCA TCggCGACGG CCCGTGCTGC TGCCTGACCA CCCTACCTGA GCACCCAG 660 TCCGCCCTGA GCAAAGACCC CAACGAGAAG CGCgATCACA TGGTCTTGCT GGAGTTcGTG 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagc aatgctgatg 780 agtccgtgag gacgaaacga gtaagctcgt ccattgcatg cttggtgtta ttcaagagat 840 aacaccaagc atgcaatgtt ggccggcatg gtcccagcct cctcgctggc gccggctggg 900 caacatgctt cggcatggcg aatgggaccg 930 <210> 35 <211> 934 <212> DNA <213> Artificial Sequence <400> 35 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagc aatgctgatg 780 agtccgtgag gacgaaacga gtaagctcgt ccattgcatg cttggtgtta ttcaagagat 840 aacaccaagc atgcaatgtt ttttggccgg catggtccca gcctcctcgc tggcgccggc 900 tgggcaacat gcttcggcat ggcgaatggg accg 934 <210> 36 <211> 940 <212> DNA <213> Artificial Sequence <400> 36 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaata 840 acaccaagca tgcaatggtc agtcagtggc caaaaccatt gcatgcttgg tgttagacga 900 gcttactcgt ttcgtcctca cggactcatc agtaacaccg 940 <210> 37 <211> 944 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 37 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaaaa 840 aataacacca agcatgcaat ggtcagtcag tggccaaaac cattgcatgc ttggtgttag 900 acgagcttac tcgtttcgtc ctcacggact catcagtaac accg 944 <210> 38 <211> 930 <212> DNA <213> Artificial Sequence <400> 38 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaaca 840 ttgcatgctt ggtgttatct cttgaataac accaagcatg caatggacga gcttactcgt 900 ttcgtcctca cggactcatc agcattgccg 930 <210> 39 <211> 934 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 39 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaaaa 840 aacattgcat gcttggtgtt atctcttgaa taacaccaag catgcaatgg acgagcttac 900 tcgtttcgtc ctcacggact catcagcatt gccg 934 <210> 40 <211> 1041 <212> DNA <213> Artificial Sequence <400> 40 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccgtcc 840 cattcgccat gccgaagcat gttgcccagc cggcgccagc gaggaggctg ggaccatgcc 900 ggccaacatt gcatgcttgg tgttatctct tgaataacac caagcatgca atggacgagc 960 ttactcgttt cgtcctcacg gactcatcag cattgcgacg agcttactcg tttcgtcctc 1020 acggactcat cagcattgcc g 1041 41 42 43 44 45 46tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 47ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 48catgcttggt gttatctctt gaataacacc aagcatgcaa tggacgagct tactcgtttc 180 49gtcctcacgg actcatcagc attgccg 207 50 51 52 53 54 55tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 56gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 57cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 58aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 59acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 60​​​​​​​​​​aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaaca 840 ttgcatgctt ggtgttatct cttgaataac accaagcatg caatggacga gcttactcgt 900 ttcgtcctca cggactcatc agcattgcgt cccattcgcc atgccgaagc atgttgccca 960 gccggcgcca gcgaggaggc tgggaccatg ccggccaaca ttgcatgctt ggtgttatct 1020 cttgaataac accaagcatg caatggacga gcttactcgt ttcgtcctca cggactcatc 1080 agcattgccg 1090 <210> 43 <211> 275 <212> DNA <213> Artificial Sequence <400> 43 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccgtcccat 120 tcgccatgcc gaagcatgtt gcccagccgg cgccagcgag gaggctggga ccatgccggc 180 caacattgca tgcttggtgt tatctcttga ataacaccaa gcatgcaatg gacgagctta 240 ctcgtttcgt cctcacggac tcatcagcat tgccg 275 <210> 44 <211> 213 <212> DNA <213> Artificial Sequence <400> 44 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 catgcttggt gttatctctt gaataacacc aagcatgcaa tggacgagct tactcgtttc 180 gtcctcacgg actcatcagc attgcatgca acg 213 <210> 45 <211> 1250 <212> DNA <213> Artificial Sequence <400> 45 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaaca 840 ttgcatgctt ggtgttatct cttgaataac accaagcatg caatggacga gcttactcgt 900 ttcgtcctca cggactcatc agcattgcgt cccattcgcc atgccgaagc atgttgccca 960 gccggcgcca gcgaggaggc tgggaccatg ccggccaaca ttgcatgctt ggtgttatct 1020 cttgaataac accaagcatg caatggacga gcttactcgt ttcgtcctca cggactcatc 1080 agcattgcgt cccattcgcc atgccgaagc atgttgccca gccggcgcca gcgaggaggc 1140 tgggaccatg ccggccaaca ttgcatgctt ggtgttatct cttgaataac accaagcatg 1200 caatggacga gcttactcgt ttcgtcctca cggactcatc agcattgccg 1250 <210> 46 <211> 1570 <212> DNA <213> Artificial Sequence <400> 46 TGA TGGTTCCGTGGCAACCCC TT AAC CAG AGTTTC AGCG GAACAATGGTG AGCAAGGGC 60 GAGGAGCTGTT CACC GGGGT GGTGCCCATC CTGGTCGAGC TGGACGGCGA C GTAAACGGC 120 CACAAGTTCA GC GTGTCCGGC GAGGGCGAG GGC GATGCCACCTACGGCAAGCTGACCCTG 180 AAGTTCATCT GCACCACC GGC AAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTG 240 ACCTACGGCGTGCAGTGCTTCAGCCGCTACCCC GACCACATGAAGCAGCACGACTTCTTC 300 AAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC 360 AAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC 360 AAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC 360 AAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC 360 AAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC 360 AAGTCCGCCATGCCC GAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGC 360 TCCGCCCTGA GCAAAGACCC CAACGAGAAG CGCGATCACA TGGT CCTGCTGGA GTTCGTG 720 ACC GCCGCCGG GATC ACTCTCGGC ATGGACGAGC TGTACAAGTA ATAAGTCCC ATTCGCC 780 ATGCCGAAGC ATGTTGCCCA GCCGGCGCCA GC GAGGAGGC TGGGACC ATG CC GGC AACA 840 TTG CATGCTTG GTGTTATCTC TTGAATAACA CCAAGCATG CAATGGACGA GCTTACTCGT 900 TTCGTCCTCA C GGACTCATC AGCATTGC GT CCCATTCGCC ATGCCGAAGC ATGTTGCCCA 960 GCCGGCGCCA GC GAGGAGGC TGGGACC ATG CC GGC AACA TTG CATGCTTG GTGTTATCT 1020 CTTGAATAAC ACCAAGCATG CAATGGACGA GCTTACTCGT TTCGTCCTCA C GGACTCATC 1080 AGCATTGC GT CCCATTCGCC ATGCCGAAGC ATGTTGCCCA GCCGGCGCCA GC GAGGAGGC 1140 TGGGACC ATG CC GGC AACA TTG CATGCTTG GTGTTATCTC TTGAATAACA CCAAGCATG 1200 CAATGGACGA GCTTACTCGT TTCGTCCTCA C GGACTCATC AGCATTGC GT CCCATTCGCC 1260 ATGCCGAAGC ATGTTGCCCA GCCGGCGCCA GC GAGGAGGC TGGGACC ATG CC GGC AACA 1320 TTG CATGCTTG GTGTTATCTC TTGAATAACA CCAAGCATG CAATGGACGA GCTTACTCGT 1380 ttcgtcctca cggactcatc agcattgcgt cccattcgcc atgccgaagc atgttgccca 1440 gccggcgcca gcgaggaggc tgggaccatg ccggccaaca ttgcatgctt ggtgttatct 1500 cttgaataac accaagcatg caatggacga gcttactcgt ttcgtcctca cggactcatc 1560 agcattgccg 1570 <210> 47 <211> 19 <212> RNA <213> Artificial Sequence <400> 47 gucuuaagcu accaacagc 19 <210> 48 <211> 19 <212> RNA <213> Artificial Sequence <400> 48 augaaguacu gcguauggc 19 <210> 49 <211> 19 <212> RNA <213> Artificial Sequence <400> 49 aaacguuucu uagguaugc 19 <210> 50 <211> 19 <212> RNA <213> Artificial Sequence <400> 50 uuaucacagc cuuucuagg 19 <210> 51 <211> 19 <212> RNA <213> Artificial Sequence <400> 51 uuaauaccga cuuccuugc 19 <210> 52 <211> 19 <212> RNA <213> Artificial Sequence <400> 52 augugagccg uaucaaugc 19 <210> 53 <211> 19 <212> RNA <213> Artificial Sequence <400> 53 ugaagcacua ggucggagc 19 <210> 54 <211> 19 <212> RNA <213> Artificial Sequence <400> 54 aacccggguc uauuaaacc 19 <210> 55 <211> 19 <212> RNA <213> Artificial Sequence <400> 55 aaacagcgga aauauuugg 19 <210> 56 <211> 19 <212> RNA <213> Artificial Sequence <400> 56 auggguccca gcacaaggc 19 <210> 57 <211> 19 <212> RNA <213> Artificial Sequence <400> 57 acgucagaua acugugugc 19 <210> 58 <211> 19 <212> RNA <213> Artificial Sequence <400> 58 aaagcaugca uuauguugg 19 <210> 59 <211> 19 <212> RNA <213> Artificial Sequence <400> 59 uaacaccaag caugcaaug 19 <210> 60 <211> 19 <212> RNA <213> Artificial Sequence <400> 60 uauguauguc uuccaucac 19 <210> 61 <211> 19 <212> RNA <213> Artificial Sequence <400> 61 aaaguuaaac ugcuuaggg 19 <210> 62 <211> 19 <212> RNA <213> Artificial Sequence <400> 62 aauuauacag gcuacccgc 19 <210> 63 <211> 19 <212> RNA <213> Artificial Sequence <400> 63 auguucagua uacccuugc 19 <210> 64 <211> 19 <212> RNA <213> Artificial Sequence <400> 64 cuccgaugag ggcucuugc 19 <210> 65 <211> 19 <212> RNA <213> Artificial Sequence <400> 65 aauauaagau caccggugg 19 <210> 66 <211> 19 <212> RNA <213> Artificial Sequence <400> 66 ugauuccauc ugcuugagc 19 <210> 67 <211> 19 <212> RNA <213> Artificial Sequence <400> 67 aacguuguaa gguuaaagg 19 <210> 68 <211> 19 <212> RNA <213> Artificial Sequence <400> 68 uucuaccauu aaucccucc 19 <210> 69 <211> 19 <212> RNA <213> Artificial Sequence <400> 69 aauagaauga aacauggcc 19 <210> 70 <211> 19 <212> RNA <213> Artificial Sequence <400> 70 uuuaugugcu auggacagg 19 <210> 71 <211> 19 <212> RNA <213> Artificial Sequence <400> 71 uuguagccaa cauuagugc 19 <210> 72 <211> 19 <212> RNA <213> Artificial Sequence <400> 72 uuauaaugac auaggcugg 19 <210> 73 <211> 19 <212> RNA <213> Artificial Sequence <400> 73 uuaauagcga ggagucugc 19 <210> 74 <211> 19 <212> RNA <213> Artificial Sequence <400> 74 auauucuuug gcucccagc 19 <210> 75 <211> 19 <212> RNA <213> Artificial Sequence <400> 75 uuggaugcag gcuaugugc 19 <210> 76 <211> 19 <212> RNA <213> Artificial Sequence <400> 76 aauaaccgga uuguaaugc 19 <210> 77 <211> 19 <212> RNA <213> Artificial Sequence <400> 77 uuaagcccuc uuuaauacc 19 <210> 78 <211> 19 <212> RNA <213> Artificial Sequence <400> 78 uugauugaug uuggcgccc 19 <210> 79 <211> 19 <212> RNA <213> Artificial Sequence <400> 79 augauuucag gguccgugc 19 <210> 80 <211> 19 <212> RNA <213> Artificial Sequence <400> 80 uuguauucgg ccacgaucc 19 <210> 81 <211> 19 <212> RNA <213> Artificial Sequence <400> 81 uucaaaggca uuaccaccc 19 <210> 82 <211> 19 <212> RNA <213> Artificial Sequence <400> 82 uuuaaguuua guggcaagg 19 <210> 83 <211> 19 <212> RNA <213> Artificial Sequence <400> 83 uucgagacaa agaucaucc 19 <210> 84 <211> 19 <212> RNA <213> Artificial Sequence <400> 84 aaagugguuc uaguuacgg 19 <210> 85 <211> 19 <212> RNA <213> Artificial Sequence <400> 85 uucaucauca gauuagggc 19 <210> 86 <211> 19 <212> RNA <213> Artificial Sequence <400> 86 auaucaagag ggccugagg 19 <210> 87 <211> 19 <212> RNA <213> Artificial Sequence <400> 87 uucagcaaagu ccgguucc 19 <210> 88 <211> 19 <212> RNA <213> Artificial Sequence <400> 88 uugcucucaa gacuuaucc 19 <210> 89 <211> 19 <212> RNA <213> Artificial Sequence <400> 89 auuaagucgu ggcgguugc 19 <210> 90 <211> 19 <212> RNA <213> Artificial Sequence <400> 90 uuauguagga guuguaggc 19 <210> 91 <211> 19 <212> RNA <213> Artificial Sequence <400> 91 uuggugcaug auggauugc 19 <210> 92 <211> 19 <212> RNA <213> Artificial Sequence <400> 92 augaaagucg ccgauuugg 19 <210> 93 <211> 19 <212> RNA <213> Artificial Sequence <400> 93 uuuacgaggu aguugacgc 19 <210> 94 <211> 19 <212> RNA <213> Artificial Sequence <400> 94 uauuaguugc uuaaaccgc 19 <210> 95 <211> 19 <212> RNA <213> Artificial Sequence <400> 95 aagggaacca ugaucuugc 19 <210> 96 <211> 19 <212> RNA <213> Artificial Sequence <400> 96 aagcauuuca gugaacagg 19 <210> 97 <211> 19 <212> RNA <213> Artificial Sequence <400> 97 uuacaaaggg uagaagccc 19 <210> 98 <211> 19 <212> RNA <213> Artificial Sequence <400> 98 uguaagaaga cccguguug 19 <210> 99 <211> 19 <212> RNA <213> Artificial Sequence <400> 99 uuauacaugu cuucgucgg 19 <210> 100 <211> 19 <212> RNA <213> Artificial Sequence <400> 100 uuauaaugga cccucucaa 19 <210> 101 <211> 19 <212> RNA <213> Artificial Sequence <400> 101 uauguccaua aagguuugg 19 <210> 102 <211> 19 <212> RNA <213> Artificial Sequence <400> 102 uaaugucgua ugguauugg 19 <210> 103 <211> 19 <212> RNA <213> Artificial Sequence <400> 103 uucauaggug gguugaucc 19 <210> 104 <211> 19 <212> RNA <213> Artificial Sequence <400> 104 auguugcaua ggagagggc 19 <210> 105 <211> 19 <212> RNA <213> Artificial Sequence <400> 105 uuguuuaccu gcuguuugg 19 <210> 106 <211> 19 <212> RNA <213> Artificial Sequence <400> 106 uuauguccag auacguugc 19 <210> 107 <211> 19 <212> RNA <213> Artificial Sequence <400> 107 auccauugca gagguuugc 19 <210> 108 <211> 19 <212> RNA <213> Artificial Sequence <400> 108 uuguuguauc ccggcucau 19 <210> 109 <211> 19 <212> RNA <213> Artificial Sequence <400> 109 uaguuguugu aucccggcu 19 <210> 110 <211> 964 <212> DNA <213> Artificial Sequence <400> 110 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatggt gagcaagggc 60 gaggagctgt tcaccggggt ggtgcccatc ctggtcgagc tggacggcga cgtaaacggc 120 cacaagttca gcgtgtccgg cgagggcgag ggcgatgcca cctacggcaa gctgaccctg 180 aagttcatct gcaccaccgg caagctgccc gtgccctggc ccaccctcgt gaccaccctg 240 acctacggcg tgcagtgctt cagccgctac cccgaccaca tgaagcagca cgacttcttc 300 aagtccgcca tgcccgaagg ctacgtccag gagcgcacca tcttcttcaa ggacgacggc 360 aactacaaga cccgcgccga ggtgaagttc gagggcgaca ccctggtgaa ccgcatcgag 420 ctgaagggca tcgacttcaa ggaggacggc aacatcctgg ggcacaagct ggagtacaac 480 tacaacagcc acaacgtcta tatcatggcc gacaagcaga agaacggcat caaggtgaac 540 ttcaagatcc gccacaacat cgaggacggc agcgtgcagc tcgccgacca ctaccagcag 600 aacaccccca tcggcgacgg ccccgtgctg ctgcccgaca accactacct gagcacccag 660 tccgccctga gcaaagaccc caacgagaag cgcgatcaca tggtcctgct ggagttcgtg 720 accgccgccg ggatcactct cggcatggac gagctgtaca agtaataagt cccattcgcc 780 atgccgaagc atgttgccca gccggcgcca gcgaggaggc tgggaccatg ccggccaaca 840 ttgcatgctt ggtgttatct cttgaataac accaagcatg caatgtgcac cagccgggaa 900 tcgaacccgg gtctgtaccg tggcagggta ctattctacc actagaccac tggtgctttg 960 ttcg 964 <210> 111 <211> 748 <212> DNA <213> Artificial Sequence <400> 111 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacaatgga ccactacctc 60 gacattcgct tgcgaccgga cccggaattt cccccggcgc aactcatgag cgtgctcttc 120 ggcaagctcc accaggccct ggtggcacag ggcggggaca ggatcggcgt gagcttcccc 180 gacctcgacg aaagccgctc ccggctgggc gagcgcctgc gcattcatgc ctcggcggac 240 gaccttcgtg ccctgctcgc ccggccctgg ctggaagggt tgcgggacca tctgcaattc 300 ggagaaccgg cagtcgtgcc tcaccccaca ccgtaccgtc aggtcagtcg ggttcaggcg 360 aaaagcaatc cggaacgcct gcggcggcgg ctcatgcgcc ggcacgatct gagtgaggag 420 gaggctcgga aacgcattcc cgatacggtc gcgagagcct tggacctgcc cttcgtcacg 480 ctacgcagcc agagcaccgg acagcacttc cgtctcttca tccgccacgg gccgttgcag 540 gtgacggcag aggaaggagg attcacctgt tacgggttga gcaaaggagg tttcgttccc 600 tggttctgag tcccattcgc catgccgaag catgttgccc agccggcgcc agcgaggagg 660 ctgggaccat gccggccaac attgcatgct tggtgttatc tcttgaataa caccaagcat 720 gcaatgctgc ctatacggca gtgaaccg 748 <210> 112 <211> 9 <212> DNA <213> Artificial Sequence <400> 112 ttcaagaga 9 <210> 113 <211> 20 <212> DNA <213> Artificial Sequence <400> 113 gttgagccca atacgtcacc 20 <210> 114 <211> 20 <212> DNA <213> Artificial Sequence <400> 114 tctttccagc accgtaccat 20 <210> 115 <211> 25 <212> DNA <213> Artificial Sequence <400> 115 actgccaaac cggaagatct tccca 25 <210> 116 <211> 15 <212> DNA <213> Artificial Sequence <400> 116 gtgaagccac agatg 15 <210> 117 <211> 19 <212> DNA <213> Artificial Sequence <400> 117 gttttggcca ctgactgac 19 <210> 118 <211> 19 <212> RNA <213> Artificial Sequence <400> 118 uucauggaua ucaaugggc 19 <210> 119 <211> 19 <212> RNA <213> Artificial Sequence <400> 119 auaaugaguc ggugucacc 19 <210> 120 <211> 19 <212> RNA <213> Artificial Sequence <400> 120 aaauauagcc cgcaucagc 19 <210> 121 <211> 19 <212> RNA <213> Artificial Sequence <400> 121 aacacuucug cucaaaggg 19 <210> 122 <211> 19 <212> RNA <213> Artificial Sequence <400> 122 aaaucuccag uuacuucgc 19 <210> 123 <211> 19 <212> RNA <213> Artificial Sequence <400> 123 auacgugaag gaaagcugg 19 <210> 124 <211> 19 <212> RNA <213> Artificial Sequence <400> 124 uuaggucaac gaugggagc 19 <210> 125 <211> 19 <212> RNA <213> Artificial Sequence <400> 125 uauuuccucc gacucaagc 19 <210> 126 <211> 19 <212> RNA <213> Artificial Sequence <400> 126 aaaccguacg guuucaagc 19 <210> 127 <211> 19 <212> RNA <213> Artificial Sequence <400> 127 aaaggccaca caggcgugc 19 <210> 128 <211> 19 <212> RNA <213> Artificial Sequence <400> 128 uuucuguuug uuuggaugc 19 <210> 129 <211> 19 <212> RNA <213> Artificial Sequence <400> 129 auuaacauug gccgcucgc 19 <210> 130 <211> 19 <212> RNA <213> Artificial Sequence <400> 130 uucauaacua gaucggugg 19 <210> 131 <211> 19 <212> RNA <213> Artificial Sequence <400> 131 uugaucgucc cacaacggg 19 <210> 132 <211> 19 <212> RNA <213> Artificial Sequence <400> 132 auacgcugcu ugcaguugg 19 <210> 133 <211> 19 <212> RNA <213> Artificial Sequence <400> 133 aagcugcaug gcaguaucc 19 <210> 134 <211> 19 <212> RNA <213> Artificial Sequence <400> 134 aauaugauac cacaugcgg 19 <210> 135 <211> 19 <212> RNA <213> Artificial Sequence <400> 135 aaacucuggg agaaucugg 19 <210> 136 <211> 19 <212> RNA <213> Artificial Sequence <400> 136 uugguaagcu guucguugc 19 <210> 137 <211> 19 <212> RNA <213> Artificial Sequence <400> 137 uuucguucac gguuguugg 19 <210> 138 <211> 19 <212> RNA <213> Artificial Sequence <400> 138 aaauucagac gcaagcugc 19 <210> 139 <211> 19 <212> RNA <213> Artificial Sequence <400> 139 uugacuggcu gugcucugg 19 <210> 140 <211> 19 <212> RNA <213> Artificial Sequence <400> 140 aauucguaua caagcucgg 19 <210> 141 <211> 19 <212> RNA <213> Artificial Sequence <400> 141 uugacaagua aagcauggc 19 <210> 142 <211> 19 <212> RNA <213> Artificial Sequence <400> 142 cuugauugug cuuuaaagc 19 <210> 143 <211> 19 <212> RNA <213> Artificial Sequence <400> 143 auaggcucuc cuguggcgg 19 <210> 144 <211> 19 <212> RNA <213> Artificial Sequence <400> 144 uuaacauauc auggacagg 19 <210> 145 <211> 177 <212> DNA <213> Artificial Sequence <400> 145 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gcccattgca 120 tgcttggtgt tagacgagct tactcgtttc gtcctcacgg actcatcagt aacaccg 177 <210> 146 <211> 186 <212> DNA <213> Artificial Sequence <400> 146 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gcccattgca 120 tgcttggtgt tagacgagct tactcgtttc gtcctcacgg actcatcagt aacaccaagc 180 atgccg 186 <210> 147 <211> 216 <212> DNA <213> Artificial Sequence <400> 147 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg catgcttggt gttatacatc tgtggcttca ctatacacc aagcatgcaa tgacgagctt actcgtttcg tcctcacgga ctcatcagat tgcacg 216 <210> 148 <211> 217 <212> DNA <213> Artificial Sequence <400> 148 60. tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaataaca ccaagcatgc aatggtcagt cagtggcca aaccattgca tgcttggtgt tagcgagct tactcgtttc gtcctcacgg actcatcagt aacaccg 217 <210> 149 <211> 221 <212> DNA <213> Artificial Sequence <400> 149 60. tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaaaaaat aacaccaagc atgcaatggt cagtcagtgg ccaaaaccat tgcatgcttg gtgttagacg 180 agcttactcg tttcgtcctc acggactcat cagtaacacc g 221 <210> 150 <211> 207 <212> DNA <213> Artificial Sequence <400> 150 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 catgcttggt gttatctctt gaataacacc aagcatgcaa tggacgagct tactcgtttc 180 gtcctcacgg actcatcagc attgccg 207 <210> 151 <211> 211 <212> DNA <213> Artificial Sequence <400> 151 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaaaaaac 120 attgcatgct tggtgttatc tcttgaataa caccaagcat gcaatggacg agcttactcg 180 tttcgtcctc acggactcat cagcattgcc g 211 <210> 152 <211> 367 <212> DNA <213> Artificial Sequence <400> 152 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 catgcttggt gttatctctt gaataacacc aagcatgcaa tggacgagct tactcgtttc 180 gtcctcacgg actcatcagc attgcgtccc attcgccatg ccgaagcatg ttgcccagcc 240 ggcgccagcg aggaggctgg gaccatgccg gccaacattg catgcttggt gttatctctt 300 gaataacacc aagcatgcaa tggacgagct tactcgtttc gtcctcacgg actcatcagc 360 attgccg 367 <210> 153 <211> 527 <212> DNA <213> Artificial Sequence <400> 153 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 ttggacgagct tactcgtttc gtcctcacgg actcatcagc attgcgtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 catgcttggt gttatctctt gaataacacc aagcatgcaa tggacgagct tactcgtttc 180 ttggacgagct tactcgtttc gtcctcacgg actcatcagc attgcgtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 catgcttggt gttatctctt gaataacacc aagcatgcaa tggacgagct tactcgtttc 180 ttggacgagct tactcgtttc gtcctcacgg actcatcagc attgcgtccc attcgccatg 60 <210> 154 <211> 847 <212> DNA <213> Artificial Sequence <400> 154 ttggacgagct tactcgtttc gtcctcacgg actcatcagc attgcgtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 catgcttggt gttatctctt gaataacacc aagcatgcaa tggacgagct tactcgtttc 180 GTCCTCACGG ACTCATCAGC ATTGCGTCCC ATTCGCCATG CCGAAGCATG TTGCCCAGCC 240 GGCGCCAGCG AGGAGGCTGG GACCATGCCG GCCAACATCG CATGCTTGGT GTTATCTCTT 300 GAATAACACC AAGCATGCAA TGGACGAGCT TACTCGTTTC GTCCTCACGG ACTCATCAGC 360 ATTGCGTCCC ATTCGCCATG CCGAAGCATG TTGCCCAGCC GGCGCCAGCG AGGAGGCTGG 420 GACCATGCCG GCCAACATCG CATGCTTGGT GTTATCTCTT GAATAACACC AAGCATGCAA 480 TGGACGAGCT TACTCGTTTC GTCCTCACGG ACTCATCAGC ATTGCGTCCC ATTCGCCATG 540 CCGAAGCATG TTGCCCAGCC GGCGCCAGCG AGGAGGCTGG GACCATGCCG GCCAACATCG 600 CATGCTTGGT GTTATCTCTT GAATAACACC AAGCATGCAA TGGACGAGCT TACTCGTTTC 660 GTCCTCACGG ACTCATCAGC ATTGCGTCCC ATTCGCCATG CCGAAGCATG TTGCCCAGCC 720 GGCGCCAGCG AGGAGGCTGG GACCATGCCG GCCAACATCG CATGCTTGGT GTTATCTCTT 780 GAATAACACC AAGCATGCAA TGGACGAGCT TACTCGTTTC GTCCTCACGG ACTCATCAGC 840 ATTGCCG 847 <210> 155 <211> 241 <212> DNA <213> Artificial Sequence <400> 155 tgatggttcc gtggcaaccc ctttaaccag agtttcagcg gaacagtccc attcgccatg 60 ccgaagcatg ttgcccagcc ggcgccagcg aggaggctgg gaccatgccg gccaacattg 120 catgcttggt gttatctctt gaataacacc aagcatgcaa tgtgcaccag ccgggaatcg 180 aacccgggtc tgtaccgtgg cagggtacta ttctaccact agaccactgg tgctttgttc 240 g 241 <210> 156 <211> 77 <212> DNA <213> Artificial Sequence <400> 156 tgcaccagcc gggaatcgaa cccgggtctg taccgtggca gggtactatt ctaccactag 60 accactggtg ctttgtt 77 <210> 157 <211> 564 <212> DNA <213> Artificial Sequence <400> 157 atggaccact acctcgacat tcgcttgcga ccggacccgg aatttccccc ggcgcaactc 60 atgagcgtgc tcttcggcaa gctccaccag gccctggtgg cacagggcgg ggacaggatc 120 ggcgtgagct tccccgacct cgacgaaagc cgctcccggc tgggcgagcg cctgcgcatt 180 catgcctcgg cggacgacct tcgtgccctg ctcgcccggc cctggctgga agggttgcgg 240 gaccatctgc aattcggaga accggcagtc gtgcctcacc ccacaccgta ccgtcaggtc 300 agtcgggttc aggcgaaaag caatccggaa cgcctgcggc ggcggctcat gcgccggcac 360 gatctgagtg aggaggaggc tcggaaacgc attcccgata cggtcgcgag agccttggac 420 ctgcccttcg tcacgctacg cagccagagc accggacagc acttccgtct cttcatccgc 480 cacgggccgt tgcaggtgac ggcagaggaa ggaggattca cctgttacgg gttgagcaaa 540 ggaggtttcg ttccctggtt ctga 564 <210> 158 <211> 20 <212> DNA <213> Artificial Sequence <400> 158 ctgcctatac ggcagtgaac 20 <210> 159 <211> 8 <212> DNA <213> Artificial Sequence <400> 159 ttgaacca 8 <210> 160 <211> 7 <212> DNA <213> Artificial Sequence <400> 160 taaccat 7 <210> 161 <211> 7 <212> DNA <213> Artificial Sequence <400> 161 ttgacca 7 <210> 162 <211> 11 <212> DNA <213> Artificial Sequence <400> 162 attagcctgt c 11 <210> 163 <211> 8 <212> DNA <213> Artificial Sequence <400> 163 tttaacca 8 <210> 164 <211> 6 <212> DNA <213> Artificial Sequence <400> 164 taacca 6

Claims

1. A method for delivering interfering RNA using a cytoplasmic RNA virus as a vector, characterized in that, The method is for non-disease diagnosis or treatment purposes, and the method comprises: using a cytoplasmic RNA virus as a carrier, inserting an RNA sequence with RNA cleavage activity at both ends of an interfering RNA sequence; wherein, The cytoplasmic RNA virus is a porcine reproductive and respiratory syndrome virus (PRRSV), and the interfering RNA is an interfering RNA of an African swine fever virus; The RNA sequence with RNA cleavage activity is a ribozyme; when the RNA sequence with RNA cleavage activity is inserted at both ends of the interfering RNA sequence, the RNA sequence with RNA cleavage activity is a different ribozyme; When different ribozymes are inserted at both ends of the interfering RNA sequence, the method comprises: inserting a hepatitis delta virus (HDV) ribozyme and a hammerhead (HH) ribozyme at both ends of the interfering RNA sequence, respectively; The method comprises constructing an expression framework of the interfering RNA, and the expression framework of the interfering RNA is selected from sequences with the following sequence characteristics: TRS6-EGFP-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNAL-HH; TRS6-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-EGFP-(HDV-shRNA-HH)*5; TRS6-HDV-shRNAL-HH; TRS6-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-HDV-shRNA-HH-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-(HDV-shRNA-HH)*5; The method comprises: the interfering RNA is a sequence as shown in any one of SEQ ID NO: 48, SEQ ID NO: 51, SEQ ID NO: 53, SEQ ID NO: 56-59, SEQ ID NO: 62-64, SEQ ID NO: 66-67, SEQ ID NO: 71, SEQ ID NO: 80, SEQ ID NO: 83-100, SEQ ID NO: 102-103, SEQ ID NO: 107-109, SEQ ID NO: 118-119, SEQ ID NO: 121, SEQ ID NO: 130-135, SEQ ID NO: 139-144. The method further comprises: the interfering RNA sequence is inserted into a cytoplasmic RNA virus genome.

2. The method of claim 1, wherein, The method further comprises:

3. The method of claim 1, wherein, 1) selecting different target genes according to different indications; 2) designing an interfering RNA sequence according to a target gene sequence, chemically synthesizing an siRNA oligo, and verifying the interfering activity of the siRNA oligo on the target gene in vitro; ​ 3) Designing shRNA sequence according to siRNA sequence; 4) Inserting ribozyme at both ends of siRNA sequence or shRNA sequence, and then constructing the DNA sequence corresponding to the obtained RNA sequence into cytoplasmic RNA virus expression vector; 5) Obtaining recombinant live virus through virus rescue.

4. The method of claim 3, wherein, The interference activity of siRNA oligo to target gene in step 2) is further verified in vitro, which comprises the following steps: chemically synthesizing target gene, adding enzyme cutting site and protection base to upstream and downstream primers of target gene through PCR method, double enzyme cutting PCR fragment and vector, and connecting to obtain vector with target gene.

5. The method of claim 3, wherein, The method further comprises the following steps in step 2): designing interference RNA sequence for each target gene, adding two deoxythymidine nucleotides as antisense strand of small interfering nucleic acid sequence to 3' end of interference sequence, and adding two deoxythymidine nucleotides as sense strand of small interfering nucleic acid sequence to 3' end of complementary sequence of the interference sequence, and chemically synthesizing oligo.

6. The method of claim 3, wherein, The method further comprises the following steps in step 2): (2-1) Culturing 293T cells in culture medium until the cells are 80-90% confluent, pouring off the culture medium, and washing the cells with PBS; (2-2) Adding Trypsin-EDTA solution, mixing, then aspirating the trypsin solution, and placing at 37℃; (2-3) Adding complete culture medium, and blowing to form single-cell suspension; (2-4) Counting with a hemocytometer, seeding about 1 x 10 5 cells per well in a 24-well plate; (2-5) Dissolving 1 OD260 oligo in DEPC-H2O to obtain a final concentration of about 20 μM; (2-6) Transfection method of Lipo2000: transfection method of three repeated holes in each group: adding Opti-MEM I into an EP tube, then adding target gene plasmid and corresponding oligo, mixing; adding Opti-MEM I and transfection reagent lipo2000 into another EP tube, mixing, then mixing the two after standing, and standing at room temperature; (2-7) During the period, removing the culture medium in the 24-well plate prepared the day before, and adding culture medium; after standing, adding the transfection mixture into the above 24-well plate, 100 μl / hole, setting 3 repeats, shaking the hole plate, and incubating in the incubator for 6 hours; (2-8) Removing the transfection liquid, rinsing with PBS, and then adding culture medium for continuous culture; (2-9) Collecting cells 24 hours after transfection, and performing dual luciferase detection.

7. The method of claim 3, wherein, The method further comprises the following steps in step 3): using siRNA complementary sequence as sense strand, using shRNA commonly used loop ring (TTCAAGAGA), mir30 loop ring sequence (GTGAAGCCACAGATG), or mir155 loop ring sequence (GTTTTGGCCACTGACTGAC) as siRNA sequence, and adding two deoxythymidine nucleotides to 3' end.

8. The method of claim 3, wherein, The method further comprises the following steps in step 5): (5-1) Seed healthy cells into 6-well plates at a density of 5 × 10⁻⁶. 5 Cells / ml, 2ml of cells per well, and incubated in a 37℃ CO2 incubator for 24h; (5-2) When the cell confluence reaches about 80%, discarding the supernatant culture medium, washing twice with PBS, and adding DMEM maintenance liquid containing 3% FBS; (5-3) According to the cell and plasmid, select the appropriate transfection reagent, according to the transfection reagent instructions, respectively, the cell cytoplasmic RNA virus expression vector with ribozyme at both ends or shRNA fragment and RFP-target gene virus expression vector are transfected, 96h after transfection, observe the change of cell morphology, have vacuoles and other lesions, recorded as P0 generation; (5-4) The P0 generation virus liquid is used to infect the re-plate cell with a multiplicity of infection of 0.1, and the cell is placed in a-20℃ refrigerator for repeated freeze-thawing three times, and the virus liquid obtained by centrifugation at 800g for 5min is recorded as P1 generation virus; (5-5) The P1 generation virus is further subcultured according to the method of (5-4), and is sequentially subcultured to P3 generation, and the cell containing P3 generation virus is placed in a-20℃ refrigerator for repeated freeze-thawing three times, and the P3 generation virus obtained by centrifugation at 800g for 5min is stored in a-80℃ refrigerator for standby.

9. The method according to any one of claims 1 to 8, characterized in that, The method further comprises: constructing an interference RNA expression framework: a) inserting an RNA sequence with RNA cleavage activity at both ends of the interference RNA sequence; b) then combining the interference RNA obtained in step a) with TRS (transcription regulatory sequence); or further inserting EGFP or Csy4 exogenous enzyme, or a combination of both, between the interference RNA and the TRS; The interference RNA expression framework is inserted into the negative strand of the PRRSV viral genome.

10. The method of claim 9, wherein, The target gene of the interference RNA is selected from the following genes of African swine fever virus: O174L, EP296R, E165R, K196R, EP152R, CP204L, A240L, MGF360-10L, MGF360-13L, MGF360-14L, MGF360-18R, MGF505-1R, MGF505-2R, MGF505-3R, S273R, CP530R, NP419L, G1211R, F1055L, I243L, D250R, M448R, or pA104R.

11. The method of claim 1, wherein, The interference RNA expression framework in the method is selected from the sequences with the following sequence characteristics: TRS6-EGFP-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNAL-HH; TRS6-HDV-shRNA-HHL; TRS6-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA-HH; TRS6-EGFP-HDV-shRNA-HH-HDV-shRNA-HH-HDV-shRNA-HH; or TRS6-EGFP-(HDV-shRNA-HH)*5.

12. The method of claim 11, wherein, The interference RNA expression framework in the method is selected from the sequences with the following sequence characteristics: TRS6-HDV-shRNA-HHL.

13. The method of claim 11, wherein the sequence of the interfering RNA expression framework in the method is obtained after transcription from a sequence selected from any one of the following: SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO:

46.

14. The method of claim 12, wherein the sequence of the interfering RNA expression framework in the method is obtained after transcription from a sequence selected from the following: SEQ ID NO:

44.

15. The method of claim 1, wherein, The interfering RNA expression framework in the method is selected from a sequence having the following sequence characteristics: TRS6-HDV-shRNA L-HH; TRS6-HDV-shRNA-HH-HDV-shRNA -HH; TRS6-HDV-shRNA-HH-HDV-shRNA -HH-HDV-shRNA -HH; TRS6-(HDV-shRNA -HH)*5.

16. The method of claim 15, wherein, The interfering RNA expression framework in the method is selected from a sequence having the following sequence characteristics: TRS6-(HDV-shRNA -HH)*5.

17. The method of claim 15, wherein, The sequence of the interfering RNA expression framework in the method is obtained after transcription from a sequence selected from any one of the following: SEQ ID NO: 150, SEQ ID NO: 152-SEQ ID NO:

154.

18. The method of claim 16, wherein, The sequence of the interfering RNA expression framework in the method is obtained after transcription from a sequence selected from the following: SEQ ID NO:

154.

19. The use of the interfering RNA-PRRSV virus prepared by the method of any one of claims 1-18 in the preparation of a medicament for the treatment or prevention of African swine fever.

20. The use of the interfering RNA-cytoplasmic RNA virus prepared by the method of any one of claims 1-18 in the preparation of a medicament for the treatment or prevention of African swine fever.

21. An interfering RNA-PRRSV viral medicament for treating or preventing African swine fever, characterized in that, prepared according to the method of any one of claims 1-18.

22. An antiviral drug or interfering RNA drug, characterized in that, prepared according to the method of any one of claims 1-18.

23. A pharmaceutical composition comprising, in combination, a compound of any one of claims 1-22 and a pharmaceutically acceptable carrier. containing the medicament of any one of claims 21-22.

Images