Molecular markers and specific primers for the wheat storage protein, starch and grain weight regulatory gene TaB3-2A1 and their applications

Abstract

The present invention discloses a molecular marker and specific primers for wheat storage protein, starch and grain weight regulatory gene TaB3-2A1 and its application. The present invention provides a material for detecting the genotype of the 523rd SNP site of the TaB3-2A1 gene in the wheat genome for use in identifying or assisting in identifying the storage protein content and / or starch content and / or 1000-grain weight of the wheat grain to be tested; the SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table. Experiments of the present invention have shown that TaB3-2A1-KASP 523A / T Molecular markers have a good correlation with grain storage protein content, starch content, and grain weight phenotypes, and can be used as molecular markers for grain storage protein content, starch content, and grain weight phenotypes to assist in wheat germplasm improvement. This identification can better meet the needs of wheat quality improvement and meet the needs of the public on a larger scale.

Description

Technical Field

[0001] The present invention belongs to the field of agricultural biotechnology, and specifically relates to wheat storage protein, starch and grain weight regulating genes. TaB3-2A1 Molecular markers and specific primers and their applications. Background Art

[0002] Wheat is the world's largest staple food crop and the most important source of staple food in my country. In the past, due to factors such as a large population, limited land, and low yields, my country has always regarded increasing yield as the main breeding goal and neglected quality improvement. In recent years, with the improvement of people's living standards, the cultivation of high-quality wheat varieties has also become an important breeding goal, so the coordinated improvement of yield and quality is an important issue we face. Starch accounts for about 70% of wheat grains and protein accounts for about 12-14%, and both together determine quality and yield. Coordinated regulation of starch and protein content and component composition in grains is crucial for the coordinated improvement of wheat quality and yield. Therefore, exploring the genetic loci of genes regulating multiple traits of wheat storage protein, starch, and grain weight has important practical application value. Summary of the Invention

[0003] In order to develop SNP molecular markers for low storage protein content and / or high starch content and / or high thousand-grain weight in wheat, the present invention provides the following technical solutions:

[0004] The present invention provides a method for detecting TaB3-2A1 Use of a substance that identifies the genotype of the 523rd SNP site of a gene in identifying or assisting in identifying the storage protein content and / or starch content and / or thousand-grain weight of wheat grains to be tested;

[0005] The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table.

[0006] In the above application, the genotype of the SNP site is TT or AA.

[0007] Or the present invention provides a method for detecting TaB3-2A1 Application of a material having a genotype at the 523rd SNP site of a gene in breeding wheat with low storage protein content and / or high starch content and / or high thousand-grain weight;

[0008] The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table.

[0009] In the above application, the detection of wheat genome TaB3-2A1 The genotype of the 523rd SNP site of the gene is as follows 1) or 2):

[0010] 1) KASP primer set,

[0011] The KASP primer set consists of a single-stranded DNA molecule or a derivative thereof shown in sequence 1 in the sequence listing, a single-stranded DNA molecule or a derivative thereof shown in sequence 2 in the sequence listing, and a single-stranded DNA molecule or a derivative thereof shown in sequence 3 in the sequence listing;

[0012] 2) A PCR reagent or kit containing the primer set. In the above kit, the different primers in the KASP primer set are packaged separately.

[0013] The above kit may also include other conventional reagents for PCR amplification and other conventional reagents for genome extraction and corresponding PCR programs.

[0014] The PCR amplification reagents also include a specific probe set. The specific probe set includes fluorescent probe A and fluorescent probe B; fluorescent probe A is shown as sequence 5 in the sequence listing, with a fluorescent group attached to its 5' end; fluorescent probe B is shown as sequence 6 in the sequence listing, with a fluorescent group attached to its 5' end; the fluorescent groups in fluorescent probe A and fluorescent probe B are different; fluorescent probe A is specifically attached to a FAM fluorescent group; and fluorescent probe B is specifically attached to a HEX fluorescent group.

[0015] The reagents for the PCR amplification include KASP 2×Master Mix.

[0016] Amplification was performed using the KASP primer set. The PCR program was as follows: 94°C for 15 minutes, 10 cycles of 94°C for 20 seconds, 61-55°C for 1 minute (with a 0.6°C decrease between cycles), and 26 cycles of 94°C for 20 seconds, 55°C for 60 seconds. Fluorescence typing of PCR products was performed using a microplate reader with FAM HEX ROM beam scanning and Kluster Caller typing software.

[0017] In the above application, the derivative of the single-stranded DNA molecule shown in Sequence 1 in the sequence listing is a DNA molecule in which one or more nucleotides are substituted and / or deleted and / or added to the single-stranded DNA molecule shown in Sequence 1 and which has the same function as Sequence 1;

[0018] The derivatives of the single-stranded DNA molecule shown in Sequence 2 in the sequence list are as follows 1) or 2):

[0019] 1) A fluorescent sequence or fluorescent group is connected to the 5' end of the single-stranded DNA molecule shown in sequence 2;

[0020] 2) The single-stranded DNA molecule shown in sequence 2 has one or more nucleotides substituted and / or deleted and / or added, and the 5' end of the DNA molecule having the same function as sequence 2 is connected to a fluorescent sequence or fluorescent group;

[0021] The derivatives of the single-stranded DNA molecule shown in Sequence 3 in the sequence list are as follows 3) or 4):

[0022] 3) The 5' end of the single-stranded DNA molecule shown in Sequence 3 is connected to another fluorescent sequence or fluorescent group;

[0023] 4) The single-stranded DNA molecule shown in Sequence 3 has one or more nucleotides substituted and / or deleted and / or added, and the 5' end of the DNA molecule having the same function as Sequence 3 is connected to another fluorescent sequence or fluorescent group;

[0024] The fluorescent group is FAM or HEX.

[0025] Furthermore, the above detection of wheat genome TaB3-2A1 The genotype of the 523rd SNP site of the gene is the molecular marker TaB3-2A1-KASP 523A / T The molecular marker is 1) the KASP primer set or 2) a PCR reagent or kit containing the primer set.

[0026] The present invention also provides a method for identifying or assisting in identifying the storage protein content and / or starch content and / or thousand-grain weight of wheat grains to be tested, which is used to detect the content of storage protein and / or starch content and / or thousand-grain weight in the wheat genome. TaB3-2A1 The genotype of the 523rd SNP site of the gene is AA homozygous or TT homozygous. The grain storage protein content and / or starch content and / or 1000-grain weight of TT homozygous wheat are better than those of AA homozygous wheat.

[0027] in TaB3-2A1 The starch content and / or thousand-grain weight of the wheat grains of the test wheat with the genotype of the TT homozygous type at the 532nd SNP site of the gene are higher than those of the test wheat with the AA homozygous type. TaB3-2A1 The storage protein content of the tested wheat grains whose genotype at the 532nd SNP site of the gene is TT homozygous is lower than that of the tested wheat grains whose genotype is AA homozygous;

[0028] The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table in the wheat genome.

[0029] Alternatively, the present invention also provides a method for breeding wheat with low storage protein content and / or high starch content and / or high thousand-grain weight, for detecting TaB3-2A1 The genotype of the 523rd SNP site of the gene is AA homozygous or TT homozygous;

[0030] Breeding wheat to be tested whose SNP locus genotype is homozygous for TT, to obtain wheat with low storage protein content and / or high starch content and / or high thousand-grain weight;

[0031] The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table.

[0032] In the above method, the detection of wheat genome TaB3-2A1 The method for determining whether the genotype of the 523rd SNP site of the gene is AA homozygous or TT homozygous is as follows: A) or B):

[0033] A) Direct sequencing;

[0034] B) Performing KASP detection on the wheat genomic DNA to be tested using the above primer set to achieve genotyping.

[0035] The above method for identifying or assisting in identifying the storage protein content and / or starch content and / or thousand-grain weight of the wheat grains to be tested specifically comprises the following steps:

[0036] (1) Using the genomic DNA of the wheat to be tested as a template, perform KASP using the above primer set;

[0037] (2) After completing step (1), perform fluorescence scanning to determine the wheat to be tested based on TaB3-2A1 The genotype of the 523rd SNP site of the gene;

[0038] (3) Judging based on genotype results: The grain characteristics of TT homozygous wheat are characterized by low storage protein content and / or high starch content and / or high thousand-grain weight.

[0039] The above method for breeding wheat with low storage protein content and / or high starch content and / or high thousand-grain weight specifically comprises the following steps:

[0040] (1) Using the genomic DNA of the wheat to be tested as a template, perform KASP using the above primer set;

[0041] (2) After completing step (1), perform fluorescence scanning to determine the wheat to be tested based on TaB3-2A1 The genotype of the 523rd SNP site of the gene;

[0042] (3) Select TT homozygous wheat for breeding.

[0043] The purpose of the breeding is to breed wheat with low storage protein content and / or high starch content and / or high thousand-grain weight.

[0044] The purpose of the breeding is to breed wheat with low storage protein content, high starch content and high thousand-grain weight.

[0045] In any of the above methods, the wheat to be tested is determined based on TaB3-2A1The genotype of the 532nd SNP site of the gene was determined by scanning the FAM VIC ROM beam of an enzyme reader and typing the scanned data using Kluster Caller typing software. The genotype of the sample displayed in blue is AA homozygous, the genotype of the sample displayed in red is TT homozygous, and the black dots represent the genotype of the negative control using water.

[0046] In any of the above methods, in the KASP reaction system, the concentration of primer A is 30 μM / μl, the concentration of primer B is 12 μM / μl, and the concentration of primer C is 12 μM / μl.

[0047] In any of the above methods, the reaction procedure of KASP is: 94°C for 15 min; 94°C for 20 s, 61-55°C for 1 min (0.6°C decrease per cycle), 10 cycles; 94°C for 20 s, 55°C for 60 s, 26 cycles.

[0048] Any of the above-mentioned SNP sites is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the Sequence Listing in the wheat genome. The SNP site is an A / T polymorphism.

[0049] The present invention also provides a product for identifying or assisting in identifying the storage protein content and / or starch content and / or thousand-grain weight of wheat to be tested, which is used for detecting the content of wheat in the genome in the above application. TaB3-2A1 The material of the genotype of the 523rd SNP site of the gene.

[0050] The present invention also provides an application of the above product, which is at least one of the following (c1) to (c12):

[0051] (c1) Identification of TaB3-2A1 The genotype of the 523rd SNP site of the gene;

[0052] (c2) Identification or assistance in identification of storage protein content traits in wheat;

[0053] (c3) Identification or assistance in identification of starch content traits in wheat;

[0054] (c4) Identification or assistance in identification of wheat grain weight traits;

[0055] (c5) Screening or breeding of wheat genome TaB3-2A1 A wheat plant, line, variety, or cultivar with a genotype of TT homozygous at the 523rd SNP site of the gene;

[0056] (c6) Identify or assist in identifying TaB3-2A1 A wheat plant, line, variety, or cultivar with a genotype of TT homozygous at the 523rd SNP site of the gene;

[0057] (c7) Preparation for identification of wheat based TaB3-2A1 The product of the genotype of the 523rd SNP site of the gene;

[0058] (c8) Preparation of products for identifying or assisting in identifying storage protein content traits in wheat;

[0059] (c9) Preparation of products for identifying or assisting in identifying the starch content traits of wheat;

[0060] (c10) Preparation of products for identifying or assisting in identifying the grain weight trait of wheat;

[0061] (c11) Preparation for identification or auxiliary identification of wheat genome TaB3-2A1 The product of a wheat plant, line, strain or variety with the genotype of the 523rd SNP site of the gene being the TT homozygous type;

[0062] (c12) Assisted selection of wheat lines with high yield and weak gluten, suitable for processing biscuits and cakes;

[0063] The TaB3-2A1-KASP site is the 523rd nucleotide in the nucleotide sequence shown in Sequence 4 of the sequence table in the wheat genome.

[0064] The present invention screened out different haplotype germplasm resources from 149 natural varieties in the Huanghuai wheat region. TaB3- 2A1 The SNPs at 523 and 573 in the gene coding region are located in the functional conserved region of the gene. Molecular markers were further developed based on these two variant sites. It was found that the marker TaB3-2A1-KASP developed based on the 523 SNP 523A / T Typing was successful. Further molecular marker TaB3-2A1-KASP was used 523A / T PCR amplification of wheat genomic DNA using the primers (sequences 1, 2, and 3) is performed. If the genotype of the target SNP in the PCR amplification product is homozygous for TT, the wheat being tested belongs to the haplotype TaB3-2A1-Hap1. This type of germplasm is considered an excellent resource with low storage protein content, high starch content, and high 1000-grain weight. This identification can better meet the needs of wheat quality improvement and more widely meet the needs of the public. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] Figure 1 for TaB3-2A1 Discovery and identification of allelic variations;

[0066] Figure 2 Molecular marker TaB3-2A1-KASP 523A / TGenotyping of 149 representative wheat lines from the Huanghuai wheat region;

[0067] Figure 3 T aB3-2A1 Effects of allelic variation on storage protein, starch content and thousand-grain weight. DETAILED DESCRIPTION

[0068] The present invention will be further described in detail below in conjunction with specific embodiments. The examples given are only for illustrating the present invention, not for limiting the scope of the present invention.

[0069] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0070] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0071] Example 1 TaB3-2A1 Identification of allelic variants

[0072] 1. Transcription factor encoding genes TaB3-2A1 (ID: TraesCS2A02G159800) was input into the wheat genome variation database, which contains 677 wheat resequencing data (Wheat-SnpHub-Portalhttp: / / wheat.cau.edu.cn / Wheat_SnpHub_Portal / ). According to the resequencing data, TaB3-2A1 There are 11 SNPs in the coding region and the interval of 1000 bp upstream and downstream, which form two major haplotypes TaB3-2A1-Hap1 and TaB3-2A1-Hap2 ( Figure 1 ), the typing exists in 91 and 45 varieties. Figure 1 The top part shows TaB3-2A1 Sequence variation: 4 SNPs occurred upstream of the promoter; 4 SNPs also occurred in the exons, all of which caused amino acid changes, 2 of which were located in TaB3-2A1 Conserved DNA binding regions, so they are more likely to affect gene function; there are three SNPs in the 3′UTR; Figure 1 The lower part shows TaB3-2A1 Differences in the encoded amino acids between the two haplotypes.

[0073] Because it is located TaB3-2A1 SNPs in the conserved DNA binding region are more likely to affect gene function. Therefore, this application developed molecular markers based on them for haplotype identification. The two SNP sites were named SNP 523A / T and SNP 573A / T ;

[0074] SNP 523A / T It is the 523rd position of sequence 4, and its genotype is AA or TT;

[0075] SNP 573A / T It is position 573 of sequence 4, and its genotype is AA or TT.

[0076] Example 2 TaB3-2A1 Molecular marker TaB3-2A1-KASP 523A / T Development and establishment of methods

[0077] Given that TaB3-2A1 The SNPs at 523 and 573 in the gene coding region are located in the functional conserved region of the gene. Molecular markers were developed based on these two variant sites, and the marker TaB3-2A1-KASP developed based on the 523 SNP was found. 523A / T The classification was successful.

[0078] one, TaB3-2A1 Development of molecular markers

[0079] 1. Molecular marker TaB3-2A1-KASP 523A / T Development

[0080] The specific steps are as follows:

[0081] (1) Obtained from the wheat omics website (http: / / 202.194.139.32 / getfasta / index.html) TaB3-2A1 The full-length sequence of the gene's open reading frame, with 523 SNPs annotated in the sequence (n represents A or T at position 523 in SEQ ID NO: 4). Compare to sequences with high homology or similarity to this DNA segment on the GSP website (http: / / probes.pw.usda.gov / GSP / index.php).

[0082] (2) Determine the specific site of the target DNA segment based on the comparison results, and design a common primer accordingly. The common primer (sequence 1) is designed.

[0083] (3) Design upstream primers with the SNP as the 3' end, as shown in Sequence 5 and Sequence 6.

[0084] (4) GAAGGTGACCAAGTTCATGCT was added to the 5' end of sequence 5 to serve as the FAM primer in the KASP primer (sequence 2), and GAAGGTCGGAGTCAACGGATT was added to the 5' end of sequence 6 to serve as the HEX primer in the KASP primer (sequence 3).

[0085] Common primers and the FAM and HEX primers in the KASP primers constitute the molecular marker TaB3-2A1-KASP 523A / T .

[0086] The 5' end of the FAM primer (sequence 2) is labeled with a FAM fluorescent group, and the reading is observed at an excitation wavelength of 485 nm and an emission wavelength of 520 nm; the 5' end of the HEX primer is labeled with a HEX fluorescent group, and the reading is observed at an excitation wavelength of 528 nm and an emission wavelength of 560 nm.

[0087] 2. Molecular marker TaB3-2A1-KASP 573A / T Development

[0088] The primers were designed using the same primer design method as above. The primers for KASP at position 573 were:

[0089] COMMON' primer: ctcaataaccTgctgtcctcT

[0090] FAM' primer: CGAAGGTGACCAAGTTCATGCTcagcaAgCTacccgtggC

[0091] HEX' Primer:

[0092] GAAGGTCGGAGTCAACGGATTcagcaAgCTacccgtggT

[0093] The COMMON' primer and the FAM' and HEX' primers in the KASP primers constitute the molecular marker TaB3-2A1-KASP 573A / T However, the molecular marker was not successfully typed.

[0094] two, TaB3-2A1 Molecular marker TaB3-2A1-KASP 523A / T Classification

[0095] Molecular marker TaB3-2A1-KASP 523A / T PCR amplification system: PCR reactions were performed in 384-well plates. Each reaction volume was approximately 3 µl, including 20–30 ng of pre-dried genomic DNA as a template, 1.5 µl of 2× KASP mastermix (V4.0, LGC, Genomics, Hoddesdon, UK), 0.0336 µl of primer mixture (including three primers, with a common primer concentration of 30 μM and final concentrations of HEX and FAM primers of 12 μM each), and 1.5 µl of deionized water.

[0096] Amplification program: 94°C for 15 min; 94°C for 20 s, 61-55°C for 1 min (0.6°C decrease per cycle), 10 cycles; 94°C for 20 s, 55°C for 60 s, 26 cycles.

[0097] Specifically, the PCR amplification products can be typed and detected through the FAM HEX ROM beam scanning of the enzyme reader and the KlusterCaller typing software.

[0098] The information of the above-mentioned microplate reader is as follows: PHERAstar plus BMG LABTECH GmbH Allmendgruren877799 Ortenberg Germany (BMG LABTECH, Ortenberg, Germany)

[0099] Software information is as follows: KlusterCaller™ (LGC) (WWW.LGCgroup.com / software).

[0100] Example 3, TaB3-2A1-KASP 523A / T Application in identification of storage protein, starch content and thousand-grain weight

[0101] 1. Field phenotyping and data analysis of 149 natural populations in the Huanghuai wheat region

[0102] A total of 149 natural wheat varieties from the Huanghuai wheat region were planted in Anyang, Henan, and Suixi, Anhui, in 2012-2013 and 2013-2014, and in Anyang, Henan, and Gaoyi, Hebei, in 2014-2015. A complete randomized block design with three replications was used, with single-row plots, 1.5 m long and 0.2 m wide, and 50 seeds per row. Field management practices followed local wheat field management practices. Thousand-grain weight was collected using the Hangzhou Wanshen SC-G Seed Testing System (http: / / hzwseen.foodmate.net), and storage protein content (14% wet basis) was analyzed using a Perten DA 7200 near-infrared reflectance spectrometer (Perten, Springfield, IL, USA). Starch content was determined using the national standard method (GB5009.9-2016, https: / / max.book118.com / html / 2018 / 1020 / 5314011304001322). T-tests were performed using R version 3.6.1. The average phenotypic data for storage protein, starch content, and 1000-grain weight across multiple environments are shown in Table 1.

[0103] 2. Molecular labeling of TaB3-2A1-KASP523A / T Detection of genotypes and analysis of genetic effects of wheat varieties in the Huanghuai region

[0104] The genomic DNA of natural wheat varieties in the Huanghuai region was extracted as a template and the molecular marker TaB3-2A1-KASP was used. 523A / T The primers (sequences 1, 2, and 3) were used for PCR amplification according to the PCR system and procedure in Example 1 (II), wherein the PCR amplification system and reaction conditions were the same as those in Example 2 (II), to obtain a PCR amplification product.

[0105] The signal was detected by scanning the FAM HEX ROM beam of the microplate reader and Kluster Caller typing software to identify TaB3-2A1-KASP. 523A / T The genotype results are shown in Table 1 and Figure 2 shown. Figure 2 The red dots represent genotypes containing the haplotype TaB3-2A1-Hap1; the blue dots represent genotypes containing the haplotype TaB3-2A1-Hap2; and the black dots represent genotypes using water as a negative control.

[0106] The T test was performed using R (version 3.6.1) statistical software based on the typing results and phenotypic data. TaB3-2A1 Genetic effects on storage protein, starch content and thousand-grain weight.

[0107] The above results show that if the genotype of the target SNP in the PCR amplification product is TT homozygous, the wheat to be tested belongs to the haplotype TaB3-2A1-Hap1, and this type of germplasm resource is an excellent germplasm resource with low storage protein content, high starch content, and high 1000-grain weight; if the genotype of the target SNP in the PCR amplification product is AA homozygous, the wheat to be tested belongs to the haplotype TaB3-2A1-Hap2 type, and this type of germplasm resource is an inferior germplasm resource with high storage protein content, low starch content, and low 1000-grain weight. The genetic analysis results of storage protein, starch, and 1000-grain weight are as follows: Figure 3 shown. Figure 3 The statistical comparison of seed protein content, starch content, and thousand-kernel weight between the two haplotypes TaB3-2A1-Hap1 and TaB3-2A1-Hap2 is shown. * indicates significant difference ( P <0.05, ns means the difference is not significant ( P >0.05).

[0108] Table 1 Molecular marker TaB3-2A1-KASP 523A / TGenotyping and phenotyping data of 149 representative wheat lines from the Huanghuai wheat region

[0109]

[0110]

[0111]

[0112]

[0113]

[0114] Table 1 shows representative main varieties, all of which have been artificially selected for key traits. Because phenotypic variation among varieties is small, phenotypic differences between genotypes are more likely to be statistically significant.

[0115] Therefore, we can use TaB3-2A1 Molecular marker TaB3-2A1-KASP 523A / T The storage protein content and / or starch content and / or thousand-grain weight of the wheat to be tested are determined by the following method:

[0116] The COMMON primers and the FAM primers and HEX primers in the KASP primers were used to amplify the wheat genomic DNA to be tested.

[0117] If the genotype of the target SNP in the PCR amplification product is TT homozygous, the wheat to be tested belongs to the haplotype TaB3-2A1-Hap1;

[0118] If the genotype of the target SNP in the PCR amplification product is AA homozygous, the wheat to be tested belongs to the haplotype TaB3-2A1-Hap2. Since the present application tests a stable strain, the genotype of the target SNP is homozygous.

[0119] The storage protein content and / or starch content and / or 1000-grain weight of the genotype TaB3-2A1-Hap1 wheat are superior to those of the genotype TaB3-2A1-Hap2 wheat;

[0120] The starch content and / or thousand-grain weight of wheat with the TT homozygous genotype of the target SNP site are higher than those of wheat with the AA homozygous genotype; the storage protein content of wheat with the TT homozygous genotype is lower than that of wheat with the AA homozygous genotype.

[0121] The above TT homozygous type is one of the two homologous chromosomes on the wheat genome. TaB3-2A1 Position 523 of sequence 4 in the gene is all T;

[0122] The above AA homozygous type is one of the two homologous chromosomes on the wheat genome. TaB3-2A1The 523rd position of sequence 4 in the gene is all A; this type of germplasm resource is a low-quality germplasm resource with high storage protein content, low starch content and low 1000-grain weight.

[0123] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. Detection of wheat genome TaB3-2A1 Application of the material of the genotype of the 523rd SNP site of the gene in identifying the storage protein content of the wheat grain to be tested; The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table.

2. The use according to claim 1, characterized in that: The genotype of the SNP site is TT or AA.

3. Detection of wheat genome TaB3-2A1 Application of the genotype of the 523rd SNP site of the gene in breeding wheat with low storage protein content in grain; The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table.

4. The use according to claim 1, characterized in that: The detection of wheat genome TaB3-2A1 The genotype of the 523rd SNP site of the gene is as follows 1) or 2): 1) KASP primer set, The KASP primer set consists of a single-stranded DNA molecule shown in sequence 1 in the sequence listing, a single-stranded DNA molecule shown in sequence 2 in the sequence listing, and a single-stranded DNA molecule shown in sequence 3 in the sequence listing; 2) A PCR reagent or kit containing the primer set.

5. A method for identifying the content of storage protein in wheat grains to be tested, for detecting TaB3-2A1 The genotype of the 523rd SNP site of the gene is AA homozygous or TT homozygous. The grain storage protein content trait of TT homozygous wheat is better than that of AA homozygous wheat. in, The storage protein content of the tested wheat grains with the TT homozygous genotype at the SNP site is lower than that of the tested wheat with the AA homozygous genotype; The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table.

6. A method for breeding wheat with low storage protein content in grains, for detecting TaB3-2A1 The genotype of the 523rd SNP site of the gene is AA homozygous or TT homozygous, Breeding wheat with a SNP site genotype of TT homozygous to obtain wheat with low storage protein content in grains; The SNP site is the 523rd nucleotide of the DNA molecule shown in Sequence 4 of the sequence table.

7. The method according to claim 5 or 6, characterized in that: The detection of wheat genome TaB3-2A1 The method for determining whether the genotype of the 523rd SNP site of the gene is AA homozygous or TT homozygous is as follows: A) or B): A) Direct sequencing; B) performing KASP detection on the wheat genomic DNA to be tested using the primer set of claim 4 to achieve genotyping.

Images